#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PON3	5446	genome.wustl.edu	37	7	94992147	94992147	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr7:94992147G>A	ENST00000265627.5	-	7	712	c.702C>T	c.(700-702)gtC>gtT	p.V234V	PON1_ENST00000542556.1_Intron|PON3_ENST00000427422.1_Intron|PON3_ENST00000451904.1_Silent_p.V234V	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	234					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.V234V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CAGCTACATAGACATACCTTT	0.373																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000105852						172.0	147.0	155.0					7																	94992147		2203	4300	6503	PON3	SO:0001819	synonymous_variant	0			-	HGNC	L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.702C>T	7.37:g.94992147G>A		Somatic	0	56	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	52	14.75	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.V234	ENST00000265627.5	37	c.702	CCDS5639.1	7																																																																																			-	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase		0.373	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	protein_coding	OTTHUMT00000333007.1	G	NM_000940	-		94992147	-1	no_errors	ENST00000265627	ensembl	human	known	74_37	silent	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155243560	155243560	+	Missense_Mutation	SNP	G	G	A	rs147038002		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr4:155243560G>A	ENST00000357232.4	-	13	2733	c.2734C>T	c.(2734-2736)Cct>Tct	p.P912S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	912	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGTAGGAAGGTCTATAATCA	0.378																																																	0								ENSG00000197410						187.0	160.0	169.0					4																	155243560		2203	4300	6503	DCHS2	SO:0001583	missense	0			-	HGNC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2734C>T	4.37:g.155243560G>A	ENSP00000349768:p.Pro912Ser	Somatic	0	71	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	38	38.71	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P912S	ENST00000357232.4	37	c.2734	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	5.372	0.253940	0.10185	.	.	ENSG00000197410	ENST00000357232	T	0.59638	0.25	5.73	4.88	0.63580	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000003	T	0.30386	0.0763	N	0.11673	0.155	0.80722	D	1	B	0.29612	0.251	B	0.27796	0.083	T	0.23726	-1.0180	10	0.02654	T	1	.	8.7382	0.34541	0.1012:0.1514:0.7474:0.0	.	912	Q6V1P9	PCD23_HUMAN	S	912	ENSP00000349768:P912S	ENSP00000349768:P912S	P	-	1	0	DCHS2	155463010	0.890000	0.30428	0.991000	0.47740	0.111000	0.19643	1.342000	0.33919	1.522000	0.49001	0.655000	0.94253	CCT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	G	NM_001142552	-		155243560	-1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	SNP	0.780	A
USP24	23358	genome.wustl.edu	37	1	55567345	55567345	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:55567345G>A	ENST00000294383.6	-	43	5056	c.5057C>T	c.(5056-5058)tCa>tTa	p.S1686L	USP24_ENST00000407756.1_Missense_Mutation_p.S1526L	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1686					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CACAAACCCTGAACTGGACCT	0.468																																																	0								ENSG00000162402						55.0	55.0	55.0					1																	55567345		1954	4144	6098	USP24	SO:0001583	missense	0			-	HGNC	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.5057C>T	1.37:g.55567345G>A	ENSP00000294383:p.Ser1686Leu	Somatic	0	72	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	35	46.15	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.S1526L	ENST00000294383.6	37	c.4577	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526701	0.85706	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.05025	3.51;3.51	5.97	5.06	0.68205	.	0.062093	0.64402	D	0.000002	T	0.08670	0.0215	L	0.43152	1.355	0.51233	D	0.999919	P	0.43542	0.81	P	0.45946	0.498	T	0.29671	-1.0004	10	0.09843	T	0.71	.	14.3091	0.66403	0.0715:0.0:0.9285:0.0	.	1526	B7WPF4	.	L	1686;1526	ENSP00000294383:S1686L;ENSP00000385700:S1526L	ENSP00000294383:S1686L	S	-	2	0	USP24	55339933	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.598000	0.82745	2.833000	0.97629	0.585000	0.79938	TCA	-	superfamily_ARM-type_fold		0.468	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	protein_coding	OTTHUMT00000022275.2	G		-		55567345	-1	no_errors	ENST00000407756	ensembl	human	known	74_37	missense	SNP	1.000	A
MT-ND6	4541	genome.wustl.edu	37	M	14384	14384	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chrM:14384G>A	ENST00000361681.2	-	1	289	c.290C>T	c.(289-291)gCg>gTg	p.A97V	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	97					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CTACCTCCATCGCTAACCCCA	0.468																																																	0								ENSG00000198695																																			MT-ND6	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.290C>T	M.37:g.14384G>A	ENSP00000354665:p.Ala97Val	Somatic	0	254	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	Q34774|Q8HG30	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	p.A97V	ENST00000361681.2	37	c.290		MT																																																																																			-	pfam_NADH_UbQ/plastoQ_OxRdtase_su6		0.468	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	protein_coding		G	YP_003024037	-		14384	-1	no_errors	ENST00000361681	ensembl	human	known	74_37	missense	SNP	NULL	A
C9orf62	157927	genome.wustl.edu	37	9	138235268	138235268	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:138235268C>T	ENST00000320778.2	+	1	174	c.24C>T	c.(22-24)acC>acT	p.T8T		NM_173520.2	NP_775791.1	Q8N4C0	CI062_HUMAN	chromosome 9 open reading frame 62	8																	CAGGGCAGACCTCAGTGTCCT	0.632																																																	0								ENSG00000178243																																			C9orf62	SO:0001819	synonymous_variant	0			-	HGNC	BC034752	CCDS59154.1	9q34.3	2008-02-05			ENSG00000178243	ENSG00000178243			28581	protein-coding gene	gene with protein product						12477932	Standard	NM_173520		Approved	MGC35463	uc004cfo.3	Q8N4C0	OTTHUMG00000020900	ENST00000320778.2:c.24C>T	9.37:g.138235268C>T		Somatic	0	19	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	Q5T7E2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T8	ENST00000320778.2	37	c.24	CCDS59154.1	9																																																																																			-	NULL		0.632	C9orf62-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf62	protein_coding	OTTHUMT00000054980.2	C	NM_173520	-		138235268	+1	no_errors	ENST00000320778	ensembl	human	putative	74_37	silent	SNP	0.000	T
C12orf42	374470	genome.wustl.edu	37	12	103699894	103699894	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr12:103699894G>C	ENST00000378113.2	-	5	714	c.489C>G	c.(487-489)aaC>aaG	p.N163K	C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000548883.1_Missense_Mutation_p.N163K|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.N96K	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	163										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						AAAATGAACTGTTCCAAGCCT	0.488																																																	0								ENSG00000179088						76.0	78.0	78.0					12																	103699894		1903	4120	6023	C12orf42	SO:0001583	missense	0			-	HGNC	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.489C>G	12.37:g.103699894G>C	ENSP00000367353:p.Asn163Lys	Somatic	0	91	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	63	16.00	Q49A64|Q4G0S2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N163K	ENST00000378113.2	37	c.489	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	8.362	0.833404	0.16820	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	3.98	2.16	0.27623	.	1.102310	0.07096	N	0.839648	T	0.24470	0.0593	N	0.19112	0.55	0.09310	N	1	P	0.38020	0.615	B	0.31547	0.132	T	0.14337	-1.0476	10	0.30854	T	0.27	-0.0034	6.5126	0.22230	0.218:0.0:0.782:0.0	.	163	Q96LP6	CL042_HUMAN	K	163;96;163;163	ENSP00000447908:N163K;ENSP00000449362:N96K;ENSP00000367353:N163K;ENSP00000447795:N163K	ENSP00000367353:N163K	N	-	3	2	C12orf42	102224024	0.001000	0.12720	0.050000	0.19076	0.011000	0.07611	0.180000	0.16860	0.669000	0.31146	0.549000	0.68633	AAC	-	NULL		0.488	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	protein_coding	OTTHUMT00000406754.1	G	NM_198521	-		103699894	-1	no_errors	ENST00000378113	ensembl	human	known	74_37	missense	SNP	0.051	C
CDC123	8872	genome.wustl.edu	37	10	12289026	12289028	+	Intron	DEL	TCC	TCC	-	rs5783246	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr10:12289026_12289028delTCC	ENST00000281141.4	+	11	1126				CDC123_ENST00000455773.3_Intron|RP11-186N15.3_ENST00000421657.1_RNA|CDC123_ENST00000378900.2_Intron|RP11-186N15.3_ENST00000598961.1_RNA	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GGACACTGTGTCCTCCTCTCTCA	0.606														1859	0.371206	0.2859	0.4409	5008	,	,		18842	0.2827		0.4622	False		,,,				2504	0.4346																0								ENSG00000228302																																			RP11-186N15.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.846+750TCC>-	10.37:g.12289029_12289031delTCC		Somatic	0	11	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281141.4	37	NULL	CCDS7090.1	10																																																																																			-	-		0.606	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228302	protein_coding	OTTHUMT00000046801.1	TCC	NM_006023			12289028	-1	no_errors	ENST00000421657	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.002	-
UBE2I	7329	genome.wustl.edu	37	16	1358609	1358628	+	5'Flank	DEL	TGAGGGAGGGAGGGAATTAG	TGAGGGAGGGAGGGAATTAG	-	rs386787686|rs148430996|rs201367779|rs71145420|rs369584051		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TGAGGGAGGGAGGGAATTAG	TGAGGGAGGGAGGGAATTAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr16:1358609_1358628delTGAGGGAGGGAGGGAATTAG	ENST00000355803.4	+	0	0				UBE2I_ENST00000566587.1_5'Flank|UBE2I_ENST00000397515.2_5'Flank|UBE2I_ENST00000403747.2_5'Flank|UBE2I_ENST00000397514.3_5'Flank|UBE2I_ENST00000325437.5_5'Flank|UBE2I_ENST00000339021.3_3'UTR	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I						cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				atcgaatgaatgagggagggagggaattagtgagggaggg	0.514																																																	0								ENSG00000103275																																			UBE2I	SO:0001631	upstream_gene_variant	0				HGNC	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845		16.37:g.1358609_1358628delTGAGGGAGGGAGGGAATTAG	Exception_encountered	Somatic	NA	NA	NA		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355803.4	37	NULL	CCDS10433.1	16																																																																																			-	-		0.514	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBE2I	protein_coding	OTTHUMT00000250317.2	TGAGGGAGGGAGGGAATTAG	NM_003345			1358628	+1	no_errors	ENST00000339021	ensembl	human	known	74_37	rna	DEL	0.003:0.003:0.001:0.001:0.000:0.000:0.001:0.000:0.001:0.001:0.004:0.006:0.007:0.005:0.003:0.001:0.000:0.000:0.000:0.000	-
ZNF286A	57335	genome.wustl.edu	37	17	15638587	15638587	+	Intron	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:15638587G>A	ENST00000413242.2	+	7	2049				TBC1D26_ENST00000579428.1_Intron|ZNF286A_ENST00000593105.1_Intron|AC005324.6_ENST00000434017.1_RNA|TBC1D26_ENST00000437605.2_Intron			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		GTGTCTGGGAGTGCAGTGCGT	0.577																																																	0								ENSG00000233002																																			AC005324.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000413242.2:c.1563+203G>A	17.37:g.15638587G>A		Somatic	0	23	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	B4DKF9|Q96JF3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000413242.2	37	NULL	CCDS11172.1	17																																																																																			-	-		0.577	ZNF286A-001	KNOWN	basic|appris_candidate_longest|readthrough_transcript|CCDS	nonsense_mediated_decay	ENSG00000233002	protein_coding	OTTHUMT00000130697.4	G	NM_020652	-		15638587	-1	no_errors	ENST00000434017	ensembl	human	known	74_37	rna	SNP	0.007	A
TTC7A	57217	genome.wustl.edu	37	2	47300982	47300982	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:47300982G>C	ENST00000319190.5	+	20	2865	c.2497G>C	c.(2497-2499)Gtt>Ctt	p.V833L	RP11-761B3.1_ENST00000422269.1_Intron|AC073283.7_ENST00000421759.1_RNA|C2orf61_ENST00000464527.2_Intron|TTC7A_ENST00000394850.2_Missense_Mutation_p.V857L|TTC7A_ENST00000409245.1_Missense_Mutation_p.V799L|TTC7A_ENST00000263737.6_Missense_Mutation_p.V479L	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	833					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CGAGGCTGCCGTTGACTGCTT	0.662																																																	0								ENSG00000068724						52.0	46.0	48.0					2																	47300982		2203	4300	6503	TTC7A	SO:0001583	missense	0			-	HGNC	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.2497G>C	2.37:g.47300982G>C	ENSP00000316699:p.Val833Leu	Somatic	0	23	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V833L	ENST00000319190.5	37	c.2497	CCDS33193.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959509	0.34565	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850;ENST00000263737;ENST00000434093	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.36	1.51	0.23008	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.509435	0.21505	N	0.073474	T	0.35998	0.0951	L	0.39020	1.185	0.09310	N	0.999999	B;B;B;B	0.23128	0.08;0.011;0.08;0.009	B;B;B;B	0.24701	0.055;0.026;0.034;0.015	T	0.26430	-1.0103	10	0.09338	T	0.73	-4.4104	8.7165	0.34414	0.3712:0.0:0.6288:0.0	.	857;799;833;799	Q2T9J9;B3KPK7;Q9ULT0;G5E9G4	.;.;TTC7A_HUMAN;.	L	799;833;857;479;660	ENSP00000386307:V799L;ENSP00000316699:V833L;ENSP00000378320:V857L;ENSP00000263737:V479L	ENSP00000263737:V479L	V	+	1	0	TTC7A	47154486	0.001000	0.12720	0.001000	0.08648	0.685000	0.39939	0.578000	0.23773	0.003000	0.14656	0.491000	0.48974	GTT	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.662	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7A	protein_coding	OTTHUMT00000329667.2	G	XM_372927	-		47300982	+1	no_errors	ENST00000319190	ensembl	human	known	74_37	missense	SNP	0.003	C
WDR41	55255	genome.wustl.edu	37	5	76745618	76745618	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr5:76745618G>T	ENST00000296679.4	-	8	1039	c.664C>A	c.(664-666)Cag>Aag	p.Q222K	WDR41_ENST00000414719.2_Intron|WDR41_ENST00000507029.1_Missense_Mutation_p.Q167K	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	222						lysosomal membrane (GO:0005765)				NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		ATATTATCCTGGTGATCAAGG	0.363																																																	0								ENSG00000164253						113.0	110.0	111.0					5																	76745618		2203	4300	6503	WDR41	SO:0001583	missense	0			-	HGNC	AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253		"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product						12477932	Standard	NM_018268		Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.664C>A	5.37:g.76745618G>T	ENSP00000296679:p.Gln222Lys	Somatic	0	81	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q222K	ENST00000296679.4	37	c.664	CCDS4038.1	5	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700104	0.68501	.	.	ENSG00000164253	ENST00000296679;ENST00000507029	T;T	0.64438	-0.1;-0.1	6.02	6.02	0.97574	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.100530	0.64402	D	0.000001	T	0.75177	0.3814	M	0.64997	1.995	0.80722	D	1	P;D	0.71674	0.924;0.998	P;D	0.75484	0.535;0.986	T	0.66448	-0.5921	10	0.06236	T	0.91	-8.4511	20.5407	0.99260	0.0:0.0:1.0:0.0	.	167;222	B4DT55;Q9HAD4	.;WDR41_HUMAN	K	222;167	ENSP00000296679:Q222K;ENSP00000424287:Q167K	ENSP00000296679:Q222K	Q	-	1	0	WDR41	76781374	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.981000	0.88123	2.865000	0.98341	0.655000	0.94253	CAG	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.363	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR41	protein_coding	OTTHUMT00000220014.2	G	NM_018268	-		76745618	-1	no_errors	ENST00000296679	ensembl	human	known	74_37	missense	SNP	1.000	T
ACLY	47	genome.wustl.edu	37	17	40048663	40048663	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:40048663C>T	ENST00000352035.2	-	16	1769	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K	ACLY_ENST00000353196.1_Missense_Mutation_p.E537K|ACLY_ENST00000590151.1_Missense_Mutation_p.E547K|ACLY_ENST00000537919.1_Missense_Mutation_p.E276K|ACLY_ENST00000393896.2_Missense_Mutation_p.E537K	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	547					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				ATCAGGATCTCTTTGTGCCCC	0.498																																					Colon(64;807 1396 15971 30971)												0								ENSG00000131473						127.0	112.0	117.0					17																	40048663		2203	4300	6503	ACLY	SO:0001583	missense	0			-	HGNC	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.1639G>A	17.37:g.40048663C>T	ENSP00000253792:p.Glu547Lys	Somatic	0	33	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	19	51.28	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.E547K	ENST00000352035.2	37	c.1639	CCDS11412.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.559222	0.96514	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.89617	-1.55;-1.57;-2.54;-1.57	5.64	5.64	0.86602	CoA-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96485	0.8853	H	0.95328	3.655	0.80722	D	1	D;P;P;P;D	0.69078	0.997;0.825;0.825;0.882;0.997	D;P;P;P;D	0.76071	0.987;0.544;0.544;0.873;0.987	D	0.96841	0.9618	10	0.66056	D	0.02	.	20.0666	0.97706	0.0:1.0:0.0:0.0	.	276;591;601;537;547	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	K	547;601;537;276;537	ENSP00000253792:E547K;ENSP00000345398:E537K;ENSP00000445349:E276K;ENSP00000377474:E537K	ENSP00000253792:E547K	E	-	1	0	ACLY	37302189	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.704000	0.84595	2.826000	0.97356	0.561000	0.74099	GAG	-	pfam_CoA-bd,smart_CoA-bd,pirsf_ATP-citrate_synthase		0.498	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	protein_coding	OTTHUMT00000257465.1	C	NM_001096	-		40048663	-1	no_errors	ENST00000352035	ensembl	human	known	74_37	missense	SNP	1.000	T
IFT46	56912	genome.wustl.edu	37	11	118427748	118427750	+	In_Frame_Del	DEL	TCT	TCT	-	rs374705299|rs144091431|rs548333275	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr11:118427748_118427750delTCT	ENST00000264021.3	-	4	474_476	c.56_58delAGA	c.(55-60)aagacc>acc	p.K19del	IFT46_ENST00000264020.2_In_Frame_Del_p.K70del|IFT46_ENST00000530872.1_In_Frame_Del_p.K70del	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	19				K -> E (in Ref. 3; BAB15146). {ECO:0000305}.	cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						AACTGTGAGGTCTTCTTCTTCTC	0.414														58	0.0115815	0.0393	0.0058	5008	,	,		20075	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000118096		,	157,4107		1,155,1976					,	3.5	0.9		dbSNP_134	149	3,8251		0,3,4124	no	coding,coding	IFT46	NM_020153.3,NM_001168618.1	,	1,158,6100	A1A1,A1R,RR		0.0363,3.682,1.2782	,	,		160,12358				IFT46	SO:0001651	inframe_deletion	0				HGNC	AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.56_58delAGA	11.37:g.118427757_118427759delTCT	ENSP00000264021:p.Lys19del	Somatic	0	39	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	A8K0F6|Q9H6V5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Intraflagellar_transp_cmplxB	p.K70in_frame_del	ENST00000264021.3	37	c.211_209	CCDS53718.1	11																																																																																			-	NULL		0.414	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT46	protein_coding	OTTHUMT00000389627.1	TCT	NM_020153			118427750	-1	no_errors	ENST00000264020	ensembl	human	known	74_37	in_frame_del	DEL	0.041:0.879:0.998	-
ZNF831	128611	genome.wustl.edu	37	20	57829203	57829203	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr20:57829203C>A	ENST00000371030.2	+	5	4439	c.4439C>A	c.(4438-4440)aCt>aAt	p.T1480N		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1480							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCCAAAGGAACTTTTCCCCAC	0.488																																																	0								ENSG00000124203						88.0	91.0	90.0					20																	57829203		2005	4190	6195	ZNF831	SO:0001583	missense	0			-	HGNC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4439C>A	20.37:g.57829203C>A	ENSP00000360069:p.Thr1480Asn	Somatic	0	28	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1480N	ENST00000371030.2	37	c.4439	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	15.83	2.950449	0.53186	.	.	ENSG00000124203	ENST00000371030	T	0.04917	3.53	5.9	-4.86	0.03132	.	0.975747	0.08415	N	0.949191	T	0.06005	0.0156	M	0.62723	1.935	0.09310	N	1	B	0.25048	0.117	B	0.17722	0.019	T	0.43540	-0.9385	10	0.87932	D	0	-0.6901	2.0504	0.03570	0.1076:0.2501:0.3171:0.3251	.	1480	Q5JPB2	ZN831_HUMAN	N	1480	ENSP00000360069:T1480N	ENSP00000360069:T1480N	T	+	2	0	ZNF831	57262598	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.363000	0.07593	-0.645000	0.05458	-0.172000	0.13284	ACT	-	NULL		0.488	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	protein_coding	OTTHUMT00000079916.2	C	NM_178457	-		57829203	+1	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	SNP	0.000	A
CNTRL	11064	genome.wustl.edu	37	9	123924170	123924170	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:123924170A>G	ENST00000373855.1	+	33	5386	c.5126A>G	c.(5125-5127)aAc>aGc	p.N1709S	CNTRL_ENST00000373850.1_Missense_Mutation_p.N1157S|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000238341.5_Missense_Mutation_p.N1709S			Q7Z7A1	CNTRL_HUMAN	centriolin	1709					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CAACTTGAAAACCATGAGCTA	0.373																																																	0								ENSG00000119397						92.0	92.0	92.0					9																	123924170		2203	4300	6503	CNTRL	SO:0001583	missense	0			-	HGNC	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5126A>G	9.37:g.123924170A>G	ENSP00000362962:p.Asn1709Ser	Somatic	0	66	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	59	25.32	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.N1709S	ENST00000373855.1	37	c.5126	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	A	13.40	2.225468	0.39300	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373845	T;T;T	0.28255	1.62;1.62;1.62	6.02	1.12	0.20585	.	.	.	.	.	T	0.19725	0.0474	L	0.42245	1.32	0.30721	N	0.748279	B	0.21071	0.051	B	0.15052	0.012	T	0.34354	-0.9832	9	0.09843	T	0.71	.	5.8476	0.18675	0.6558:0.1351:0.2091:0.0	.	1709	Q7Z7A1	CNTRL_HUMAN	S	1709;1709;1709;465;1157;391	ENSP00000362962:N1709S;ENSP00000238341:N1709S;ENSP00000362956:N1157S	ENSP00000238341:N1709S	N	+	2	0	CNTRL	122963991	0.920000	0.31207	0.994000	0.49952	0.978000	0.69477	0.816000	0.27267	0.166000	0.19597	0.533000	0.62120	AAC	-	NULL		0.373	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	protein_coding	OTTHUMT00000250216.1	A	NM_007018	-		123924170	+1	no_errors	ENST00000238341	ensembl	human	known	74_37	missense	SNP	0.995	G
HELZ2	85441	genome.wustl.edu	37	20	62203295	62203295	+	Intron	SNP	G	G	A	rs75418499	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr20:62203295G>A	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGGGAGCCTCTGGCTC	0.677																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+165C>T	20.37:g.62203295G>A		Somatic	0	11	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	G	NM_001037335	rs75418499		62203295	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.747	A
HKDC1	80201	genome.wustl.edu	37	10	71025434	71025434	+	Silent	SNP	C	C	T	rs373165480		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr10:71025434C>T	ENST00000354624.5	+	17	2599	c.2466C>T	c.(2464-2466)tgC>tgT	p.C822C	RP11-227H15.5_ENST00000413220.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	822	Hexokinase type-2 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						AGGAGGTGTGCGGAGCCGTGT	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		16556	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000156510						58.0	55.0	56.0					10																	71025434		2203	4299	6502	HKDC1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2466C>T	10.37:g.71025434C>T		Somatic	0	63	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.C822	ENST00000354624.5	37	c.2466	CCDS7288.1	10																																																																																			-	pfam_Hexokinase_C,prints_Hexokinase		0.642	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	protein_coding	OTTHUMT00000048389.1	C	NM_025130	-		71025434	+1	no_errors	ENST00000354624	ensembl	human	known	74_37	silent	SNP	0.996	T
RB1	5925	genome.wustl.edu	37	13	49027153	49027156	+	Frame_Shift_Del	DEL	AAAC	AAAC	-	rs587778864		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	AAAC	AAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr13:49027153_49027156delAAAC	ENST00000267163.4	+	18	1858_1861	c.1720_1723delAAAC	c.(1720-1725)aaacaafs	p.KQ574fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	574	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.Q575fs*35(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGATCTTATTAAACAATCAAAGGA	0.338		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(10)|Deletion - Frameshift(1)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|eye(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CM961232	RB1	M		ENSG00000139687																																			RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1720_1723delAAAC	13.37:g.49027153_49027156delAAAC	ENSP00000267163:p.Lys574fs	Somatic	0	100	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	42	46.15	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.K574fs	ENST00000267163.4	37	c.1720_1723	CCDS31973.1	13																																																																																			-	superfamily_Cyclin-like		0.338	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	AAAC				49027156	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
OR7G1	125962	genome.wustl.edu	37	19	9225933	9225933	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:9225933G>T	ENST00000541538.1	-	1	506	c.507C>A	c.(505-507)tgC>tgA	p.C169*	OR7G1_ENST00000293614.1_Nonsense_Mutation_p.C169*	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						CAACGTTTTTGCAGAAGGACA	0.448																																																	0								ENSG00000161807						119.0	111.0	114.0					19																	9225933		2203	4300	6503	OR7G1	SO:0001587	stop_gained	0			-	HGNC		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.507C>A	19.37:g.9225933G>T	ENSP00000444134:p.Cys169*	Somatic	0	46	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	23	42.50	Q6IFJ5|Q96RA1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C169*	ENST00000541538.1	37	c.507	CCDS32898.2	19	.	.	.	.	.	.	.	.	.	.	g	15.96	2.985612	0.53934	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	.	.	.	3.78	-2.38	0.06622	.	0.000000	0.41938	U	0.000792	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4063	0.11411	0.4696:0.0:0.3751:0.1553	.	.	.	.	X	169	.	ENSP00000293614:C169X	C	-	3	2	OR7G1	9086933	0.011000	0.17503	0.000000	0.03702	0.338000	0.28826	0.137000	0.15995	-0.195000	0.10382	0.501000	0.49751	TGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.448	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	protein_coding	OTTHUMT00000397912.1	G		-		9225933	-1	no_errors	ENST00000293614	ensembl	human	known	74_37	nonsense	SNP	0.000	T
LRP2	4036	genome.wustl.edu	37	2	170148813	170148813	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:170148813A>T	ENST00000263816.3	-	7	1004	c.719T>A	c.(718-720)gTt>gAt	p.V240D	LRP2_ENST00000443831.1_Missense_Mutation_p.V240D	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	240	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCCATCACAAACCCAGTTTTG	0.443																																																	0								ENSG00000081479						151.0	136.0	141.0					2																	170148813		2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.719T>A	2.37:g.170148813A>T	ENSP00000263816:p.Val240Asp	Somatic	0	40	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	10	68.75	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V240D	ENST00000263816.3	37	c.719	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372309	0.61624	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.96104	-3.91;-3.91	5.56	5.56	0.83823	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.432617	0.23452	N	0.048026	D	0.98308	0.9439	H	0.95043	3.615	0.58432	D	0.999997	D;D	0.61697	0.978;0.99	P;D	0.65773	0.88;0.938	D	0.99601	1.0978	9	.	.	.	.	15.3737	0.74587	1.0:0.0:0.0:0.0	.	240;240	E9PC35;P98164	.;LRP2_HUMAN	D	240	ENSP00000263816:V240D;ENSP00000409813:V240D	.	V	-	2	0	LRP2	169857059	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	8.867000	0.92314	2.087000	0.62958	0.533000	0.62120	GTT	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.443	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	A	NM_004525	-		170148813	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	1.000	T
RNF213	57674	genome.wustl.edu	37	17	78282903	78282903	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:78282903A>G	ENST00000582970.1	+	14	2730	c.2587A>G	c.(2587-2589)Aag>Gag	p.K863E	RNF213_ENST00000508628.2_Missense_Mutation_p.K912E|RNF213_ENST00000319921.4_Missense_Mutation_p.K863E|RNF213_ENST00000456466.1_Missense_Mutation_p.K863E	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	863					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AAAGCTACTTAAGTTTTACGA	0.498																																																	0								ENSG00000173821						155.0	143.0	147.0					17																	78282903		2203	4300	6503	RNF213	SO:0001583	missense	0			-	HGNC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2587A>G	17.37:g.78282903A>G	ENSP00000464087:p.Lys863Glu	Somatic	0	41	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	12	68.42	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.K863E	ENST00000582970.1	37	c.2587	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	A	9.841	1.191048	0.21954	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	T;T	0.13538	2.58;2.58	5.38	-10.2	0.00374	.	3.163830	0.00654	N	0.000577	T	0.09335	0.0230	L	0.40543	1.245	0.09310	N	0.999998	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.003	T	0.13872	-1.0493	10	0.14252	T	0.57	-2.6289	8.7253	0.34465	0.3164:0.3167:0.3669:0.0	.	863;863	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	E	863;912;863;863	ENSP00000392123:K863E;ENSP00000324392:K863E	ENSP00000324392:K863E	K	+	1	0	RNF213	75897498	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.886000	0.04157	-1.998000	0.00968	-2.200000	0.00306	AAG	-	NULL		0.498	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	A	NM_020914	-		78282903	+1	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	SNP	0.000	G
FGF5	2250	genome.wustl.edu	37	4	81189526	81189526	+	Intron	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr4:81189526C>T	ENST00000312465.7	+	1	581				FGF5_ENST00000456523.3_Intron|FGF5_ENST00000503413.1_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5						cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						CAGGAGACAGCAGCGCTCACA	0.607																																																	0								ENSG00000138675																																			FGF5	SO:0001627	intron_variant	0			-	HGNC	M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.355+1193C>T	4.37:g.81189526C>T		Somatic	0	43	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	B2R554|O75846|Q3Y8M3|Q8NF90	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312465.7	37	NULL	CCDS34021.1	4																																																																																			-	-		0.607	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	protein_coding	OTTHUMT00000252627.2	C		-		81189526	+1	no_errors	ENST00000503413	ensembl	human	known	74_37	rna	SNP	0.001	T
TLE4	7091	genome.wustl.edu	37	9	82323521	82323521	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:82323521G>T	ENST00000376552.2	+	13	2101	c.1083G>T	c.(1081-1083)agG>agT	p.R361S	TLE4_ENST00000376544.3_Missense_Mutation_p.R292S|TLE4_ENST00000376537.4_Missense_Mutation_p.R393S|TLE4_ENST00000376520.4_Missense_Mutation_p.R393S|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000265284.6_Missense_Mutation_p.R336S	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	361					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CAAGCCTAAGGACCCCAATGG	0.473																																																	0								ENSG00000106829						128.0	130.0	129.0					9																	82323521		1972	4179	6151	TLE4	SO:0001583	missense	0			-	HGNC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1083G>T	9.37:g.82323521G>T	ENSP00000365735:p.Arg361Ser	Somatic	0	52	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.R393S	ENST00000376552.2	37	c.1179	CCDS43837.1	9	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.26|18.26|18.26	3.584338|3.584338|3.584338	0.65992|0.65992|0.65992	.|.|.	.|.|.	ENSG00000106829|ENSG00000106829|ENSG00000106829	ENST00000496114|ENST00000417836|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000265284;ENST00000490347;ENST00000467142	.|.|T;T;T;T;T;T;T	.|.|0.56611	.|.|0.8;0.93;0.93;0.93;0.89;1.38;0.45	6.16|6.16|6.16	2.97|2.97|2.97	0.34412|0.34412|0.34412	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.66723|0.66723|0.66723	0.2818|0.2818|0.2818	M|M|M	0.72479|0.72479|0.72479	2.2|2.2|2.2	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B;D;P;B	.|.|0.57899	.|.|0.197;0.981;0.712;0.233	.|.|B;D;P;B	.|.|0.66351	.|.|0.127;0.943;0.559;0.081	T|T|T	0.66384|0.66384|0.66384	-0.5937|-0.5937|-0.5937	5|5|10	.|.|0.40728	.|.|T	.|.|0.16	-29.3035|-29.3035|-29.3035	11.8822|11.8822|11.8822	0.52581|0.52581|0.52581	0.2638:0.0:0.7362:0.0|0.2638:0.0:0.7362:0.0|0.2638:0.0:0.7362:0.0	.|.|.	.|.|336;292;393;361	.|.|F8W6T6;Q04727-2;Q04727-3;Q04727	.|.|.;.;.;TLE4_HUMAN	Y|V|S	152|126|361;292;393;393;336;180;89	.|.|ENSP00000365735:R361S;ENSP00000365727:R292S;ENSP00000365703:R393S;ENSP00000365720:R393S;ENSP00000265284:R336S;ENSP00000417844:R180S;ENSP00000418409:R89S	.|.|ENSP00000265284:R336S	D|G|R	+|+|+	1|2|3	0|0|2	TLE4|TLE4|TLE4	81513341|81513341|81513341	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	0.997000|0.997000|0.997000	0.29731|0.29731|0.29731	0.954000|0.954000|0.954000	0.37851|0.37851|0.37851	-0.142000|-0.142000|-0.142000	0.14014|0.14014|0.14014	GAC|GGA|AGG	-	NULL		0.473	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	protein_coding	OTTHUMT00000052792.4	G	XM_212237	-		82323521	+1	no_errors	ENST00000376520	ensembl	human	known	74_37	missense	SNP	0.998	T
ZRANB3	84083	genome.wustl.edu	37	2	136029367	136029367	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:136029367C>G	ENST00000264159.6	-	10	1293	c.1177G>C	c.(1177-1179)Gct>Cct	p.A393P	ZRANB3_ENST00000401392.1_Missense_Mutation_p.A393P|ZRANB3_ENST00000536680.1_Missense_Mutation_p.A393P	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	393	DNA annealing helicase activity.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		CTTAGGATAGCCACGCGAGTG	0.373																																																	0								ENSG00000121988						75.0	72.0	73.0					2																	136029367		1854	4100	5954	ZRANB3	SO:0001583	missense	0			-	HGNC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1177G>C	2.37:g.136029367C>G	ENSP00000264159:p.Ala393Pro	Somatic	0	57	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	18	62.50	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A393P	ENST00000264159.6	37	c.1177	CCDS46419.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.568716	0.96540	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	T;T;T	0.75589	-0.95;-0.95;-0.95	5.94	5.94	0.96194	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90229	0.6945	M	0.92649	3.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91397	0.5140	10	0.72032	D	0.01	-3.8144	20.3593	0.98849	0.0:1.0:0.0:0.0	.	333;393;393	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	P	393;393;393;333	ENSP00000383979:A393P;ENSP00000264159:A393P;ENSP00000441320:A393P	ENSP00000264159:A393P	A	-	1	0	ZRANB3	135745837	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.458000	0.80787	2.807000	0.96579	0.591000	0.81541	GCT	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.373	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	protein_coding	OTTHUMT00000318254.1	C	NM_032143	-		136029367	-1	no_errors	ENST00000264159	ensembl	human	known	74_37	missense	SNP	1.000	G
CDK2	1017	genome.wustl.edu	37	12	56365351	56365351	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr12:56365351C>T	ENST00000266970.4	+	7	1079	c.839C>T	c.(838-840)gCc>gTc	p.A280V	CDK2_ENST00000556656.1_3'UTR|RAB5B_ENST00000360299.5_5'Flank|CDK2_ENST00000440311.2_Missense_Mutation_p.A220V|RAB5B_ENST00000448789.2_5'Flank|CDK2_ENST00000354056.4_Missense_Mutation_p.A246V|CDK2_ENST00000553376.1_Missense_Mutation_p.A328V|RAB5B_ENST00000553116.1_5'Flank	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	GCCAAGGCAGCCCTGGCTCAC	0.527																																																	0								ENSG00000123374						150.0	130.0	137.0					12																	56365351		2203	4300	6503	CDK2	SO:0001583	missense	0			-	HGNC	M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.839C>T	12.37:g.56365351C>T	ENSP00000266970:p.Ala280Val	Somatic	0	33	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8K7C6|O75100	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A280V	ENST00000266970.4	37	c.839	CCDS8898.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.568408	0.96540	.	.	ENSG00000123374	ENST00000266970;ENST00000553376;ENST00000440311;ENST00000354056	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.37	5.37	0.77165	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67325	0.2881	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.67900	0.954;0.947;0.931	T	0.69767	-0.5056	10	0.87932	D	0	-12.9933	18.2571	0.90023	0.0:1.0:0.0:0.0	.	220;246;280	E7ESI2;P24941-2;P24941	.;.;CDK2_HUMAN	V	280;328;220;246	ENSP00000266970:A280V;ENSP00000452514:A328V;ENSP00000393605:A220V;ENSP00000243067:A246V	ENSP00000266970:A280V	A	+	2	0	CDK2	54651618	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.805000	0.86005	2.688000	0.91661	0.591000	0.81541	GCC	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.527	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2	protein_coding	OTTHUMT00000409650.1	C		-		56365351	+1	no_errors	ENST00000266970	ensembl	human	known	74_37	missense	SNP	1.000	T
ZMYM1	79830	genome.wustl.edu	37	1	35580503	35580503	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:35580503C>T	ENST00000373330.1	+	11	3246	c.3072C>T	c.(3070-3072)atC>atT	p.I1024I	ZMYM1_ENST00000359858.4_Silent_p.I1024I|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	1024						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGGACATTATCCCAGAACTTA	0.318																																																	0								ENSG00000197056						106.0	98.0	100.0					1																	35580503		1838	4090	5928	ZMYM1	SO:0001819	synonymous_variant	0			-	HGNC	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.3072C>T	1.37:g.35580503C>T		Somatic	0	78	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	63	36.36	D3DPR7|Q7Z3Q4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.I1024	ENST00000373330.1	37	c.3072	CCDS41302.1	1																																																																																			-	superfamily_RNaseH-like_dom		0.318	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	protein_coding	OTTHUMT00000012705.1	C	NM_024772	-		35580503	+1	no_errors	ENST00000359858	ensembl	human	novel	74_37	silent	SNP	1.000	T
MKI67	4288	genome.wustl.edu	37	10	129905112	129905113	+	Frame_Shift_Del	DEL	TG	TG	-	rs145960091		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr10:129905112_129905113delTG	ENST00000368654.3	-	13	5366_5367	c.4991_4992delCA	c.(4990-4992)acafs	p.T1664fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.T1304fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1664	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGTTGGCTCTGTGTGTGTGTG	0.51																																																	0								ENSG00000148773																																			MKI67	SO:0001589	frameshift_variant	0				HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4991_4992delCA	10.37:g.129905122_129905123delTG	ENSP00000357643:p.Thr1664fs	Somatic	0	46	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	Q5VWH2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.T1664fs	ENST00000368654.3	37	c.4992_4991	CCDS7659.1	10																																																																																			-	pfam_K167R		0.510	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	TG	NM_002417			129905113	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000	-
RN7SL319P	106479339	genome.wustl.edu	37	15	76077689	76077690	+	RNA	INS	-	-	G	rs200411336	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr15:76077689_76077690insG	ENST00000395215.3	+	0	1184				RN7SL319P_ENST00000480656.2_RNA																							agcaagatcttgttcttaaaag	0.515													|||unknown(NO_COVERAGE)	899	0.179513	0.0817	0.255	5008	,	,		17448	0.2599		0.2028	False		,,,				2504	0.1513																0								ENSG00000241807																																			RN7SL319P			0				HGNC																													15.37:g.76077690_76077690dupG		Somatic	0	24	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			-	-		0.515	RP11-24M17.5-001	KNOWN	basic	processed_transcript	RN7SL319P	pseudogene	OTTHUMT00000420501.1	-				76077690	+1	no_errors	ENST00000480656	ensembl	human	known	74_37	rna	INS	0.981:0.985	G
NLRP12	91662	genome.wustl.edu	37	19	54327234	54327234	+	Silent	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:54327234C>A	ENST00000324134.6	-	1	363	c.195G>T	c.(193-195)ggG>ggT	p.G65G	NLRP12_ENST00000535162.1_Silent_p.G65G|NLRP12_ENST00000345770.5_Silent_p.G65G|NLRP12_ENST00000391772.1_Silent_p.G65G|NLRP12_ENST00000351894.4_Silent_p.G65G|NLRP12_ENST00000391773.1_Silent_p.G65G|NLRP12_ENST00000391775.3_Silent_p.G65G|NLRP12_ENST00000354278.3_Silent_p.G65G	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	65	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCTCCTCTGGCCCGAAGTGGG	0.617																																																	0								ENSG00000142405						85.0	83.0	84.0					19																	54327234		2203	4300	6503	NLRP12	SO:0001819	synonymous_variant	0			-	HGNC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.195G>T	19.37:g.54327234C>A		Somatic	0	71	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.G65	ENST00000324134.6	37	c.195	CCDS12864.1	19																																																																																			-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN		0.617	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	protein_coding	OTTHUMT00000134340.1	C	NM_144687	-		54327234	-1	no_errors	ENST00000324134	ensembl	human	known	74_37	silent	SNP	0.034	A
SLC16A11	162515	genome.wustl.edu	37	17	6946879	6946879	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:6946879C>A	ENST00000308009.1	-	1	363	c.26G>T	c.(25-27)aGg>aTg	p.R9M	SLC16A11_ENST00000447225.1_De_novo_Start_InFrame	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	9					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						GCCTCCACGCCTGTGCTTCCG	0.731																																																	0								ENSG00000174326						16.0	21.0	19.0					17																	6946879		1915	3954	5869	SLC16A11	SO:0001583	missense	0			-	HGNC	AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.26G>T	17.37:g.6946879C>A	ENSP00000310490:p.Arg9Met	Somatic	0	11	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R9M	ENST00000308009.1	37	c.26	CCDS11086.1	17	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513816	0.64522	.	.	ENSG00000174326	ENST00000308009	T	0.07444	3.19	5.31	5.31	0.75309	.	5.956090	0.00357	N	0.000025	T	0.09113	0.0225	N	0.08118	0	0.47341	D	0.999391	P	0.39576	0.679	B	0.40702	0.338	T	0.31110	-0.9955	10	0.48119	T	0.1	.	14.8698	0.70448	0.0:1.0:0.0:0.0	.	9	Q8NCK7	MOT11_HUMAN	M	9	ENSP00000310490:R9M	ENSP00000310490:R9M	R	-	2	0	SLC16A11	6887603	0.001000	0.12720	0.006000	0.13384	0.033000	0.12548	1.397000	0.34543	2.658000	0.90341	0.485000	0.47835	AGG	-	NULL		0.731	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC16A11	protein_coding	OTTHUMT00000219921.1	C	NM_153357	-		6946879	-1	no_errors	ENST00000308009	ensembl	human	known	74_37	missense	SNP	0.009	A
HUNK	30811	genome.wustl.edu	37	21	33318455	33318455	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr21:33318455T>C	ENST00000270112.2	+	4	1078	c.718T>C	c.(718-720)Tac>Cac	p.Y240H		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CAGGAAGAAATACGGCCCCAA	0.532																																																	0								ENSG00000142149						98.0	85.0	89.0					21																	33318455		2203	4300	6503	HUNK	SO:0001583	missense	0			-	HGNC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.718T>C	21.37:g.33318455T>C	ENSP00000270112:p.Tyr240His	Somatic	0	61	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	59	28.57		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y240H	ENST00000270112.2	37	c.718	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	T	26.2	4.716804	0.89205	.	.	ENSG00000142149	ENST00000270112;ENST00000430354	T;T	0.30182	1.54;1.54	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67654	-0.5615	10	0.87932	D	0	-33.5884	15.3876	0.74714	0.0:0.0:0.0:1.0	.	240	P57058	HUNK_HUMAN	H	240;125	ENSP00000270112:Y240H;ENSP00000411860:Y125H	ENSP00000270112:Y240H	Y	+	1	0	HUNK	32240326	1.000000	0.71417	0.984000	0.44739	0.939000	0.58152	7.470000	0.80973	2.217000	0.71921	0.533000	0.62120	TAC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.532	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	protein_coding	OTTHUMT00000192782.1	T	NM_014586	-		33318455	+1	no_errors	ENST00000270112	ensembl	human	known	74_37	missense	SNP	1.000	C
GAPVD1	26130	genome.wustl.edu	37	9	128025963	128025989	+	Intron	DEL	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT	-	rs551743640|rs71374244|rs143312600	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT	ENST00000495955.1	+	1	92				GAPVD1_ENST00000394084.1_Intron|GAPVD1_ENST00000394083.2_Intron|GAPVD1_ENST00000265956.4_Intron|GAPVD1_ENST00000469528.1_3'UTR|GAPVD1_ENST00000297933.6_Intron|GAPVD1_ENST00000394104.2_Intron|GAPVD1_ENST00000470056.1_Intron|GAPVD1_ENST00000394105.2_Intron			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTAAGTGGCACAGCACTCCATCTGTAGGTATGTCTGTCAGCACTCCA	0.564														2105	0.420327	0.4516	0.3818	5008	,	,		19587	0.4454		0.3777	False		,,,				2504	0.4233																0								ENSG00000165219																																			GAPVD1	SO:0001627	intron_variant	0				HGNC		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.-199+1725CAGCACTCCATCTGTAGGTATGTCTGT>-	9.37:g.128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT		Somatic	NA	NA	NA		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000495955.1	37	c.NULL		9																																																																																			-	-		0.564	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	protein_coding	OTTHUMT00000355644.1	CAGCACTCCATCTGTAGGTATGTCTGT				128025989	+1	no_errors	ENST00000469528	ensembl	human	known	74_37	splice_site_del	DEL	1.000:1.000:1.000:1.000:1.000:0.999:0.996:0.980:0.970:0.963:0.961:0.959:0.952:0.948:0.947:0.950:0.961:0.966:0.966:0.969:0.974:0.982:0.984:0.985:0.984:0.985:0.993	-
RNASE2	6036	genome.wustl.edu	37	14	21424381	21424381	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:21424381C>A	ENST00000304625.2	+	2	541	c.451C>A	c.(451-453)Ccg>Acg	p.P151T		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	151					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)			breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		TCCACAGTATCCGGTGGTTCC	0.463																																																	0								ENSG00000169385						129.0	126.0	127.0					14																	21424381		2203	4300	6503	RNASE2	SO:0001583	missense	0			-	HGNC	X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.451C>A	14.37:g.21424381C>A	ENSP00000303276:p.Pro151Thr	Somatic	0	64	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.P151T	ENST00000304625.2	37	c.451	CCDS9561.1	14	.	.	.	.	.	.	.	.	.	.	c	11.54	1.669185	0.29604	.	.	ENSG00000169385	ENST00000304625	T	0.72942	-0.7	2.88	-3.52	0.04682	Ribonuclease A, domain (4);	1.043280	0.07647	U	0.931348	T	0.79873	0.4521	M	0.87682	2.9	0.09310	N	1	D	0.69078	0.997	D	0.66716	0.946	T	0.67856	-0.5562	10	0.87932	D	0	.	0.6975	0.00902	0.1717:0.2588:0.1694:0.4001	.	151	P10153	RNAS2_HUMAN	T	151	ENSP00000303276:P151T	ENSP00000303276:P151T	P	+	1	0	RNASE2	20494221	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.166000	0.03129	-0.900000	0.03896	-0.384000	0.06662	CCG	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain		0.463	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE2	protein_coding	OTTHUMT00000073799.2	C		-		21424381	+1	no_errors	ENST00000304625	ensembl	human	known	74_37	missense	SNP	0.000	A
PRAMENP	649179	genome.wustl.edu	37	22	22348852	22348852	+	RNA	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr22:22348852G>T	ENST00000337471.4	-	0	2071									PRAME N-terminal-like, pseudogene																		TCTTCTCAATGTGCAACTTCC	0.512																																																	0								ENSG00000197549																																			PRAMENP			0			-	HGNC			22q11.22	2013-09-27	2013-09-27	2013-09-27	ENSG00000197549	ENSG00000197549		"""-"""	34302	pseudogene	pseudogene			"""preferentially expressed antigen in melanoma-like"", ""PRAME family member 24, pseudogene"""	PRAMEL, PRAMEF24P			Standard	XR_425303		Approved	FLJ16327			OTTHUMG00000150836		22.37:g.22348852G>T		Somatic	0	21	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337471.4	37	NULL		22																																																																																			-	-		0.512	PRAMENP-001	KNOWN	basic|exp_conf	processed_transcript	PRAMENP	pseudogene	OTTHUMT00000320276.2	G		-		22348852	-1	no_errors	ENST00000337471	ensembl	human	known	74_37	rna	SNP	0.002	T
NUP214	8021	genome.wustl.edu	37	9	134008391	134008392	+	Intron	INS	-	-	TT	rs200244345	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:134008391_134008392insTT	ENST00000359428.5	+	7	871				NUP214_ENST00000451030.1_Intron|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|NUP214_ENST00000411637.2_Intron			P35658	NU214_HUMAN	nucleoporin 214kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AGGGCCTTTGATTTTTTTTTTA	0.351			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0								ENSG00000236986																																			RP11-544A12.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.728-101->TT	9.37:g.134008400_134008401dupTT		Somatic	0	11	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	37.50	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359428.5	37	NULL	CCDS6940.1	9																																																																																			-	-		0.351	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000236986	protein_coding	OTTHUMT00000054694.2	-	NM_005085			134008392	-1	no_errors	ENST00000587264	ensembl	human	known	74_37	rna	INS	0.002:0.002	TT
PILRB	29990	genome.wustl.edu	37	7	99943552	99943553	+	5'UTR	INS	-	-	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr7:99943552_99943553insT	ENST00000610247.1	+	0	492_493				STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGTGAAGGGATTTTTTTTTTT	0.416																																																	0								ENSG00000272752																																			STAG3L5P-PVRIG2P-PILRB	SO:0001623	5_prime_UTR_variant	0				HGNC	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-2004->T	7.37:g.99943563_99943563dupT		Somatic	0	32	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q69YF9|Q9HBS0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			-	-		0.416	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3L5P-PVRIG2P-PILRB	protein_coding		-	NM_178238			99943553	+1	no_errors	ENST00000310771	ensembl	human	known	74_37	rna	INS	0.000:0.002	T
USH2A	7399	genome.wustl.edu	37	1	216251697	216251697	+	Missense_Mutation	SNP	A	A	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:216251697A>C	ENST00000307340.3	-	27	5692	c.5306T>G	c.(5305-5307)cTg>cGg	p.L1769R	RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.L1769R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1769	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCACTTTTCAGCTCCATCTG	0.368										HNSCC(13;0.011)																																							0								ENSG00000042781						152.0	170.0	164.0					1																	216251697		2203	4299	6502	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5306T>G	1.37:g.216251697A>C	ENSP00000305941:p.Leu1769Arg	Somatic	0	57	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	8	68.00	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L1769R	ENST00000307340.3	37	c.5306	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.191451	0.78902	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;D	0.89196	-2.48;-2.48	5.36	5.36	0.76844	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34314	N	0.004067	D	0.95010	0.8385	M	0.87456	2.885	0.47214	D	0.99935	D	0.89917	1.0	D	0.97110	1.0	D	0.95799	0.8831	10	0.87932	D	0	.	15.3555	0.74423	1.0:0.0:0.0:0.0	.	1769	O75445	USH2A_HUMAN	R	1769	ENSP00000305941:L1769R;ENSP00000355910:L1769R	ENSP00000305941:L1769R	L	-	2	0	USH2A	214318320	1.000000	0.71417	0.965000	0.40720	0.995000	0.86356	6.097000	0.71452	2.039000	0.60335	0.528000	0.53228	CTG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	A	NM_007123	-		216251697	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	1.000	C
FSHR	2492	genome.wustl.edu	37	2	49190918	49190918	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:49190918G>T	ENST00000406846.2	-	10	1161	c.1042C>A	c.(1042-1044)Cct>Act	p.P348T	FSHR_ENST00000541117.1_Missense_Mutation_p.P84T|FSHR_ENST00000346173.3_Missense_Mutation_p.P286T|FSHR_ENST00000304421.4_Missense_Mutation_p.P322T	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	348			P -> R (in ODG1). {ECO:0000269|PubMed:12571157}.		female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TCTGGCTTAGGGGAGCAGGTC	0.468									Gonadal Dysgenesis, 46 XX																																								0								ENSG00000170820						275.0	231.0	246.0					2																	49190918		2203	4300	6503	FSHR	SO:0001583	missense	0	Familial Cancer Database		-	HGNC		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1042C>A	2.37:g.49190918G>T	ENSP00000384708:p.Pro348Thr	Somatic	0	55	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.P348T	ENST00000406846.2	37	c.1042	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	G	18.12	3.554143	0.65425	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.13	5.13	0.70059	Gonadotropin hormone receptor, transmembrane domain (1);	0.054975	0.85682	D	0.000000	D	0.95802	0.8634	M	0.79475	2.455	0.80722	D	1	P;P;P	0.46512	0.879;0.853;0.879	P;P;P	0.50378	0.639;0.506;0.639	D	0.95410	0.8497	9	.	.	.	.	17.7464	0.88422	0.0:0.0:1.0:0.0	.	322;286;348	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	T	348;286;322;84	ENSP00000384708:P348T;ENSP00000333908:P286T;ENSP00000306780:P322T;ENSP00000444172:P84T	.	P	-	1	0	FSHR	49044422	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.657000	0.98554	2.673000	0.90976	0.561000	0.74099	CCT	-	pfam_GnHR_TM		0.468	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	protein_coding	OTTHUMT00000251367.2	G		-		49190918	-1	no_errors	ENST00000406846	ensembl	human	known	74_37	missense	SNP	1.000	T
PICALM	8301	genome.wustl.edu	37	11	85714464	85714464	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr11:85714464G>T	ENST00000393346.3	-	9	986	c.838C>A	c.(838-840)Caa>Aaa	p.Q280K	PICALM_ENST00000532317.1_Missense_Mutation_p.Q280K|PICALM_ENST00000356360.5_Missense_Mutation_p.Q280K|PICALM_ENST00000528398.1_Missense_Mutation_p.Q229K|PICALM_ENST00000526033.1_Missense_Mutation_p.Q280K			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	280	Interaction with FAM64A.				axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				GCTAAATGTTGTTCCAAAGCA	0.363			T	"""MLLT10, MLL"""	"""TALL, AML, """																																			Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	0								ENSG00000073921						94.0	92.0	92.0					11																	85714464		2203	4299	6502	PICALM	SO:0001583	missense	0			-	HGNC	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.838C>A	11.37:g.85714464G>T	ENSP00000377015:p.Gln280Lys	Somatic	0	28	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.Q280K	ENST00000393346.3	37	c.838	CCDS8272.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.507437	0.96386	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.7	5.7	0.88788	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.67739	0.2925	M	0.78637	2.42	0.80722	D	1	P;D;P;D	0.65815	0.931;0.995;0.771;0.991	P;D;P;D	0.77004	0.883;0.989;0.556;0.985	T	0.67221	-0.5725	9	.	.	.	-8.1117	19.8424	0.96695	0.0:0.0:1.0:0.0	.	229;280;280;280	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	K	280;280;280;280;229;280	ENSP00000436958:Q280K;ENSP00000433846:Q280K;ENSP00000377015:Q280K;ENSP00000434884:Q229K;ENSP00000348718:Q280K	.	Q	-	1	0	PICALM	85392112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.673000	0.90976	0.655000	0.94253	CAA	-	pfam_ANTH_dom		0.363	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PICALM	protein_coding	OTTHUMT00000392224.1	G	NM_007166	-		85714464	-1	no_errors	ENST00000393346	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH9	1770	genome.wustl.edu	37	17	11584066	11584066	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:11584066delA	ENST00000262442.4	+	19	3671	c.3603delA	c.(3601-3603)atafs	p.I1201fs	DNAH9_ENST00000454412.2_Frame_Shift_Del_p.I1201fs	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1201	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGAACAACATAAAAAAGGTGG	0.532																																																	0								ENSG00000007174						69.0	56.0	60.0					17																	11584066		2203	4300	6503	DNAH9	SO:0001589	frameshift_variant	0				HGNC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3603delA	17.37:g.11584066delA	ENSP00000262442:p.Ile1201fs	Somatic	0	43	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	A2VCQ8|O15064|O95494|Q9NQ28	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K1203fs	ENST00000262442.4	37	c.3603	CCDS11160.1	17																																																																																			-	NULL		0.532	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	A	NM_001372			11584066	+1	no_errors	ENST00000262442	ensembl	human	known	74_37	frame_shift_del	DEL	0.379	-
ANGEL2	90806	genome.wustl.edu	37	1	213188755	213188755	+	Intron	DEL	T	T	-			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:213188755delT	ENST00000366962.3	-	1	214				ANGEL2_ENST00000540642.1_Intron|ANGEL2_ENST00000535388.1_Intron|ANGEL2_ENST00000544555.1_5'UTR|ANGEL2_ENST00000360506.2_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)											central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TGGCCCAGCGTCCCGCCAGCT	0.672																																																	0								ENSG00000174606																																			ANGEL2	SO:0001627	intron_variant	0				HGNC	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.59+199A>-	1.37:g.213188755delT		Somatic	0	25	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366962.3	37	NULL	CCDS1512.1	1																																																																																			-	-		0.672	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	protein_coding	OTTHUMT00000089693.1	T	NM_144567			213188755	-1	no_errors	ENST00000481918	ensembl	human	known	74_37	rna	DEL	0.000	-
ACADVL	37	genome.wustl.edu	37	17	7123240	7123241	+	5'UTR	INS	-	-	GGGCGTGCAGGACGC	rs77051465|rs550196368|rs3835013|rs6145976|rs139223575|rs421019	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:7123240_7123241insGGGCGTGCAGGACGC	ENST00000356839.5	+	0	116_117				ACADVL_ENST00000543245.2_Intron|DLG4_ENST00000485100.1_5'Flank|DLG4_ENST00000399506.2_5'Flank|ACADVL_ENST00000350303.5_5'UTR|DLG4_ENST00000302955.6_5'Flank|DLG4_ENST00000399510.2_5'Flank	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CGCCAGGACGTGGGCGTGCAGG	0.713														2343	0.467851	0.2988	0.4769	5008	,	,		14818	0.4712		0.5736	False		,,,				2504	0.5777																0								ENSG00000072778		,,	1193,2759		290,613,1073					,,	-1.0	0.0		dbSNP_130	8	4084,3646		1352,1380,1133	no	utr-5,utr-5,utr-5	ACADVL,DLG4	NM_001365.3,NM_001033859.1,NM_000018.2	,,	1642,1993,2206	A1A1,A1R,RR		47.1669,30.1872,45.1721	,,	,,		5277,6405				ACADVL	SO:0001623	5_prime_UTR_variant	0				HGNC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.-63->GGGCGTGCAGGACGC	17.37:g.7123240_7123241insGGGCGTGCAGGACGC		Somatic	NA	NA	NA		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DEB6|F5H2A9|O76056|Q8WUL0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356839.5	37	NULL	CCDS11090.1	17																																																																																			-	-		0.713	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	protein_coding	OTTHUMT00000220001.5	-	NM_000018			7123241	+1	no_errors	ENST00000577857	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGGCGTGCAGGACGC
YEATS2	55689	genome.wustl.edu	37	3	183520323	183520324	+	Intron	INS	-	-	TA	rs11276625|rs74710373	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr3:183520323_183520324insTA	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			atatacacgtgtatatacacac	0.332														2148	0.428914	0.2602	0.4568	5008	,	,		21295	0.5228		0.4642	False		,,,				2504	0.5041																0								ENSG00000216166																																			AC131160.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-720->TA	3.37:g.183520328_183520329dupTA		Somatic	0	9	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56	A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			-	-		0.332	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	protein_coding	OTTHUMT00000346507.2	-	NM_018023			183520324	-1	no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TA
GOLGA5	9950	genome.wustl.edu	37	14	93264116	93264116	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:93264116C>T	ENST00000163416.2	+	2	590	c.334C>T	c.(334-336)Cga>Tga	p.R112*	GOLGA5_ENST00000355976.2_Nonsense_Mutation_p.R112*	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	112					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		CCATTTTGTGCGAAGAAAAAA	0.453			T	RET	papillary thyroid																																			Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	0								ENSG00000066455						93.0	91.0	91.0					14																	93264116		2203	4300	6503	GOLGA5	SO:0001587	stop_gained	0			-	HGNC	AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.334C>T	14.37:g.93264116C>T	ENSP00000163416:p.Arg112*	Somatic	0	27	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Golgin_subfamily_A_member_5,superfamily_Prefoldin	p.R112*	ENST00000163416.2	37	c.334	CCDS9905.1	14	.	.	.	.	.	.	.	.	.	.	C	38	6.915931	0.97932	.	.	ENSG00000066455	ENST00000163416;ENST00000355976	.	.	.	5.45	3.46	0.39613	.	0.000000	0.40385	N	0.001118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-13.7303	13.7434	0.62862	0.4246:0.5754:0.0:0.0	.	.	.	.	X	112	.	ENSP00000163416:R112X	R	+	1	2	GOLGA5	92333869	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.366000	0.52343	1.393000	0.46605	0.655000	0.94253	CGA	-	NULL		0.453	GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA5	protein_coding	OTTHUMT00000412365.1	C		-		93264116	+1	no_errors	ENST00000163416	ensembl	human	known	74_37	nonsense	SNP	0.998	T
ITGA7	3679	genome.wustl.edu	37	12	56079995	56079995	+	Intron	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr12:56079995C>A	ENST00000555728.1	-	26	3344				ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000257879.6_Intron|ITGA7_ENST00000394230.2_Missense_Mutation_p.G1100V|ITGA7_ENST00000553804.1_Intron|ITGA7_ENST00000394229.2_Missense_Mutation_p.G1096V|ITGA7_ENST00000347027.6_Intron|ITGA7_ENST00000257880.7_Missense_Mutation_p.G1140V			Q13683	ITA7_HUMAN	integrin, alpha 7						blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCCCACAGTCCCTGGACCCCC	0.527																																																	0								ENSG00000135424						27.0	23.0	24.0					12																	56079995		876	1991	2867	ITGA7	SO:0001627	intron_variant	0			-	HGNC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3316-923G>T	12.37:g.56079995C>A		Somatic	0	38	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G1140V	ENST00000555728.1	37	c.3419		12	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654159	0.47362	.	.	ENSG00000135424	ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000557555	T;T;T	0.71579	-0.58;-0.58;-0.58	5.47	3.64	0.41730	.	.	.	.	.	T	0.72985	0.3529	.	.	.	0.43647	D	0.99605	.	.	.	.	.	.	T	0.73610	-0.3928	6	0.66056	D	0.02	.	6.4889	0.22105	0.0:0.7252:0.0:0.2748	.	.	.	.	V	1140;1100;1096;969;126	ENSP00000257880:G1140V;ENSP00000377777:G1100V;ENSP00000377776:G1096V	ENSP00000257880:G1140V	G	-	2	0	ITGA7	54366262	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.601000	0.46249	1.321000	0.45227	0.561000	0.74099	GGG	-	NULL		0.527	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	protein_coding	OTTHUMT00000410138.1	C	NM_002206	-		56079995	-1	no_errors	ENST00000257880	ensembl	human	known	74_37	missense	SNP	1.000	A
SPACA3	124912	genome.wustl.edu	37	17	31324480	31324480	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:31324480C>G	ENST00000269053.3	+	4	590	c.520C>G	c.(520-522)Ctc>Gtc	p.L174V	SPACA3_ENST00000580599.1_Missense_Mutation_p.L105V|SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000394638.1_Missense_Mutation_p.L71V	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	174					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			GAATCCTAATCTCAAGGATAC	0.498																																																	0								ENSG00000141316						232.0	220.0	224.0					17																	31324480		2203	4300	6503	SPACA3	SO:0001583	missense	0			-	HGNC	AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.520C>G	17.37:g.31324480C>G	ENSP00000269053:p.Leu174Val	Somatic	0	25	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	Q7Z4Y5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.L174V	ENST00000269053.3	37	c.520	CCDS11275.1	17	.	.	.	.	.	.	.	.	.	.	C	13.99	2.400852	0.42613	.	.	ENSG00000141316	ENST00000269053;ENST00000394638;ENST00000394637;ENST00000411740	T;T	0.71103	-0.54;-0.54	3.87	2.85	0.33270	Lysozyme-like domain (1);Glycoside hydrolase, family 22, conserved site (1);	0.422175	0.18467	N	0.140360	T	0.76941	0.4058	L	0.56396	1.775	0.24350	N	0.994929	D	0.59357	0.985	D	0.65874	0.939	T	0.64166	-0.6471	10	0.49607	T	0.09	-3.4417	8.5237	0.33291	0.2306:0.7694:0.0:0.0	.	174	Q8IXA5	SACA3_HUMAN	V	174;71;175;82	ENSP00000269053:L174V;ENSP00000378134:L71V	ENSP00000269053:L174V	L	+	1	0	SPACA3	28348593	0.974000	0.33945	0.248000	0.24265	0.107000	0.19398	1.421000	0.34815	1.980000	0.57719	0.379000	0.24179	CTC	-	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys		0.498	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA3	protein_coding	OTTHUMT00000256380.1	C	NM_173847	-		31324480	+1	no_errors	ENST00000269053	ensembl	human	known	74_37	missense	SNP	0.544	G
OLFM3	118427	genome.wustl.edu	37	1	102269445	102269445	+	3'UTR	DEL	A	A	-			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:102269445delA	ENST00000338858.5	-	0	1785				OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_3'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3						eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TGACAGTTTTAAAAAAAAAGA	0.303																																																	0								ENSG00000118733																																			OLFM3	SO:0001624	3_prime_UTR_variant	0				HGNC	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.*349T>-	1.37:g.102269445delA		Somatic	0	17	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338858.5	37	NULL		1																																																																																			-	-		0.303	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	protein_coding	OTTHUMT00000030142.1	A				102269445	-1	no_errors	ENST00000462354	ensembl	human	known	74_37	rna	DEL	0.075	-
TPR	7175	genome.wustl.edu	37	1	186302508	186302508	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:186302508G>A	ENST00000367478.4	-	37	5497	c.5201C>T	c.(5200-5202)cCt>cTt	p.P1734L		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1734					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ATGTTCCACAGGCCCTTCTGA	0.383			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0								ENSG00000047410						104.0	97.0	99.0					1																	186302508		1875	4100	5975	TPR	SO:0001583	missense	0			-	HGNC	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5201C>T	1.37:g.186302508G>A	ENSP00000356448:p.Pro1734Leu	Somatic	0	76	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	7	85.11	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.P1734L	ENST00000367478.4	37	c.5201	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934508	0.52866	.	.	ENSG00000047410	ENST00000367478	T	0.27104	1.69	5.09	5.09	0.68999	.	0.108809	0.64402	D	0.000004	T	0.27098	0.0664	L	0.59436	1.845	0.58432	D	0.999997	B	0.25850	0.136	B	0.17722	0.019	T	0.06698	-1.0812	10	0.72032	D	0.01	.	13.5442	0.61693	0.0:0.0:0.8443:0.1557	.	1734	P12270	TPR_HUMAN	L	1734	ENSP00000356448:P1734L	ENSP00000356448:P1734L	P	-	2	0	TPR	184569131	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	6.496000	0.73670	2.403000	0.81681	0.644000	0.83932	CCT	-	NULL		0.383	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	protein_coding	OTTHUMT00000086353.2	G	NM_003292	-		186302508	-1	no_errors	ENST00000367478	ensembl	human	known	74_37	missense	SNP	1.000	A
ATRX	546	genome.wustl.edu	37	X	76888728	76888728	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chrX:76888728T>A	ENST00000373344.5	-	19	5315	c.5101A>T	c.(5101-5103)Aaa>Taa	p.K1701*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.K1663*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1701	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AATATTTCTTTAAGTTTCCGA	0.343			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						195.0	209.0	204.0					X																	76888728		2203	4296	6499	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5101A>T	X.37:g.76888728T>A	ENSP00000362441:p.Lys1701*	Somatic	0	51	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	40	42.86	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K1701*	ENST00000373344.5	37	c.5101	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	T	47	13.841391	0.99766	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6866	14.8311	0.70149	0.0:0.0:0.0:1.0	.	.	.	.	X	1701;1663	.	ENSP00000362441:K1701X	K	-	1	0	ATRX	76775384	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.673000	0.83973	1.885000	0.54596	0.481000	0.45027	AAA	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.343	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	T	NM_000489	-		76888728	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	1.000	A
BCO1	53630	genome.wustl.edu	37	16	81323975	81323975	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr16:81323975C>T	ENST00000258168.2	+	11	1898	c.1437C>T	c.(1435-1437)gtC>gtT	p.V479V	BCMO1_ENST00000425577.2_Silent_p.V410V	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						CAGCCATTGTCTCTACTGATC	0.448																																																	0								ENSG00000135697						77.0	73.0	75.0					16																	81323975		2202	4300	6502	BCMO1	SO:0001819	synonymous_variant	0			-	HGNC																												ENST00000258168.2:c.1437C>T	16.37:g.81323975C>T		Somatic	0	67	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Carotenoid_Oase	p.V479	ENST00000258168.2	37	c.1437	CCDS10934.1	16																																																																																			-	pfam_Carotenoid_Oase		0.448	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	protein_coding	OTTHUMT00000269056.1	C		-		81323975	+1	no_errors	ENST00000258168	ensembl	human	known	74_37	silent	SNP	0.992	T
BMS1P18	414763	genome.wustl.edu	37	14	19891124	19891124	+	lincRNA	SNP	T	T	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:19891124T>A	ENST00000552602.1	-	0	293																											CACCCTACCTTAGGAAACAGG	0.532																																																	0								ENSG00000244306																																			CTD-2314B22.3			0			-	Clone_based_vega_gene																													14.37:g.19891124T>A		Somatic	0	31	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	31	29.55		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000552602.1	37	NULL		14																																																																																			-	-		0.532	CTD-2314B22.3-003	KNOWN	basic	lincRNA	ENSG00000244306	lincRNA	OTTHUMT00000409412.1	T		-		19891124	-1	no_errors	ENST00000547285	ensembl	human	known	74_37	rna	SNP	0.023	A
GPR135	64582	genome.wustl.edu	37	14	59931123	59931123	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:59931123G>A	ENST00000395116.1	-	1	937	c.822C>T	c.(820-822)ggC>ggT	p.G274G		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		TGAAGGCCGCGCCCAGCTGCG	0.711																																																	0								ENSG00000181619						7.0	7.0	7.0					14																	59931123		2080	4126	6206	GPR135	SO:0001819	synonymous_variant	0			-	HGNC	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.822C>T	14.37:g.59931123G>A		Somatic	0	15	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q7Z604|Q86SM3|Q8NH39	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G274	ENST00000395116.1	37	c.822	CCDS9738.1	14																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.711	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR135	protein_coding	OTTHUMT00000276941.1	G	NM_022571	-		59931123	-1	no_errors	ENST00000395116	ensembl	human	known	74_37	silent	SNP	0.958	A
KEL	3792	genome.wustl.edu	37	7	142638486	142638486	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr7:142638486C>G	ENST00000355265.2	-	19	2526	c.2052G>C	c.(2050-2052)aaG>aaC	p.K684N		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	684					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GGGGGCTGGGCTTCCTACACA	0.612																																																	0								ENSG00000197993						91.0	94.0	93.0					7																	142638486		2203	4300	6503	KEL	SO:0001583	missense	0			-	HGNC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.2052G>C	7.37:g.142638486C>G	ENSP00000347409:p.Lys684Asn	Somatic	0	47	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	21	38.24	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.K684N	ENST00000355265.2	37	c.2052	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	c	2.992	-0.207865	0.06180	.	.	ENSG00000197993	ENST00000355265	D	0.91464	-2.85	4.86	-0.652	0.11450	Peptidase M13, neprilysin, C-terminal (1);	1.740460	0.02785	N	0.121428	T	0.77705	0.4170	N	0.10629	0.01	0.09310	N	1	B	0.15473	0.013	B	0.19148	0.024	T	0.65179	-0.6231	10	0.22706	T	0.39	-20.206	0.6914	0.00892	0.333:0.3135:0.1601:0.1934	.	684	P23276	KELL_HUMAN	N	684	ENSP00000347409:K684N	ENSP00000347409:K684N	K	-	3	2	KEL	142348608	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.366000	0.02585	0.013000	0.14918	0.651000	0.88453	AAG	-	pfam_Peptidase_M13_C		0.612	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	protein_coding	OTTHUMT00000347671.2	C	NM_000420	-		142638486	-1	no_errors	ENST00000355265	ensembl	human	known	74_37	missense	SNP	0.000	G
SLC20A1	6574	genome.wustl.edu	37	2	113414763	113414763	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:113414763C>T	ENST00000272542.3	+	6	1262	c.723C>T	c.(721-723)ttC>ttT	p.F241F	SLC20A1_ENST00000480984.1_3'UTR	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	241					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						GTGCAGTTTTCTGTGCCCTTA	0.423																																																	0								ENSG00000144136						195.0	192.0	193.0					2																	113414763		2203	4300	6503	SLC20A1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.723C>T	2.37:g.113414763C>T		Somatic	0	23	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	23	46.51	Q08344|Q6DHX8|Q9UQ82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phos_transporter	p.F241	ENST00000272542.3	37	c.723	CCDS2099.1	2																																																																																			-	pfam_Phos_transporter		0.423	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A1	protein_coding	OTTHUMT00000254086.2	C	NM_005415	-		113414763	+1	no_errors	ENST00000272542	ensembl	human	known	74_37	silent	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7574025	7574025	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:7574025delC	ENST00000269305.4	-	10	1191	c.1002delG	c.(1000-1002)gggfs	p.G334fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.G334fs|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	334	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		G -> V (in sporadic cancers; somatic mutation).|G -> W (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCGCTCACGCCCACGGATCT	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	10	Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|large_intestine(1)|stomach(1)						ENSG00000141510						51.0	40.0	44.0					17																	7574025		2203	4300	6503	TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1002delG	17.37:g.7574025delC	ENSP00000269305:p.Gly334fs	Somatic	0	30	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	7	58.82	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R335fs	ENST00000269305.4	37	c.1002	CCDS11118.1	17																																																																																			-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546			7574025	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	0.879	-
EMR3	84658	genome.wustl.edu	37	19	14752409	14752409	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:14752409G>A	ENST00000253673.5	-	10	1170	c.1070C>T	c.(1069-1071)aCt>aTt	p.T357I	EMR3_ENST00000344373.4_Missense_Mutation_p.T305I|EMR3_ENST00000443157.2_Missense_Mutation_p.T231I|EMR3_ENST00000599900.1_Missense_Mutation_p.T142I	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	357					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						GGTGATGACAGTCAGCACGGG	0.562																																																	0								ENSG00000131355						72.0	60.0	64.0					19																	14752409		2203	4300	6503	EMR3	SO:0001583	missense	0			-	HGNC	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1070C>T	19.37:g.14752409G>A	ENSP00000253673:p.Thr357Ile	Somatic	0	39	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	13	62.86		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.T357I	ENST00000253673.5	37	c.1070	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	G	12.38	1.922118	0.33908	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.37058	1.22;1.22;1.22	3.68	0.0856	0.14442	GPCR, family 2-like (1);	.	.	.	.	T	0.52549	0.1741	M	0.89904	3.07	0.09310	N	1	D;P;P	0.53151	0.958;0.948;0.707	P;P;P	0.57468	0.821;0.726;0.703	T	0.47209	-0.9135	9	0.72032	D	0.01	.	0.9045	0.01281	0.2157:0.1847:0.41:0.1896	.	231;305;357	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	I	231;357;305	ENSP00000396208:T231I;ENSP00000253673:T357I;ENSP00000340758:T305I	ENSP00000253673:T357I	T	-	2	0	EMR3	14613409	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.737000	0.01843	-0.058000	0.13177	0.561000	0.74099	ACT	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.562	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	protein_coding	OTTHUMT00000466488.1	G	NM_032571	-		14752409	-1	no_errors	ENST00000253673	ensembl	human	known	74_37	missense	SNP	0.000	A
WIPI1	55062	genome.wustl.edu	37	17	66453573	66453581	+	5'Flank	DEL	GCCCGGGAA	GCCCGGGAA	-	rs146213184|rs549957857	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	GCCCGGGAA	GCCCGGGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr17:66453573_66453581delGCCCGGGAA	ENST00000262139.5	-	0	0				WIPI1_ENST00000546360.1_5'UTR|WIPI1_ENST00000589459.1_5'UTR	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						CGGGGGCTCGGCCCGGGAAGCCGCAGCTC	0.766														2183	0.435903	0.4539	0.402	5008	,	,		3514	0.3075		0.4443	False		,,,				2504	0.5593																0								ENSG00000070540			1018,1940		351,316,812						2.1	1.0		dbSNP_134	5	2379,3493		815,749,1372	no	utr-5	WIPI1	NM_017983.5		1166,1065,2184	A1A1,A1R,RR		40.5143,34.4151,38.4711				3397,5433				WIPI1	SO:0001631	upstream_gene_variant	0				HGNC		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9			17.37:g.66453573_66453581delGCCCGGGAA	Exception_encountered	Somatic	NA	NA	NA		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IXM5|Q9NWF8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262139.5	37	NULL	CCDS11677.1	17																																																																																			-	-		0.766	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPI1	protein_coding	OTTHUMT00000448739.1	GCCCGGGAA	NM_017983			66453581	-1	no_errors	ENST00000586815	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000:0.999:0.975:0.979:0.991:0.991:0.998	-
TRRAP	8295	genome.wustl.edu	37	7	98602905	98602905	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr7:98602905C>T	ENST00000359863.4	+	68	10854	c.10645C>T	c.(10645-10647)Ctg>Ttg	p.L3549L	TRRAP_ENST00000355540.3_Silent_p.L3520L|TRRAP_ENST00000446306.3_Silent_p.L3538L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3549	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTTGCAGCTGCTGCGTCTGCT	0.557																																																	0								ENSG00000196367						95.0	86.0	89.0					7																	98602905		2203	4300	6503	TRRAP	SO:0001819	synonymous_variant	0			-	HGNC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10645C>T	7.37:g.98602905C>T		Somatic	0	36	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L3549	ENST00000359863.4	37	c.10645	CCDS59066.1	7																																																																																			-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.557	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	C	NM_003496	-		98602905	+1	no_errors	ENST00000359863	ensembl	human	known	74_37	silent	SNP	1.000	T
PCDHGA7	56108	genome.wustl.edu	37	5	140763249	140763249	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr5:140763249G>A	ENST00000518325.1	+	1	783	c.783G>A	c.(781-783)ctG>ctA	p.L261L	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	261	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACAAGACTGCTCACGGTAC	0.483																																																	0								ENSG00000253537						49.0	49.0	49.0					5																	140763249		2029	4188	6217	PCDHGA7	SO:0001819	synonymous_variant	0			-	HGNC	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.783G>A	5.37:g.140763249G>A		Somatic	0	66	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2RN87|Q9Y5D0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L261	ENST00000518325.1	37	c.783	CCDS54927.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.483	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	protein_coding	OTTHUMT00000374744.1	G	NM_018920	-		140763249	+1	no_errors	ENST00000518325	ensembl	human	known	74_37	silent	SNP	0.001	A
CHST10	9486	genome.wustl.edu	37	2	101014550	101014550	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:101014550C>A	ENST00000264249.3	-	5	632	c.247G>T	c.(247-249)Gag>Tag	p.E83*	CHST10_ENST00000409701.1_Nonsense_Mutation_p.E83*|CHST10_ENST00000542617.1_Nonsense_Mutation_p.E131*	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	83					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						TCCAGGCGCTCCATGTAGACC	0.547																																																	0								ENSG00000115526						124.0	126.0	125.0					2																	101014550		2203	4300	6503	CHST10	SO:0001587	stop_gained	0			-	HGNC	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.247G>T	2.37:g.101014550C>A	ENSP00000264249:p.Glu83*	Somatic	0	33	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q53T18	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.E131*	ENST00000264249.3	37	c.391	CCDS2047.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275765	0.80580	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474	.	.	.	5.59	2.75	0.32379	.	0.458224	0.24490	N	0.038064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-24.0115	16.6223	0.84933	0.0:0.5775:0.4225:0.0	.	.	.	.	X	83;131;83;83;83;131;83	.	ENSP00000264249:E83X	E	-	1	0	CHST10	100380982	1.000000	0.71417	0.927000	0.36925	0.950000	0.60333	1.243000	0.32767	0.274000	0.22072	0.655000	0.94253	GAG	-	NULL		0.547	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST10	protein_coding	OTTHUMT00000253162.1	C	NM_004854	-		101014550	-1	no_errors	ENST00000542617	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZNF234	10780	genome.wustl.edu	37	19	44661971	44661971	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:44661971G>T	ENST00000426739.2	+	6	2060	c.1802G>T	c.(1801-1803)tGt>tTt	p.C601F	ZNF234_ENST00000592437.1_Missense_Mutation_p.C601F	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	601					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TGTGGGGAGTGTGGGAAGCAC	0.473																																																	0								ENSG00000263002						127.0	135.0	133.0					19																	44661971		2192	4296	6488	ZNF234	SO:0001583	missense	0			-	HGNC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1802G>T	19.37:g.44661971G>T	ENSP00000400878:p.Cys601Phe	Somatic	0	58	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C601F	ENST00000426739.2	37	c.1802	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	G	16.71	3.200009	0.58126	.	.	ENSG00000167380	ENST00000426739	D	0.85861	-2.04	4.11	4.11	0.48088	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95043	0.8395	H	0.97682	4.055	0.38076	D	0.936525	D	0.89917	1.0	D	0.91635	0.999	D	0.97849	1.0273	9	0.87932	D	0	.	15.6391	0.76981	0.0:0.0:1.0:0.0	.	601	Q14588	ZN234_HUMAN	F	601	ENSP00000400878:C601F	ENSP00000400878:C601F	C	+	2	0	ZNF226	49353811	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	4.775000	0.62346	2.278000	0.76064	0.585000	0.79938	TGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.473	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	protein_coding	OTTHUMT00000460586.2	G		-		44661971	+1	no_errors	ENST00000426739	ensembl	human	known	74_37	missense	SNP	1.000	T
CHST1	8534	genome.wustl.edu	37	11	45670506	45670507	+	3'UTR	INS	-	-	T	rs199768059		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr11:45670506_45670507insT	ENST00000308064.2	-	0	2637_2638				RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'UTR	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1						carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CTGATCCACTCTTTTTTTTTCT	0.386																																																	0								ENSG00000175264																																			CHST1	SO:0001624	3_prime_UTR_variant	0				HGNC	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.*732->A	11.37:g.45670515_45670515dupT		Somatic	0	41	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	D3DQP2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308064.2	37	NULL	CCDS7913.1	11																																																																																			-	-		0.386	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	protein_coding	OTTHUMT00000390127.1	-	NM_003654			45670507	-1	no_errors	ENST00000533673	ensembl	human	known	74_37	rna	INS	0.924:0.922	T
NCOA6	23054	genome.wustl.edu	37	20	33345721	33345723	+	In_Frame_Del	DEL	TGC	TGC	-	rs546356291	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr20:33345721_33345723delTGC	ENST00000374796.2	-	8	3398_3400	c.828_830delGCA	c.(826-831)cagcaa>caa	p.276_277QQ>Q	NCOA6_ENST00000359003.2_In_Frame_Del_p.276_277QQ>Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	276	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ttgctgttgttgctgctgctgct	0.537																																																	0								ENSG00000198646																																			NCOA6	SO:0001651	inframe_deletion	0				HGNC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.828_830delGCA	20.37:g.33345730_33345732delTGC	ENSP00000363929:p.Gln285del	Somatic	0	37	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q280in_frame_del	ENST00000374796.2	37	c.830_828	CCDS13241.1	20																																																																																			-	NULL		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	TGC	NM_014071			33345723	-1	no_errors	ENST00000359003	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.999	-
PAPPA2	60676	genome.wustl.edu	37	1	176564098	176564098	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:176564098A>T	ENST00000367662.3	+	3	2522	c.1358A>T	c.(1357-1359)gAc>gTc	p.D453V	PAPPA2_ENST00000367661.3_Missense_Mutation_p.D453V	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	453	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAAGCGACTGACTTGGTCCTG	0.547																																																	0								ENSG00000116183						100.0	105.0	103.0					1																	176564098		2111	4229	6340	PAPPA2	SO:0001583	missense	0			-	HGNC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1358A>T	1.37:g.176564098A>T	ENSP00000356634:p.Asp453Val	Somatic	0	24	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D453V	ENST00000367662.3	37	c.1358	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	A	0.054	-1.240415	0.01493	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.30182	4.75;1.54	5.08	3.19	0.36642	.	1.258880	0.05311	N	0.524751	T	0.16896	0.0406	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.08055	0.003;0.001	T	0.26292	-1.0107	10	0.27082	T	0.32	-0.1658	5.858	0.18730	0.1618:0.6777:0.0:0.1604	.	453;453	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	V	453	ENSP00000356634:D453V;ENSP00000356633:D453V	ENSP00000356633:D453V	D	+	2	0	PAPPA2	174830721	0.000000	0.05858	0.012000	0.15200	0.008000	0.06430	0.200000	0.17257	0.524000	0.28502	-0.219000	0.12488	GAC	-	NULL		0.547	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	A		-		176564098	+1	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	SNP	0.000	T
FSCB	84075	genome.wustl.edu	37	14	44976143	44976143	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:44976143G>C	ENST00000340446.4	-	1	339	c.48C>G	c.(46-48)caC>caG	p.H16Q	RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	16						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GTATGGCCATGTGTTTCTTTT	0.428																																																	0								ENSG00000189139						286.0	269.0	275.0					14																	44976143		2203	4300	6503	FSCB	SO:0001583	missense	0			-	HGNC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.48C>G	14.37:g.44976143G>C	ENSP00000344579:p.His16Gln	Somatic	0	76	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	58	23.68	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H16Q	ENST00000340446.4	37	c.48	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	G	0.624	-0.819838	0.02776	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.12672	2.66	5.49	-2.18	0.07037	.	.	.	.	.	T	0.06234	0.0161	L	0.28115	0.83	0.09310	N	1	B	0.33841	0.428	B	0.29077	0.098	T	0.34403	-0.9830	9	0.26408	T	0.33	3.7506	1.0853	0.01651	0.2847:0.2678:0.3108:0.1367	.	16	Q5H9T9	FSCB_HUMAN	Q	16	ENSP00000344579:H16Q	ENSP00000344579:H16Q	H	-	3	2	FSCB	44045893	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.236000	0.09003	-0.258000	0.09446	0.555000	0.69702	CAC	-	NULL		0.428	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	protein_coding	OTTHUMT00000276788.1	G	NM_032135	-		44976143	-1	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	SNP	0.000	C
BCO1	53630	genome.wustl.edu	37	16	81323977	81323977	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr16:81323977C>T	ENST00000258168.2	+	11	1900	c.1439C>T	c.(1438-1440)tCt>tTt	p.S480F	BCMO1_ENST00000425577.2_Missense_Mutation_p.S411F	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GCCATTGTCTCTACTGATCCC	0.448																																																	0								ENSG00000135697						77.0	74.0	75.0					16																	81323977		2202	4300	6502	BCMO1	SO:0001583	missense	0			-	HGNC																												ENST00000258168.2:c.1439C>T	16.37:g.81323977C>T	ENSP00000258168:p.Ser480Phe	Somatic	0	66	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carotenoid_Oase	p.S480F	ENST00000258168.2	37	c.1439	CCDS10934.1	16	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552627	0.86127	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.95001	-3.58;-3.58	6.0	6.0	0.97389	.	0.256761	0.39909	N	0.001227	D	0.97324	0.9125	M	0.80028	2.48	0.44762	D	0.997763	D;D	0.71674	0.998;0.988	D;P	0.71414	0.973;0.888	D	0.97323	0.9945	10	0.72032	D	0.01	-26.1679	19.331	0.94288	0.0:1.0:0.0:0.0	.	411;480	E7EM88;Q9HAY6	.;BCDO1_HUMAN	F	480;411	ENSP00000258168:S480F;ENSP00000400586:S411F	ENSP00000258168:S480F	S	+	2	0	BCMO1	79881478	0.999000	0.42202	0.889000	0.34880	0.927000	0.56198	4.427000	0.59888	2.868000	0.98415	0.555000	0.69702	TCT	-	pfam_Carotenoid_Oase		0.448	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	protein_coding	OTTHUMT00000269056.1	C		-		81323977	+1	no_errors	ENST00000258168	ensembl	human	known	74_37	missense	SNP	0.997	T
ZAK	51776	genome.wustl.edu	37	2	173955845	173955845	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:173955845G>T	ENST00000375213.3	+	2	164	c.86G>T	c.(85-87)aGt>aTt	p.S29I	MLTK_ENST00000338983.3_Missense_Mutation_p.S29I|MLTK_ENST00000431503.2_Intron|MLTK_ENST00000539448.1_Missense_Mutation_p.S29I|MLTK_ENST00000409176.2_Missense_Mutation_p.S29I	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		29	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										AGTTTTGGGAGTGTTTATCGA	0.423																																																	0								ENSG00000091436						89.0	91.0	91.0					2																	173955845		2203	4300	6503	MLTK	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000375213.3:c.86G>T	2.37:g.173955845G>T	ENSP00000364361:p.Ser29Ile	Somatic	0	63	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S29I	ENST00000375213.3	37	c.86	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962946	0.92791	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000375213;ENST00000422149	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86994	0.6067	N	0.25380	0.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.992;1.0;0.995;0.996	D	0.88106	0.2822	10	0.66056	D	0.02	.	19.7604	0.96314	0.0:0.0:1.0:0.0	.	29;29;29;29	Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;MLTK_HUMAN;.;.	I	29	ENSP00000439414:S29I;ENSP00000387259:S29I;ENSP00000340257:S29I;ENSP00000364361:S29I;ENSP00000411923:S29I	ENSP00000340257:S29I	S	+	2	0	AC013461.1	173664091	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.675000	0.91044	0.655000	0.94253	AGT	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.423	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	protein_coding	OTTHUMT00000255401.1	G		-		173955845	+1	no_errors	ENST00000375213	ensembl	human	known	74_37	missense	SNP	1.000	T
SBNO2	22904	genome.wustl.edu	37	19	1112841	1112847	+	Frame_Shift_Del	DEL	CTTCTCC	CTTCTCC	-	rs200086865	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	CTTCTCC	CTTCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:1112841_1112847delCTTCTCC	ENST00000361757.3	-	20	2586_2592	c.2349_2355delGGAGAAG	c.(2347-2355)agggagaagfs	p.REK783fs	SBNO2_ENST00000438103.2_Frame_Shift_Del_p.REK726fs|SBNO2_ENST00000587024.1_Frame_Shift_Del_p.REK773fs	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	783					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAAGCGCTGCTTCTCCCTGAGGTTCA	0.696																																																	0								ENSG00000064932																																			SBNO2	SO:0001589	frameshift_variant	0				HGNC	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.2349_2355delGGAGAAG	19.37:g.1112841_1112847delCTTCTCC	ENSP00000354733:p.Arg783fs	Somatic	NA	NA	NA		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.R783fs	ENST00000361757.3	37	c.2355_2349	CCDS45894.1	19																																																																																			-	NULL		0.696	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	protein_coding	OTTHUMT00000458065.2	CTTCTCC	NM_014963			1112847	-1	no_errors	ENST00000361757	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
KANK1	23189	genome.wustl.edu	37	9	732475	732477	+	In_Frame_Del	DEL	GAG	GAG	-	rs569686873|rs370051574		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:732475_732477delGAG	ENST00000382303.1	+	10	3755_3757	c.3103_3105delGAG	c.(3103-3105)gagdel	p.E1039del	KANK1_ENST00000382297.2_In_Frame_Del_p.E1039del|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_In_Frame_Del_p.E881del	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1039					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TCTTGAAGAAGAGGAGGAGGAGG	0.463																																																	0								ENSG00000107104		,	16,0,4248		0,0,16,0,0,2116					,	5.3	1.0		dbSNP_132	135	3,2,8249		0,0,3,1,0,4123	no	codingComplex,codingComplex	KANK1	NM_153186.3,NM_015158.2	,	0,0,19,1,0,6239	A1A1,A1A2,A1R,A2A2,A2R,RR		0.0606,0.3752,0.1678	,	,		19,2,12497				KANK1	SO:0001651	inframe_deletion	0				HGNC	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3103_3105delGAG	9.37:g.732484_732486delGAG	ENSP00000371740:p.Glu1039del	Somatic	0	54	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1038in_frame_del	ENST00000382303.1	37	c.3103_3105	CCDS34976.1	9																																																																																			-	NULL		0.463	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	protein_coding	OTTHUMT00000051484.2	GAG	NM_015158			732477	+1	no_errors	ENST00000382297	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
GVINP1	387751	genome.wustl.edu	37	11	6735924	6735924	+	RNA	SNP	T	T	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr11:6735924T>A	ENST00000526769.3	-	0	7280					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										ACCTGCAAATTTTTTCTGATA	0.388																																																	0								ENSG00000254838																																			GVINP1			0			-	HGNC	BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6735924T>A		Somatic	0	75	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	21	59.62	A6NFL2|Q9H8N5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			-	-		0.388	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	pseudogene	OTTHUMT00000386960.3	T	NR_003945	-		6735924	-1	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	SNP	0.878	A
FOLH1B	219595	genome.wustl.edu	37	11	89385760	89385760	+	RNA	SNP	C	C	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr11:89385760C>A	ENST00000532352.1	+	0	397							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TCAAGGAATGCCAGAGGTAAA	0.363																																																	0								ENSG00000134612																																			FOLH1B			0			-	HGNC	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89385760C>A		Somatic	0	107	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	29	61.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			-	-		0.363	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	pseudogene	OTTHUMT00000395421.1	C	NM_153696	-		89385760	+1	no_errors	ENST00000526379	ensembl	human	known	74_37	rna	SNP	1.000	A
ANO2	57101	genome.wustl.edu	37	12	5908718	5908718	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr12:5908718G>A	ENST00000356134.5	-	11	1072	c.1001C>T	c.(1000-1002)gCg>gTg	p.A334V	ANO2_ENST00000546188.1_Missense_Mutation_p.A334V|ANO2_ENST00000327087.8_Missense_Mutation_p.A333V	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	338					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TCCATAGCGCGCCCATTCTTG	0.418																																																	0								ENSG00000047617						76.0	69.0	71.0					12																	5908718		1855	4110	5965	ANO2	SO:0001583	missense	0			-	HGNC	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1001C>T	12.37:g.5908718G>A	ENSP00000348453:p.Ala334Val	Somatic	0	94	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00	C4N787|Q9H847	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.A334V	ENST00000356134.5	37	c.1001		12	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845190	0.71603	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.70282	-0.47;-0.47;-0.47	5.92	5.92	0.95590	.	0.050707	0.85682	D	0.000000	D	0.89584	0.6757	H	0.95294	3.65	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.91836	0.5479	10	0.87932	D	0	.	19.3181	0.94224	0.0:0.0:1.0:0.0	.	333	Q9NQ90-3	.	V	333;334;334;338	ENSP00000314048:A333V;ENSP00000348453:A334V;ENSP00000440981:A334V	ENSP00000314048:A333V	A	-	2	0	ANO2	5778979	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	6.845000	0.75394	2.810000	0.96702	0.585000	0.79938	GCG	-	NULL		0.418	ANO2-001	KNOWN	basic	protein_coding	ANO2	protein_coding	OTTHUMT00000399019.4	G	NM_020373	-		5908718	-1	no_errors	ENST00000356134	ensembl	human	known	74_37	missense	SNP	1.000	A
PLEKHG5	57449	genome.wustl.edu	37	1	6529183	6529185	+	In_Frame_Del	DEL	TCC	TCC	-	rs113541584|rs375111412	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr1:6529183_6529185delTCC	ENST00000400915.3	-	20	2400_2402	c.2334_2336delGGA	c.(2332-2337)gaggaa>gaa	p.778_779EE>E	PLEKHG5_ENST00000377748.1_In_Frame_Del_p.799_800EE>E|TNFRSF25_ENST00000351959.5_5'Flank|PLEKHG5_ENST00000340850.5_In_Frame_Del_p.722_723EE>E|PLEKHG5_ENST00000400913.1_In_Frame_Del_p.722_723EE>E|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000377740.3_In_Frame_Del_p.799_800EE>E|PLEKHG5_ENST00000377732.1_In_Frame_Del_p.759_760EE>E|PLEKHG5_ENST00000377728.3_In_Frame_Del_p.722_723EE>E|PLEKHG5_ENST00000377737.2_In_Frame_Del_p.722_723EE>E|PLEKHG5_ENST00000377725.1_In_Frame_Del_p.722_723EE>E|PLEKHG5_ENST00000544978.1_In_Frame_Del_p.722_723EE>E|PLEKHG5_ENST00000537245.1_In_Frame_Del_p.801_802EE>E|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000535355.1_In_Frame_Del_p.791_792EE>E	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	778	Glu-rich.			Missing (in Ref. 6; BAC77354). {ECO:0000305}.	apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		Gtcctcgccttcctcctcctcct	0.631														487	0.0972444	0.1906	0.0663	5008	,	,		23598	0.004		0.0646	False		,,,				2504	0.1227																0								ENSG00000171680																																			PLEKHG5	SO:0001651	inframe_deletion	0				HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2334_2336delGGA	1.37:g.6529192_6529194delTCC	ENSP00000383706:p.Glu779del	Somatic	0	27	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E802in_frame_del	ENST00000400915.3	37	c.2405_2403	CCDS41241.1	1																																																																																			-	NULL		0.631	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	TCC	NM_020631			6529185	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	in_frame_del	DEL	0.152:0.271:0.391	-
ITPK1	3705	genome.wustl.edu	37	14	93537319	93537319	+	Intron	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr14:93537319G>T	ENST00000267615.6	-	3	294				ITPK1_ENST00000556603.2_Intron|ITPK1-AS1_ENST00000553639.1_RNA|ITPK1_ENST00000555495.1_Intron|ITPK1_ENST00000354313.3_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase						blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GCACGGGGCTGAGGAAACAGG	0.542																																																	0								ENSG00000258730						205.0	175.0	184.0					14																	93537319		692	1591	2283	ITPK1-AS1	SO:0001627	intron_variant	0			-	HGNC	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.120+5620C>A	14.37:g.93537319G>T		Somatic	0	46	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	25	37.50	Q9BTL6|Q9H2E7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267615.6	37	NULL	CCDS9907.1	14																																																																																			-	-		0.542	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1-AS1	protein_coding	OTTHUMT00000412421.2	G	NM_014216	-		93537319	+1	no_errors	ENST00000553639	ensembl	human	known	74_37	rna	SNP	0.107	T
SASH1	23328	genome.wustl.edu	37	6	148852780	148852780	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr6:148852780G>A	ENST00000367467.3	+	13	2022	c.1547G>A	c.(1546-1548)aGt>aAt	p.S516N		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	516					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		AGTTCTCTCAGTGGGCAGAGC	0.493																																																	0								ENSG00000111961						80.0	71.0	74.0					6																	148852780		2203	4300	6503	SASH1	SO:0001583	missense	0			-	HGNC	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1547G>A	6.37:g.148852780G>A	ENSP00000356437:p.Ser516Asn	Somatic	0	70	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	18	62.50	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.S516N	ENST00000367467.3	37	c.1547	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	29.3	4.997660	0.93227	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.64991	-0.13	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.78207	0.4247	M	0.80746	2.51	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.80939	-0.1158	10	0.72032	D	0.01	-18.095	19.0299	0.92952	0.0:0.0:1.0:0.0	.	497;516	Q6P4R9;O94885	.;SASH1_HUMAN	N	516;277	ENSP00000356437:S516N	ENSP00000356437:S516N	S	+	2	0	SASH1	148894473	1.000000	0.71417	0.972000	0.41901	0.950000	0.60333	9.476000	0.97823	2.503000	0.84419	0.655000	0.94253	AGT	-	pfam_rSAM/SH3_domain-containing		0.493	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	protein_coding	OTTHUMT00000042619.1	G	NM_015278	-		148852780	+1	no_errors	ENST00000367467	ensembl	human	known	74_37	missense	SNP	1.000	A
GFRA3	2676	genome.wustl.edu	37	5	137593567	137593567	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr5:137593567G>A	ENST00000274721.3	-	4	792	c.546C>T	c.(544-546)taC>taT	p.Y182Y	GFRA3_ENST00000378362.3_Silent_p.Y151Y	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	182					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACGCCTCCCCGTAGGCCTTGC	0.652																																																	0								ENSG00000146013						29.0	31.0	30.0					5																	137593567		2203	4300	6503	GFRA3	SO:0001819	synonymous_variant	0			-	HGNC	AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.546C>T	5.37:g.137593567G>A		Somatic	0	20	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	6	62.50	B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GDNF/GAS1,smart_GDNF/GAS1,prints_GDNF_rcpt,prints_GDNF_rcpt_A3	p.Y182	ENST00000274721.3	37	c.546	CCDS4201.1	5																																																																																			-	pfam_GDNF/GAS1,smart_GDNF/GAS1		0.652	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GFRA3	protein_coding	OTTHUMT00000251277.1	G	NM_001496	-		137593567	-1	no_errors	ENST00000274721	ensembl	human	known	74_37	silent	SNP	0.602	A
SHROOM4	57477	genome.wustl.edu	37	X	50350911	50350911	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chrX:50350911C>T	ENST00000289292.7	-	6	3514	c.3231G>A	c.(3229-3231)agG>agA	p.R1077R	SHROOM4_ENST00000376020.2_Silent_p.R1077R|SHROOM4_ENST00000460112.3_Silent_p.R961R			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1077					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					AGAGCTCCCTCCTATGCTGCC	0.627																																																	0								ENSG00000158352						41.0	38.0	39.0					X																	50350911		2203	4300	6503	SHROOM4	SO:0001819	synonymous_variant	0			-	HGNC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3231G>A	X.37:g.50350911C>T		Somatic	0	48	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	65	14.47	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R1077	ENST00000289292.7	37	c.3231	CCDS35277.1	X																																																																																			-	NULL		0.627	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	protein_coding	OTTHUMT00000056564.4	C	NM_020717	-		50350911	-1	no_errors	ENST00000289292	ensembl	human	known	74_37	silent	SNP	0.008	T
DPH6	89978	genome.wustl.edu	37	15	35530195	35530195	+	Intron	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr15:35530195G>A	ENST00000560386.1	-	4	200				ANP32AP1_ENST00000560832.1_RNA			Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										ATGAAGAAGAGCTCCGTGAAG	0.443																																																	0								ENSG00000259516																																			ANP32AP1	SO:0001627	intron_variant	0			-	HGNC		CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000560386.1:c.3239-17412C>T	15.37:g.35530195G>A		Somatic	0	80	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	50	24.24	B3KWG1|Q96HJ6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560386.1	37	NULL		15																																																																																			-	-		0.443	DPH6-003	KNOWN	basic	processed_transcript	ANP32AP1	protein_coding	OTTHUMT00000417824.1	G	NM_080650	-		35530195	+1	no_errors	ENST00000560832	ensembl	human	known	74_37	rna	SNP	0.056	A
FAT1	2195	genome.wustl.edu	37	4	187629482	187629482	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr4:187629482G>A	ENST00000441802.2	-	2	1709	c.1500C>T	c.(1498-1500)taC>taT	p.Y500Y		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	500	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGCGATACTGTATGTCACGT	0.488										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						143.0	136.0	139.0					4																	187629482		2032	4172	6204	FAT1	SO:0001819	synonymous_variant	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1500C>T	4.37:g.187629482G>A		Somatic	0	41	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	31	40.38		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Y500	ENST00000441802.2	37	c.1500	CCDS47177.1	4																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.488	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	G	NM_005245	-		187629482	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	SNP	1.000	A
TOPORS	10210	genome.wustl.edu	37	9	32543162	32543162	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr9:32543162G>T	ENST00000360538.2	-	3	1477	c.1361C>A	c.(1360-1362)gCc>gAc	p.A454D	TOPORS_ENST00000379858.1_Missense_Mutation_p.A389D	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	454	Interaction with SUMO1.|Required for sumoylation and localization to discrete nuclear foci.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CTGAGACGTGGCTCCTCCTGT	0.403																																																	0								ENSG00000197579						143.0	129.0	134.0					9																	32543162		2203	4300	6503	TOPORS	SO:0001583	missense	0			-	HGNC	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1361C>A	9.37:g.32543162G>T	ENSP00000353735:p.Ala454Asp	Somatic	0	50	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A454D	ENST00000360538.2	37	c.1361	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	G	0.844	-0.740878	0.03088	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.15718	2.4;2.41	5.83	4.94	0.65067	.	0.826651	0.10440	N	0.674366	T	0.12178	0.0296	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.21314	-1.0249	10	0.38643	T	0.18	0.1331	8.9182	0.35594	0.0757:0.0:0.7766:0.1477	.	454	Q9NS56	TOPRS_HUMAN	D	454;389	ENSP00000353735:A454D;ENSP00000369187:A389D	ENSP00000353735:A454D	A	-	2	0	TOPORS	32533162	0.127000	0.22367	0.605000	0.28930	0.026000	0.11368	2.407000	0.44565	1.481000	0.48307	0.644000	0.83932	GCC	-	NULL		0.403	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	protein_coding	OTTHUMT00000052007.1	G	NM_005802	-		32543162	-1	no_errors	ENST00000360538	ensembl	human	known	74_37	missense	SNP	0.001	T
WDFY4	57705	genome.wustl.edu	37	10	49934024	49934024	+	Silent	SNP	G	G	A			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr10:49934024G>A	ENST00000325239.5	+	5	717	c.690G>A	c.(688-690)gaG>gaA	p.E230E	WDFY4_ENST00000360890.2_Silent_p.E230E|WDFY4_ENST00000413659.2_Silent_p.E230E	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	230						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GCCTTCGGGAGCACAGCTGCT	0.567																																																	0								ENSG00000128815						63.0	57.0	58.0					10																	49934024		692	1591	2283	WDFY4	SO:0001819	synonymous_variant	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.690G>A	10.37:g.49934024G>A		Somatic	0	20	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E230	ENST00000325239.5	37	c.690	CCDS44385.1	10																																																																																			-	superfamily_ARM-type_fold		0.567	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		G	XM_033379	-		49934024	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	SNP	0.988	A
MERTK	10461	genome.wustl.edu	37	2	112722787	112722787	+	Silent	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:112722787C>T	ENST00000295408.4	+	5	1034	c.777C>T	c.(775-777)gtC>gtT	p.V259V	MERTK_ENST00000409780.1_Silent_p.V83V|MERTK_ENST00000421804.2_Silent_p.V259V			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	259	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						AGATGGCGGTCTTCAGTTGTG	0.507																																																	0								ENSG00000153208						125.0	100.0	108.0					2																	112722787		2203	4300	6503	MERTK	SO:0001819	synonymous_variant	0			-	HGNC	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.777C>T	2.37:g.112722787C>T		Somatic	0	44	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.77	Q9HBB4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V259	ENST00000295408.4	37	c.777	CCDS2094.1	2																																																																																			-	smart_Ig_sub,pfscan_Ig-like_dom		0.507	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	protein_coding	OTTHUMT00000254046.2	C		-		112722787	+1	no_errors	ENST00000295408	ensembl	human	known	74_37	silent	SNP	0.449	T
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr12:118604652_118604653insACAC	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000537952.1_Intron|TAOK3_ENST00000419821.2_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGT	12.37:g.118604657_118604660dupACAC		Somatic	0	10	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	-	NM_016281			118604653	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	INS	0.002:0.000	ACAC
ITPRIPL1	150771	genome.wustl.edu	37	2	96992793	96992795	+	In_Frame_Del	DEL	GAG	GAG	-	rs368798001		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr2:96992793_96992795delGAG	ENST00000439118.2	+	3	675_677	c.424_426delGAG	c.(424-426)gagdel	p.E147del	ITPRIPL1_ENST00000542887.1_In_Frame_Del_p.E139del|ITPRIPL1_ENST00000536814.1_In_Frame_Del_p.E139del|ITPRIPL1_ENST00000361124.4_In_Frame_Del_p.E155del	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	147						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCCAGCAGTGAGGAGGAGGAGG	0.532																																																	0								ENSG00000198885																																			ITPRIPL1	SO:0001651	inframe_deletion	0				HGNC		CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.424_426delGAG	2.37:g.96992802_96992804delGAG	ENSP00000389308:p.Glu147del	Somatic	0	22	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	F5H1L8|Q8NE61	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.E153in_frame_del	ENST00000439118.2	37	c.448_450	CCDS46360.1	2																																																																																			-	NULL		0.532	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	ITPRIPL1	protein_coding	OTTHUMT00000338896.1	GAG	NM_178495			96992795	+1	no_errors	ENST00000361124	ensembl	human	known	74_37	in_frame_del	DEL	0.991:0.987:0.325	-
PTPRZ1	5803	genome.wustl.edu	37	7	121513382	121513383	+	5'UTR	INS	-	-	CA	rs35113798|rs386360108|rs3069073|rs4988976|rs370737965	byFrequency	TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr7:121513382_121513383insCA	ENST00000393386.2	+	0	240_241				PTPRZ1_ENST00000449182.1_5'Flank	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						tctctctctctcacacacacac	0.49														1511	0.301717	0.3374	0.2464	5008	,	,		12284	0.2679		0.2753	False		,,,				2504	0.3548																0								ENSG00000106278																																			PTPRZ1	SO:0001623	5_prime_UTR_variant	0				HGNC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.-171->CA	7.37:g.121513391_121513392dupCA		Somatic	0	12	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	A4D0W5|C9JFM0|O76043|Q9UDR6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393386.2	37	NULL	CCDS34740.1	7																																																																																			-	-		0.490	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	-	NM_002851			121513383	+1	no_errors	ENST00000471837	ensembl	human	known	74_37	rna	INS	0.000:0.002	CA
COL9A3	1299	genome.wustl.edu	37	20	61467792	61467792	+	Intron	SNP	C	C	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr20:61467792C>T	ENST00000343916.3	+	29	1551				COL9A3_ENST00000462700.1_Intron	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					ACCGAGGCTGCCGCCCCCATG	0.582																																																	0								ENSG00000092758						29.0	33.0	32.0					20																	61467792		2203	4300	6503	COL9A3	SO:0001627	intron_variant	0			-	HGNC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1549-38C>T	20.37:g.61467792C>T		Somatic	0	34	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q13681|Q9H4G9|Q9UPE2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000343916.3	37	NULL	CCDS13505.1	20																																																																																			-	-		0.582	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	protein_coding	OTTHUMT00000080071.2	C	NM_001853	-		61467792	+1	no_errors	ENST00000467819	ensembl	human	putative	74_37	rna	SNP	0.007	T
PTEN	5728	genome.wustl.edu	37	10	89692905	89692905	+	Missense_Mutation	SNP	G	G	A	rs121913292|rs121909229		TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr10:89692905G>A	ENST00000371953.3	+	5	1746	c.389G>A	c.(388-390)cGa>cAa	p.R130Q		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).|R -> L (in CWS1 and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes). {ECO:0000269|PubMed:9635567}.|R -> Q (in CWS1; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes). {ECO:0000269|PubMed:9915974}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R130Q(62)|p.0?(37)|p.R130fs*4(13)|p.R130L(12)|p.R130P(7)|p.?(5)|p.R55fs*1(5)|p.K128_R130del(3)|p.Y27fs*1(2)|p.A121_F145del(1)|p.R130fs*2(1)|p.T131fs*50(1)|p.F56fs*2(1)|p.K128fs*47(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGAAAGGGACGAACTGGTGTA	0.403	R130Q(JHUEM1_ENDOMETRIUM)|R130Q(MDAPCA2B_PROSTATE)|R130Q(MFE296_ENDOMETRIUM)|R130fs*4(AN3CA_ENDOMETRIUM)	31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	151	Substitution - Missense(81)|Whole gene deletion(37)|Deletion - Frameshift(23)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(1)	endometrium(77)|prostate(18)|central_nervous_system(16)|lung(7)|breast(7)|ovary(7)|skin(6)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|thyroid(2)|soft_tissue(2)|urinary_tract(1)	GRCh37	CM981670|CM991081	PTEN	M	rs121909229	ENSG00000171862						139.0	129.0	133.0					10																	89692905		2203	4300	6503	PTEN	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	-	HGNC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.389G>A	10.37:g.89692905G>A	ENSP00000361021:p.Arg130Gln	Somatic	0	122	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	34	66.00	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R130Q	ENST00000371953.3	37	c.389	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.637233	0.96693	.	.	ENSG00000171862	ENST00000371953	D	0.98345	-4.88	5.22	5.22	0.72569	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99378	0.9781	H	0.96889	3.9	0.80722	A	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98503	1.0615	8	.	.	.	-1.7685	18.7776	0.91918	0.0:0.0:1.0:0.0	.	130	P60484	PTEN_HUMAN	Q	130	ENSP00000361021:R130Q	.	R	+	2	0	PTEN	89682885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.429000	0.97481	2.411000	0.81874	0.655000	0.94253	CGA	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ		0.403	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	protein_coding	OTTHUMT00000049241.1	G	NM_000314	rs121909229		89692905	+1	no_errors	ENST00000371953	ensembl	human	known	74_37	missense	SNP	1.000	A
UQCRC1	7384	genome.wustl.edu	37	3	48641757	48641757	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr3:48641757T>C	ENST00000203407.5	-	5	951	c.535A>G	c.(535-537)Atg>Gtg	p.M179V		NM_003365.2	NP_003356.2	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	179					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to alkaloid (GO:0043279)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ACATCTCGCATAGATGCATCA	0.527																																					NSCLC(81;1112 1427 27031 32409 45529)												0								ENSG00000010256						166.0	133.0	144.0					3																	48641757		2203	4300	6503	UQCRC1	SO:0001583	missense	0			-	HGNC	BC009586	CCDS2774.1	3p21	2011-07-04			ENSG00000010256	ENSG00000010256	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12585	protein-coding gene	gene with protein product		191328				8407948	Standard	NM_003365		Approved	D3S3191, QCR1, UQCR1	uc003cub.1	P31930	OTTHUMG00000133539	ENST00000203407.5:c.535A>G	3.37:g.48641757T>C	ENSP00000203407:p.Met179Val	Somatic	0	30	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	14	50.00	B2R7R8|Q96DD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.M179V	ENST00000203407.5	37	c.535	CCDS2774.1	3	.	.	.	.	.	.	.	.	.	.	T	10.27	1.304048	0.23736	.	.	ENSG00000010256	ENST00000203407	T	0.39787	1.06	5.83	-1.07	0.09968	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.517494	0.24282	N	0.039882	T	0.16471	0.0396	N	0.05012	-0.13	0.19575	N	0.999963	B;B	0.25743	0.001;0.133	B;B	0.27170	0.015;0.077	T	0.09357	-1.0678	10	0.40728	T	0.16	-10.0444	2.9677	0.05912	0.2381:0.0746:0.393:0.2943	.	64;179	B4DUL5;P31930	.;QCR1_HUMAN	V	179	ENSP00000203407:M179V	ENSP00000203407:M179V	M	-	1	0	UQCRC1	48616761	0.025000	0.19082	0.007000	0.13788	0.751000	0.42716	-0.292000	0.08332	-0.066000	0.12998	0.459000	0.35465	ATG	-	pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16		0.527	UQCRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC1	protein_coding	OTTHUMT00000257517.1	T	NM_003365	-		48641757	-1	no_errors	ENST00000203407	ensembl	human	known	74_37	missense	SNP	0.001	C
ANKLE1	126549	genome.wustl.edu	37	19	17396345	17396345	+	Silent	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr19:17396345G>T	ENST00000394458.3	+	7	1758	c.1482G>T	c.(1480-1482)cgG>cgT	p.R494R	ANKLE1_ENST00000598347.1_Silent_p.R468R|ANKLE1_ENST00000404085.1_Silent_p.R490R|ANKLE1_ENST00000594072.1_Silent_p.R457R|ANKLE1_ENST00000433424.2_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	494	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CGAGGGCCCGGCCATATGTCC	0.622																																																	0								ENSG00000160117						81.0	89.0	86.0					19																	17396345		2203	4300	6503	ANKLE1	SO:0001819	synonymous_variant	0			-	HGNC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1482G>T	19.37:g.17396345G>T		Somatic	0	53	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8VU82|Q8N8J8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_LEM_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_LEM/LEM-like_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_LEM_dom	p.R494	ENST00000394458.3	37	c.1482	CCDS12354.2	19																																																																																			-	NULL		0.622	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	protein_coding	OTTHUMT00000325392.2	G	NM_152363	-		17396345	+1	no_errors	ENST00000394458	ensembl	human	known	74_37	silent	SNP	0.963	T
LOC388813	388813	genome.wustl.edu	37	21	16015347	16015347	+	Silent	SNP	T	T	C			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr21:16015347T>C	ENST00000400562.1	-	2	181	c.132A>G	c.(130-132)gaA>gaG	p.E44E																	central_nervous_system(1)	1						TTGGTGTTTGTTCACTCTCTC	0.388																																																	0								ENSG00000243440																																			AF165138.7	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000400562.1:c.132A>G	21.37:g.16015347T>C		Somatic	0	86	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	54	34.94		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E44	ENST00000400562.1	37	c.132		21	.	.	.	.	.	.	.	.	.	.	T	4.247	0.044802	0.08196	.	.	ENSG00000243440	ENST00000442499;ENST00000389438	.	.	.	5.13	2.69	0.31865	.	.	.	.	.	T	0.26268	0.0641	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21381	-1.0247	4	.	.	.	.	4.4116	0.11436	0.1733:0.0944:0.0:0.7323	.	.	.	.	A	24;6	.	.	T	-	1	0	AF165138.7	14937218	0.011000	0.17503	0.001000	0.08648	0.086000	0.17979	1.086000	0.30853	0.339000	0.23719	0.528000	0.53228	ACA	-	NULL		0.388	AF165138.7-001	PUTATIVE	basic|appris_principal	protein_coding	LOC388813	protein_coding	OTTHUMT00000157908.1	T		-		16015347	-1	no_errors	ENST00000400562	ensembl	human	putative	74_37	silent	SNP	0.003	C
PRDM14	63978	genome.wustl.edu	37	8	70964471	70964471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8Y0-01A-11D-A417-09	TCGA-WK-A8Y0-10D-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efdaf8c2-1a45-4677-9eac-e5a8ab3dae46	f02bb3c1-15b5-43b8-a511-7e422b29cdbc	g.chr8:70964471G>T	ENST00000276594.2	-	8	1758	c.1557C>A	c.(1555-1557)tgC>tgA	p.C519*		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	519					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CACAGTACTTGCATTTGAAGG	0.517																																					NSCLC(129;99 1813 5906 40656 46114)												0								ENSG00000147596						158.0	147.0	151.0					8																	70964471		2203	4300	6503	PRDM14	SO:0001587	stop_gained	0			-	HGNC	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1557C>A	8.37:g.70964471G>T	ENSP00000276594:p.Cys519*	Somatic	0	35	0.00		0.6888471086445629	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q86UX9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.C519*	ENST00000276594.2	37	c.1557	CCDS6206.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.646192	0.98409	.	.	ENSG00000147596	ENST00000276594	.	.	.	6.08	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.9791	12.3226	0.54993	0.135:0.0:0.865:0.0	.	.	.	.	X	519	.	ENSP00000276594:C519X	C	-	3	2	PRDM14	71127025	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.815000	0.48018	1.590000	0.49995	0.655000	0.94253	TGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.517	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	protein_coding	OTTHUMT00000318505.1	G		-		70964471	-1	no_errors	ENST00000276594	ensembl	human	known	74_37	nonsense	SNP	1.000	T
