#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
UBR5	51366	genome.wustl.edu	37	8	103323643	103323643	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:103323643C>T	ENST00000520539.1	-	20	3106	c.2500G>A	c.(2500-2502)Gat>Aat	p.D834N	UBR5_ENST00000521922.1_Missense_Mutation_p.D828N|UBR5_ENST00000220959.4_Missense_Mutation_p.D834N	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	834					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TCCAGCCAATCGGGATCCCTT	0.398																																					Ovarian(131;96 1741 5634 7352 27489)												0								ENSG00000104517						126.0	126.0	126.0					8																	103323643		2203	4300	6503	UBR5	SO:0001583	missense	0			-	HGNC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2500G>A	8.37:g.103323643C>T	ENSP00000429084:p.Asp834Asn	Somatic	0	66	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_RCC1/BLIP-II,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.D834N	ENST00000520539.1	37	c.2500	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346187	0.82022	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.49720	0.77;0.77;0.77	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	N	0.11427	0.14	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68621	0.959;0.959	T	0.46679	-0.9174	10	0.17369	T	0.5	.	19.7693	0.96356	0.0:1.0:0.0:0.0	.	828;834	E7EMW7;O95071	.;UBR5_HUMAN	N	834;834;828	ENSP00000429084:D834N;ENSP00000220959:D834N;ENSP00000427819:D828N	ENSP00000220959:D834N	D	-	1	0	UBR5	103392819	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	7.814000	0.86154	2.669000	0.90835	0.561000	0.74099	GAT	-	NULL		0.398	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	protein_coding	OTTHUMT00000380075.2	C	NM_015902	-		103323643	-1	no_errors	ENST00000520539	ensembl	human	known	74_37	missense	SNP	1.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68038952	68038952	+	Missense_Mutation	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:68038952G>T	ENST00000329153.5	+	11	1818	c.1686G>T	c.(1684-1686)caG>caT	p.Q562H		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	562						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ACAAACTGCAGCGCACCTCAT	0.662																																																	0								ENSG00000054690						30.0	32.0	31.0					14																	68038952		2080	4209	6289	PLEKHH1	SO:0001583	missense	0			-	HGNC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1686G>T	14.37:g.68038952G>T	ENSP00000330278:p.Gln562His	Somatic	0	97	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.Q562H	ENST00000329153.5	37	c.1686	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152983	0.57259	.	.	ENSG00000054690	ENST00000329153	T	0.72725	-0.68	4.61	3.63	0.41609	.	0.203798	0.44902	D	0.000417	T	0.74053	0.3666	L	0.59436	1.845	0.80722	D	1	D;P	0.62365	0.991;0.529	P;B	0.58970	0.849;0.281	T	0.71958	-0.4435	10	0.37606	T	0.19	.	7.7587	0.28940	0.1662:0.0:0.8338:0.0	.	77;562	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	H	562	ENSP00000330278:Q562H	ENSP00000330278:Q562H	Q	+	3	2	PLEKHH1	67108705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.745000	0.47459	2.387000	0.81309	0.555000	0.69702	CAG	-	NULL		0.662	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	protein_coding	OTTHUMT00000412730.3	G	XM_031054	-		68038952	+1	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65268614	65268614	+	lincRNA	SNP	C	C	T	rs539201929		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:65268614C>T	ENST00000534336.1	+	0	3382				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AATAGATGACCTGTTTTTACT	0.373																																																	0								ENSG00000251562						61.0	67.0	65.0					11																	65268614		874	1988	2862	MALAT1			0			-	HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268614C>T		Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	23	47.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.373	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	C	NR_002819	-		65268614	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	SNP	0.000	T
UFL1	23376	genome.wustl.edu	37	6	96969559	96969578	+	5'Flank	DEL	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC	-	rs3841018|rs112373805|rs67707404	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:96969559_96969578delAACCCCCAGCGCCGCGGTAC	ENST00000369278.4	+	0	0				UFL1_ENST00000461673.1_3'UTR|UFL1-AS1_ENST00000430796.1_RNA	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										CGCCGGGAGGAACCCCCAGCGCCGCGGTACAACCACGGCA	0.7														677	0.135184	0.1036	0.1772	5008	,	,		14561	0.0387		0.2157	False		,,,				2504	0.1646																0								ENSG00000014123																																			UFL1	SO:0001631	upstream_gene_variant	0				HGNC	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238		6.37:g.96969559_96969578delAACCCCCAGCGCCGCGGTAC	Exception_encountered	Somatic	NA	NA	NA		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369278.4	37	NULL	CCDS5034.1	6																																																																																			-	-		0.700	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	protein_coding	OTTHUMT00000041557.1	AACCCCCAGCGCCGCGGTAC	NM_015323			96969578	+1	no_errors	ENST00000461673	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.001:0.001:0.003:0.006:0.006:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
RARB	5915	genome.wustl.edu	37	3	25622051	25622051	+	Missense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:25622051C>A	ENST00000404969.1	+	5	645	c.645C>A	c.(643-645)gaC>gaA	p.D215E	RARB_ENST00000458646.1_Missense_Mutation_p.D96E|RARB_ENST00000330688.4_Missense_Mutation_p.D208E|RARB_ENST00000437042.2_Missense_Mutation_p.D96E|RARB_ENST00000462272.1_3'UTR			P10826	RARB_HUMAN	retinoic acid receptor, beta	215	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCAGTGCTGACCATCGAGTCC	0.473																																																	0								ENSG00000077092						93.0	86.0	88.0					3																	25622051		2203	4300	6503	RARB	SO:0001583	missense	0			-	HGNC	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.645C>A	3.37:g.25622051C>A	ENSP00000385865:p.Asp215Glu	Somatic	0	56	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	15	57.14	P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.D215E	ENST00000404969.1	37	c.645		3	.	.	.	.	.	.	.	.	.	.	C	7.954	0.745542	0.15710	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.2	1.93	0.25924	Nuclear hormone receptor, ligand-binding (2);	0.049752	0.85682	D	0.000000	T	0.14614	0.0353	N	0.05078	-0.115	0.38228	D	0.940943	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08700	-1.0709	10	0.20519	T	0.43	.	6.4962	0.22144	0.0:0.5023:0.2643:0.2334	.	215;208	P10826;F1D8S6	RARB_HUMAN;.	E	215;215;215;96;208;96	ENSP00000373282:D215E;ENSP00000385865:D215E;ENSP00000398840:D96E;ENSP00000332296:D208E;ENSP00000391391:D96E	ENSP00000332296:D208E	D	+	3	2	RARB	25597055	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	0.938000	0.28965	0.588000	0.29660	-0.440000	0.05779	GAC	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Retinoic_acid_rcpt		0.473	RARB-201	KNOWN	basic	protein_coding	RARB	protein_coding		C	NM_000965, NM_016152	-		25622051	+1	no_errors	ENST00000404969	ensembl	human	known	74_37	missense	SNP	0.997	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43915500	43915500	+	Missense_Mutation	SNP	G	G	C	rs587604741	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:43915500G>C	ENST00000377564.3	+	22	3976	c.3583G>C	c.(3583-3585)Ggc>Cgc	p.G1195R	CNTNAP3B_ENST00000467854.1_3'UTR	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	1195	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						CACCGTCCGCGGCCACGTGGC	0.791													.|||	44	0.00878594	0.0076	0.0058	5008	,	,		7477	0.0119		0.007	False		,,,				2504	0.0112																0								ENSG00000154529																																			CNTNAP3B	SO:0001583	missense	0			-	HGNC	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.3583G>C	9.37:g.43915500G>C	ENSP00000366787:p.Gly1195Arg	Somatic	0	14	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G1195R	ENST00000377564.3	37	c.3583	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711004	0.68730	.	.	ENSG00000154529	ENST00000377564	D	0.90732	-2.72	2.28	1.31	0.21738	.	.	.	.	.	D	0.92374	0.7580	M	0.79926	2.475	0.51482	D	0.999921	.	.	.	.	.	.	D	0.90154	0.4223	7	0.72032	D	0.01	.	7.2767	0.26288	0.0:0.0:0.7356:0.2644	.	.	.	.	R	1195	ENSP00000366787:G1195R	ENSP00000366787:G1195R	G	+	1	0	CNTNAP3B	43855496	1.000000	0.71417	0.010000	0.14722	0.372000	0.29890	5.792000	0.69052	0.278000	0.22164	0.064000	0.15345	GGC	-	pfscan_Laminin_G		0.791	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	protein_coding	OTTHUMT00000036930.3	G		-		43915500	+1	no_errors	ENST00000377564	ensembl	human	known	74_37	missense	SNP	0.363	C
FEM1A	55527	genome.wustl.edu	37	19	4794948	4794949	+	3'UTR	INS	-	-	AACCTCAC	rs3214271|rs140617521	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:4794948_4794949insAACCTCAC	ENST00000269856.3	+	0	3221_3222				AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)						negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TCTGCCTTGCAGTGGCCTCTGA	0.52														3201	0.639177	0.7163	0.5778	5008	,	,		18444	0.6171		0.6471	False		,,,				2504	0.593																0								ENSG00000269604																																			AC005523.2	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.*1073->AACCTCAC	19.37:g.4794948_4794949insAACCTCAC		Somatic	NA	NA	NA		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000269856.3	37	NULL	CCDS12135.1	19																																																																																			-	-		0.520	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269604	protein_coding	OTTHUMT00000459000.1	-				4794949	-1	no_errors	ENST00000601192	ensembl	human	known	74_37	rna	INS	0.000:0.000	AACCTCAC
FLRT2	23768	genome.wustl.edu	37	14	86090074	86090075	+	3'UTR	INS	-	-	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:86090074_86090075insA	ENST00000330753.4	+	0	2983_2984				FLRT2_ENST00000554746.1_3'UTR	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TTTTAAATCTTAAAAAAAAAAA	0.302																																																	0								ENSG00000185070																																			FLRT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.*234->A	14.37:g.86090085_86090085dupA		Somatic	0	40	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A0AV84|B7ZLP3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330753.4	37	NULL	CCDS9877.1	14																																																																																			-	-		0.302	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	-				86090075	+1	no_errors	ENST00000553650	ensembl	human	putative	74_37	rna	INS	1.000:1.000	A
ZNF551	90233	genome.wustl.edu	37	19	58199223	58199223	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:58199223G>A	ENST00000282296.5	+	3	1765	c.1580G>A	c.(1579-1581)gGc>gAc	p.G527D	ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.G511D|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATTCATACTGGCACAAGACCT	0.448																																																	0								ENSG00000204519						82.0	78.0	80.0					19																	58199223		2203	4300	6503	ZNF551	SO:0001583	missense	0			-	HGNC	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1580G>A	19.37:g.58199223G>A	ENSP00000282296:p.Gly527Asp	Somatic	0	75	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G527D	ENST00000282296.5	37	c.1580	CCDS12959.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.05|15.05	2.717304|2.717304	0.48622|0.48622	.|.	.|.	ENSG00000228006|ENSG00000204519	ENST00000541705|ENST00000356715;ENST00000282296;ENST00000359821	.|.	.|.	.|.	2.31|2.31	1.21|1.21	0.21127|0.21127	.|Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.517850|.	0.04499|.	U|.	0.380852|.	T|T	0.65678|0.65678	0.2714|0.2714	M|M	0.64080|0.64080	1.96|1.96	0.37962|0.37962	D|D	0.932998|0.932998	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.64123|0.64123	-0.6481|-0.6481	7|7	0.41790|.	T|.	0.15|.	.|.	4.1836|4.1836	0.10387|0.10387	0.1369:0.0:0.64:0.2231|0.1369:0.0:0.64:0.2231	.|.	.|527	.|Q7Z340	.|ZN551_HUMAN	V|D	61|527;511;310	.|.	ENSP00000437781:A61V|.	A|G	-|+	2|2	0|0	AC004017.1|ZNF551	62891035|62891035	0.994000|0.994000	0.37717|0.37717	0.009000|0.009000	0.14445|0.14445	0.020000|0.020000	0.10135|0.10135	2.204000|2.204000	0.42761|0.42761	0.283000|0.283000	0.22279|0.22279	0.561000|0.561000	0.74099|0.74099	GCC|GGC	-	pfscan_Znf_C2H2		0.448	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	protein_coding	OTTHUMT00000466803.2	G	NM_138347	-		58199223	+1	no_errors	ENST00000282296	ensembl	human	known	74_37	missense	SNP	0.911	A
MMP24	10893	genome.wustl.edu	37	20	33834715	33834715	+	Missense_Mutation	SNP	T	T	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr20:33834715T>A	ENST00000246186.6	+	2	404	c.319T>A	c.(319-321)Ttg>Atg	p.L107M	EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000438751.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	107					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	AGCGAAGGCCTTGCAGTCGGC	0.507																																																	0								ENSG00000125966						140.0	135.0	136.0					20																	33834715		2041	4209	6250	MMP24	SO:0001583	missense	0			-	HGNC	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.319T>A	20.37:g.33834715T>A	ENSP00000246186:p.Leu107Met	Somatic	0	79	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7ZBG8|Q9H440	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.L107M	ENST00000246186.6	37	c.319	CCDS46593.1	20	.	.	.	.	.	.	.	.	.	.	T	12.38	1.921531	0.33908	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.42900	0.96	5.5	4.37	0.52481	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.161011	0.51477	D	0.000100	T	0.18002	0.0432	N	0.04820	-0.15	0.28673	N	0.905519	B	0.24618	0.107	B	0.28553	0.091	T	0.07673	-1.0760	10	0.22109	T	0.4	.	2.8322	0.05503	0.1357:0.0805:0.1593:0.6244	.	107	Q9Y5R2	MMP24_HUMAN	M	107;55	ENSP00000246186:L107M	ENSP00000246186:L107M	L	+	1	2	MMP24	33298131	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.168000	0.31859	2.310000	0.77875	0.450000	0.29827	TTG	-	pirsf_Pept_M10A_Metazoans,pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like		0.507	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP24	protein_coding	OTTHUMT00000078851.4	T	NM_006690	-		33834715	+1	no_errors	ENST00000246186	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC30	728621	genome.wustl.edu	37	1	42948563	42948563	+	Intron	DEL	A	A	-	rs202122677	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:42948563delA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GGAACATGAGAAAAAAAAAAA	0.363													|||unknown(HR)	839	0.167532	0.1573	0.1556	5008	,	,		20659	0.1746		0.1998	False		,,,				2504	0.1493																0								ENSG00000186409																																			CCDC30	SO:0001627	intron_variant	0				HGNC	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+76A>-	1.37:g.42948563delA		Somatic	0	25	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q14F06|Q5VVM5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			-	-		0.363	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	protein_coding		A	NM_025030			42948563	+1	no_errors	ENST00000475614	ensembl	human	known	74_37	rna	DEL	0.003	-
RP11-65D24.2	0	genome.wustl.edu	37	13	112240744	112240744	+	3'UTR	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr13:112240744C>T	ENST00000607406.1	+	0	197				RP11-65D24.2_ENST00000375713.1_Intron																							ACCTCACAGCCGGGAGGAGAC	0.532																																																	0								ENSG00000204398																																			RP11-65D24.2	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene																												ENST00000607406.1:c.*194C>T	13.37:g.112240744C>T		Somatic	0	39	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607406.1	37	NULL		13																																																																																			-	-		0.532	RP11-65D24.2-002	KNOWN	basic	processed_transcript	ENSG00000204398	protein_coding	OTTHUMT00000471073.1	C		-		112240744	+1	no_errors	ENST00000607406	ensembl	human	known	74_37	rna	SNP	0.000	T
MTFR1	9650	genome.wustl.edu	37	8	66620234	66620237	+	Frame_Shift_Del	DEL	AGAG	AGAG	-	rs150478914		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AGAG	AGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:66620234_66620237delAGAG	ENST00000262146.4	+	7	1047_1050	c.921_924delAGAG	c.(919-924)tcagagfs	p.SE307fs	MTFR1_ENST00000458689.2_Frame_Shift_Del_p.SE274fs	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	307					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AGGCCACCTCAGAGAGAGTGTTGG	0.412																																																	0								ENSG00000066855																																			MTFR1	SO:0001589	frameshift_variant	0				HGNC		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.921_924delAGAG	8.37:g.66620238_66620241delAGAG	ENSP00000262146:p.Ser307fs	Somatic	0	58	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	8	70.37	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mtfr1	p.R309fs	ENST00000262146.4	37	c.921_924	CCDS6182.1	8																																																																																			-	NULL		0.412	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFR1	protein_coding	OTTHUMT00000378894.1	AGAG	NM_014637			66620237	+1	no_errors	ENST00000262146	ensembl	human	known	74_37	frame_shift_del	DEL	0.994:0.993:0.944:0.308	-
ETAA1	54465	genome.wustl.edu	37	2	67631536	67631539	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TTCT	TTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:67631536_67631539delTTCT	ENST00000272342.5	+	5	1852_1855	c.1722_1725delTTCT	c.(1720-1725)ggttctfs	p.GS574fs	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	574						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						CAAAAGTAGGTTCTTTCTTTGATG	0.358																																																	0								ENSG00000143971																																			ETAA1	SO:0001589	frameshift_variant	0				HGNC	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1722_1725delTTCT	2.37:g.67631540_67631543delTTCT	ENSP00000272342:p.Gly574fs	Somatic	0	20	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	Q05BT7|Q53SC4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.F576fs	ENST00000272342.5	37	c.1722_1725	CCDS1882.1	2																																																																																			-	NULL		0.358	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	protein_coding	OTTHUMT00000251735.1	TTCT	NM_019002			67631539	+1	no_errors	ENST00000272342	ensembl	human	known	74_37	frame_shift_del	DEL	0.011:0.116:0.932:0.987	-
HYLS1	219844	genome.wustl.edu	37	11	125770156	125770158	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:125770156_125770158delCTT	ENST00000425380.2	+	3	1674_1676	c.893_895delCTT	c.(892-897)ccttct>cct	p.S299del	PUS3_ENST00000227474.3_Intron|HYLS1_ENST00000526028.1_In_Frame_Del_p.S299del|HYLS1_ENST00000356438.3_In_Frame_Del_p.S299del|RP11-680F20.9_ENST00000533033.2_RNA	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	299						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		CCTCTTTCTCCTTCTTAAATCTT	0.409																																					Esophageal Squamous(172;2590 2636 8884 10471)												0								ENSG00000198331		,,	0,4264		0,0,2132					,,	5.3	1.0			69	1,8253		0,1,4126	no	coding,intron,coding	PUS3,HYLS1	NM_145014.2,NM_031307.3,NM_001134793.1	,,	0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080	,,	,,		1,12517				HYLS1	SO:0001651	inframe_deletion	0				HGNC	AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.893_895delCTT	11.37:g.125770159_125770161delCTT	ENSP00000414884:p.Ser299del	Somatic	0	52	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	18	52.63	B3KXI8|Q96BX9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S299in_frame_del	ENST00000425380.2	37	c.893_895	CCDS8467.1	11																																																																																			-	NULL		0.409	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYLS1	protein_coding	OTTHUMT00000386733.1	CTT	NM_145014			125770158	+1	no_errors	ENST00000356438	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
KCNMB3	27094	genome.wustl.edu	37	3	178968712	178968712	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:178968712G>A	ENST00000314235.5	-	2	590	c.79C>T	c.(79-81)Cct>Tct	p.P27S	KCNMB3_ENST00000497599.1_Missense_Mutation_p.P25S|KCNMB3_ENST00000392685.2_Missense_Mutation_p.P23S|KCNMB3_ENST00000349697.2_Missense_Mutation_p.P25S|KCNMB3_ENST00000485523.1_Missense_Mutation_p.P5S	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	27					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CCTGAGGCAGGAAAGGCTGTC	0.522																																																	0								ENSG00000171121						116.0	108.0	111.0					3																	178968712		2203	4300	6503	KCNMB3	SO:0001583	missense	0			-	HGNC	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.79C>T	3.37:g.178968712G>A	ENSP00000319370:p.Pro27Ser	Somatic	0	45	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	24	48.94	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_bsu	p.P27S	ENST00000314235.5	37	c.79	CCDS3226.1	3	.	.	.	.	.	.	.	.	.	.	G	7.748	0.702789	0.15172	.	.	ENSG00000171121	ENST00000497599;ENST00000392685;ENST00000349697;ENST00000314235;ENST00000485523	T;T;T;T;T	0.16597	2.33;3.09;3.06;3.09;3.03	6.07	-2.26	0.06867	.	1.472700	0.04038	N	0.302650	T	0.04724	0.0128	N	0.01874	-0.695	0.09310	N	1	B;B;B;B;B	0.12630	0.0;0.001;0.001;0.006;0.003	B;B;B;B;B	0.10450	0.001;0.003;0.003;0.005;0.002	T	0.27606	-1.0069	10	0.02654	T	1	-11.5657	2.8077	0.05432	0.3266:0.1341:0.4086:0.1307	.	25;25;5;23;27	E9PER5;Q9NPA1-2;Q9NPA1-4;Q9NPA1-3;Q9NPA1	.;.;.;.;KCMB3_HUMAN	S	25;23;25;27;5	ENSP00000417091:P25S;ENSP00000376451:P23S;ENSP00000327866:P25S;ENSP00000319370:P27S;ENSP00000418536:P5S	ENSP00000319370:P27S	P	-	1	0	KCNMB3	180451406	0.006000	0.16342	0.000000	0.03702	0.636000	0.38137	-0.235000	0.09016	-0.622000	0.05626	0.650000	0.86243	CCT	-	NULL		0.522	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	KCNMB3	protein_coding	OTTHUMT00000348484.1	G		-		178968712	-1	no_errors	ENST00000314235	ensembl	human	known	74_37	missense	SNP	0.002	A
RAB13	5872	genome.wustl.edu	37	1	153955850	153955850	+	Intron	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:153955850T>C	ENST00000368575.3	-	4	362				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCCGCATCCATGGGTCTAAAC	0.502																																					Ovarian(138;395 2427 24306 43415)												0								ENSG00000143545																																			RAB13	SO:0001627	intron_variant	0			-	HGNC	X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.247-78A>G	1.37:g.153955850T>C		Somatic	0	57	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			-	-		0.502	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	protein_coding	OTTHUMT00000088992.1	T	NM_002870	-		153955850	-1	no_errors	ENST00000462680	ensembl	human	known	74_37	rna	SNP	0.000	C
CPA3	1359	genome.wustl.edu	37	3	148599387	148599387	+	Missense_Mutation	SNP	A	A	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:148599387A>G	ENST00000296046.3	+	7	707	c.655A>G	c.(655-657)Aat>Gat	p.N219D	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	219					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.N219D(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TCCTGTGTTCAATGTTGATGG	0.348																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000163751						130.0	122.0	125.0					3																	148599387		2203	4300	6503	CPA3	SO:0001583	missense	0			-	HGNC		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.655A>G	3.37:g.148599387A>G	ENSP00000296046:p.Asn219Asp	Somatic	0	55	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q96E94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.N219D	ENST00000296046.3	37	c.655	CCDS3138.1	3	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497334	0.85069	.	.	ENSG00000163751	ENST00000296046	T	0.71341	-0.56	5.06	5.06	0.68205	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	D	0.89371	0.6696	H	0.98005	4.125	0.58432	D	0.999999	D	0.69078	0.997	D	0.71656	0.974	D	0.92991	0.6415	10	0.87932	D	0	.	13.9293	0.63983	1.0:0.0:0.0:0.0	.	219	P15088	CBPA3_HUMAN	D	219	ENSP00000296046:N219D	ENSP00000296046:N219D	N	+	1	0	CPA3	150082077	1.000000	0.71417	0.963000	0.40424	0.987000	0.75469	7.533000	0.81994	2.111000	0.64477	0.533000	0.62120	AAT	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.348	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	protein_coding	OTTHUMT00000355974.1	A	NM_001870	-		148599387	+1	no_errors	ENST00000296046	ensembl	human	known	74_37	missense	SNP	1.000	G
C6orf165	154313	genome.wustl.edu	37	6	88119637	88119637	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:88119637T>C	ENST00000507897.1	+	2	163	c.80T>C	c.(79-81)aTt>aCt	p.I27T	C6ORF165_ENST00000369562.4_Missense_Mutation_p.I27T			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	27										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		CATGGAGAGATTGTTTCTGAA	0.353																																																	0								ENSG00000272514						142.0	147.0	145.0					6																	88119637		2203	4300	6503	C6ORF165	SO:0001583	missense	0			-	Uniprot_gn	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.80T>C	6.37:g.88119637T>C	ENSP00000426769:p.Ile27Thr	Somatic	0	210	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	62	50.40	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3508	p.I27T	ENST00000507897.1	37	c.80	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	T	0.917	-0.717133	0.03182	.	.	ENSG00000213204	ENST00000369562;ENST00000480123	T;T	0.27720	1.65;1.65	5.39	2.73	0.32206	.	0.602100	0.17226	N	0.182152	T	0.02230	0.0069	N	0.01109	-1.01	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.47045	-0.9147	10	0.10111	T	0.7	.	6.3819	0.21540	0.0:0.3494:0.0:0.6506	.	27;27	Q8IYR0;E1P509	CF165_HUMAN;.	T	27	ENSP00000358575:I27T;ENSP00000422494:I27T	ENSP00000358575:I27T	I	+	2	0	C6orf165	88176356	0.004000	0.15560	0.612000	0.29024	0.930000	0.56654	1.314000	0.33597	0.983000	0.38602	0.533000	0.62120	ATT	-	NULL		0.353	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	protein_coding	OTTHUMT00000470406.1	T	NM_178823	-		88119637	+1	no_errors	ENST00000369562	ensembl	human	known	74_37	missense	SNP	0.100	C
ORM1	5004	genome.wustl.edu	37	9	117087474	117087474	+	3'UTR	SNP	C	C	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:117087474C>G	ENST00000477456.1	+	0	365				ORM1_ENST00000259396.8_Intron			P02763	A1AG1_HUMAN	orosomucoid 1						acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|large_intestine(4)|lung(2)	8		Myeloproliferative disorder(63;0.163)			Abiraterone(DB05812)|Acenocoumarol(DB01418)|Ajmaline(DB01426)|Alfentanil(DB00802)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aprindine(DB01429)|Bupropion(DB01156)|Canagliflozin(DB08907)|Celecoxib(DB00482)|Chlorpromazine(DB00477)|Desipramine(DB01151)|Disopyramide(DB00280)|Doxazosin(DB00590)|Doxepin(DB01142)|Erlotinib(DB00530)|Fluoxetine(DB00472)|Gefitinib(DB00317)|Imatinib(DB00619)|Imipramine(DB00458)|Ivacaftor(DB08820)|Maprotiline(DB00934)|Mirabegron(DB08893)|Nateglinide(DB00731)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxycodone(DB00497)|Penbutolol(DB01359)|Pethidine(DB00454)|Phenprocoumon(DB00946)|Pitavastatin(DB08860)|Prazosin(DB00457)|Propranolol(DB00571)|Quinidine(DB00908)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Tamsulosin(DB00706)|Telaprevir(DB05521)|Thalidomide(DB01041)|Trazodone(DB00656)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Vismodegib(DB08828)|Warfarin(DB00682)	TGTCCATGGCCCAACTTGGGC	0.567																																																	0								ENSG00000229314						47.0	50.0	49.0					9																	117087474		2203	4300	6503	ORM1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS6803.1	9q32	2013-09-19			ENSG00000229314	ENSG00000229314		"""Lipocalins"""	8498	protein-coding gene	gene with protein product		138600					Standard	NM_000607		Approved		uc004bik.4	P02763	OTTHUMG00000021012	ENST00000477456.1:c.*362C>G	9.37:g.117087474C>G		Somatic	0	108	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	87	13.00	B7ZKQ5|Q5T539|Q5U067|Q8TC16	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000477456.1	37	NULL		9																																																																																			-	-		0.567	ORM1-002	KNOWN	basic	processed_transcript	ORM1	protein_coding	OTTHUMT00000055427.1	C		-		117087474	+1	no_errors	ENST00000477456	ensembl	human	known	74_37	rna	SNP	0.001	G
METTL3	56339	genome.wustl.edu	37	14	21967642	21967642	+	Silent	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:21967642G>A	ENST00000298717.4	-	8	1597	c.1446C>T	c.(1444-1446)caC>caT	p.H482H		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	482					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		TCACCAAGCAGTGTTCCTTCC	0.438																																																	0								ENSG00000165819						158.0	150.0	153.0					14																	21967642		2203	4300	6503	METTL3	SO:0001819	synonymous_variant	0			-	HGNC	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1446C>T	14.37:g.21967642G>A		Somatic	0	35	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	O14736|Q86V05|Q9HB32	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MT-A70-like,pfscan_MT-A70-like	p.H482	ENST00000298717.4	37	c.1446	CCDS32044.1	14																																																																																			-	pfam_MT-A70-like,pfscan_MT-A70-like		0.438	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL3	protein_coding	OTTHUMT00000401227.1	G	NM_019852	-		21967642	-1	no_errors	ENST00000298717	ensembl	human	known	74_37	silent	SNP	1.000	A
CTD-2555A7.2	0	genome.wustl.edu	37	16	89119157	89119157	+	lincRNA	DEL	T	T	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:89119157delT	ENST00000537498.1	-	0	216																											GGCACGCTTCTTTTTTTTTTT	0.567																																																	0								ENSG00000256982																																			CTD-2555A7.2			0				Clone_based_vega_gene																													16.37:g.89119157delT		Somatic	0	26	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000537498.1	37	NULL		16																																																																																			-	-		0.567	CTD-2555A7.2-001	KNOWN	basic	lincRNA	ENSG00000256982	lincRNA	OTTHUMT00000430645.1	T				89119157	-1	no_errors	ENST00000537498	ensembl	human	known	74_37	rna	DEL	0.003	-
ARHGAP31	57514	genome.wustl.edu	37	3	119133104	119133134	+	Frame_Shift_Del	DEL	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	-	rs368591462|rs183837502|rs139659618	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:119133104_119133134delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	ENST00000264245.4	+	12	2860_2890	c.2328_2358delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	c.(2326-2358)aatctgtctcctccactcccacctgctcctcccfs	p.NLSPPLPPAPP776fs		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	776	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GCCCAGGCAATCTGTCTCCTCCACTCCCACCTGCTCCTCCCCCTCCAACTC	0.558																																					Pancreas(7;176 297 5394 51128 51241)												0								ENSG00000031081																																			ARHGAP31	SO:0001589	frameshift_variant	0				HGNC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2328_2358delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	3.37:g.119133104_119133134delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	ENSP00000264245:p.Asn776fs	Somatic	NA	NA	NA		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9ULL6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S778fs	ENST00000264245.4	37	c.2328_2358	CCDS43135.1	3																																																																																			-	NULL		0.558	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	protein_coding	OTTHUMT00000354942.2	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC				119133134	+1	no_errors	ENST00000264245	ensembl	human	known	74_37	frame_shift_del	DEL	0.057:0.059:0.035:0.024:0.028:0.051:0.004:0.013:0.021:0.004:0.002:0.000:0.000:0.004:0.007:0.006:0.007:0.007:0.006:0.919:0.985:0.990:1.000:1.000:0.998:0.987:1.000:0.998:1.000:1.000:0.990	-
SCG2	7857	genome.wustl.edu	37	2	224462494	224462494	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:224462494C>A	ENST00000305409.2	-	2	1739	c.1507G>T	c.(1507-1509)Gaa>Taa	p.E503*		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCACCTAATTCTTGATCCTTG	0.438																																																	0								ENSG00000171951						178.0	152.0	161.0					2																	224462494		2203	4300	6503	SCG2	SO:0001587	stop_gained	0			-	HGNC	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1507G>T	2.37:g.224462494C>A	ENSP00000304133:p.Glu503*	Somatic	0	62	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Granin	p.E503*	ENST00000305409.2	37	c.1507	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	C	38	6.899815	0.97920	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	.	.	.	5.77	5.77	0.91146	.	0.173184	0.49305	D	0.000152	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.9913	0.97366	0.0:1.0:0.0:0.0	.	.	.	.	X	503;363	.	ENSP00000304133:E503X	E	-	1	0	SCG2	224170738	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.462000	0.66707	2.734000	0.93682	0.585000	0.79938	GAA	-	pfam_Granin		0.438	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	protein_coding	OTTHUMT00000256870.2	C	NM_003469	-		224462494	-1	no_errors	ENST00000305409	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SVILP1	645954	genome.wustl.edu	37	10	30987307	30987307	+	RNA	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:30987307G>T	ENST00000435645.1	+	0	440									supervillin pseudogene 1																		AGCTGCTGGAGACCCAAAAGA	0.418																																																	0								ENSG00000234814																																			SVILP1			0			-	HGNC			10p11.23	2012-12-20			ENSG00000234814	ENSG00000234814			44959	pseudogene	pseudogene							Standard	NR_036438		Approved				OTTHUMG00000017900		10.37:g.30987307G>T		Somatic	0	84	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	48	38.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000435645.1	37	NULL		10																																																																																			-	-		0.418	SVILP1-002	KNOWN	basic	processed_transcript	SVILP1	pseudogene	OTTHUMT00000331601.1	G		-		30987307	+1	no_errors	ENST00000435645	ensembl	human	known	74_37	rna	SNP	0.996	T
TSC22D2	9819	genome.wustl.edu	37	3	150128722	150128722	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:150128722C>T	ENST00000361875.3	+	1	2601	c.1585C>T	c.(1585-1587)Cca>Tca	p.P529S	TSC22D2_ENST00000361136.2_Missense_Mutation_p.P529S	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	529					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGTTACTATGCCAAATGTACC	0.612																																																	0								ENSG00000196428						59.0	61.0	60.0					3																	150128722		2203	4300	6503	TSC22D2	SO:0001583	missense	0			-	HGNC	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1585C>T	3.37:g.150128722C>T	ENSP00000354543:p.Pro529Ser	Somatic	0	58	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	20	47.37	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TSC-22_Dip_Bun	p.P529S	ENST00000361875.3	37	c.1585	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097662	0.56075	.	.	ENSG00000196428	ENST00000543241;ENST00000361875;ENST00000361136	T;T	0.39229	1.13;1.09	4.56	2.77	0.32553	.	0.000000	0.50627	D	0.000111	T	0.47948	0.1473	L	0.32530	0.975	0.36424	D	0.864463	D;D	0.67145	0.996;0.994	D;P	0.67382	0.951;0.895	T	0.52801	-0.8527	10	0.48119	T	0.1	.	10.2395	0.43303	0.0:0.8354:0.0:0.1646	.	529;529	O75157-2;O75157	.;T22D2_HUMAN	S	2;529;529	ENSP00000354543:P529S;ENSP00000354893:P529S	ENSP00000354893:P529S	P	+	1	0	TSC22D2	151611412	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	2.794000	0.47853	0.383000	0.24910	0.563000	0.77884	CCA	-	NULL		0.612	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	protein_coding	OTTHUMT00000357123.2	C	NM_014779	-		150128722	+1	no_errors	ENST00000361875	ensembl	human	known	74_37	missense	SNP	1.000	T
CRY1	1407	genome.wustl.edu	37	12	107391083	107391085	+	In_Frame_Del	DEL	CTA	CTA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CTA	CTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:107391083_107391085delCTA	ENST00000008527.5	-	10	2439_2441	c.1572_1574delTAG	c.(1570-1575)tgtagc>tgc	p.S527del		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	527					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						TCCACTGCTGCTACAACCTGGGA	0.345																																																	0								ENSG00000008405																																			CRY1	SO:0001651	inframe_deletion	0				HGNC	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1572_1574delTAG	12.37:g.107391083_107391085delCTA	ENSP00000008527:p.Ser527del	Somatic	0	50	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.S527in_frame_del	ENST00000008527.5	37	c.1574_1572	CCDS9112.1	12																																																																																			-	NULL		0.345	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	protein_coding	OTTHUMT00000406827.1	CTA	NM_004075			107391085	-1	no_errors	ENST00000008527	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ASAP2	8853	genome.wustl.edu	37	2	9515060	9515060	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:9515060T>C	ENST00000281419.3	+	17	2073	c.1733T>C	c.(1732-1734)cTg>cCg	p.L578P	ASAP2_ENST00000315273.4_Missense_Mutation_p.L578P	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	578					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AAAATCCCACTGGCCAACGGA	0.468																																																	0								ENSG00000151693						79.0	81.0	80.0					2																	9515060		2203	4300	6503	ASAP2	SO:0001583	missense	0			-	HGNC	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1733T>C	2.37:g.9515060T>C	ENSP00000281419:p.Leu578Pro	Somatic	0	56	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	13	67.50	D6W4Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.L578P	ENST00000281419.3	37	c.1733	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	T	18.67	3.673987	0.67928	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.72725	-0.68;-0.68	5.4	5.4	0.78164	Ankyrin repeat-containing domain (1);	0.217695	0.40385	N	0.001105	T	0.74846	0.3770	L	0.28115	0.83	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.80764	0.817;0.994	T	0.73930	-0.3827	10	0.32370	T	0.25	.	15.4253	0.75045	0.0:0.0:0.0:1.0	.	578;578	O43150-2;O43150	.;ASAP2_HUMAN	P	578	ENSP00000281419:L578P;ENSP00000316404:L578P	ENSP00000281419:L578P	L	+	2	0	ASAP2	9432511	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.002000	0.57053	2.039000	0.60335	0.533000	0.62120	CTG	-	superfamily_Ankyrin_rpt-contain_dom		0.468	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	protein_coding	OTTHUMT00000237522.1	T	NM_003887	-		9515060	+1	no_errors	ENST00000281419	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF610	162963	genome.wustl.edu	37	19	52869510	52869510	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:52869510T>A	ENST00000403906.3	+	6	1335	c.879T>A	c.(877-879)tgT>tgA	p.C293*	ZNF610_ENST00000321287.8_Nonsense_Mutation_p.C293*|ZNF610_ENST00000327920.8_Nonsense_Mutation_p.C293*|ZNF610_ENST00000601151.1_Nonsense_Mutation_p.C250*	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GTAACGAATGTGGCAAAGCTT	0.403																																																	0								ENSG00000167554						53.0	49.0	51.0					19																	52869510		2203	4300	6503	ZNF610	SO:0001587	stop_gained	0			-	HGNC	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.879T>A	19.37:g.52869510T>A	ENSP00000383922:p.Cys293*	Somatic	0	42	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A8K4C3|Q86YH8|Q8NDS9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C293*	ENST00000403906.3	37	c.879	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	T	36	5.623769	0.96660	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	.	.	.	1.69	0.578	0.17391	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9031	0.13784	0.0:0.3321:0.0:0.6679	.	.	.	.	X	293;250;293	.	ENSP00000324441:C250X	C	+	3	2	ZNF610	57561322	1.000000	0.71417	0.037000	0.18230	0.267000	0.26476	1.659000	0.37387	-0.071000	0.12886	-0.736000	0.03550	TGT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	protein_coding	OTTHUMT00000462880.1	T	NM_173530	-		52869510	+1	no_errors	ENST00000321287	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CTD-2311B13.7	0	genome.wustl.edu	37	14	19969169	19969169	+	lincRNA	SNP	T	T	C	rs372783582		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:19969169T>C	ENST00000547399.1	-	0	3123																											TGCAGTGAAATAAATGAAAGC	0.323																																																	0								ENSG00000257931																																			CTD-2311B13.7			0			-	Clone_based_vega_gene																													14.37:g.19969169T>C		Somatic	0	16	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000547399.1	37	NULL		14																																																																																			-	-		0.323	CTD-2311B13.7-001	KNOWN	basic	lincRNA	ENSG00000257931	lincRNA	OTTHUMT00000409457.1	T		-		19969169	-1	no_errors	ENST00000547399	ensembl	human	known	74_37	rna	SNP	0.600	C
TRIM52	84851	genome.wustl.edu	37	5	180687743	180687746	+	Frame_Shift_Del	DEL	CAAG	CAAG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CAAG	CAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:180687743_180687746delCAAG	ENST00000327767.4	-	1	373_376	c.69_72delCTTG	c.(67-72)tgcttgfs	p.CL23fs	TRIM52-AS1_ENST00000433265.3_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000509252.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	23					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TGAAGTAATCCAAGCAGATGGCAC	0.578																																																	0								ENSG00000183718																																			TRIM52	SO:0001589	frameshift_variant	0				HGNC		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.69_72delCTTG	5.37:g.180687743_180687746delCAAG	ENSP00000332152:p.Cys23fs	Somatic	0	40	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.C23fs	ENST00000327767.4	37	c.72_69	CCDS4467.1	5																																																																																			-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.578	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	protein_coding	OTTHUMT00000253572.3	CAAG	NM_032765			180687746	-1	no_errors	ENST00000327767	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
STK36	27148	genome.wustl.edu	37	2	219563973	219563973	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:219563973C>T	ENST00000295709.3	+	26	3985	c.3706C>T	c.(3706-3708)Cgg>Tgg	p.R1236W	STK36_ENST00000392106.2_Missense_Mutation_p.R1215W|STK36_ENST00000440309.1_Missense_Mutation_p.R1236W|STK36_ENST00000392105.3_Missense_Mutation_p.R1215W	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		AGTACCCCAGCGGCTCCTAGA	0.582																																																	0								ENSG00000163482						49.0	52.0	51.0					2																	219563973		2203	4300	6503	STK36	SO:0001583	missense	0			-	HGNC	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3706C>T	2.37:g.219563973C>T	ENSP00000295709:p.Arg1236Trp	Somatic	0	42	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1236W	ENST00000295709.3	37	c.3706	CCDS2421.1	2	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202376	0.58234	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.77	3.82	0.43975	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.41396	D	0.000900	T	0.34193	0.0889	L	0.50333	1.59	0.30901	N	0.729324	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.981;0.978;0.928	T	0.30031	-0.9992	10	0.66056	D	0.02	-24.276	13.47	0.61278	0.4064:0.5936:0.0:0.0	.	1215;1215;1236	A8MU99;Q9NRP7-2;Q9NRP7	.;.;STK36_HUMAN	W	1236;1215;1215;1236	ENSP00000295709:R1236W;ENSP00000375955:R1215W;ENSP00000375954:R1215W;ENSP00000394095:R1236W	ENSP00000295709:R1236W	R	+	1	2	STK36	219272217	0.027000	0.19231	1.000000	0.80357	0.846000	0.48090	-0.202000	0.09451	1.385000	0.46445	0.561000	0.74099	CGG	-	superfamily_ARM-type_fold		0.582	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	protein_coding	OTTHUMT00000256723.2	C		-		219563973	+1	no_errors	ENST00000295709	ensembl	human	known	74_37	missense	SNP	0.994	T
RTEL1	51750	genome.wustl.edu	37	20	62321658	62321658	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr20:62321658delG	ENST00000360203.5	+	26	2602	c.2277delG	c.(2275-2277)ccgfs	p.P759fs	RTEL1_ENST00000508582.2_Frame_Shift_Del_p.P783fs|RTEL1_ENST00000370018.3_Frame_Shift_Del_p.P759fs|RTEL1-TNFRSF6B_ENST00000482936.1_Frame_Shift_Del_p.P759fs|RTEL1_ENST00000370003.1_Frame_Shift_Del_p.P4fs|RTEL1_ENST00000318100.4_Frame_Shift_Del_p.P759fs					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TGCCAGCGCCGGCCCCCCGGG	0.632																																																	0								ENSG00000258366						40.0	44.0	43.0					20																	62321658		2194	4294	6488	RTEL1	SO:0001589	frameshift_variant	0				HGNC	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2277delG	20.37:g.62321658delG	ENSP00000353332:p.Pro759fs	Somatic	0	53	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A760fs	ENST00000360203.5	37	c.2277		20																																																																																			-	NULL		0.632	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	protein_coding	OTTHUMT00000289781.1	G	NM_032957			62321658	+1	no_errors	ENST00000318100	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
AANAT	15	genome.wustl.edu	37	17	74465965	74465965	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:74465965C>T	ENST00000392492.3	+	4	771	c.537C>T	c.(535-537)tgC>tgT	p.C179C	AANAT_ENST00000250615.3_Silent_p.C224C	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase	179	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						TGGGCCCCTGCGCCATCACCG	0.697																																																	0								ENSG00000129673						18.0	16.0	17.0					17																	74465965		2201	4290	6491	AANAT	SO:0001819	synonymous_variant	0			-	HGNC	U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.537C>T	17.37:g.74465965C>T		Somatic	0	67	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	A0AVF2|J3KMZ5|Q562F4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.C224	ENST00000392492.3	37	c.672	CCDS11745.1	17																																																																																			-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom		0.697	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AANAT	protein_coding	OTTHUMT00000450130.1	C	NM_001088	-		74465965	+1	no_errors	ENST00000250615	ensembl	human	known	74_37	silent	SNP	0.020	T
SHOX2	6474	genome.wustl.edu	37	3	157816014	157816014	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:157816014C>T	ENST00000425436.3	-	5	823	c.798G>A	c.(796-798)ccG>ccA	p.P266P	SHOX2_ENST00000389589.4_Silent_p.P290P|SHOX2_ENST00000483851.2_Silent_p.P254P|SHOX2_ENST00000441443.2_Silent_p.P125P|SHOX2_ENST00000490689.2_Silent_p.P125P	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	266					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CGGCCAGGTGCGGATGCAGGT	0.672																																																	0								ENSG00000168779						59.0	63.0	61.0					3																	157816014		2203	4298	6501	SHOX2	SO:0001819	synonymous_variant	0			-	HGNC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.798G>A	3.37:g.157816014C>T		Somatic	0	37	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O60465|O60467|O60903	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.P290	ENST00000425436.3	37	c.870	CCDS43164.1	3	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069828	0.36566	.	.	ENSG00000168779	ENST00000555977	.	.	.	5.12	4.2	0.49525	.	.	.	.	.	T	0.53077	0.1774	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50381	-0.8835	4	.	.	.	.	4.666	0.12666	0.1708:0.6359:0.0:0.1933	.	.	.	.	H	157	.	.	R	-	2	0	SHOX2	159298708	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.864000	0.27926	1.181000	0.42912	-0.345000	0.07892	CGC	-	NULL		0.672	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHOX2	protein_coding	OTTHUMT00000352057.2	C		-		157816014	-1	no_errors	ENST00000389589	ensembl	human	known	74_37	silent	SNP	1.000	T
EDDM3B	64184	genome.wustl.edu	37	14	21238473	21238473	+	Missense_Mutation	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:21238473G>T	ENST00000326783.3	+	2	262	c.164G>T	c.(163-165)aGa>aTa	p.R55I		NM_022360.4	NP_071755.1	P56851	EP3B_HUMAN	epididymal protein 3B	55						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						GTCCTCATGAGAGAAAATGAA	0.393																																																	0								ENSG00000181552						109.0	105.0	107.0					14																	21238473		2203	4300	6503	EDDM3B	SO:0001583	missense	0			-	HGNC	X76386	CCDS9557.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181552	ENSG00000181552			19223	protein-coding gene	gene with protein product		611582	"""family with sequence similarity 12, member B (epididymal)"""	FAM12B		7514008	Standard	NM_022360		Approved	HE3-BETA	uc001vyd.3	P56851	OTTHUMG00000029583	ENST00000326783.3:c.164G>T	14.37:g.21238473G>T	ENSP00000314810:p.Arg55Ile	Somatic	0	32	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A0PK89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain	p.R55I	ENST00000326783.3	37	c.164	CCDS9557.1	14	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674038	0.47781	.	.	ENSG00000181552	ENST00000326783	T	0.74106	-0.81	4.05	-1.24	0.09435	Ribonuclease A, domain (3);	0.952198	0.08690	N	0.908176	T	0.69904	0.3163	L	0.53249	1.67	0.23533	N	0.997475	P	0.50943	0.94	P	0.47864	0.559	T	0.59643	-0.7416	10	0.59425	D	0.04	.	4.198	0.10452	0.442:0.186:0.3721:0.0	.	55	P56851	EP3B_HUMAN	I	55	ENSP00000314810:R55I	ENSP00000314810:R55I	R	+	2	0	EDDM3B	20308313	0.018000	0.18449	0.020000	0.16555	0.924000	0.55760	-0.138000	0.10374	-0.537000	0.06290	0.561000	0.74099	AGA	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain		0.393	EDDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3B	protein_coding	OTTHUMT00000073745.2	G		-		21238473	+1	no_errors	ENST00000326783	ensembl	human	known	74_37	missense	SNP	0.027	T
LINC00933	100506874	genome.wustl.edu	37	15	85121416	85121416	+	RNA	SNP	A	A	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:85121416A>T	ENST00000557887.1	+	0	616					NR_038273.1|NR_038274.1				long intergenic non-protein coding RNA 933																		GGATTCTCTGAATCGGAAGTT	0.413																																																	0								ENSG00000259728																																			LINC00933			0			-	HGNC			15q25.2	2013-05-29			ENSG00000259728	ENSG00000259728		"""Long non-coding RNAs"""	48625	non-coding RNA	RNA, long non-coding							Standard	NR_038273		Approved				OTTHUMG00000172445		15.37:g.85121416A>T		Somatic	0	19	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557887.1	37	NULL		15																																																																																			-	-		0.413	LINC00933-001	KNOWN	basic	processed_transcript	LINC00933	pseudogene	OTTHUMT00000418591.1	A		-		85121416	+1	no_errors	ENST00000557887	ensembl	human	known	74_37	rna	SNP	0.235	T
GART	2618	genome.wustl.edu	37	21	34882121	34882122	+	Frame_Shift_Ins	INS	-	-	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr21:34882121_34882122insT	ENST00000381831.3	-	18	2683_2684	c.2420_2421insA	c.(2419-2421)aagfs	p.K807fs	GART_ENST00000381839.3_Frame_Shift_Ins_p.K807fs|GART_ENST00000543717.1_Frame_Shift_Ins_p.K359fs|GART_ENST00000381815.4_Frame_Shift_Ins_p.K807fs	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	807	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.K807fs*7(2)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CCACTCTGGCCTTTTTTTTTTC	0.446																																																	2	Deletion - Frameshift(2)	ovary(2)						ENSG00000159131																																			GART	SO:0001589	frameshift_variant	0				HGNC	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2421dupA	21.37:g.34882131_34882131dupT	ENSP00000371253:p.Lys807fs	Somatic	0	57	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C_dom,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth_N_dom,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.A808fs	ENST00000381831.3	37	c.2421_2420	CCDS13627.1	21																																																																																			-	superfamily_Formyl_transf_N,tigrfam_PurN_trans		0.446	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	protein_coding	OTTHUMT00000140626.3	-	NM_000819			34882122	-1	no_errors	ENST00000381815	ensembl	human	known	74_37	frame_shift_ins	INS	0.864:0.844	T
STAT2	6773	genome.wustl.edu	37	12	56744659	56744659	+	Missense_Mutation	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:56744659G>T	ENST00000314128.4	-	11	1071	c.1048C>A	c.(1048-1050)Ctc>Atc	p.L350I	STAT2_ENST00000557235.1_Missense_Mutation_p.L346I|STAT2_ENST00000418572.2_Missense_Mutation_p.L346I|STAT2_ENST00000556539.1_5'Flank|RNU7-40P_ENST00000516397.1_RNA			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	350					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						CCTTCCTGGAGTCTCACCAGC	0.532																																																	0								ENSG00000170581						101.0	95.0	97.0					12																	56744659		2203	4300	6503	STAT2	SO:0001583	missense	0			-	HGNC	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1048C>A	12.37:g.56744659G>T	ENSP00000315768:p.Leu350Ile	Somatic	0	49	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.L350I	ENST00000314128.4	37	c.1048	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255653	0.59321	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	D;D;D	0.90261	-2.64;-2.64;-2.64	4.92	3.1	0.35709	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.139921	0.49305	D	0.000147	D	0.93815	0.8022	M	0.74467	2.265	0.39512	D	0.968373	D;P;D	0.76494	0.983;0.858;0.999	P;P;D	0.87578	0.867;0.729;0.998	D	0.92689	0.6165	10	0.49607	T	0.09	-15.4742	9.6083	0.39648	0.1961:0.0:0.8039:0.0	.	346;346;350	B4DLC8;G3V2M6;P52630	.;.;STAT2_HUMAN	I	350;346;346	ENSP00000315768:L350I;ENSP00000450751:L346I;ENSP00000387354:L346I	ENSP00000315768:L350I	L	-	1	0	STAT2	55030926	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.608000	0.36847	0.613000	0.30089	0.462000	0.41574	CTC	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.532	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	G	NM_005419	-		56744659	-1	no_errors	ENST00000314128	ensembl	human	known	74_37	missense	SNP	1.000	T
TENM3	55714	genome.wustl.edu	37	4	183650181	183650181	+	Missense_Mutation	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:183650181A>C	ENST00000511685.1	+	14	2555	c.2432A>C	c.(2431-2433)tAt>tCt	p.Y811S	TENM3_ENST00000406950.2_Missense_Mutation_p.Y811S|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	811					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AATCAGCCCTATTGTCGGGGA	0.478																																																	0								ENSG00000218336						84.0	81.0	82.0					4																	183650181		1933	4153	6086	TENM3	SO:0001583	missense	0			-	HGNC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2432A>C	4.37:g.183650181A>C	ENSP00000424226:p.Tyr811Ser	Somatic	0	72	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	24	54.72	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.Y811S	ENST00000511685.1	37	c.2432	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	A	9.129	1.010874	0.19277	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.10668	2.85;2.85	5.14	2.61	0.31194	.	.	.	.	.	T	0.06005	0.0156	N	0.11892	0.195	0.53688	D	0.99997	B	0.06786	0.001	B	0.04013	0.001	T	0.27468	-1.0073	9	0.62326	D	0.03	.	7.0216	0.24916	0.6073:0.1346:0.0:0.258	.	811	Q9P273	TEN3_HUMAN	S	811	ENSP00000424226:Y811S;ENSP00000385276:Y811S	ENSP00000385276:Y811S	Y	+	2	0	ODZ3	183887175	1.000000	0.71417	0.990000	0.47175	0.400000	0.30750	3.193000	0.50997	0.383000	0.24910	0.460000	0.39030	TAT	-	NULL		0.478	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	protein_coding	OTTHUMT00000361734.1	A		-		183650181	+1	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	SNP	1.000	C
KMT2D	8085	genome.wustl.edu	37	12	49431874	49431874	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:49431874delC	ENST00000301067.7	-	34	9264	c.9265delG	c.(9265-9267)gtgfs	p.V3089fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3089					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V2819fs*9(1)|p.V3089fs*9(1)									CCTGGCTCCACCCCCCGCAGC	0.622																																																	2	Insertion - Frameshift(2)	large_intestine(2)						ENSG00000167548						40.0	40.0	40.0					12																	49431874		1964	4143	6107	KMT2D	SO:0001589	frameshift_variant	0				HGNC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9265delG	12.37:g.49431874delC	ENSP00000301067:p.Val3089fs	Somatic	0	144	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	O14687	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.V3089fs	ENST00000301067.7	37	c.9265	CCDS44873.1	12																																																																																			-	NULL		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	protein_coding	OTTHUMT00000390183.2	C				49431874	-1	no_errors	ENST00000301067	ensembl	human	known	74_37	frame_shift_del	DEL	0.784	-
KHDC1	80759	genome.wustl.edu	37	6	73972779	73972793	+	Intron	DEL	GCGGCGGCGGCGGCA	GCGGCGGCGGCGGCA	-	rs28641970|rs373485269|rs574127460	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	GCGGCGGCGGCGGCA	GCGGCGGCGGCGGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:73972779_73972793delGCGGCGGCGGCGGCA	ENST00000370384.3	-	3	707				RP11-257K9.8_ENST00000423730.3_5'UTR|KHDC1_ENST00000257765.5_5'UTR|AC019205.1_ENST00000584443.1_RNA|RP11-398K22.12_ENST00000441363.1_RNA|RP11-398K22.12_ENST00000442007.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1							integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						ggcggcggcggcggcggcggcggcagcggcggcag	0.749											OREG0003897	type=REGULATORY REGION|Gene=BC031876|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000263378																																			AC019205.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene		CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.207-20526TGCCGCCGCCGCCGC>-	6.37:g.73972779_73972793delGCGGCGGCGGCGGCA		Somatic	NA	NA	NA	1149	0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5JSQ7|Q8WTV2|Q96NQ5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370384.3	37	NULL	CCDS59027.1	6																																																																																			-	-		0.749	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000263378	protein_coding	OTTHUMT00000148103.2	GCGGCGGCGGCGGCA	NM_030568			73972793	+1	no_errors	ENST00000584443	ensembl	human	novel	74_37	rna	DEL	0.010:0.008:0.003:0.004:0.002:0.001:0.002:0.003:0.003:0.012:0.028:0.028:0.029:0.029:0.028	-
NSUN5	55695	genome.wustl.edu	37	7	72717970	72717973	+	Frame_Shift_Del	DEL	GCAT	GCAT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	GCAT	GCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:72717970_72717973delGCAT	ENST00000252594.6	-	8	1010_1013	c.995_998delATGC	c.(994-999)catgccfs	p.HA332fs	NSUN5_ENST00000438747.2_Frame_Shift_Del_p.HA332fs|NSUN5_ENST00000310326.8_Frame_Shift_Del_p.HA332fs|NSUN5_ENST00000428206.1_Frame_Shift_Del_p.HA294fs			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	332					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				CCCTGCCAGGGCATGCAGACGCAC	0.618																																																	0								ENSG00000130305																																			NSUN5	SO:0001589	frameshift_variant	0				HGNC	AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.995_998delATGC	7.37:g.72717970_72717973delGCAT	ENSP00000252594:p.His332fs	Somatic	0	85	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	34	44.26	B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.H332fs	ENST00000252594.6	37	c.998_995	CCDS5547.1	7																																																																																			-	pfam_Fmu/NOL1/Nop2p		0.618	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	protein_coding	OTTHUMT00000252113.1	GCAT	NM_148956			72717973	-1	no_errors	ENST00000438747	ensembl	human	known	74_37	frame_shift_del	DEL	0.962:0.948:0.057:0.066	-
SCYL2	55681	genome.wustl.edu	37	12	100732431	100732431	+	Missense_Mutation	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:100732431G>T	ENST00000360820.2	+	18	2708	c.2271G>T	c.(2269-2271)atG>atT	p.M757I		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	757	Necessary for interaction with AP2 complex and clathrin, interaction with clathrin is necessary for its targeting to the TGN and endosomal membranes.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TTGGTATGATGTTTTCTACAC	0.388																																																	0								ENSG00000136021						105.0	98.0	100.0					12																	100732431		2203	4300	6503	SCYL2	SO:0001583	missense	0			-	HGNC	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2271G>T	12.37:g.100732431G>T	ENSP00000354061:p.Met757Ile	Somatic	0	74	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.M757I	ENST00000360820.2	37	c.2271	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	G	7.831	0.719771	0.15372	.	.	ENSG00000136021	ENST00000360820	T	0.28666	1.6	5.67	3.74	0.42951	.	0.566875	0.19470	N	0.113461	T	0.15305	0.0369	N	0.14661	0.345	0.27368	N	0.955771	B	0.09022	0.002	B	0.09377	0.004	T	0.04090	-1.0978	10	0.34782	T	0.22	-1.443	5.5014	0.16831	0.1435:0.0:0.6594:0.1971	.	757	Q6P3W7	SCYL2_HUMAN	I	757	ENSP00000354061:M757I	ENSP00000354061:M757I	M	+	3	0	SCYL2	99256562	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.660000	0.46749	2.832000	0.97577	0.585000	0.79938	ATG	-	NULL		0.388	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	protein_coding	OTTHUMT00000408493.2	G	NM_017988	-		100732431	+1	no_errors	ENST00000360820	ensembl	human	known	74_37	missense	SNP	1.000	T
PGLYRP3	114771	genome.wustl.edu	37	1	153270612	153270612	+	Splice_Site	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:153270612T>C	ENST00000290722.1	-	7	900		c.e7-2			NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3						defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGGCTTTTCTGCAAAACACA	0.532																																																	0								ENSG00000159527						149.0	138.0	142.0					1																	153270612		2203	4300	6503	PGLYRP3	SO:0001630	splice_region_variant	0			-	HGNC	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.848-2A>G	1.37:g.153270612T>C		Somatic	0	87	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A1A4U8|Q5SY65	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-2	ENST00000290722.1	37	c.848-2	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	t	12.76	2.035829	0.35893	.	.	ENSG00000159527	ENST00000290722	.	.	.	4.25	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9809	0.24702	0.2022:0.0:0.0:0.7978	.	.	.	.	.	-1	.	.	.	-	.	.	PGLYRP3	151537236	1.000000	0.71417	0.935000	0.37517	0.706000	0.40770	4.378000	0.59568	1.770000	0.52166	0.456000	0.33151	.	-	-		0.532	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	protein_coding	OTTHUMT00000039488.1	T	NM_052891	-	Intron	153270612	-1	no_errors	ENST00000290722	ensembl	human	known	74_37	splice_site	SNP	0.630	C
SLC9A8	23315	genome.wustl.edu	37	20	48481298	48481298	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr20:48481298delG	ENST00000361573.2	+	10	917	c.875delG	c.(874-876)aggfs	p.R292fs	SLC9A8_ENST00000539601.1_Frame_Shift_Del_p.R73fs|SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.R308fs			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	292					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			ATTGACTTGAGGAAAACGCCT	0.453																																																	0								ENSG00000197818						221.0	146.0	171.0					20																	48481298		2203	4300	6503	SLC9A8	SO:0001589	frameshift_variant	0				HGNC	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.875delG	20.37:g.48481298delG	ENSP00000354966:p.Arg292fs	Somatic	0	49	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T310fs	ENST00000361573.2	37	c.923	CCDS13421.1	20																																																																																			-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.453	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	protein_coding	OTTHUMT00000106483.3	G	XM_030524			48481298	+1	no_errors	ENST00000417961	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ERAS	3266	genome.wustl.edu	37	X	48688026	48688026	+	Missense_Mutation	SNP	G	G	T	rs199842596		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:48688026G>T	ENST00000338270.1	+	1	744	c.493G>T	c.(493-495)Gct>Tct	p.A165S	PCSK1N_ENST00000478242.1_5'Flank	NM_181532.2	NP_853510.1	Q7Z444	RASE_HUMAN	ES cell expressed Ras	165					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.A165S(1)		endometrium(2)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	14						TGCTCATGCCGCTGCTGCAGC	0.647																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000187682						30.0	25.0	27.0					X																	48688026		2203	4300	6503	ERAS	SO:0001583	missense	0			-	HGNC	X00419	CCDS35246.1	Xp11.23	2014-05-09	2003-07-14	2003-07-16	ENSG00000187682	ENSG00000187682			5174	protein-coding gene	gene with protein product		300437	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog pseudogene"""	HRAS2, HRASP		12774123	Standard	NM_181532		Approved		uc031tjl.1	Q7Z444	OTTHUMG00000059533	ENST00000338270.1:c.493G>T	X.37:g.48688026G>T	ENSP00000339136:p.Ala165Ser	Somatic	0	75	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A165S	ENST00000338270.1	37	c.493	CCDS35246.1	X	.	.	.	.	.	.	.	.	.	.	g	8.947	0.967252	0.18659	.	.	ENSG00000187682	ENST00000338270	T	0.76316	-1.01	4.66	2.9	0.33743	Small GTP-binding protein domain (1);	0.000000	0.37857	N	0.001909	T	0.67906	0.2943	L	0.28608	0.87	0.09310	N	1	P	0.39576	0.679	B	0.42916	0.402	T	0.60732	-0.7205	10	0.66056	D	0.02	.	8.2142	0.31501	0.2006:0.0:0.7994:0.0	.	165	Q7Z444	RASE_HUMAN	S	165	ENSP00000339136:A165S	ENSP00000339136:A165S	A	+	1	0	ERAS	48572970	0.062000	0.20869	0.006000	0.13384	0.274000	0.26718	1.073000	0.30691	0.524000	0.28502	0.597000	0.82753	GCT	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom		0.647	ERAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAS	protein_coding	OTTHUMT00000132402.1	G	NM_181532	-		48688026	+1	no_errors	ENST00000338270	ensembl	human	known	74_37	missense	SNP	0.006	T
NOD2	64127	genome.wustl.edu	37	16	50765685	50765685	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:50765685delG	ENST00000300589.2	+	12	3183	c.3078delG	c.(3076-3078)gagfs	p.E1027fs		NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	1027					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				TCTCTCTAGAGGAGGTTGACA	0.498																																																	0								ENSG00000167207						116.0	104.0	108.0					16																	50765685		2198	4300	6498	NOD2	SO:0001589	frameshift_variant	0				HGNC	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.3078delG	16.37:g.50765685delG	ENSP00000300589:p.Glu1027fs	Somatic	0	51	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.E1027fs	ENST00000300589.2	37	c.3078	CCDS10746.1	16																																																																																			-	NULL		0.498	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	protein_coding	OTTHUMT00000256876.2	G	NM_022162			50765685	+1	no_errors	ENST00000300589	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DHRS7C	201140	genome.wustl.edu	37	17	9675005	9675005	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:9675005T>C	ENST00000330255.5	-	6	751	c.739A>G	c.(739-741)Agg>Ggg	p.R247G	DHRS7C_ENST00000571134.1_Missense_Mutation_p.R246G	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	247					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						GTCAGCTTCCTGAAAAAGACT	0.627																																																	0								ENSG00000184544						23.0	25.0	25.0					17																	9675005		1936	4140	6076	DHRS7C	SO:0001583	missense	0			-	HGNC		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.739A>G	17.37:g.9675005T>C	ENSP00000327975:p.Arg247Gly	Somatic	0	61	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B7ZW74|B9EJH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.R247G	ENST00000330255.5	37	c.739	CCDS56020.1	17	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811749	0.50527	.	.	ENSG00000184544	ENST00000330255	T	0.51071	0.72	5.5	5.5	0.81552	NAD(P)-binding domain (1);	0.172208	0.64402	D	0.000005	T	0.42177	0.1191	L	0.47716	1.5	0.51482	D	0.999928	B;B	0.30021	0.265;0.126	B;B	0.24394	0.053;0.034	T	0.40098	-0.9581	10	0.62326	D	0.03	.	14.7364	0.69419	0.0:0.0:0.0:1.0	.	247;243	A6NNS2;B9EJH3	DRS7C_HUMAN;.	G	247	ENSP00000327975:R247G	ENSP00000327975:R247G	R	-	1	2	DHRS7C	9615730	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.254000	0.78329	2.302000	0.77476	0.533000	0.62120	AGG	-	NULL		0.627	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	DHRS7C	protein_coding	OTTHUMT00000439863.1	T	XM_113912	-		9675005	-1	no_errors	ENST00000330255	ensembl	human	known	74_37	missense	SNP	1.000	C
PRPS2	5634	genome.wustl.edu	37	X	12837656	12837656	+	Silent	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:12837656G>T	ENST00000380668.5	+	5	689	c.561G>T	c.(559-561)gtG>gtT	p.V187V	PRPS2_ENST00000398491.2_Silent_p.V190V	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	187					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						GGTTGAATGTGGAATTTGCTT	0.478																																																	0								ENSG00000101911						224.0	192.0	202.0					X																	12837656		2203	4300	6503	PRPS2	SO:0001819	synonymous_variant	0			-	HGNC	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.561G>T	X.37:g.12837656G>T		Somatic	0	49	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PRibTrfase_dom,tigrfam_Rib-P_diPkinase	p.V190	ENST00000380668.5	37	c.570	CCDS14150.1	X																																																																																			-	pfam_PRibTrfase_dom,tigrfam_Rib-P_diPkinase		0.478	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRPS2	protein_coding	OTTHUMT00000055772.2	G	NM_002765	-		12837656	+1	no_errors	ENST00000398491	ensembl	human	known	74_37	silent	SNP	1.000	T
SLC25A5	292	genome.wustl.edu	37	X	118603830	118603830	+	Silent	SNP	A	A	G	rs73637847		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:118603830A>G	ENST00000317881.8	+	2	434	c.318A>G	c.(316-318)agA>agG	p.R106R	SLC25A5_ENST00000460013.1_3'UTR|SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	106					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)	p.R106R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	TGGACAAGAGAACCCAGTTTT	0.517																																																	1	Substitution - coding silent(1)	stomach(1)						ENSG00000005022						106.0	104.0	105.0					X																	118603830		2203	4300	6503	SLC25A5	SO:0001819	synonymous_variant	0			-	HGNC	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.318A>G	X.37:g.118603830A>G		Somatic	0	41	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	16	44.83	B2RCV1|O43350	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor	p.R106	ENST00000317881.8	37	c.318	CCDS14578.1	X																																																																																			-	superfamily_Mt_carrier_dom		0.517	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A5	protein_coding	OTTHUMT00000058952.2	A	NM_001152	rs73637847		118603830	+1	no_errors	ENST00000317881	ensembl	human	known	74_37	silent	SNP	0.998	G
TP53	7157	genome.wustl.edu	37	17	7579346	7579348	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:7579346_7579348delAAG	ENST00000269305.4	-	4	528_530	c.339_341delCTT	c.(337-342)ttcttg>ttg	p.F113del	TP53_ENST00000455263.2_In_Frame_Del_p.F113del|TP53_ENST00000420246.2_In_Frame_Del_p.F113del|TP53_ENST00000413465.2_In_Frame_Del_p.F113del|TP53_ENST00000445888.2_In_Frame_Del_p.F113del|TP53_ENST00000359597.4_In_Frame_Del_p.F113del|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L114*(4)|p.F113L(3)|p.G59fs*23(3)|p.F113C(2)|p.F113del(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.L114fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCAGAATGCAAGAAGCCCAGAC	0.601		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Deletion - Frameshift(9)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(5)|Substitution - Nonsense(4)	lung(5)|breast(5)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|biliary_tract(1)|liver(1)|oesophagus(1)	GRCh37	CD084237	TP53	D		ENSG00000141510																																			TP53	SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.339_341delCTT	17.37:g.7579349_7579351delAAG	ENSP00000269305:p.Phe113del	Somatic	0	124	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	4	88.24	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F113in_frame_del	ENST00000269305.4	37	c.341_339	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.601	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	AAG	NM_000546			7579348	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_del	DEL	0.998:1.000:1.000	-
VPS13C	54832	genome.wustl.edu	37	15	62261502	62261502	+	Silent	SNP	A	A	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:62261502A>T	ENST00000261517.5	-	28	2980	c.2907T>A	c.(2905-2907)atT>atA	p.I969I	VPS13C_ENST00000249837.3_Silent_p.I926I|VPS13C_ENST00000395898.3_Silent_p.I926I|VPS13C_ENST00000395896.4_Silent_p.I969I	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TATTACCTTCAATTTCATGAT	0.264																																																	0								ENSG00000129003						49.0	47.0	48.0					15																	62261502		2198	4284	6482	VPS13C	SO:0001819	synonymous_variant	0			-	HGNC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2907T>A	15.37:g.62261502A>T		Somatic	0	47	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.I969	ENST00000261517.5	37	c.2907	CCDS32257.1	15																																																																																			-	NULL		0.264	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	protein_coding	OTTHUMT00000415997.1	A	NM_017684	-		62261502	-1	no_errors	ENST00000261517	ensembl	human	known	74_37	silent	SNP	1.000	T
SYT6	148281	genome.wustl.edu	37	1	114646326	114646326	+	Silent	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:114646326T>C	ENST00000610222.1	-	4	1235	c.1089A>G	c.(1087-1089)ggA>ggG	p.G363G	SYT6_ENST00000607941.1_Silent_p.G278G|SYT6_ENST00000609117.1_Silent_p.G278G|SYT6_ENST00000369547.1_Silent_p.G278G|SYT6_ENST00000393296.1_Silent_p.G363G			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	363	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATGATCTCTCCCAAGTCCA	0.557																																																	0								ENSG00000134207						111.0	78.0	89.0					1																	114646326		2203	4300	6503	SYT6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1089A>G	1.37:g.114646326T>C		Somatic	0	48	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	22	33.33	B1AMB8|B3KPK1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.G363	ENST00000610222.1	37	c.1089		1																																																																																			-	superfamily_C2_dom		0.557	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	protein_coding	OTTHUMT00000314819.2	T	NM_205848	-		114646326	-1	no_errors	ENST00000393296	ensembl	human	known	74_37	silent	SNP	0.716	C
TRIM73	375593	genome.wustl.edu	37	7	75028241	75028241	+	Silent	SNP	G	G	A	rs73702637		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:75028241G>A	ENST00000437796.1	+	1	43	c.24G>A	c.(22-24)ctG>ctA	p.L8L	TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000430211.1_Silent_p.L8L|TRIM73_ENST00000447409.2_Silent_p.L8L|TRIM73_ENST00000323819.3_Silent_p.L8L|TRIM73_ENST00000463766.1_3'UTR			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						TGAGCCTGCTGGAGCTGGAGG	0.612																																																	0								ENSG00000178809						137.0	139.0	138.0					7																	75028241		2203	4300	6503	TRIM73	SO:0001819	synonymous_variant	0			-	HGNC	AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.24G>A	7.37:g.75028241G>A		Somatic	1	149	0.67		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	97	11.01	Q8N0S3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.L8	ENST00000437796.1	37	c.24	CCDS34665.1	7																																																																																			-	NULL		0.612	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM73	protein_coding	OTTHUMT00000342950.1	G		rs117463977		75028241	+1	no_errors	ENST00000323819	ensembl	human	known	74_37	silent	SNP	0.004	A
ABI1	10006	genome.wustl.edu	37	10	27060004	27060004	+	Splice_Site	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:27060004C>A	ENST00000376142.2	-	4	548	c.477G>T	c.(475-477)aaG>aaT	p.K159N	ABI1_ENST00000376160.1_Intron|ABI1_ENST00000376166.1_Intron|ABI1_ENST00000536334.1_Intron|ABI1_ENST00000359188.4_Splice_Site_p.K159N|ABI1_ENST00000355394.4_Intron|ABI1_ENST00000376137.4_Intron|ABI1_ENST00000376140.3_Splice_Site_p.K159N|ABI1_ENST00000376170.4_Splice_Site_p.K159N|ABI1_ENST00000376138.3_Splice_Site_p.K159N|ABI1_ENST00000376134.3_Intron|ABI1_ENST00000490841.2_Intron|ABI1_ENST00000346832.5_Splice_Site_p.K176N|ABI1_ENST00000376139.2_Intron	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	159					actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGCTCTTACCTTGGCTTTTA	0.383																																																	0								ENSG00000136754						105.0	107.0	106.0					10																	27060004		2203	4300	6503	ABI1	SO:0001630	splice_region_variant	0			-	HGNC	U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.477+1G>T	10.37:g.27060004C>A		Somatic	0	87	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Abl-interactor_HHR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,pfscan_T_SNARE_dom,prints_SH3_domain,prints_p67phox	p.K159N	ENST00000376142.2	37	c.477	CCDS7150.1	10	.	.	.	.	.	.	.	.	.	.	C	13.17	2.158585	0.38119	.	.	ENSG00000136754	ENST00000376138;ENST00000376170;ENST00000376142;ENST00000359188;ENST00000346832;ENST00000376140	D;D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01;-3.01	5.65	5.65	0.86999	Abl-interactor, homeo-domain homologous domain (1);	.	.	.	.	D	0.86347	0.5911	N	0.08118	0	0.80722	D	1	B;B;B;B;B;B;B;B	0.33755	0.0;0.424;0.361;0.135;0.0;0.0;0.156;0.372	B;B;B;B;B;B;B;B	0.39935	0.001;0.314;0.062;0.047;0.002;0.001;0.168;0.079	D	0.83613	0.0135	8	.	.	.	.	19.7111	0.96096	0.0:1.0:0.0:0.0	.	159;159;184;159;176;159;159;159	B6VEX4;B6VEX3;Q59G41;Q8IZP0-6;B3KX62;Q8IZP0-3;Q8IZP0-9;Q8IZP0	.;.;.;.;.;.;.;ABI1_HUMAN	N	159;159;159;159;176;159	ENSP00000365308:K159N;ENSP00000365340:K159N;ENSP00000365312:K159N;ENSP00000352114:K159N;ENSP00000279599:K176N;ENSP00000365310:K159N	.	K	-	3	2	ABI1	27100010	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.298000	0.78815	2.664000	0.90586	0.491000	0.48974	AAG	-	pfam_Abl-interactor_HHR_dom		0.383	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI1	protein_coding	OTTHUMT00000047287.1	C	NM_005470	-	Missense_Mutation	27060004	-1	no_errors	ENST00000376142	ensembl	human	known	74_37	missense	SNP	1.000	A
MIR202	574448	genome.wustl.edu	37	10	135061186	135061186	+	RNA	SNP	G	G	A	rs570376093	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:135061186G>A	ENST00000300167.6	-	0	114				MIR202_ENST00000362219.2_RNA|MIR202_ENST00000553459.1_RNA					microRNA 202																		CGGGCAGCAGGGAGAAGTCGG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		12340	0.002		0.0	False		,,,				2504	0.001																0								ENSG00000166917						10.0	16.0	14.0					10																	135061186		691	1590	2281	MIR202			0			-	HGNC			10q26.3	2011-09-12		2008-12-18	ENSG00000199089	ENSG00000278352		"""ncRNAs / Micro RNAs"""	32080	non-coding RNA	RNA, micro				MIRN202			Standard	NR_030170		Approved	hsa-mir-202	uc009ybh.2				10.37:g.135061186G>A		Somatic	0	92	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	42	43.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300167.6	37	NULL		10																																																																																			-	-		0.677	MIR202-001	KNOWN	basic|exp_conf	antisense	MIR202	antisense	OTTHUMT00000409806.1	G	NR_030170	-		135061186	-1	no_errors	ENST00000300167	ensembl	human	known	74_37	rna	SNP	0.018	A
CDH9	1007	genome.wustl.edu	37	5	26988233	26988233	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:26988233C>T	ENST00000231021.4	-	2	380	c.208G>A	c.(208-210)Gac>Aac	p.D70N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	70	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TATTGTGTGTCAGTACCTGTG	0.393																																					Melanoma(8;187 585 15745 40864 52829)												0								ENSG00000113100						76.0	73.0	74.0					5																	26988233		2203	4300	6503	CDH9	SO:0001583	missense	0			-	HGNC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.208G>A	5.37:g.26988233C>T	ENSP00000231021:p.Asp70Asn	Somatic	0	29	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q3B7I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D70N	ENST00000231021.4	37	c.208	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260654	0.80246	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.00590	6.36;6.36;6.36	5.64	5.64	0.86602	Cadherin (1);Cadherin-like (1);	0.049238	0.85682	D	0.000000	T	0.01765	0.0056	L	0.46819	1.47	0.58432	D	0.999997	D;B	0.60575	0.988;0.169	P;B	0.61722	0.893;0.31	T	0.76732	-0.2851	9	.	.	.	.	18.2526	0.90009	0.0:1.0:0.0:0.0	.	70;70	E7EPN0;Q9ULB4	.;CADH9_HUMAN	N	70	ENSP00000231021:D70N;ENSP00000426239:D70N;ENSP00000422538:D70N	.	D	-	1	0	CDH9	27023990	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.447000	0.80620	2.652000	0.90054	0.591000	0.81541	GAC	-	pfam_Cadherin,superfamily_Cadherin-like		0.393	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	C	NM_016279	-		26988233	-1	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF469	84627	genome.wustl.edu	37	16	88504643	88504643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:88504643delC	ENST00000437464.1	+	2	10681	c.10681delC	c.(10681-10683)cctfs	p.P3561fs	ZNF469_ENST00000565624.1_Frame_Shift_Del_p.P3589fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGCCCCGGGCCTCTTCTCCA	0.672																																																	0								ENSG00000225614						14.0	19.0	17.0					16																	88504643		692	1587	2279	ZNF469	SO:0001589	frameshift_variant	0				HGNC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.10681delC	16.37:g.88504643delC	ENSP00000402343:p.Pro3561fs	Somatic	0	57	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	19	59.57		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P3561fs	ENST00000437464.1	37	c.10681	CCDS45544.1	16																																																																																			-	NULL		0.672	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	protein_coding		C	NG_012236			88504643	+1	no_errors	ENST00000437464	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
COL10A1	1300	genome.wustl.edu	37	6	116442752	116442752	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:116442752T>C	ENST00000327673.4	-	2	934	c.527A>G	c.(526-528)aAg>aGg	p.K176R	NT5DC1_ENST00000319550.4_Intron|AL121963.1_ENST00000430695.1_Intron|COL10A1_ENST00000243222.4_Missense_Mutation_p.K176R			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	176	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TGGTGCACCCTTTTCTCCAGG	0.592																																																	0								ENSG00000123500						38.0	40.0	39.0					6																	116442752		2203	4300	6503	COL10A1	SO:0001583	missense	0			-	HGNC		CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.527A>G	6.37:g.116442752T>C	ENSP00000327368:p.Lys176Arg	Somatic	0	48	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A1L4P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.K176R	ENST00000327673.4	37	c.527	CCDS5105.1	6	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065892	0.55539	.	.	ENSG00000123500	ENST00000243222;ENST00000327673;ENST00000452729	D;D;D	0.94184	-3.37;-3.37;-3.14	5.55	3.01	0.34805	.	0.101017	0.64402	D	0.000002	D	0.85923	0.5810	N	0.17379	0.485	0.54753	D	0.99998	D	0.63880	0.993	P	0.55615	0.78	T	0.82987	-0.0184	10	0.20046	T	0.44	.	12.3737	0.55269	0.0:0.0:0.2665:0.7335	.	176	Q03692	COAA1_HUMAN	R	176	ENSP00000243222:K176R;ENSP00000327368:K176R;ENSP00000411285:K176R	ENSP00000243222:K176R	K	-	2	0	COL10A1	116549445	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	6.161000	0.71868	0.411000	0.25702	0.533000	0.62120	AAG	-	NULL		0.592	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL10A1	protein_coding	OTTHUMT00000041926.1	T		-		116442752	-1	no_errors	ENST00000243222	ensembl	human	known	74_37	missense	SNP	1.000	C
TEX261	113419	genome.wustl.edu	37	2	71215822	71215822	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:71215822T>C	ENST00000272438.4	-	6	686	c.499A>G	c.(499-501)Acc>Gcc	p.T167A	TEX261_ENST00000466731.1_5'UTR|AC007040.11_ENST00000606025.1_Intron	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261	167						integral component of membrane (GO:0016021)				NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						TTGCCTTTGGTGAAATAATTG	0.498																																																	0								ENSG00000144043						115.0	106.0	109.0					2																	71215822		2203	4300	6503	TEX261	SO:0001583	missense	0			-	HGNC	AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.499A>G	2.37:g.71215822T>C	ENSP00000272438:p.Thr167Ala	Somatic	0	48	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A1A587|D6W5G9|Q8WUJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transmembrane_adaptor_Erv26	p.T167A	ENST00000272438.4	37	c.499	CCDS1914.1	2	.	.	.	.	.	.	.	.	.	.	T	12.29	1.893443	0.33442	.	.	ENSG00000144043	ENST00000272438	.	.	.	5.5	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.44222	0.1283	N	0.16201	0.385	0.58432	D	0.999997	P	0.51147	0.942	P	0.54210	0.745	T	0.19976	-1.0289	9	0.15499	T	0.54	-19.2233	11.2362	0.48942	0.0:0.0:0.1535:0.8465	.	167	Q6UWH6	TX261_HUMAN	A	167	.	ENSP00000272438:T167A	T	-	1	0	TEX261	71069330	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.252000	0.78309	1.023000	0.39654	0.533000	0.62120	ACC	-	pfam_Transmembrane_adaptor_Erv26		0.498	TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX261	protein_coding	OTTHUMT00000251916.1	T	NM_144582	-		71215822	-1	no_errors	ENST00000272438	ensembl	human	known	74_37	missense	SNP	1.000	C
FGF9	2254	genome.wustl.edu	37	13	22275848	22275849	+	3'UTR	INS	-	-	TGTGTG	rs138451360|rs377431851|rs112896362|rs61706549|rs201279299|rs79021222|rs9796160|rs71093347|rs398037423	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr13:22275848_22275849insTGTGTG	ENST00000382353.5	+	0	1431_1432				FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9						angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		GAgtgtgtgtatgtgtgtgtgt	0.525																																					Melanoma(195;1939 2127 12623 13963 52730)												0								ENSG00000102678																																			FGF9	SO:0001624	3_prime_UTR_variant	0				HGNC	D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.*275->TGTGTG	13.37:g.22275849_22275854dupTGTGTG		Somatic	NA	NA	NA		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K427|Q3SY32	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382353.5	37	NULL	CCDS9298.1	13																																																																																			-	-		0.525	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	protein_coding	OTTHUMT00000046002.2	-				22275849	+1	no_errors	ENST00000478546	ensembl	human	known	74_37	rna	INS	0.004:0.000	TGTGTG
ERBB2	2064	genome.wustl.edu	37	17	37872823	37872823	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:37872823C>T	ENST00000269571.5	+	14	1861	c.1702C>T	c.(1702-1704)Cag>Tag	p.Q568*	ERBB2_ENST00000445658.2_Nonsense_Mutation_p.Q292*|ERBB2_ENST00000584450.1_Nonsense_Mutation_p.Q568*|ERBB2_ENST00000584601.1_Nonsense_Mutation_p.Q538*|ERBB2_ENST00000406381.2_Nonsense_Mutation_p.Q538*|ERBB2_ENST00000540042.1_Nonsense_Mutation_p.Q538*|ERBB2_ENST00000540147.1_Nonsense_Mutation_p.Q538*|ERBB2_ENST00000578199.1_Nonsense_Mutation_p.Q538*|ERBB2_ENST00000541774.1_Nonsense_Mutation_p.Q553*			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	568					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CCCTGAGTGTCAGCCCCAGAA	0.637		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																														Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0								ENSG00000141736						79.0	67.0	71.0					17																	37872823		2203	4300	6503	ERBB2	SO:0001587	stop_gained	0			-	HGNC	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1702C>T	17.37:g.37872823C>T	ENSP00000269571:p.Gln568*	Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q568*	ENST00000269571.5	37	c.1702	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.590034	0.98875	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	.	.	.	5.93	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6563	0.77136	0.0:0.8623:0.1377:0.0	.	.	.	.	X	538;553;292;568;538;538	.	ENSP00000269571:Q568X	Q	+	1	0	ERBB2	35126349	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.916000	0.48813	1.477000	0.48234	0.561000	0.74099	CAG	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat		0.637	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	protein_coding	OTTHUMT00000445621.2	C		-		37872823	+1	no_errors	ENST00000269571	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RBP3	5949	genome.wustl.edu	37	10	48389030	48389030	+	Silent	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:48389030G>A	ENST00000224600.4	-	1	1961	c.1848C>T	c.(1846-1848)atC>atT	p.I616I	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	616	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CGGCCAGCACGATGGCATCGG	0.672																																																	0								ENSG00000107618						31.0	32.0	32.0					10																	48389030		2196	4292	6488	RBP3	SO:0001819	synonymous_variant	0			-	HGNC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1848C>T	10.37:g.48389030G>A		Somatic	0	75	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.I616	ENST00000224600.4	37	c.1848	CCDS7218.1	10																																																																																			-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	protein_coding	OTTHUMT00000047888.1	G	NM_002900	-		48389030	-1	no_errors	ENST00000224600	ensembl	human	known	74_37	silent	SNP	0.981	A
SLC13A4	26266	genome.wustl.edu	37	7	135412200	135412200	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:135412200C>T	ENST00000354042.4	-	1	734	c.45G>A	c.(43-45)ctG>ctA	p.L15L	FAM180A_ENST00000435869.1_5'Flank	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	15					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						CGCAGACGACCAGCAGCAGCT	0.697																																																	0								ENSG00000164707						28.0	26.0	27.0					7																	135412200		1930	3671	5601	SLC13A4	SO:0001819	synonymous_variant	0			-	HGNC	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.45G>A	7.37:g.135412200C>T		Somatic	0	62	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A4D1Q4|Q8N631	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.L15	ENST00000354042.4	37	c.45	CCDS5840.1	7																																																																																			-	pfam_Na/sul_symport		0.697	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	protein_coding	OTTHUMT00000340558.1	C	NM_012450	-		135412200	-1	no_errors	ENST00000354042	ensembl	human	known	74_37	silent	SNP	0.998	T
SLC30A9	10463	genome.wustl.edu	37	4	42041023	42041024	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:42041023_42041024delAG	ENST00000264451.7	+	8	870_871	c.690_691delAG	c.(688-693)tcagtgfs	p.V231fs		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	231					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAACAGCATCAGTGTTTTTTAA	0.347																																																	0								ENSG00000014824																																			SLC30A9	SO:0001589	frameshift_variant	0				HGNC	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.690_691delAG	4.37:g.42041023_42041024delAG	ENSP00000264451:p.Val231fs	Somatic	0	158	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.F233fs	ENST00000264451.7	37	c.690_691	CCDS3465.1	4																																																																																			-	NULL		0.347	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	protein_coding	OTTHUMT00000216842.3	AG				42041024	+1	no_errors	ENST00000264451	ensembl	human	known	74_37	frame_shift_del	DEL	0.990:0.999	-
NPDC1	56654	genome.wustl.edu	37	9	139935530	139935531	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:139935530_139935531delCT	ENST00000371601.4	-	3	581_582	c.368_369delAG	c.(367-369)cagfs	p.Q123fs	NPDC1_ENST00000488145.1_5'UTR|NPDC1_ENST00000371600.3_Frame_Shift_Del_p.Q201fs	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	123						integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CCGGGAGCCGCTGTCGGTCCTT	0.653																																																	0								ENSG00000107281																																			NPDC1	SO:0001589	frameshift_variant	0				HGNC	AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.368_369delAG	9.37:g.139935530_139935531delCT	ENSP00000360660:p.Gln123fs	Somatic	0	84	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	34	44.26	Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NPDC1	p.Q201fs	ENST00000371601.4	37	c.603_602	CCDS7024.1	9																																																																																			-	pfam_NPDC1		0.653	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	protein_coding	OTTHUMT00000055182.1	CT	NM_015392			139935531	-1	no_errors	ENST00000371600	ensembl	human	known	74_37	frame_shift_del	DEL	0.001:0.001	-
ARHGEF28	64283	genome.wustl.edu	37	5	73236726	73236726	+	Missense_Mutation	SNP	C	C	A	rs181057055		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:73236726C>A	ENST00000426542.2	+	35	5026	c.5006C>A	c.(5005-5007)cCt>cAt	p.P1669H	ARHGEF28_ENST00000512883.1_Missense_Mutation_p.P615H|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.P1695H|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.P1695H|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.P1669H|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.P1356H|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.P1651H			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1669	Interaction with microtubules. {ECO:0000250}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TCACACCGCCCTCAACTGCAG	0.488																																																	0								ENSG00000214944																																			ARHGEF28	SO:0001583	missense	0			-	HGNC		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.5006C>A	5.37:g.73236726C>A	ENSP00000412175:p.Pro1669His	Somatic	0	72	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.P1695H	ENST00000426542.2	37	c.5084	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541530	0.65085	.	.	ENSG00000214944	ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T	0.40476	2.51;2.94;2.54;2.51;2.94;2.76;1.03	5.27	3.44	0.39384	.	.	.	.	.	T	0.33089	0.0851	N	0.19112	0.55	0.09310	N	1	P;P;P;P	0.51240	0.838;0.838;0.838;0.943	B;B;B;P	0.48166	0.297;0.297;0.297;0.569	T	0.10154	-1.0642	9	0.87932	D	0	.	6.8492	0.24005	0.1738:0.7365:0.0:0.0897	.	1356;1669;1695;615	B5MDA3;Q8N1W1;E9PC75;D6RGZ3	.;RGNEF_HUMAN;.;.	H	1695;1669;1651;1695;1669;1356;615	ENSP00000441913:P1695H;ENSP00000441436:P1669H;ENSP00000287898:P1651H;ENSP00000411459:P1695H;ENSP00000412175:P1669H;ENSP00000296799:P1356H;ENSP00000421081:P615H	ENSP00000287898:P1651H	P	+	2	0	RP11-428C6.1	73272482	0.001000	0.12720	0.011000	0.14972	0.437000	0.31866	0.910000	0.28571	1.446000	0.47643	0.650000	0.86243	CCT	-	NULL		0.488	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	protein_coding	OTTHUMT00000368975.1	C		-		73236726	+1	no_errors	ENST00000545377	ensembl	human	known	74_37	missense	SNP	0.003	A
TMEM131	23505	genome.wustl.edu	37	2	98409102	98409102	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:98409102C>T	ENST00000186436.5	-	31	4119	c.3891G>A	c.(3889-3891)ccG>ccA	p.P1297P		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1297	Pro-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GCTGCTCCAGCGGGCTGTGGG	0.642																																																	0								ENSG00000075568						29.0	33.0	31.0					2																	98409102		2162	4276	6438	TMEM131	SO:0001819	synonymous_variant	0			-	HGNC	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3891G>A	2.37:g.98409102C>T		Somatic	0	56	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3651_TMEM131	p.P1297	ENST00000186436.5	37	c.3891	CCDS46368.1	2																																																																																			-	NULL		0.642	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	C	XM_371542	-		98409102	-1	no_errors	ENST00000186436	ensembl	human	known	74_37	silent	SNP	0.000	T
PRR27	401137	genome.wustl.edu	37	4	71024318	71024318	+	Missense_Mutation	SNP	T	T	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:71024318T>A	ENST00000344526.5	+	3	538	c.349T>A	c.(349-351)Ttt>Att	p.F117I	C4orf40_ENST00000502441.2_3'UTR|C4orf40_ENST00000502294.1_Missense_Mutation_p.F117I	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		117	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TCCTTCAAGGTTTTTTTCAGC	0.547																																																	0								ENSG00000187533						148.0	152.0	151.0					4																	71024318		2203	4300	6503	C4orf40	SO:0001583	missense	0			-	HGNC																												ENST00000344526.5:c.349T>A	4.37:g.71024318T>A	ENSP00000343172:p.Phe117Ile	Somatic	0	56	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	25	40.48	A8MXP0|Q6MZR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F117I	ENST00000344526.5	37	c.349	CCDS3535.1	4	.	.	.	.	.	.	.	.	.	.	T	2.451	-0.326363	0.05350	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.27890	1.64;1.64	2.91	-4.36	0.03645	.	.	.	.	.	T	0.08179	0.0204	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23619	-1.0183	9	0.32370	T	0.25	9.0E-4	0.3708	0.00379	0.2991:0.1896:0.13:0.3813	.	117	Q6MZM9	CD040_HUMAN	I	117	ENSP00000426249:F117I;ENSP00000343172:F117I	ENSP00000343172:F117I	F	+	1	0	C4orf40	71058907	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.424000	0.07025	-0.459000	0.07013	-2.739000	0.00128	TTT	-	NULL		0.547	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf40	protein_coding	OTTHUMT00000251558.1	T		-		71024318	+1	no_errors	ENST00000344526	ensembl	human	known	74_37	missense	SNP	0.000	A
DGKZ	8525	genome.wustl.edu	37	11	46393986	46393986	+	Missense_Mutation	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:46393986G>T	ENST00000454345.1	+	12	1625	c.1500G>T	c.(1498-1500)aaG>aaT	p.K500N	DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000456247.2_Missense_Mutation_p.K311N|DGKZ_ENST00000527911.1_Missense_Mutation_p.K312N|DGKZ_ENST00000343674.6_Missense_Mutation_p.K328N|DGKZ_ENST00000528615.1_Missense_Mutation_p.K90N|DGKZ_ENST00000318201.8_Missense_Mutation_p.K289N|DGKZ_ENST00000532868.2_Missense_Mutation_p.K316N|DGKZ_ENST00000421244.2_Missense_Mutation_p.K312N|DGKZ_ENST00000395574.3_Missense_Mutation_p.K278N	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	500	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.|Mediates interaction with RASGRP1.				blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		AGGGTGCAAAGATCATCCAGT	0.582																																																	0								ENSG00000149091						96.0	75.0	82.0					11																	46393986		2202	4299	6501	DGKZ	SO:0001583	missense	0			-	HGNC	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.1500G>T	11.37:g.46393986G>T	ENSP00000412178:p.Lys500Asn	Somatic	0	30	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K500N	ENST00000454345.1	37	c.1500	CCDS41640.1	11	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368542	0.61624	.	.	ENSG00000149091	ENST00000343674;ENST00000528615;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345	T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	4.68	3.76	0.43208	Diacylglycerol kinase, catalytic domain (3);	0.045925	0.85682	D	0.000000	T	0.45094	0.1325	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.67145	0.993;0.993;0.994;0.993;0.986;0.979;0.979;0.981;0.996	D;D;D;D;D;D;D;D;D	0.77557	0.962;0.983;0.974;0.962;0.976;0.952;0.936;0.94;0.99	T	0.41034	-0.9531	10	0.87932	D	0	.	10.4922	0.44756	0.1593:0.0:0.8407:0.0	.	289;277;255;312;500;311;312;278;328	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.	N	328;90;278;277;312;311;312;289;500	ENSP00000343065:K328N;ENSP00000434719:K90N;ENSP00000378941:K278N;ENSP00000436273:K277N;ENSP00000436291:K312N;ENSP00000395684:K311N;ENSP00000391021:K312N;ENSP00000320340:K289N;ENSP00000412178:K500N	ENSP00000320340:K289N	K	+	3	2	DGKZ	46350562	1.000000	0.71417	0.997000	0.53966	0.668000	0.39293	3.938000	0.56583	1.099000	0.41499	0.467000	0.42956	AAG	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom		0.582	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKZ	protein_coding	OTTHUMT00000389772.1	G	NM_001105540	-		46393986	+1	no_errors	ENST00000454345	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD12	23253	genome.wustl.edu	37	18	9256921	9256921	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr18:9256921C>T	ENST00000262126.4	+	9	3896	c.3656C>T	c.(3655-3657)aCa>aTa	p.T1219I	ANKRD12_ENST00000400020.3_Missense_Mutation_p.T1196I|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.T1196I	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1219						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TGCCATACTACAGTGACAACC	0.423																																																	0								ENSG00000101745						68.0	71.0	70.0					18																	9256921		2202	4300	6502	ANKRD12	SO:0001583	missense	0			-	HGNC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3656C>T	18.37:g.9256921C>T	ENSP00000262126:p.Thr1219Ile	Somatic	0	44	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T1219I	ENST00000262126.4	37	c.3656	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486620	0.63962	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.67698	-0.28;-0.28	5.79	5.79	0.91817	.	0.152217	0.64402	D	0.000018	T	0.75664	0.3880	M	0.67953	2.075	0.44918	D	0.997939	D;D	0.56746	0.977;0.961	P;P	0.51016	0.656;0.454	T	0.77900	-0.2415	10	0.72032	D	0.01	-26.1195	20.0417	0.97594	0.0:1.0:0.0:0.0	.	1196;1219	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	I	1196;1219	ENSP00000372932:T1196I;ENSP00000262126:T1219I	ENSP00000262126:T1219I	T	+	2	0	ANKRD12	9246921	0.999000	0.42202	0.373000	0.26003	0.985000	0.73830	4.625000	0.61262	2.736000	0.93811	0.655000	0.94253	ACA	-	NULL		0.423	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	protein_coding	OTTHUMT00000254478.2	C	NM_015208	-		9256921	+1	no_errors	ENST00000262126	ensembl	human	known	74_37	missense	SNP	0.949	T
NFE2L1	4779	genome.wustl.edu	37	17	46128077	46128077	+	5'UTR	DEL	A	A	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:46128077delA	ENST00000362042.3	+	0	213				NFE2L1_ENST00000361665.3_5'UTR|RP5-890E16.2_ENST00000584428.1_RNA|NFE2L1_ENST00000579481.1_3'UTR|NFE2L1_ENST00000357480.5_5'UTR|NFE2L1_ENST00000585291.1_5'UTR	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1						anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGGGAGAAGGAAAAAAAAAAT	0.488																																																	0								ENSG00000082641																																			NFE2L1	SO:0001623	5_prime_UTR_variant	0				HGNC	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.-404A>-	17.37:g.46128077delA		Somatic	0	26	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	D3DTU3|D3DTU5|Q12877|Q96FN6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000362042.3	37	NULL	CCDS11524.1	17																																																																																			-	-		0.488	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	protein_coding	OTTHUMT00000443019.1	A	NM_003204			46128077	+1	no_errors	ENST00000579481	ensembl	human	known	74_37	rna	DEL	0.035	-
AHNAK	79026	genome.wustl.edu	37	11	62286210	62286210	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:62286210G>A	ENST00000378024.4	-	5	15953	c.15679C>T	c.(15679-15681)Cca>Tca	p.P5227S	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5227					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTTGCTTCTGGACCTTGCAGA	0.512																																																	0								ENSG00000124942						141.0	121.0	127.0					11																	62286210		2202	4299	6501	AHNAK	SO:0001583	missense	0			-	HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15679C>T	11.37:g.62286210G>A	ENSP00000367263:p.Pro5227Ser	Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00	A1A586	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P5227S	ENST00000378024.4	37	c.15679	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188882	0.57909	.	.	ENSG00000124942	ENST00000378024	T	0.03152	4.03	4.99	4.99	0.66335	.	0.000000	0.45606	D	0.000352	T	0.18383	0.0441	M	0.74546	2.27	0.34187	D	0.671663	D	0.71674	0.998	D	0.87578	0.998	T	0.10520	-1.0626	10	0.39692	T	0.17	-4.1066	17.896	0.88888	0.0:0.0:1.0:0.0	.	5227	Q09666	AHNK_HUMAN	S	5227	ENSP00000367263:P5227S	ENSP00000367263:P5227S	P	-	1	0	AHNAK	62042786	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.369000	0.44231	2.308000	0.77769	0.643000	0.83706	CCA	-	NULL		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	G	NM_024060	-		62286210	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	SNP	1.000	A
AMY1C	278	genome.wustl.edu	37	1	104297408	104297408	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:104297408G>A	ENST00000370079.3	+	7	1137	c.1073G>A	c.(1072-1074)cGt>cAt	p.R358H		NM_001008219.1	NP_001008220.1	P04745	AMY1_HUMAN	amylase, alpha 1C (salivary)	358					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			lung(5)|skin(3)	8		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		TCAAGCTACCGTTGGCCAAGA	0.323																																																	0								ENSG00000187733																																			AMY1C	SO:0001583	missense	0			-	HGNC		CCDS30784.1	1p21	2012-10-02	2007-05-03		ENSG00000187733	ENSG00000187733	3.2.1.1		476	protein-coding gene	gene with protein product		104702	"""amylase, alpha 1C; salivary"""	AMY1			Standard	XM_005270761		Approved			P04745	OTTHUMG00000011045	ENST00000370079.3:c.1073G>A	1.37:g.104297408G>A	ENSP00000359096:p.Arg358His	Somatic	0	19	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	1	90.91	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R358H	ENST00000370079.3	37	c.1073	CCDS30784.1	1	.	.	.	.	.	.	.	.	.	.	G	3.071	-0.191123	0.06299	.	.	ENSG00000187733	ENST00000370079	.	.	.	2.23	1.23	0.21249	.	0.055619	0.64402	D	0.000002	T	0.35856	0.0946	L	0.45228	1.405	0.50313	D	0.999863	.	.	.	.	.	.	T	0.12319	-1.0552	7	0.22109	T	0.4	.	9.1661	0.37052	0.1186:0.0:0.8814:0.0	.	.	.	.	H	358	.	ENSP00000359096:R358H	R	+	2	0	AMY1C	104098931	0.710000	0.27896	0.524000	0.27887	0.466000	0.32739	2.272000	0.43373	0.228000	0.21019	0.184000	0.17185	CGT	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom		0.323	AMY1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY1C	protein_coding	OTTHUMT00000030375.1	G	NM_001008219	-		104297408	+1	no_errors	ENST00000370079	ensembl	human	known	74_37	missense	SNP	0.998	A
ATMIN	23300	genome.wustl.edu	37	16	81077734	81077735	+	Frame_Shift_Del	DEL	AT	AT	-	rs535702865|rs541174089	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:81077734_81077735delAT	ENST00000299575.4	+	4	1655_1656	c.1631_1632delAT	c.(1630-1632)catfs	p.H544fs	ATMIN_ENST00000566488.1_Frame_Shift_Del_p.H388fs|ATMIN_ENST00000539819.1_3'UTR|ATMIN_ENST00000564241.1_Frame_Shift_Del_p.H388fs	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	544					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						ACAGTAACTCATAGTTTGTTAC	0.356																																																	0								ENSG00000166454																																			ATMIN	SO:0001589	frameshift_variant	0				HGNC	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1631_1632delAT	16.37:g.81077734_81077735delAT	ENSP00000299575:p.His544fs	Somatic	0	50	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	A8K4H8|Q68DC9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like	p.H544fs	ENST00000299575.4	37	c.1631_1632	CCDS32494.1	16																																																																																			-	NULL		0.356	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	protein_coding	OTTHUMT00000432140.1	AT	NM_015251			81077735	+1	no_errors	ENST00000299575	ensembl	human	known	74_37	frame_shift_del	DEL	0.052:0.000	-
LINC01317	104355287	genome.wustl.edu	37	2	33952486	33952486	+	lincRNA	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:33952486C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GGTTGTGGTACACGTAGGGGC	0.632																																																	0								ENSG00000239649																																			MYADML			0			-	HGNC																													2.37:g.33952486C>T		Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.632	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	C		-		33952486	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	SNP	0.071	T
MBD3L1	85509	genome.wustl.edu	37	19	8953669	8953669	+	Silent	SNP	G	G	T	rs370088504		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:8953669G>T	ENST00000595891.1	+	3	546	c.315G>T	c.(313-315)ctG>ctT	p.L105L	MBD3L1_ENST00000305625.2_Silent_p.L105L			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GTGGATCTCTGCTGGAGGATC	0.532																																																	0								ENSG00000170948						92.0	79.0	84.0					19																	8953669		2203	4300	6503	MBD3L1	SO:0001819	synonymous_variant	0			-	HGNC	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.315G>T	19.37:g.8953669G>T		Somatic	0	68	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	B5BUM6|Q2M291	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L105	ENST00000595891.1	37	c.315	CCDS12209.1	19																																																																																			-	NULL		0.532	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	protein_coding	OTTHUMT00000459973.1	G	NM_145208	-		8953669	+1	no_errors	ENST00000305625	ensembl	human	known	74_37	silent	SNP	0.000	T
RSL1D1	26156	genome.wustl.edu	37	16	11941583	11941584	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:11941583_11941584delTT	ENST00000571133.1	-	3	397_398	c.325_326delAA	c.(325-327)aagfs	p.K109fs	RSL1D1_ENST00000542106.1_5'UTR	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	109					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						CTGTTCTGTCTTTTCAGGAGTT	0.337																																																	0								ENSG00000171490																																			RSL1D1	SO:0001589	frameshift_variant	0				HGNC	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.325_326delAA	16.37:g.11941585_11941586delTT	ENSP00000460871:p.Lys109fs	Somatic	0	68	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	31	48.33	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like	p.K109fs	ENST00000571133.1	37	c.326_325	CCDS10551.1	16																																																																																			-	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like		0.337	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL1D1	protein_coding	OTTHUMT00000252059.2	TT	NM_015659			11941584	-1	no_errors	ENST00000571133	ensembl	human	known	74_37	frame_shift_del	DEL	0.995:0.892	-
SNX16	64089	genome.wustl.edu	37	8	82727641	82727641	+	Intron	DEL	A	A	-	rs55997432	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:82727641delA	ENST00000345957.4	-	5	890				SNX16_ENST00000396330.2_Intron|RP13-923O23.6_ENST00000524337.1_RNA|SNX16_ENST00000353788.4_Intron	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16						early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						TTTTCAAAGGAAAAAAAAAAT	0.343													|||unknown(HR)	622	0.124201	0.0825	0.1744	5008	,	,		16519	0.1825		0.0686	False		,,,				2504	0.1421																0								ENSG00000253334		,,	34,491,3737		0,0,34,13,465,1619	43.0	41.0	42.0		,,	-8.8	0.0	8	dbSNP_130	47	79,815,7360		0,0,79,17,781,3250	no	intron,intron,intron	SNX16	NM_152837.2,NM_152836.2,NM_022133.3	,,	0,0,113,30,1246,4869	A1A1,A1A2,A1R,A2A2,A2R,RR		10.8311,12.3182,11.3375	,,	,,	82727641	113,1306,11097	2201	4300	6501	RP13-923O23.6	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.612-12T>-	8.37:g.82727641delA		Somatic	0	19	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	A8K4D8|Q658L0|Q8N4U3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000345957.4	37	NULL	CCDS6234.1	8																																																																																			-	-		0.343	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253334	protein_coding	OTTHUMT00000379929.1	A	NM_022133			82727641	+1	no_errors	ENST00000524337	ensembl	human	known	74_37	rna	DEL	0.496	-
ANP32B	10541	genome.wustl.edu	37	9	100767419	100767419	+	Silent	SNP	A	A	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:100767419A>G	ENST00000339399.4	+	4	696	c.501A>G	c.(499-501)gaA>gaG	p.E167E		NM_006401.2	NP_006392.1	Q92688	AN32B_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member B	167	Asp/Glu-rich (highly acidic).				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|inner ear development (GO:0048839)|negative regulation of cell differentiation (GO:0045596)|nucleosome assembly (GO:0006334)|palate development (GO:0060021)|positive regulation of protein export from nucleus (GO:0046827)|vasculature development (GO:0001944)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	histone binding (GO:0042393)|RNA polymerase binding (GO:0070063)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6		Acute lymphoblastic leukemia(62;0.0559)				GTGTGGATGAAGAGGAGGAGG	0.542																																																	0								ENSG00000136938						93.0	76.0	82.0					9																	100767419		2203	4300	6503	ANP32B	SO:0001819	synonymous_variant	0			-	HGNC	Y07969	CCDS6732.1	9q22.32	2010-06-17			ENSG00000136938	ENSG00000136938		"""ANP32 acidic nuclear phosphoproteins"""	16677	protein-coding gene	gene with protein product	"""acidic protein rich in leucines"""					9285060, 9473664	Standard	NM_006401		Approved	SSP29, PHAPI2, APRIL	uc004aya.3	Q92688	OTTHUMG00000020338	ENST00000339399.4:c.501A>G	9.37:g.100767419A>G		Somatic	0	68	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R9C7|O00655|P78458|P78459	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_U2A'_phosphoprotein32A_C	p.E167	ENST00000339399.4	37	c.501	CCDS6732.1	9																																																																																			-	NULL		0.542	ANP32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32B	protein_coding	OTTHUMT00000053346.4	A	NM_006401	-		100767419	+1	no_errors	ENST00000339399	ensembl	human	known	74_37	silent	SNP	0.986	G
PRKAR2B	5577	genome.wustl.edu	37	7	106786808	106786809	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:106786808_106786809delTA	ENST00000265717.4	+	6	902_903	c.643_644delTA	c.(643-645)tatfs	p.Y215fs		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	215					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TGTTGGTAACTATGATAATCGT	0.416																																																	0								ENSG00000005249																																			PRKAR2B	SO:0001589	frameshift_variant	0				HGNC		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.643_644delTA	7.37:g.106786808_106786809delTA	ENSP00000265717:p.Tyr215fs	Somatic	0	84	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	37	39.34	A4D0R9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.Y215fs	ENST00000265717.4	37	c.643_644	CCDS5740.1	7																																																																																			-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom		0.416	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR2B	protein_coding	OTTHUMT00000268386.1	TA				106786809	+1	no_errors	ENST00000265717	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
ACAP1	9744	genome.wustl.edu	37	17	7250169	7250169	+	Silent	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:7250169G>A	ENST00000158762.3	+	13	1256	c.1050G>A	c.(1048-1050)ctG>ctA	p.L350L		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	350	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						TCCTGCAGCTGTGGGTCAGTG	0.632																																																	0								ENSG00000072818						92.0	89.0	90.0					17																	7250169		2203	4300	6503	ACAP1	SO:0001819	synonymous_variant	0			-	HGNC	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1050G>A	17.37:g.7250169G>A		Somatic	0	38	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	Q53XN9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.L350	ENST00000158762.3	37	c.1050	CCDS11101.1	17																																																																																			-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.632	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	protein_coding	OTTHUMT00000220049.4	G	NM_014716	-		7250169	+1	no_errors	ENST00000158762	ensembl	human	known	74_37	silent	SNP	0.998	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693														1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT		Somatic	NA	NA	NA		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRG1|A6NIR9|Q70LJ1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	-				46048197	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	INS	0.001:0.001	CGCTGGT
IRF3	3661	genome.wustl.edu	37	19	50165229	50165230	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:50165229_50165230delAC	ENST00000597198.1	-	6	1338_1339	c.957_958delGT	c.(955-960)gtgtttfs	p.F320fs	IRF3_ENST00000377135.4_Intron|IRF3_ENST00000598808.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000596822.1_Intron|IRF3_ENST00000600022.1_Intron|IRF3_ENST00000599223.1_Intron|IRF3_ENST00000596765.1_Intron|IRF3_ENST00000599680.1_5'Flank|IRF3_ENST00000593922.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000599144.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000377139.3_Frame_Shift_Del_p.F320fs|IRF3_ENST00000600911.1_Frame_Shift_Del_p.F320fs|IRF3_ENST00000309877.7_Frame_Shift_Del_p.F320fs|IRF3_ENST00000601291.1_Frame_Shift_Del_p.F320fs			Q14653	IRF3_HUMAN	interferon regulatory factor 3	320	Involved in HERC5 binding.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		CCCAGGTCAAACACGCCTCCTT	0.609																																																	0								ENSG00000126456																																			IRF3	SO:0001589	frameshift_variant	0				HGNC		CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.957_958delGT	19.37:g.50165231_50165232delAC	ENSP00000469113:p.Phe320fs	Somatic	0	67	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	28	42.86	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.F320fs	ENST00000597198.1	37	c.958_957	CCDS12775.1	19																																																																																			-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain		0.609	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IRF3	protein_coding	OTTHUMT00000465962.1	AC	NM_001571			50165230	-1	no_errors	ENST00000309877	ensembl	human	known	74_37	frame_shift_del	DEL	0.004:0.003	-
HERC1	8925	genome.wustl.edu	37	15	63904735	63904735	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:63904735C>T	ENST00000443617.2	-	77	14202	c.14115G>A	c.(14113-14115)ggG>ggA	p.G4705G		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4705	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCCAGGACATCCCTTCTCGGA	0.592																																																	0								ENSG00000103657						100.0	98.0	99.0					15																	63904735		2156	4253	6409	HERC1	SO:0001819	synonymous_variant	0			-	HGNC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.14115G>A	15.37:g.63904735C>T		Somatic	0	85	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q8IW65	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.G4705	ENST00000443617.2	37	c.14115	CCDS45277.1	15																																																																																			-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.592	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	protein_coding	OTTHUMT00000418523.1	C	NM_003922	-		63904735	-1	no_errors	ENST00000443617	ensembl	human	known	74_37	silent	SNP	0.304	T
SGOL1	151648	genome.wustl.edu	37	3	20212755	20212755	+	Intron	DEL	A	A	-	rs202135893|rs369158870	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:20212755delA	ENST00000263753.4	-	7	1422				SGOL1_ENST00000460637.1_5'UTR|SGOL1_ENST00000417364.1_Intron|SGOL1_ENST00000419233.2_Intron|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000425061.1_Intron|SGOL1_ENST00000442720.1_Intron|SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000306698.2_Intron|SGOL1_ENST00000452020.1_Intron|SGOL1_ENST00000412868.1_Intron|SGOL1_ENST00000437051.1_Intron|SGOL1_ENST00000443724.1_Intron|SGOL1_ENST00000412997.1_Intron|SGOL1_ENST00000421451.1_Intron|SGOL1_ENST00000383774.1_Intron	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)						attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						AATATGATTTAAAAAAAAAAA	0.308																																																	0								ENSG00000129810						26.0	28.0	27.0					3																	20212755		2201	4297	6498	SGOL1	SO:0001627	intron_variant	0				HGNC	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.1283-31T>-	3.37:g.20212755delA		Somatic	0	24	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263753.4	37	NULL	CCDS33716.1	3																																																																																			-	-		0.308	SGOL1-009	KNOWN	basic|CCDS	protein_coding	SGOL1	protein_coding	OTTHUMT00000340498.1	A	NM_138484			20212755	-1	no_errors	ENST00000460637	ensembl	human	putative	74_37	rna	DEL	0.000	-
FRMD1	79981	genome.wustl.edu	37	6	168464403	168464403	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:168464403G>A	ENST00000283309.6	-	6	746	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W	FRMD1_ENST00000440994.2_Missense_Mutation_p.R160W|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.R228W(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCATGTGCCGGAGGATGTAG	0.657																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												1	Substitution - Missense(1)	ovary(1)						ENSG00000153303						103.0	86.0	92.0					6																	168464403		2203	4300	6503	FRMD1	SO:0001583	missense	0			-	HGNC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.682C>T	6.37:g.168464403G>A	ENSP00000283309:p.Arg228Trp	Somatic	0	30	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.R228W	ENST00000283309.6	37	c.682	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	11.08	1.532869	0.27387	.	.	ENSG00000153303	ENST00000283309;ENST00000440994	T;T	0.78707	-1.2;-1.2	2.83	0.191	0.15130	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.506221	0.18349	U	0.143925	T	0.77425	0.4128	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;P	0.65140	0.932;0.932;0.888	T	0.77104	-0.2711	10	0.87932	D	0	.	9.1883	0.37184	0.0:0.0:0.3699:0.6301	.	140;228;160	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	W	228;160	ENSP00000283309:R228W;ENSP00000414115:R160W	ENSP00000283309:R228W	R	-	1	2	FRMD1	168207252	0.549000	0.26481	0.003000	0.11579	0.137000	0.21094	-0.029000	0.12329	-0.172000	0.10779	0.305000	0.20034	CGG	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	protein_coding	OTTHUMT00000362513.2	G	NM_024919	-		168464403	-1	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	SNP	0.938	A
COQ9	57017	genome.wustl.edu	37	16	57493517	57493519	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	ACA	ACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:57493517_57493519delACA	ENST00000262507.6	+	7	821_823	c.752_754delACA	c.(751-756)tacaac>tac	p.N252del	AC009052.12_ENST00000567090.1_RNA|COQ9_ENST00000567933.1_In_Frame_Del_p.N141del|POLR2C_ENST00000219252.5_5'Flank|COQ9_ENST00000567072.1_In_Frame_Del_p.N217del	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	252					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						GCTGCCATCTACAACACAACAGA	0.532																																																	0								ENSG00000088682																																			COQ9	SO:0001651	inframe_deletion	0				HGNC	BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.752_754delACA	16.37:g.57493520_57493522delACA	ENSP00000262507:p.Asn252del	Somatic	0	36	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	5	78.26	A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_COQ9,superfamily_Homeodomain-like,tigrfam_Ubiq_biosynth_COQ9	p.N252in_frame_del	ENST00000262507.6	37	c.752_754	CCDS32459.1	16																																																																																			-	pfam_COQ9,tigrfam_Ubiq_biosynth_COQ9		0.532	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ9	protein_coding	OTTHUMT00000432598.3	ACA	NM_020312			57493519	+1	no_errors	ENST00000262507	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
TEX10	54881	genome.wustl.edu	37	9	103109310	103109310	+	Missense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:103109310C>A	ENST00000374902.4	-	3	735	c.559G>T	c.(559-561)Gta>Tta	p.V187L	TEX10_ENST00000537512.1_Missense_Mutation_p.V122L|TEX10_ENST00000535814.1_Missense_Mutation_p.V190L	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	187						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		ATAAGTTCTACAAAATTCTTA	0.408																																																	0								ENSG00000136891						67.0	71.0	70.0					9																	103109310		2203	4300	6503	TEX10	SO:0001583	missense	0			-	HGNC	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.559G>T	9.37:g.103109310C>A	ENSP00000364037:p.Val187Leu	Somatic	0	30	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	11	59.26	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPI1/TEX10,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V187L	ENST00000374902.4	37	c.559	CCDS6748.1	9	.	.	.	.	.	.	.	.	.	.	C	7.044	0.563062	0.13498	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000537512	T;T;T	0.61392	0.11;0.11;0.11	5.32	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	0.065999	0.64402	D	0.000007	T	0.33206	0.0855	N	0.03084	-0.415	0.45318	D	0.998312	B;B;B	0.21520	0.057;0.057;0.016	B;B;B	0.29942	0.109;0.066;0.049	T	0.25847	-1.0120	10	0.06494	T	0.89	-8.8888	13.9026	0.63815	0.1522:0.8478:0.0:0.0	.	122;190;187	B7Z9D5;B4DYV2;Q9NXF1	.;.;TEX10_HUMAN	L	190;187;122	ENSP00000444555:V190L;ENSP00000364037:V187L;ENSP00000438120:V122L	ENSP00000364037:V187L	V	-	1	0	TEX10	102149131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.166000	0.50785	2.484000	0.83849	0.591000	0.81541	GTA	-	pfam_IPI1/TEX10,superfamily_ARM-type_fold		0.408	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	protein_coding	OTTHUMT00000053416.1	C	NM_017746	-		103109310	-1	no_errors	ENST00000374902	ensembl	human	known	74_37	missense	SNP	1.000	A
OS9	10956	genome.wustl.edu	37	12	58114250	58114250	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:58114250G>A	ENST00000315970.7	+	14	1868	c.1827G>A	c.(1825-1827)tgG>tgA	p.W609*	OS9_ENST00000257966.8_Nonsense_Mutation_p.W555*|OS9_ENST00000435406.2_Nonsense_Mutation_p.W502*|OS9_ENST00000552285.1_Nonsense_Mutation_p.W554*|OS9_ENST00000389146.6_Nonsense_Mutation_p.W594*|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000551035.1_Nonsense_Mutation_p.W522*|OS9_ENST00000389142.5_Nonsense_Mutation_p.W539*|OS9_ENST00000413095.2_Nonsense_Mutation_p.W348*|OS9_ENST00000439210.2_Nonsense_Mutation_p.W480*	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	609					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GTGCACGTTGGCTGACTGATG	0.532																																																	0								ENSG00000135506						103.0	101.0	101.0					12																	58114250		2203	4300	6503	OS9	SO:0001587	stop_gained	0			-	HGNC	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1827G>A	12.37:g.58114250G>A	ENSP00000318165:p.Trp609*	Somatic	0	61	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.W609*	ENST00000315970.7	37	c.1827	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592723	0.66219	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	.	.	.	5.54	5.54	0.83059	.	0.066435	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.3968	0.83610	0.0:0.0:1.0:0.0	.	.	.	.	X	554;609;480;594;348;522;555;502;539	.	ENSP00000257966:W555X	W	+	3	0	OS9	56400517	1.000000	0.71417	1.000000	0.80357	0.170000	0.22686	7.150000	0.77403	2.606000	0.88127	0.655000	0.94253	TGG	-	NULL		0.532	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	protein_coding	OTTHUMT00000408344.1	G	NM_006812	-		58114250	+1	no_errors	ENST00000315970	ensembl	human	known	74_37	nonsense	SNP	1.000	A
FUZ	80199	genome.wustl.edu	37	19	50315965	50315965	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:50315965T>C	ENST00000313777.4	-	2	303	c.140A>G	c.(139-141)aAt>aGt	p.N47S	FUZ_ENST00000533418.1_5'UTR|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000526575.1_Missense_Mutation_p.N47S|FUZ_ENST00000534008.1_5'UTR|FUZ_ENST00000528094.1_Missense_Mutation_p.N47S|FUZ_ENST00000445575.2_Missense_Mutation_p.N47S	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	47					cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		GTGGACTCCATTGAGGGAACC	0.572																																																	0								ENSG00000010361						104.0	93.0	97.0					19																	50315965		2203	4300	6503	FUZ	SO:0001583	missense	0			-	HGNC	BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.140A>G	19.37:g.50315965T>C	ENSP00000313309:p.Asn47Ser	Somatic	0	51	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	24	46.67	B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N47S	ENST00000313777.4	37	c.140	CCDS12781.1	19	.	.	.	.	.	.	.	.	.	.	T	25.9	4.681243	0.88542	.	.	ENSG00000010361	ENST00000525130;ENST00000528094;ENST00000529634;ENST00000525370;ENST00000313777;ENST00000445575;ENST00000421740;ENST00000526575	T;T;T;T;T;T	0.72167	-0.46;-0.45;-0.46;-0.61;-0.63;-0.46	5.41	5.41	0.78517	.	0.055575	0.64402	D	0.000002	D	0.82939	0.5146	M	0.75085	2.285	0.49130	D	0.999754	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.87578	0.879;0.996;0.998	D	0.85087	0.0949	10	0.87932	D	0	-11.0987	13.0152	0.58753	0.0:0.0:0.0:1.0	.	47;47;47	B4DHF8;Q9BT04-3;Q9BT04	.;.;FUZZY_HUMAN	S	47	ENSP00000433492:N47S;ENSP00000435177:N47S;ENSP00000431420:N47S;ENSP00000313309:N47S;ENSP00000408018:N47S;ENSP00000433164:N47S	ENSP00000313309:N47S	N	-	2	0	FUZ	55007777	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.324000	0.65863	2.076000	0.62316	0.374000	0.22700	AAT	-	NULL		0.572	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUZ	protein_coding	OTTHUMT00000393986.1	T	NM_025129	-		50315965	-1	no_errors	ENST00000313777	ensembl	human	known	74_37	missense	SNP	1.000	C
SCNN1A	6337	genome.wustl.edu	37	12	6464514	6464514	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:6464514delT	ENST00000228916.2	-	6	1165	c.1067delA	c.(1066-1068)cagfs	p.Q356fs	SCNN1A_ENST00000360168.3_Frame_Shift_Del_p.Q415fs|SCNN1A_ENST00000538979.1_5'UTR|SCNN1A_ENST00000540037.1_Frame_Shift_Del_p.Q56fs|SCNN1A_ENST00000358945.3_Frame_Shift_Del_p.Q356fs|SCNN1A_ENST00000396966.2_Frame_Shift_Del_p.Q356fs|SCNN1A_ENST00000543768.1_Frame_Shift_Del_p.Q379fs	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	356					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	AGGTTCATCCTGCCCGTGCAC	0.587																																																	0								ENSG00000111319						57.0	48.0	51.0					12																	6464514		2203	4300	6503	SCNN1A	SO:0001589	frameshift_variant	0				HGNC	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1067delA	12.37:g.6464514delT	ENSP00000228916:p.Gln356fs	Somatic	0	32	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.Q356fs	ENST00000228916.2	37	c.1067	CCDS8543.1	12																																																																																			-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC		0.587	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCNN1A	protein_coding	OTTHUMT00000399055.1	T				6464514	-1	no_errors	ENST00000358945	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SLC29A2	3177	genome.wustl.edu	37	11	66136939	66136939	+	Missense_Mutation	SNP	G	G	T	rs200637398	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:66136939G>T	ENST00000357440.2	-	3	404	c.176C>A	c.(175-177)aCg>aAg	p.T59K	SLC29A2_ENST00000311161.7_Missense_Mutation_p.T59K|SLC29A2_ENST00000544554.1_Missense_Mutation_p.T59K|SLC29A2_ENST00000546034.1_Missense_Mutation_p.T59K	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	59					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTCGGGACCCGTGTGGTTGGT	0.632																																																	0								ENSG00000174669						200.0	192.0	195.0					11																	66136939		2200	4295	6495	SLC29A2	SO:0001583	missense	0			-	HGNC	X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.176C>A	11.37:g.66136939G>T	ENSP00000350024:p.Thr59Lys	Somatic	0	65	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt,tigrfam_Eqnu_transpt	p.T59K	ENST00000357440.2	37	c.176	CCDS8137.1	11	.	.	.	.	.	.	.	.	.	.	G	8.817	0.936548	0.18206	.	.	ENSG00000174669	ENST00000311161;ENST00000357440;ENST00000544554;ENST00000546034	T;T;T;T	0.21031	2.03;2.03;2.03;2.03	4.85	4.85	0.62838	.	2.852240	0.01007	N	0.003778	T	0.32376	0.0827	M	0.73598	2.24	0.34132	D	0.66535	P;B	0.49253	0.921;0.015	P;B	0.46275	0.51;0.012	T	0.49762	-0.8905	10	0.08179	T	0.78	-10.2633	9.2068	0.37293	0.0987:0.0:0.9013:0.0	.	59;59	G5E943;Q14542	.;S29A2_HUMAN	K	59	ENSP00000311250:T59K;ENSP00000350024:T59K;ENSP00000439456:T59K;ENSP00000440329:T59K	ENSP00000311250:T59K	T	-	2	0	SLC29A2	65893515	0.334000	0.24739	0.927000	0.36925	0.018000	0.09664	0.900000	0.28431	2.274000	0.75844	0.555000	0.69702	ACG	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Eqnu_transpt		0.632	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC29A2	protein_coding	OTTHUMT00000402093.1	G	NM_001532	-		66136939	-1	no_errors	ENST00000357440	ensembl	human	known	74_37	missense	SNP	0.786	T
ATAD2	29028	genome.wustl.edu	37	8	124381375	124381375	+	Silent	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:124381375G>T	ENST00000287394.5	-	8	1079	c.972C>A	c.(970-972)ggC>ggA	p.G324G	ATAD2_ENST00000521903.1_5'UTR|ATAD2_ENST00000534257.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	324					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GAGAAGCTGGGCCACTATAAA	0.343																																																	0								ENSG00000156802						96.0	88.0	91.0					8																	124381375		2203	4300	6503	ATAD2	SO:0001819	synonymous_variant	0			-	HGNC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.972C>A	8.37:g.124381375G>T		Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G324	ENST00000287394.5	37	c.972	CCDS6343.1	8																																																																																			-	NULL		0.343	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	protein_coding	OTTHUMT00000381766.2	G	NM_014109	-		124381375	-1	no_errors	ENST00000287394	ensembl	human	known	74_37	silent	SNP	0.998	T
DNMT1	1786	genome.wustl.edu	37	19	10244331	10244331	+	3'UTR	SNP	G	G	A	rs375175304		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:10244331G>A	ENST00000340748.4	-	0	5098				DNMT1_ENST00000540357.1_3'UTR|DNMT1_ENST00000359526.4_3'UTR			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1						cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CAGGGGTGACGGGAGGGCAGA	0.488																																																	0								ENSG00000130816						114.0	81.0	92.0					19																	10244331		2203	4299	6502	DNMT1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.*12C>T	19.37:g.10244331G>A		Somatic	0	54	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340748.4	37	NULL	CCDS12228.1	19																																																																																			-	-		0.488	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	protein_coding	OTTHUMT00000451166.1	G	NM_001379	-		10244331	-1	no_errors	ENST00000591798	ensembl	human	known	74_37	rna	SNP	0.000	A
LETM1	3954	genome.wustl.edu	37	4	1824837	1824837	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:1824837C>T	ENST00000302787.2	-	9	1650	c.1354G>A	c.(1354-1356)Gtg>Atg	p.V452M		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	452					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ACCTCGGCCACTTTCACCTGT	0.632																																																	0								ENSG00000168924						101.0	96.0	97.0					4																	1824837		2203	4300	6503	LETM1	SO:0001583	missense	0			-	HGNC	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1354G>A	4.37:g.1824837C>T	ENSP00000305653:p.Val452Met	Somatic	0	65	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	6	62.50	B4DED2|Q9UF65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LETM1,pfscan_EF_hand_dom	p.V452M	ENST00000302787.2	37	c.1354	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423647	0.62733	.	.	ENSG00000168924	ENST00000302787	.	.	.	4.87	4.87	0.63330	.	0.537879	0.19531	N	0.112059	T	0.61311	0.2337	L	0.51422	1.61	0.49915	D	0.999839	D	0.53885	0.963	P	0.47673	0.554	T	0.67296	-0.5706	9	0.72032	D	0.01	-12.6623	17.9976	0.89188	0.0:1.0:0.0:0.0	.	452	O95202	LETM1_HUMAN	M	452	.	ENSP00000305653:V452M	V	-	1	0	LETM1	1794635	0.985000	0.35326	0.413000	0.26509	0.136000	0.21042	7.344000	0.79328	2.242000	0.73789	0.491000	0.48974	GTG	-	NULL		0.632	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	protein_coding	OTTHUMT00000241634.1	C		-		1824837	-1	no_errors	ENST00000302787	ensembl	human	known	74_37	missense	SNP	0.993	T
ATP10D	57205	genome.wustl.edu	37	4	47593241	47593241	+	Missense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:47593241C>A	ENST00000273859.3	+	23	4393	c.4124C>A	c.(4123-4125)cCc>cAc	p.P1375H		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1375					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GGAAGAAGACCCATGCCTGGC	0.458																																																	0								ENSG00000145246						136.0	135.0	135.0					4																	47593241		2203	4300	6503	ATP10D	SO:0001583	missense	0			-	HGNC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4124C>A	4.37:g.47593241C>A	ENSP00000273859:p.Pro1375His	Somatic	0	38	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.P1375H	ENST00000273859.3	37	c.4124	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641629	0.29157	.	.	ENSG00000145246	ENST00000273859	T	0.38240	1.15	4.7	1.89	0.25635	.	1.594970	0.03799	N	0.264120	T	0.31513	0.0799	L	0.54323	1.7	0.09310	N	1	B	0.33379	0.41	B	0.28305	0.088	T	0.36986	-0.9725	10	0.62326	D	0.03	-6.6414	2.7824	0.05364	0.1475:0.5354:0.1437:0.1734	.	1375	Q9P241	AT10D_HUMAN	H	1375	ENSP00000273859:P1375H	ENSP00000273859:P1375H	P	+	2	0	ATP10D	47287998	0.000000	0.05858	0.014000	0.15608	0.056000	0.15407	0.629000	0.24538	1.185000	0.42971	0.460000	0.39030	CCC	-	NULL		0.458	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	protein_coding	OTTHUMT00000216900.1	C	NM_020453	-		47593241	+1	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	SNP	0.000	A
PLXNB2	23654	genome.wustl.edu	37	22	50718148	50718148	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr22:50718148T>C	ENST00000449103.1	-	27	4440	c.4300A>G	c.(4300-4302)Aag>Gag	p.K1434E	PLXNB2_ENST00000359337.4_Missense_Mutation_p.K1434E			O15031	PLXB2_HUMAN	plexin B2	1434					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCGGGCCCTTTTCCACCTGA	0.602																																																	0								ENSG00000196576						149.0	164.0	159.0					22																	50718148		1950	4134	6084	PLXNB2	SO:0001583	missense	0			-	HGNC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4300A>G	22.37:g.50718148T>C	ENSP00000409171:p.Lys1434Glu	Somatic	0	90	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	4	86.67	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.K1434E	ENST00000449103.1	37	c.4300	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259702	0.80246	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.23348	1.91;1.91	4.17	4.17	0.49024	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.58264	0.2110	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69468	-0.5137	10	0.87932	D	0	.	13.6445	0.62272	0.0:0.0:0.0:1.0	.	1434	O15031	PLXB2_HUMAN	E	1434;1434;66	ENSP00000409171:K1434E;ENSP00000352288:K1434E	ENSP00000352288:K1434E	K	-	1	0	PLXNB2	49060275	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	5.876000	0.69667	1.867000	0.54127	0.379000	0.24179	AAG	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.602	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	protein_coding	OTTHUMT00000316874.3	T	NM_012401	-		50718148	-1	no_errors	ENST00000359337	ensembl	human	known	74_37	missense	SNP	1.000	C
TLN2	83660	genome.wustl.edu	37	15	63055879	63055879	+	Silent	SNP	C	C	T	rs370731939		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:63055879C>T	ENST00000561311.1	+	39	5309	c.5079C>T	c.(5077-5079)gaC>gaT	p.D1693D	TLN2_ENST00000472902.1_Silent_p.D86D|TLN2_ENST00000306829.6_Silent_p.D1693D			Q9Y4G6	TLN2_HUMAN	talin 2	1693					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCACGAGGGACGACATCTCTG	0.572																																																	0								ENSG00000171914						28.0	26.0	27.0					15																	63055879		2203	4300	6503	TLN2	SO:0001819	synonymous_variant	0			-	HGNC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5079C>T	15.37:g.63055879C>T		Somatic	0	33	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	12	65.71	A6NLB8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.D1693	ENST00000561311.1	37	c.5079	CCDS32261.1	15																																																																																			-	superfamily_Vinculin/catenin		0.572	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	C		-		63055879	+1	no_errors	ENST00000306829	ensembl	human	known	74_37	silent	SNP	0.962	T
ATRX	546	genome.wustl.edu	37	X	76939473	76939474	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:76939473_76939474delTT	ENST00000373344.5	-	9	1488_1489	c.1274_1275delAA	c.(1273-1275)aaafs	p.K425fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.K387fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	425					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATTTTTCTCTTTGTTTACAGC	0.361			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1274_1275delAA	X.37:g.76939473_76939474delTT	ENSP00000362441:p.Lys425fs	Somatic	0	53	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	3	83.33	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K425fs	ENST00000373344.5	37	c.1275_1274	CCDS14434.1	X																																																																																			-	NULL		0.361	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TT	NM_000489			76939474	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	0.312:0.307	-
MOSPD1	56180	genome.wustl.edu	37	X	134033514	134033514	+	5'UTR	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:134033514A>C	ENST00000370783.3	-	0	136				MOSPD1_ENST00000491609.1_5'UTR|MOSPD1_ENST00000370779.4_5'UTR|MOSPD1_ENST00000370777.1_5'UTR	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					TCTCAAATCTATTTTGGACTT	0.368																																																	0								ENSG00000101928						61.0	63.0	62.0					X																	134033514		2200	4299	6499	MOSPD1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.-51T>G	X.37:g.134033514A>C		Somatic	0	65	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	23	55.77	B2RE62|D3DTG5|Q5H9C5|Q5H9C7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370783.3	37	NULL	CCDS14645.1	X																																																																																			-	-		0.368	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MOSPD1	protein_coding	OTTHUMT00000085439.1	A	NM_019556	-		134033514	-1	no_errors	ENST00000462060	ensembl	human	known	74_37	rna	SNP	0.873	C
UGGT1	56886	genome.wustl.edu	37	2	128900693	128900694	+	Frame_Shift_Del	DEL	AA	AA	-	rs142665549	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:128900693_128900694delAA	ENST00000259253.6	+	17	1792_1793	c.1745_1746delAA	c.(1744-1746)gaafs	p.E582fs	UGGT1_ENST00000375990.3_Frame_Shift_Del_p.E558fs	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	582					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGGACTGGAGAAAAAGTGAAAG	0.351																																																	0								ENSG00000136731																																			UGGT1	SO:0001589	frameshift_variant	0				HGNC	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.1745_1746delAA	2.37:g.128900695_128900696delAA	ENSP00000259253:p.Glu582fs	Somatic	0	99	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	25	43.18	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_UDP-g_GGtrans	p.K583fs	ENST00000259253.6	37	c.1745_1746	CCDS2154.1	2																																																																																			-	NULL		0.351	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	protein_coding	OTTHUMT00000254435.2	AA	NM_020120			128900694	+1	no_errors	ENST00000259253	ensembl	human	known	74_37	frame_shift_del	DEL	0.996:0.531	-
LYST	1130	genome.wustl.edu	37	1	235929491	235929491	+	Silent	SNP	A	A	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:235929491A>G	ENST00000389794.3	-	21	6183	c.6009T>C	c.(6007-6009)ccT>ccC	p.P2003P	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Silent_p.P2003P			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2003					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CCAAATCTGGAGGAGATCCAA	0.378																																																	0								ENSG00000143669						161.0	176.0	171.0					1																	235929491		2203	4300	6503	LYST	SO:0001819	synonymous_variant	0			-	HGNC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6009T>C	1.37:g.235929491A>G		Somatic	0	36	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2003	ENST00000389794.3	37	c.6009	CCDS31062.1	1																																																																																			-	superfamily_ARM-type_fold		0.378	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	protein_coding	OTTHUMT00000097533.5	A		-		235929491	-1	no_errors	ENST00000389793	ensembl	human	known	74_37	silent	SNP	0.999	G
AFM	173	genome.wustl.edu	37	4	74347514	74347514	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:74347514delG	ENST00000226355.3	+	1	115	c.22delG	c.(22-24)ggtfs	p.G8fs		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	8					vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAACTTACAGGTTTTATTTT	0.308																																																	0								ENSG00000079557						37.0	40.0	39.0					4																	74347514		2190	4277	6467	AFM	SO:0001589	frameshift_variant	0				HGNC	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.22delG	4.37:g.74347514delG	ENSP00000226355:p.Gly8fs	Somatic	0	99	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	35	31.37	A8K3E1|Q32MR3|Q4W5C5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_ALB/AFP/VDB,prints_Alpha-fetoprotein	p.G8fs	ENST00000226355.3	37	c.22	CCDS3557.1	4																																																																																			-	pirsf_Serum_albumin/AFP		0.308	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFM	protein_coding	OTTHUMT00000252275.2	G				74347514	+1	no_errors	ENST00000226355	ensembl	human	known	74_37	frame_shift_del	DEL	0.856	-
TULP4	56995	genome.wustl.edu	37	6	158923753	158923753	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:158923753delG	ENST00000367097.3	+	13	4415	c.3058delG	c.(3058-3060)gggfs	p.G1021fs	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1021					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1022fs*80(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGGCGGGCCCGGGGGGGTGGT	0.721																																																	1	Insertion - Frameshift(1)	large_intestine(1)						ENSG00000130338		,	20,3782		2,16,1883					,	-2.0	0.0			7	44,7448		4,36,3706	no	frameshift,intron	TULP4	NM_020245.3,NM_001007466.1	,	6,52,5589	A1A1,A1R,RR		0.5873,0.526,0.5667	,	,		64,11230				TULP4	SO:0001589	frameshift_variant	0				HGNC		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3058delG	6.37:g.158923753delG	ENSP00000356064:p.Gly1021fs	Somatic	0	35	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1022fs	ENST00000367097.3	37	c.3058	CCDS34561.1	6																																																																																			-	NULL		0.721	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	protein_coding	OTTHUMT00000042869.1	G	NM_020245			158923753	+1	no_errors	ENST00000367097	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
LOC643201	643201	genome.wustl.edu	37	5	175583878	175583878	+	lincRNA	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:175583878G>T	ENST00000515403.1	-	0	1426				RP11-826N14.4_ENST00000510029.1_lincRNA	NR_036494.1																						CAGATCTCAAGTCTTCAGTCA	0.428																																																	0								ENSG00000248596																																			RP11-844P9.2			0			-	Clone_based_vega_gene																													5.37:g.175583878G>T		Somatic	0	48	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515403.1	37	NULL		5																																																																																			-	-		0.428	RP11-844P9.2-001	KNOWN	basic	lincRNA	LOC643201	lincRNA	OTTHUMT00000371986.1	G		-		175583878	-1	no_errors	ENST00000515403	ensembl	human	known	74_37	rna	SNP	0.940	T
SLC7A9	11136	genome.wustl.edu	37	19	33349358	33349358	+	Missense_Mutation	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:33349358A>C	ENST00000023064.4	-	9	1156	c.965T>G	c.(964-966)tTc>tGc	p.F322C	SLC7A9_ENST00000587772.1_Missense_Mutation_p.F322C|SLC7A9_ENST00000590341.1_Missense_Mutation_p.F322C	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	322					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GCCCGCTGTGAAGCAGGTCCC	0.552																																					GBM(181;1335 2108 9644 44178 46689)												0								ENSG00000021488						73.0	59.0	64.0					19																	33349358		2203	4300	6503	SLC7A9	SO:0001583	missense	0			-	HGNC	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.965T>G	19.37:g.33349358A>C	ENSP00000023064:p.Phe322Cys	Somatic	0	37	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	B2R9A6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.F322C	ENST00000023064.4	37	c.965	CCDS12425.1	19	.	.	.	.	.	.	.	.	.	.	A	22.6	4.310662	0.81358	.	.	ENSG00000021488	ENST00000023064	D	0.90620	-2.7	5.36	5.36	0.76844	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97210	0.9088	H	0.98048	4.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98748	1.0719	10	0.87932	D	0	.	15.3624	0.74487	1.0:0.0:0.0:0.0	.	322;322	Q53FY4;P82251	.;BAT1_HUMAN	C	322	ENSP00000023064:F322C	ENSP00000023064:F322C	F	-	2	0	SLC7A9	38041198	1.000000	0.71417	0.704000	0.30370	0.895000	0.52256	9.310000	0.96267	2.048000	0.60808	0.379000	0.24179	TTC	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1		0.552	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	protein_coding	OTTHUMT00000450585.1	A		-		33349358	-1	no_errors	ENST00000023064	ensembl	human	known	74_37	missense	SNP	1.000	C
CENPU	79682	genome.wustl.edu	37	4	185652114	185652114	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:185652114C>T	ENST00000281453.5	-	2	126	c.56G>A	c.(55-57)cGt>cAt	p.R19H	MLF1IP_ENST00000541971.1_Missense_Mutation_p.R19H	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		GTTCTTTGAACGTCTTGCGCT	0.323																																																	0								ENSG00000151725						109.0	102.0	104.0					4																	185652114		2202	4298	6500	MLF1IP	SO:0001583	missense	0			-	HGNC																												ENST00000281453.5:c.56G>A	4.37:g.185652114C>T	ENSP00000281453:p.Arg19His	Somatic	0	86	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R19H	ENST00000281453.5	37	c.56	CCDS3838.1	4	.	.	.	.	.	.	.	.	.	.	c	3.081	-0.188996	0.06299	.	.	ENSG00000151725	ENST00000281453;ENST00000541665;ENST00000541971	T;T	0.14766	2.5;2.48	4.09	-8.18	0.01053	.	3.824880	0.00520	N	0.000191	T	0.05593	0.0147	N	0.12182	0.205	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.0	T	0.30387	-0.9980	10	0.12430	T	0.62	-15.7673	3.2582	0.06839	0.0982:0.2218:0.398:0.282	.	19;19	Q09GN1;Q71F23	.;CENPU_HUMAN	H	19	ENSP00000281453:R19H;ENSP00000445862:R19H	ENSP00000281453:R19H	R	-	2	0	MLF1IP	185889108	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.289000	0.02780	-2.766000	0.00367	-1.088000	0.02184	CGT	-	NULL		0.323	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLF1IP	protein_coding	OTTHUMT00000360841.2	C		-		185652114	-1	no_errors	ENST00000281453	ensembl	human	known	74_37	missense	SNP	0.000	T
SGPP1	81537	genome.wustl.edu	37	14	64153216	64153216	+	Silent	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:64153216G>T	ENST00000247225.6	-	3	1027	c.933C>A	c.(931-933)acC>acA	p.T311T		NM_030791.2	NP_110418.1	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	311					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate metabolic process (GO:0006668)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	10				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		ATGTGCTCCAGGTGTCAAGAG	0.438																																																	0								ENSG00000126821						69.0	61.0	64.0					14																	64153216		2203	4300	6503	SGPP1	SO:0001819	synonymous_variant	0			-	HGNC	AJ293294	CCDS9760.1	14q23.1	2003-09-17			ENSG00000126821	ENSG00000126821			17720	protein-coding gene	gene with protein product		612826				10859351	Standard	NM_030791		Approved		uc001xgj.3	Q9BX95	OTTHUMG00000029080	ENST00000247225.6:c.933C>A	14.37:g.64153216G>T		Somatic	0	74	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2RAH0|Q9H189	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.T311	ENST00000247225.6	37	c.933	CCDS9760.1	14																																																																																			-	NULL		0.438	SGPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGPP1	protein_coding	OTTHUMT00000072626.3	G	NM_030791	-		64153216	-1	no_errors	ENST00000247225	ensembl	human	known	74_37	silent	SNP	0.986	T
VPS8	23355	genome.wustl.edu	37	3	184689503	184689503	+	Missense_Mutation	SNP	A	A	G	rs556078456		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:184689503A>G	ENST00000437079.3	+	40	3554	c.3383A>G	c.(3382-3384)cAg>cGg	p.Q1128R	VPS8_ENST00000436792.2_Missense_Mutation_p.Q1126R|VPS8_ENST00000446204.2_Missense_Mutation_p.Q1036R|VPS8_ENST00000287546.4_Missense_Mutation_p.Q1128R	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1128							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GCTCTTTGCCAGAGAAATTCA	0.413													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17021	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000156931						111.0	106.0	107.0					3																	184689503		1901	4126	6027	VPS8	SO:0001583	missense	0			-	HGNC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3383A>G	3.37:g.184689503A>G	ENSP00000397879:p.Gln1128Arg	Somatic	0	57	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1128R	ENST00000437079.3	37	c.3383	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	A	17.15	3.317056	0.60524	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.22336	1.96;1.96;1.96;1.97	6.06	6.06	0.98353	Quinonprotein alcohol dehydrogenase-like (1);	0.106857	0.64402	D	0.000003	T	0.46776	0.1410	M	0.82517	2.595	0.43271	D	0.995224	P;D;P	0.59767	0.872;0.986;0.952	B;D;P	0.64042	0.396;0.921;0.677	T	0.43491	-0.9388	10	0.33940	T	0.23	-5.0819	14.1325	0.65263	1.0:0.0:0.0:0.0	.	1128;1036;1126	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	R	1128;1128;1126;1036	ENSP00000287546:Q1128R;ENSP00000397879:Q1128R;ENSP00000404704:Q1126R;ENSP00000405483:Q1036R	ENSP00000287546:Q1128R	Q	+	2	0	VPS8	186172197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.915000	0.69973	2.324000	0.78689	0.533000	0.62120	CAG	-	superfamily_Quinonprotein_ADH-like_supfam		0.413	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	protein_coding		A	NM_015303	-		184689503	+1	no_errors	ENST00000287546	ensembl	human	known	74_37	missense	SNP	1.000	G
PDE6H	5149	genome.wustl.edu	37	12	15132126	15132126	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:15132126delA	ENST00000266395.2	+	3	254	c.148delA	c.(148-150)attfs	p.I50fs		NM_006205.2	NP_006196.1	Q13956	CNCG_HUMAN	phosphodiesterase 6H, cGMP-specific, cone, gamma	50					activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|lung(6)|ovary(1)|skin(2)	10					Sildenafil(DB00203)|Vardenafil(DB00862)	TGGAGATGACATTCCAGGAAT	0.408																																																	0								ENSG00000139053						104.0	97.0	99.0					12																	15132126		2203	4300	6503	PDE6H	SO:0001589	frameshift_variant	0				HGNC		CCDS8672.1	12p13	2008-03-18					3.1.4.17	"""Phosphodiesterases"""	8790	protein-coding gene	gene with protein product		601190				8786098	Standard	NM_006205		Approved		uc001rcr.3	Q13956		ENST00000266395.2:c.148delA	12.37:g.15132126delA	ENSP00000266395:p.Ile50fs	Somatic	0	56	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	Q52LY7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PDE6_gamma,pirsf_PDE6_gamma	p.I50fs	ENST00000266395.2	37	c.148	CCDS8672.1	12																																																																																			-	pfam_PDE6_gamma,pirsf_PDE6_gamma		0.408	PDE6H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6H	protein_coding	OTTHUMT00000400880.1	A				15132126	+1	no_errors	ENST00000266395	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TPCN2	219931	genome.wustl.edu	37	11	68855412	68855412	+	Silent	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:68855412G>T	ENST00000294309.3	+	25	2351	c.2250G>T	c.(2248-2250)ctG>ctT	p.L750L	TPCN2_ENST00000542467.1_Silent_p.L568L|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	750					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ACCTGTGGCTGTGCAGGTGAC	0.647																																																	0								ENSG00000162341						18.0	24.0	22.0					11																	68855412		2200	4294	6494	TPCN2	SO:0001819	synonymous_variant	0			-	HGNC	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.2250G>T	11.37:g.68855412G>T		Somatic	0	24	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q9NT82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.L750	ENST00000294309.3	37	c.2250	CCDS8189.1	11																																																																																			-	NULL		0.647	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	protein_coding	OTTHUMT00000396878.2	G	NM_139075	-		68855412	+1	no_errors	ENST00000294309	ensembl	human	known	74_37	silent	SNP	0.989	T
PTPN7	5778	genome.wustl.edu	37	1	202123433	202123433	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:202123433T>C	ENST00000308986.5	-	6	617	c.487A>G	c.(487-489)Aag>Gag	p.K163E	PTPN7_ENST00000309017.3_Missense_Mutation_p.K268E|PTPN7_ENST00000492977.1_5'UTR|PTPN7_ENST00000367279.4_Missense_Mutation_p.K202E|PTPN7_ENST00000544762.1_Intron|PTPN7_ENST00000543735.1_5'UTR			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7	163	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						ATGTAGACCTTCTCCTTCCCG	0.587																																																	0								ENSG00000143851						100.0	78.0	86.0					1																	202123433		2203	4300	6503	PTPN7	SO:0001583	missense	0			-	HGNC	BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.487A>G	1.37:g.202123433T>C	ENSP00000311133:p.Lys163Glu	Somatic	0	63	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.K268E	ENST00000308986.5	37	c.802		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.53|16.53	3.147887|3.147887	0.57151|0.57151	.|.	.|.	ENSG00000143851|ENSG00000143851	ENST00000477625|ENST00000367279;ENST00000309017;ENST00000308986;ENST00000477554;ENST00000476061	T|D;D;D;D;D	0.13657|0.83914	2.57|-1.78;-1.78;-1.78;-1.78;-1.78	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Protein-tyrosine phosphatase, receptor/non-receptor type (3);	.|0.103999	.|0.42294	.|D	.|0.000736	D|D	0.85826|0.85826	0.5787|0.5787	M|M	0.72624|0.72624	2.21|2.21	0.80722|0.80722	D|D	1|1	.|P;P;P;P;P	.|0.48589	.|0.912;0.454;0.669;0.669;0.822	.|P;B;B;B;B	.|0.50860	.|0.652;0.253;0.364;0.364;0.368	D|D	0.87291|0.87291	0.2299|0.2299	7|10	0.72032|0.72032	D|D	0.01|0.01	.|.	11.6607|11.6607	0.51345|0.51345	0.0:0.0:0.1589:0.8411|0.0:0.0:0.1589:0.8411	.|.	.|237;111;115;163;202	.|B4DZD9;B4DVF0;Q8NFX3;P35236;P35236-2	.|.;.;.;PTN7_HUMAN;.	G|E	94|202;268;163;244;162	ENSP00000418129:E94G|ENSP00000356248:K202E;ENSP00000309116:K268E;ENSP00000311133:K163E;ENSP00000418416:K244E;ENSP00000419993:K162E	ENSP00000418129:E94G|ENSP00000311133:K163E	E|K	-|-	2|1	0|0	PTPN7|PTPN7	200390056|200390056	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	3.815000|3.815000	0.55651|0.55651	1.890000|1.890000	0.54733|0.54733	0.533000|0.533000	0.62120|0.62120	GAA|AAG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_KIM-con,pfscan_Tyr_Pase_rcpt/non-rcpt		0.587	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	PTPN7	protein_coding		T	NM_002832	-		202123433	-1	no_errors	ENST00000309017	ensembl	human	known	74_37	missense	SNP	0.994	C
TADA3	10474	genome.wustl.edu	37	3	9827049	9827050	+	Frame_Shift_Del	DEL	CT	CT	-	rs377606064		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:9827049_9827050delCT	ENST00000301964.2	-	7	1428_1429	c.870_871delAG	c.(868-873)tcagggfs	p.G291fs	TADA3_ENST00000343450.2_Frame_Shift_Del_p.G291fs|TADA3_ENST00000440161.1_Frame_Shift_Del_p.G291fs	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	291					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						CCGTCAGCCCCTGATTCTTTCC	0.5																																																	0								ENSG00000171148																																			TADA3	SO:0001589	frameshift_variant	0				HGNC	AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.870_871delAG	3.37:g.9827049_9827050delCT	ENSP00000307684:p.Gly291fs	Somatic	0	85	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	24	33.33	Q6FI83|Q9UFS2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Histone_AcTrfase_su3	p.A292fs	ENST00000301964.2	37	c.871_870	CCDS2583.1	3																																																																																			-	NULL		0.500	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	protein_coding	OTTHUMT00000250236.1	CT				9827050	-1	no_errors	ENST00000301964	ensembl	human	known	74_37	frame_shift_del	DEL	0.617:0.028	-
MICALL1	85377	genome.wustl.edu	37	22	38323604	38323605	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr22:38323604_38323605delCT	ENST00000215957.6	+	9	1778_1779	c.1652_1653delCT	c.(1651-1653)cctfs	p.P551fs	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	551	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					CCTGGAAACCCTGTCAGCCTCT	0.629																																																	0								ENSG00000100139																																			MICALL1	SO:0001589	frameshift_variant	0				HGNC	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.1652_1653delCT	22.37:g.38323604_38323605delCT	ENSP00000215957:p.Pro551fs	Somatic	0	129	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	8	86.67	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.P551fs	ENST00000215957.6	37	c.1652_1653	CCDS13961.1	22																																																																																			-	NULL		0.629	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	protein_coding	OTTHUMT00000319545.4	CT	NM_033386			38323605	+1	no_errors	ENST00000215957	ensembl	human	known	74_37	frame_shift_del	DEL	0.572:0.475	-
DLG2	1740	genome.wustl.edu	37	11	84996326	84996326	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:84996326G>A	ENST00000376104.2	-	4	435	c.124C>T	c.(124-126)Cag>Tag	p.Q42*	DLG2_ENST00000543673.1_Nonsense_Mutation_p.Q42*	NM_001142699.1	NP_001136171.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TCCCATTTCTGTAAAACTTGA	0.348																																																	0								ENSG00000150672						222.0	198.0	205.0					11																	84996326		1568	3581	5149	DLG2	SO:0001587	stop_gained	0			-	HGNC	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000376104.2:c.124C>T	11.37:g.84996326G>A	ENSP00000365272:p.Gln42*	Somatic	0	59	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.Q42*	ENST00000376104.2	37	c.124	CCDS44690.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.198050	0.94997	.	.	ENSG00000150672	ENST00000376104;ENST00000543673;ENST00000546021	.	.	.	5.88	3.93	0.45458	.	0.241793	0.26780	N	0.022539	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0218	0.36204	0.0:0.3681:0.5138:0.1181	.	.	.	.	X	42	.	.	Q	-	1	0	DLG2	84673974	0.997000	0.39634	0.995000	0.50966	0.990000	0.78478	1.957000	0.40392	1.444000	0.47605	0.650000	0.86243	CAG	-	pirsf_M-assoc_guanylate_kinase		0.348	DLG2-003	KNOWN	basic|CCDS	protein_coding	DLG2	protein_coding	OTTHUMT00000259245.3	G	NM_001364	-		84996326	-1	no_errors	ENST00000376104	ensembl	human	known	74_37	nonsense	SNP	1.000	A
MOK	5891	genome.wustl.edu	37	14	102718302	102718303	+	Frame_Shift_Ins	INS	-	-	T	rs145834415	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:102718302_102718303insT	ENST00000361847.2	-	5	544_545	c.313_314insA	c.(313-315)attfs	p.I105fs	MOK_ENST00000522874.1_Frame_Shift_Ins_p.I105fs|MOK_ENST00000524214.1_Frame_Shift_Ins_p.I75fs|MOK_ENST00000193029.6_5'UTR	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	105	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										ATAGTGCATAATTTTTTTTTCT	0.322																																																	0								ENSG00000080823																																			MOK	SO:0001589	frameshift_variant	0				HGNC	AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.314dupA	14.37:g.102718311_102718311dupT	ENSP00000355304:p.Ile105fs	Somatic	0	52	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I105fs	ENST00000361847.2	37	c.314_313	CCDS9971.1	14																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.322	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOK	protein_coding	OTTHUMT00000380848.3	-				102718303	-1	no_errors	ENST00000361847	ensembl	human	known	74_37	frame_shift_ins	INS	0.044:0.007	T
PPP2R2A	5520	genome.wustl.edu	37	8	26218555	26218555	+	Silent	SNP	T	T	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:26218555T>G	ENST00000380737.3	+	6	854	c.525T>G	c.(523-525)gcT>gcG	p.A175A	PPP2R2A_ENST00000315985.7_Silent_p.A185A	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	175					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TTGCCAATGCTCATACATATC	0.353																																																	0								ENSG00000221914						149.0	144.0	146.0					8																	26218555		2203	4300	6503	PPP2R2A	SO:0001819	synonymous_variant	0			-	HGNC	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.525T>G	8.37:g.26218555T>G		Somatic	0	82	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	40	40.30	B2RBU8|B4E1T7|P50409|Q00007	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.A175	ENST00000380737.3	37	c.525	CCDS34867.1	8																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55		0.353	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2A	protein_coding	OTTHUMT00000375954.2	T	NM_002717	-		26218555	+1	no_errors	ENST00000380737	ensembl	human	known	74_37	silent	SNP	0.997	G
SETD1A	9739	genome.wustl.edu	37	16	30992058	30992059	+	Splice_Site	DEL	AG	AG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:30992058_30992059delAG	ENST00000262519.8	+	16	5267		c.e16-1			NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A						histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TGTGTCTCACAGGGGACGAACC	0.678																																																	0								ENSG00000099381			1,4261		0,1,2130						4.3	1.0			42	0,8252		0,0,4126	no	splice-3	SETD1A	NM_014712.1		0,1,6256	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12513				SETD1A	SO:0001630	splice_region_variant	0				HGNC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4582-1AG>-	16.37:g.30992058_30992059delAG		Somatic	0	68	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	33	48.44	A6NP62|Q6PIF3|Q8TAJ6	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e15-1	ENST00000262519.8	37	c.4582-2_4582-1	CCDS32435.1	16																																																																																			-	-		0.678	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	AG	NM_014712		Intron	30992059	+1	no_errors	ENST00000262519	ensembl	human	known	74_37	splice_site_del	DEL	1.000:1.000	-
TRIM73	375593	genome.wustl.edu	37	7	75028240	75028240	+	Missense_Mutation	SNP	T	T	C	rs73702636		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:75028240T>C	ENST00000437796.1	+	1	42	c.23T>C	c.(22-24)cTg>cCg	p.L8P	TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000430211.1_Missense_Mutation_p.L8P|TRIM73_ENST00000447409.2_Missense_Mutation_p.L8P|TRIM73_ENST00000323819.3_Missense_Mutation_p.L8P|TRIM73_ENST00000463766.1_3'UTR			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GTGAGCCTGCTGGAGCTGGAG	0.617																																																	0								ENSG00000178809						134.0	135.0	135.0					7																	75028240		2203	4300	6503	TRIM73	SO:0001583	missense	0			-	HGNC	AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.23T>C	7.37:g.75028240T>C	ENSP00000417040:p.Leu8Pro	Somatic	0	147	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	96	11.11	Q8N0S3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.L8P	ENST00000437796.1	37	c.23	CCDS34665.1	7	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.453889	0.00175	.	.	ENSG00000178809	ENST00000323819;ENST00000430211;ENST00000447409;ENST00000437796	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	2.31	2.31	0.28768	Zinc finger, RING/FYVE/PHD-type (2);	0.716055	0.13135	N	0.411154	T	0.65037	0.2653	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56282	-0.8005	9	0.20046	T	0.44	.	3.1123	0.06363	0.2601:0.5871:0.0:0.1528	.	8;8	Q86UV6;Q86UV7	TRI74_HUMAN;TRI73_HUMAN	P	8	ENSP00000318615:L8P;ENSP00000410121:L8P;ENSP00000407135:L8P;ENSP00000417040:L8P	ENSP00000318615:L8P	L	+	2	0	TRIM73	74866176	0.000000	0.05858	0.274000	0.24659	0.362000	0.29581	-0.984000	0.03755	0.549000	0.28973	-0.511000	0.04467	CTG	-	NULL		0.617	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM73	protein_coding	OTTHUMT00000342950.1	T		rs116984258		75028240	+1	no_errors	ENST00000323819	ensembl	human	known	74_37	missense	SNP	0.061	C
ETV3L	440695	genome.wustl.edu	37	1	157067778	157067778	+	Silent	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:157067778G>T	ENST00000454449.2	-	4	773	c.489C>A	c.(487-489)ctC>ctA	p.L163L		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	163					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TGCTGTGCAGGAGCTGAGGGG	0.552																																																	0								ENSG00000253831						58.0	57.0	57.0					1																	157067778		2203	4300	6503	ETV3L	SO:0001819	synonymous_variant	0			-	HGNC	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.489C>A	1.37:g.157067778G>T		Somatic	0	99	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.L163	ENST00000454449.2	37	c.489	CCDS30893.1	1																																																																																			-	NULL		0.552	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	protein_coding	OTTHUMT00000099024.2	G	NM_001004341	-		157067778	-1	no_errors	ENST00000454449	ensembl	human	known	74_37	silent	SNP	1.000	T
TOPAZ1	375337	genome.wustl.edu	37	3	44346765	44346766	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:44346765_44346766delTA	ENST00000309765.4	+	14	4159_4160	c.3991_3992delTA	c.(3991-3993)tatfs	p.Y1331fs		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	1331						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										CACAAAAAACTATGAAGATGAA	0.342																																																	0								ENSG00000173769																																			TOPAZ1	SO:0001589	frameshift_variant	0				HGNC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.3991_3992delTA	3.37:g.44346765_44346766delTA	ENSP00000310303:p.Tyr1331fs	Somatic	0	60	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Y1331fs	ENST00000309765.4	37	c.3991_3992	CCDS46809.1	3																																																																																			-	NULL		0.342	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPAZ1	protein_coding	OTTHUMT00000343247.1	TA	NM_001145030			44346766	+1	no_errors	ENST00000309765	ensembl	human	known	74_37	frame_shift_del	DEL	0.462:0.000	-
RP11-146E13.4	0	genome.wustl.edu	37	14	19855845	19855845	+	lincRNA	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:19855845C>T	ENST00000548109.1	+	0	72																											CAGTGTGGCTCTGGACTCACC	0.647																																																	0								ENSG00000244306																																			CTD-2314B22.3			0			-	Clone_based_vega_gene																													14.37:g.19855845C>T		Somatic	0	9	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			-	-		0.647	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	lincRNA	OTTHUMT00000409408.1	C		-		19855845	-1	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	SNP	0.998	T
CPNE8	144402	genome.wustl.edu	37	12	39268274	39268274	+	Splice_Site	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr12:39268274T>C	ENST00000331366.5	-	2	234	c.138A>G	c.(136-138)ccA>ccG	p.P46P	CPNE8_ENST00000360449.3_Splice_Site_p.P34P	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	46	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				CATACTTACTTGGATCAGATT	0.274																																																	0								ENSG00000139117						45.0	51.0	49.0					12																	39268274		2203	4297	6500	CPNE8	SO:0001630	splice_region_variant	0			-	HGNC	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.139+1A>G	12.37:g.39268274T>C		Somatic	0	96	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	Q2TB41|Q86VY2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.P46	ENST00000331366.5	37	c.138	CCDS8733.1	12																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.274	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	protein_coding	OTTHUMT00000403856.1	T	NM_153634	-	Silent	39268274	-1	no_errors	ENST00000331366	ensembl	human	known	74_37	silent	SNP	1.000	C
MGME1	92667	genome.wustl.edu	37	20	17956397	17956398	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr20:17956397_17956398delAG	ENST00000377710.5	+	3	870_871	c.582_583delAG	c.(580-585)aaagagfs	p.E195fs	MGME1_ENST00000377704.4_Intron|MGME1_ENST00000467391.1_Intron|MGME1_ENST00000377709.1_Frame_Shift_Del_p.E115fs	NM_052865.2	NP_443097.1			mitochondrial genome maintenance exonuclease 1																		AAACCTTAAAAGAGAGAGATGA	0.436																																																	0								ENSG00000125871																																			MGME1	SO:0001589	frameshift_variant	0				HGNC		CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377710.5:c.582_583delAG	20.37:g.17956403_17956404delAG	ENSP00000366939:p.Glu195fs	Somatic	0	53	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Restrct_endonuc-II-like	p.D197fs	ENST00000377710.5	37	c.582_583	CCDS13131.1	20																																																																																			-	NULL		0.436	MGME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGME1	protein_coding	OTTHUMT00000078139.1	AG	NM_052865			17956398	+1	no_errors	ENST00000377710	ensembl	human	known	74_37	frame_shift_del	DEL	0.395:0.212	-
ANKIB1	54467	genome.wustl.edu	37	7	92027826	92027826	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:92027826G>A	ENST00000265742.3	+	20	3209	c.2833G>A	c.(2833-2835)Gca>Aca	p.A945T		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	945							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTCAGTGAGGCAAGAAGTGA	0.498																																																	0								ENSG00000001629						114.0	111.0	112.0					7																	92027826		2032	4186	6218	ANKIB1	SO:0001583	missense	0			-	HGNC	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2833G>A	7.37:g.92027826G>A	ENSP00000265742:p.Ala945Thr	Somatic	0	50	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.A945T	ENST00000265742.3	37	c.2833	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	G	8.721	0.914351	0.17907	.	.	ENSG00000001629	ENST00000265742	T	0.09538	2.97	5.6	0.319	0.15873	.	1.082220	0.06841	N	0.795763	T	0.03263	0.0095	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.40850	-0.9541	10	0.02654	T	1	.	1.5015	0.02477	0.2821:0.2413:0.3535:0.1231	.	297;945	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	T	945	ENSP00000265742:A945T	ENSP00000265742:A945T	A	+	1	0	ANKIB1	91865762	0.115000	0.22152	0.869000	0.34112	0.996000	0.88848	0.541000	0.23207	0.108000	0.17862	-0.157000	0.13467	GCA	-	NULL		0.498	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	protein_coding	OTTHUMT00000342018.1	G		-		92027826	+1	no_errors	ENST00000265742	ensembl	human	known	74_37	missense	SNP	0.001	A
OR1S1	219959	genome.wustl.edu	37	11	57982690	57982690	+	Silent	SNP	A	A	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:57982690A>T	ENST00000309433.6	+	1	474	c.474A>T	c.(472-474)acA>acT	p.T158T		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TTTTGCTCACAGTCATCTCAT	0.468																																																	0								ENSG00000172774						213.0	201.0	205.0					11																	57982690		2201	4296	6497	OR1S1	SO:0001819	synonymous_variant	0			-	HGNC	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.474A>T	11.37:g.57982690A>T		Somatic	0	43	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	10	72.97	Q6IFG3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T158	ENST00000309433.6	37	c.474	CCDS31546.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.468	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	protein_coding	OTTHUMT00000394705.1	A	NM_001004458	-		57982690	+1	no_errors	ENST00000309433	ensembl	human	known	74_37	silent	SNP	0.000	T
TONSL	4796	genome.wustl.edu	37	8	145660403	145660403	+	Silent	SNP	G	G	A	rs558700548		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:145660403G>A	ENST00000409379.3	-	19	3032	c.3003C>T	c.(3001-3003)gaC>gaT	p.D1001D	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1001					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GGCTCACCTCGTCATTGCTCT	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		16355	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000160949						22.0	24.0	23.0					8																	145660403		2200	4299	6499	TONSL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3003C>T	8.37:g.145660403G>A		Somatic	0	95	0.00		0.7045929696752881	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	4	87.10	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.D1001	ENST00000409379.3	37	c.3003	CCDS34968.2	8																																																																																			-	NULL		0.682	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	protein_coding	OTTHUMT00000329668.2	G	NM_013432	-		145660403	-1	no_errors	ENST00000409379	ensembl	human	known	74_37	silent	SNP	0.999	A
