#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RBMX	27316	genome.wustl.edu	37	X	135961586	135961588	+	Start_Codon_Del	DEL	TGT	TGT	-	rs201673579|rs2011584		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:135961586_135961588delTGT	ENST00000320676.7	-	0	153_155				RBMX_ENST00000431446.3_Start_Codon_Del|RBMX_ENST00000562646.1_Start_Codon_Del|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000565438.1_Intron|RBMX_ENST00000570135.1_5'UTR	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GCTTCAACCATGTTTTTTTTTTT	0.389																																																	1	Unknown(1)	ovary(1)						ENSG00000147274																																			RBMX	SO:0001582	initiator_codon_variant	0				HGNC		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517		X.37:g.135961586_135961588delTGT		Somatic	0	17	0.00		0.5694851509381481	45	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.M1fs	ENST00000320676.7	37	c.1	CCDS14661.1	X																																																																																			-	NULL		0.389	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	protein_coding	OTTHUMT00000058507.1	TGT	NM_002139			135961588	-1	no_errors	ENST00000320676	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
BGLT3	103344929	genome.wustl.edu	37	11	5263299	5263320	+	RNA	DEL	CATAGGTACAAACATAGTGGAC	CATAGGTACAAACATAGTGGAC	-	rs113355107|rs73402614|rs547059693	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	CATAGGTACAAACATAGTGGAC	CATAGGTACAAACATAGTGGAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:5263299_5263320delCATAGGTACAAACATAGTGGAC	ENST00000564523.1	-	0	1988				HBBP1_ENST00000454892.1_RNA																							GATTTTGGGACATAGGTACAAACATAGTGGACCATAGGTACA	0.432														54	0.0107827	0.0015	0.013	5008	,	,		24332	0.001		0.0328	False		,,,				2504	0.0092																0								ENSG00000229988																																			HBBP1			0				HGNC																													11.37:g.5263299_5263320delCATAGGTACAAACATAGTGGAC		Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564523.1	37	NULL		11																																																																																			-	-		0.432	CTD-2643I7.1-001	KNOWN	basic	sense_overlapping	HBBP1	sense_overlapping	OTTHUMT00000422245.1	CATAGGTACAAACATAGTGGAC				5263320	-1	no_errors	ENST00000454892	ensembl	human	known	74_37	rna	DEL	0.001:0.001:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.002:0.002:0.003:0.002:0.002:0.002:0.002:0.002	-
OR5T2	219464	genome.wustl.edu	37	11	56000184	56000184	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:56000184C>A	ENST00000313264.4	-	1	553	c.478G>T	c.(478-480)Gat>Tat	p.D160Y		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D160N(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					ACATAGCGATCATAAGCCATT	0.428																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000181718						188.0	158.0	168.0					11																	56000184		2201	4294	6495	OR5T2	SO:0001583	missense	0			-	HGNC	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.478G>T	11.37:g.56000184C>A	ENSP00000323688:p.Asp160Tyr	Somatic	0	64	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	36	23.40	B9EGX5|Q6IFC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D160Y	ENST00000313264.4	37	c.478	CCDS31523.1	11	.	.	.	.	.	.	.	.	.	.	C	25.5	4.639692	0.87760	.	.	ENSG00000181718	ENST00000313264	T	0.02140	4.43	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43110	U	0.000602	T	0.24236	0.0587	H	0.97732	4.065	0.53688	D	0.999977	D	0.89917	1.0	D	0.80764	0.994	T	0.46119	-0.9214	10	0.87932	D	0	.	18.4134	0.90559	0.0:1.0:0.0:0.0	.	160	Q8NGG2	OR5T2_HUMAN	Y	160	ENSP00000323688:D160Y	ENSP00000323688:D160Y	D	-	1	0	OR5T2	55756760	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	7.184000	0.77705	2.520000	0.84964	0.471000	0.43371	GAT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.428	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	protein_coding	OTTHUMT00000391598.1	C	NM_001004746	-		56000184	-1	no_errors	ENST00000313264	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF282	8427	genome.wustl.edu	37	7	148921432	148921432	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:148921432G>T	ENST00000262085.3	+	8	1814	c.1709G>T	c.(1708-1710)gGc>gTc	p.G570V	ZNF282_ENST00000479907.1_3'UTR	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	570					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		ACGCACCGCGGCGAGCGGCCC	0.652																																																	0								ENSG00000170265						36.0	38.0	38.0					7																	148921432		2203	4300	6503	ZNF282	SO:0001583	missense	0			-	HGNC	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.1709G>T	7.37:g.148921432G>T	ENSP00000262085:p.Gly570Val	Somatic	0	49	0.00		0.5694851509381481	36	25.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	61	16.44	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G570V	ENST00000262085.3	37	c.1709	CCDS5895.1	7	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878403	0.51801	.	.	ENSG00000170265	ENST00000430197;ENST00000262085	T	0.23552	1.9	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000082	T	0.52597	0.1744	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.59337	-0.7473	10	0.87932	D	0	-7.8816	10.094	0.42464	0.0:0.2045:0.7955:0.0	.	570	Q9UDV7	ZN282_HUMAN	V	223;570	ENSP00000262085:G570V	ENSP00000262085:G570V	G	+	2	0	ZNF282	148552365	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.702000	0.54800	2.205000	0.71048	0.462000	0.41574	GGC	-	pfscan_Znf_C2H2		0.652	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF282	protein_coding	OTTHUMT00000352746.1	G	NM_003575	-		148921432	+1	no_errors	ENST00000262085	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHA11	56138	genome.wustl.edu	37	5	140248722	140248722	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:140248722C>T	ENST00000398640.2	+	1	34	c.34C>T	c.(34-36)Cca>Tca	p.P12S	PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	12					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTGGGCACCCCACGACTACA	0.522																																																	0								ENSG00000249158						90.0	103.0	99.0					5																	140248722		2186	4296	6482	PCDHA11	SO:0001583	missense	0			-	HGNC	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.34C>T	5.37:g.140248722C>T	ENSP00000381636:p.Pro12Ser	Somatic	0	79	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	90	19.64	B2RN58|O75279	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P12S	ENST00000398640.2	37	c.34	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	C	0.972	-0.699938	0.03279	.	.	ENSG00000249158	ENST00000398640	T	0.48836	0.8	5.35	-1.86	0.07760	.	.	.	.	.	T	0.21921	0.0528	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.27226	-1.0080	9	0.09084	T	0.74	.	6.2971	0.21091	0.0:0.254:0.371:0.375	.	12;12	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	S	12	ENSP00000381636:P12S	ENSP00000381636:P12S	P	+	1	0	PCDHA11	140228906	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.555000	0.00925	-0.826000	0.04284	-0.812000	0.03155	CCA	-	NULL		0.522	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	protein_coding	OTTHUMT00000372885.2	C	NM_018902	-		140248722	+1	no_errors	ENST00000398640	ensembl	human	known	74_37	missense	SNP	0.000	T
MYCBP2	23077	genome.wustl.edu	37	13	77798600	77798600	+	Silent	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr13:77798600T>C	ENST00000544440.2	-	20	2828	c.2811A>G	c.(2809-2811)ggA>ggG	p.G937G	MYCBP2_ENST00000407578.2_Silent_p.G975G|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Silent_p.G937G					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGTTGACATCTCCATGTCCTA	0.348																																																	0								ENSG00000005810						117.0	109.0	112.0					13																	77798600		2203	4300	6503	MYCBP2	SO:0001819	synonymous_variant	0			-	HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2811A>G	13.37:g.77798600T>C		Somatic	0	57	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	27	40.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.G975	ENST00000544440.2	37	c.2925		13																																																																																			-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold,pfscan_Reg_chr_condens		0.348	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	T	NM_015057	-		77798600	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	silent	SNP	0.999	C
IGHV1OR21-1	390530	genome.wustl.edu	37	21	10862982	10862982	+	RNA	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr21:10862982C>A	ENST00000559480.1	+	0	278							A6NJS3	IV1U1_HUMAN	immunoglobulin heavy variable 1/OR21-1 (non-functional)							extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|lung(20)|urinary_tract(1)	26						ACCAGGGACACATCCATGAGC	0.507																																																	0								ENSG00000169861						412.0	405.0	408.0					21																	10862982		2184	4282	6466	IGHV1OR21-1			0			-	HGNC			21p11.2	2014-05-06	2010-11-09		ENSG00000169861	ENSG00000277282		"""Immunoglobulins / IGH orphons"""	38040	other	immunoglobulin gene			"""immunoglobulin heavy variable 1/OR21-1 pseudogene"""				Standard	NG_011680		Approved	IGHV1/OR21-1		A6NJS3	OTTHUMG00000188295		21.37:g.10862982C>A		Somatic	0	185	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	99	26.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.T93K	ENST00000559480.1	37	c.278		21																																																																																			-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.507	IGHV1OR21-1-201	KNOWN	basic|appris_principal	IG_V_gene	IGHV1OR21-1	IG_V_gene		C	NG_011680	-		10862982	+1	no_errors	ENST00000559480	ensembl	human	known	74_37	missense	SNP	0.243	A
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.5694851509381481	92	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
FAM213B	127281	genome.wustl.edu	37	1	2520961	2520961	+	3'UTR	SNP	G	G	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:2520961G>C	ENST00000378425.5	+	0	768				FAM213B_ENST00000537325.1_3'UTR|FAM213B_ENST00000444521.2_3'UTR|FAM213B_ENST00000378424.4_3'UTR|FAM213B_ENST00000419916.2_3'UTR|FAM213B_ENST00000484099.1_3'UTR			Q8TBF2	PGFS_HUMAN	family with sequence similarity 213, member B						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|myelin sheath (GO:0043209)	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|prostaglandin-F synthase activity (GO:0047017)										CGGAGGCGCTGGGTCGGGATG	0.632																																																	0								ENSG00000157870																																			FAM213B	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK075273	CCDS44.1, CCDS44.2, CCDS55564.1, CCDS72690.1, CCDS72691.1	1p36.32	2011-12-08	2011-11-24	2011-11-24	ENSG00000157870	ENSG00000157870	1.11.1.20		28390	protein-coding gene	gene with protein product	"""prostamide/prostaglandin F synthase"""		"""chromosome 1 open reading frame 93"""	C1orf93		18006499	Standard	NM_152371		Approved	MGC26818	uc001ajv.2	Q8TBF2	OTTHUMG00000000847	ENST00000378425.5:c.*95G>C	1.37:g.2520961G>C		Somatic	0	9	0.00		0.5694851509381481	62	18.42	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	A8K793|B3KPY3|B4DQR9|B4E0S5|B7ZAC8|B9DI90|B9DI92|J3KQD0|Q8N2H0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378425.5	37	NULL		1																																																																																			-	-		0.632	FAM213B-201	KNOWN	basic|appris_principal	protein_coding	FAM213B	protein_coding		G	NM_152371	-		2520961	+1	no_errors	ENST00000464043	ensembl	human	known	74_37	rna	SNP	0.015	C
PAPPA2	60676	genome.wustl.edu	37	1	176526055	176526055	+	Silent	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:176526055C>A	ENST00000367662.3	+	2	1761	c.597C>A	c.(595-597)cgC>cgA	p.R199R	PAPPA2_ENST00000367661.3_Silent_p.R199R	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	199					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCAGCGTCGCCAAGTGTGGA	0.567																																																	0								ENSG00000116183						96.0	105.0	102.0					1																	176526055		1992	4143	6135	PAPPA2	SO:0001819	synonymous_variant	0			-	HGNC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.597C>A	1.37:g.176526055C>A		Somatic	0	39	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.R199	ENST00000367662.3	37	c.597	CCDS41438.1	1																																																																																			-	NULL		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	C		-		176526055	+1	no_errors	ENST00000367662	ensembl	human	known	74_37	silent	SNP	0.001	A
PLEKHG2	64857	genome.wustl.edu	37	19	39915497	39915497	+	Missense_Mutation	SNP	G	G	T	rs138840836		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:39915497G>T	ENST00000409794.3	+	19	4574	c.3724G>T	c.(3724-3726)Ggc>Tgc	p.G1242C	PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.G1183C|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.G1213C	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1242					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAAACCAGGAGGCTCCTTAGC	0.582																																																	0								ENSG00000090924						154.0	153.0	153.0					19																	39915497		2203	4300	6503	PLEKHG2	SO:0001583	missense	0			-	HGNC	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3724G>T	19.37:g.39915497G>T	ENSP00000386733:p.Gly1242Cys	Somatic	0	39	0.00		0.5694851509381481	70	18.60	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	53	18.46	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G1242C	ENST00000409794.3	37	c.3724	CCDS33022.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.51|16.51	3.142155|3.142155	0.57044|0.57044	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000205135|ENST00000409794;ENST00000425673;ENST00000458508	.|T;D;D	.|0.82433	.|-1.4;-1.51;-1.61	4.94|4.94	-1.39|-1.39	0.08997|0.08997	.|.	.|0.392321	.|0.18802	.|N	.|0.130774	D|D	0.82632|0.82632	0.5079|0.5079	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	0.999997|0.999997	.|D;D;B	.|0.63046	.|0.992;0.986;0.025	.|P;P;B	.|0.57620	.|0.824;0.671;0.016	T|T	0.72398|0.72398	-0.4306|-0.4306	5|9	.|.	.|.	.|.	.|.	3.8551|3.8551	0.08971|0.08971	0.3885:0.0:0.4509:0.1605|0.3885:0.0:0.4509:0.1605	.|.	.|1213;1242;1183	.|Q9H7P9-3;Q9H7P9;E7ESZ3	.|.;PKHG2_HUMAN;.	D|C	1109|1242;1213;1183	.|ENSP00000386733:G1242C;ENSP00000392906:G1213C;ENSP00000408857:G1183C	.|.	E|G	+|+	3|1	2|0	PLEKHG2|PLEKHG2	44607337|44607337	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.105000|0.105000	0.19272|0.19272	-0.408000|-0.408000	0.07169|0.07169	-0.280000|-0.280000	0.09154|0.09154	0.561000|0.561000	0.74099|0.74099	GAG|GGC	-	NULL		0.582	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG2	protein_coding	OTTHUMT00000326802.1	G	NM_022835	-		39915497	+1	no_errors	ENST00000409794	ensembl	human	known	74_37	missense	SNP	0.001	T
EPHA8	2046	genome.wustl.edu	37	1	22903293	22903293	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:22903293G>A	ENST00000166244.3	+	3	815	c.743G>A	c.(742-744)aGc>aAc	p.S248N	EPHA8_ENST00000374644.4_Missense_Mutation_p.S248N|EPHA8_ENST00000538803.1_Missense_Mutation_p.S248N	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	248	Cys-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ATGTACTGCAGCGCGGAGGGC	0.687																																																	0								ENSG00000070886						46.0	45.0	45.0					1																	22903293		2203	4300	6503	EPHA8	SO:0001583	missense	0			-	HGNC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.743G>A	1.37:g.22903293G>A	ENSP00000166244:p.Ser248Asn	Somatic	0	77	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	94	8.74	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S248N	ENST00000166244.3	37	c.743	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800503	0.50315	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.73047	-0.71;5.12;5.12	4.09	4.09	0.47781	Tyrosine-protein kinase, receptor class V, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	L	0.33710	1.025	0.52099	D	0.999944	D;D	0.69078	0.997;0.997	D;D	0.75484	0.986;0.979	T	0.67011	-0.5778	10	0.09084	T	0.74	.	15.0354	0.71741	0.0:0.0:1.0:0.0	.	248;248	P29322;P29322-2	EPHA8_HUMAN;.	N	248	ENSP00000166244:S248N;ENSP00000363775:S248N;ENSP00000440274:S248N	ENSP00000166244:S248N	S	+	2	0	EPHA8	22775880	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.787000	0.85759	2.103000	0.63969	0.442000	0.29010	AGC	-	pirsf_Tyr_kinase_ephrin_rcpt		0.687	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	protein_coding	OTTHUMT00000008085.1	G	NM_020526	-		22903293	+1	no_errors	ENST00000166244	ensembl	human	known	74_37	missense	SNP	1.000	A
SMIM9	100132963	genome.wustl.edu	37	X	154057855	154057855	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:154057855G>T	ENST00000369529.1	-	3	423	c.227C>A	c.(226-228)gCt>gAt	p.A76D	SMIM9_ENST00000478043.1_5'Flank	NM_001162936.1	NP_001156408.1	A6NGZ8	SMIM9_HUMAN	small integral membrane protein 9	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGAAGAAAAGCAACAATGGC	0.493																																																	0								ENSG00000203870						111.0	97.0	102.0					X																	154057855		692	1591	2283	SMIM9	SO:0001583	missense	0			-	HGNC		CCDS55546.1	Xq28	2012-11-29	2012-11-29	2012-11-29	ENSG00000203870	ENSG00000203870			41915	protein-coding gene	gene with protein product			"""chromosome X open reading frame 68"""	CXorf68			Standard	NM_001162936		Approved		uc022cik.1	A6NGZ8	OTTHUMG00000024243	ENST00000369529.1:c.227C>A	X.37:g.154057855G>T	ENSP00000358542:p.Ala76Asp	Somatic	0	41	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A76D	ENST00000369529.1	37	c.227	CCDS55546.1	X	.	.	.	.	.	.	.	.	.	.	g	14.93	2.681157	0.47886	.	.	ENSG00000203870	ENST00000369529	.	.	.	4.46	2.68	0.31781	.	0.000000	0.37577	N	0.002030	T	0.40909	0.1136	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32613	-0.9900	6	0.87932	D	0	-5.2362	6.3302	0.21266	0.2355:0.0:0.7645:0.0	.	.	.	.	D	76	.	ENSP00000358542:A76D	A	-	2	0	CXorf68	153711049	0.932000	0.31603	0.001000	0.08648	0.067000	0.16453	2.780000	0.47742	0.448000	0.26722	0.513000	0.50165	GCT	-	NULL		0.493	SMIM9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMIM9	protein_coding	OTTHUMT00000061185.2	G	NM_001162936	-		154057855	-1	no_errors	ENST00000369529	ensembl	human	known	74_37	missense	SNP	0.002	T
CCDC27	148870	genome.wustl.edu	37	1	3679854	3679854	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:3679854C>A	ENST00000294600.2	+	7	1221	c.1137C>A	c.(1135-1137)gaC>gaA	p.D379E		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	379	Glu-rich.									breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		aggaaggggacagggatgagg	0.642																																																	0								ENSG00000162592						77.0	80.0	79.0					1																	3679854		2199	4300	6499	CCDC27	SO:0001583	missense	0			-	HGNC		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1137C>A	1.37:g.3679854C>A	ENSP00000294600:p.Asp379Glu	Somatic	0	59	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	65	13.33	Q5TBV3|Q96M50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.D379E	ENST00000294600.2	37	c.1137	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	c	2.188	-0.385977	0.04966	.	.	ENSG00000162592	ENST00000294600	T	0.17370	2.28	3.64	-7.29	0.01451	.	2.086530	0.02203	N	0.062401	T	0.06554	0.0168	N	0.12182	0.205	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.32719	-0.9896	10	0.02654	T	1	-0.4268	4.4248	0.11498	0.0851:0.3032:0.4264:0.1854	.	379	Q2M243	CCD27_HUMAN	E	379	ENSP00000294600:D379E	ENSP00000294600:D379E	D	+	3	2	CCDC27	3669714	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.044000	0.03532	-1.701000	0.01413	-1.753000	0.00675	GAC	-	NULL		0.642	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	protein_coding	OTTHUMT00000009740.1	C	NM_152492	-		3679854	+1	no_errors	ENST00000294600	ensembl	human	known	74_37	missense	SNP	0.000	A
GABRA2	2555	genome.wustl.edu	37	4	46305540	46305540	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:46305540C>T	ENST00000510861.1	-	8	966	c.793G>A	c.(793-795)Gtc>Atc	p.V265I	GABRA2_ENST00000540012.1_Missense_Mutation_p.V210I|GABRA2_ENST00000514090.1_Missense_Mutation_p.V265I|GABRA2_ENST00000515082.1_Missense_Mutation_p.V265I|GABRA2_ENST00000356504.1_Missense_Mutation_p.V265I|GABRA2_ENST00000381620.4_Missense_Mutation_p.V265I|GABRA2_ENST00000507069.1_Missense_Mutation_p.V265I			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	265					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GAGAGAATGACAGTCATGATG	0.393																																																	0								ENSG00000151834						139.0	136.0	137.0					4																	46305540		2203	4300	6503	GABRA2	SO:0001583	missense	0			-	HGNC		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.793G>A	4.37:g.46305540C>T	ENSP00000421828:p.Val265Ile	Somatic	0	77	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	68	29.90	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V210I	ENST00000510861.1	37	c.628	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.189177	0.94923	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	D;D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	5.17	5.17	0.71159	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.93527	0.7934	M	0.79258	2.445	0.80722	D	1	D;P;D	0.69078	0.997;0.942;0.996	D;P;D	0.85130	0.972;0.805;0.997	D	0.94141	0.7397	10	0.87932	D	0	.	18.0281	0.89275	0.0:1.0:0.0:0.0	.	210;265;265	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	I	265;265;265;265;210;265;265	ENSP00000421828:V265I;ENSP00000421300:V265I;ENSP00000371033:V265I;ENSP00000348897:V265I;ENSP00000444409:V210I;ENSP00000427603:V265I;ENSP00000423840:V265I	ENSP00000348897:V265I	V	-	1	0	GABRA2	46000297	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.574000	0.86865	0.655000	0.94253	GTC	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.393	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	protein_coding	OTTHUMT00000360848.2	C		-		46305540	-1	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	SNP	1.000	T
NOTCH4	4855	genome.wustl.edu	37	6	32188547	32188547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:32188547delG	ENST00000375023.3	-	5	1046	c.908delC	c.(907-909)ccafs	p.P303fs		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	303	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CCAGGTTTCTGGGCAGAGGCA	0.587																																																	0								ENSG00000204301						89.0	85.0	86.0					6																	32188547		2203	4300	6503	NOTCH4	SO:0001589	frameshift_variant	0				HGNC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.908delC	6.37:g.32188547delG	ENSP00000364163:p.Pro303fs	Somatic	0	78	0.00		0.5694851509381481	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	45	48.86	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P303fs	ENST00000375023.3	37	c.908	CCDS34420.1	6																																																																																			-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.587	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	G				32188547	-1	no_errors	ENST00000375023	ensembl	human	known	74_37	frame_shift_del	DEL	0.983	-
OR2M3	127062	genome.wustl.edu	37	1	248367058	248367058	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:248367058C>T	ENST00000456743.1	+	1	727	c.689C>T	c.(688-690)tCt>tTt	p.S230F		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CACATGGGATCTGGAGAGGGT	0.443																																																	0								ENSG00000228198						274.0	264.0	268.0					1																	248367058		2203	4300	6503	OR2M3	SO:0001583	missense	0			-	HGNC		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.689C>T	1.37:g.248367058C>T	ENSP00000389625:p.Ser230Phe	Somatic	0	97	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	84	22.22	B9EH06|Q6IEY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S230F	ENST00000456743.1	37	c.689	CCDS31107.1	1	.	.	.	.	.	.	.	.	.	.	c	11.21	1.572043	0.28092	.	.	ENSG00000228198	ENST00000456743	T	0.00340	8.04	2.54	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31167	U	0.008122	T	0.00784	0.0026	H	0.95574	3.69	0.09310	N	1	P	0.36712	0.566	P	0.46850	0.529	T	0.01371	-1.1372	10	0.87932	D	0	.	13.0939	0.59180	0.0:1.0:0.0:0.0	.	230	Q8NG83	OR2M3_HUMAN	F	230	ENSP00000389625:S230F	ENSP00000389625:S230F	S	+	2	0	OR2M3	246433681	0.000000	0.05858	0.004000	0.12327	0.399000	0.30720	1.049000	0.30392	1.420000	0.47138	0.398000	0.26397	TCT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M3	protein_coding	OTTHUMT00000097355.1	C	NM_001004689	-		248367058	+1	no_errors	ENST00000456743	ensembl	human	known	74_37	missense	SNP	0.001	T
ASMT	438	genome.wustl.edu	37	X	1746870	1746870	+	Intron	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:1746870G>A	ENST00000381229.4	+	4	479				ASMT_ENST00000381233.3_Intron|ASMT_ENST00000381241.3_Intron|ASMT_ENST00000509780.1_3'UTR			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	GAGGTGCAACGTGACCCTTCC	0.468													g|||	75	0.014976	0.0552	0.0029	5008	,	,		18737	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000196433																																			ASMT	SO:0001627	intron_variant	0			-	HGNC	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.443+206G>A	X.37:g.1746870G>A		Somatic	0	24	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	31	44.64	B2RC33|Q16598|Q5JQ72|Q5JQ73	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381229.4	37	NULL		X																																																																																			-	-		0.468	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	protein_coding	OTTHUMT00000055612.1	G	NM_004043	-		1746870	+1	no_errors	ENST00000509780	ensembl	human	known	74_37	rna	SNP	0.002	A
ZDHHC16	84287	genome.wustl.edu	37	10	99212618	99212618	+	Intron	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr10:99212618C>T	ENST00000370854.3	+	5	716				ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000345745.5_Intron|ZDHHC16_ENST00000370842.2_Intron|ZDHHC16_ENST00000352634.4_Intron|ZDHHC16_ENST00000353979.3_Intron|ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000393760.1_Intron	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16						apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		AGAACTTTGGCCACCGTAACA	0.522																																																	0								ENSG00000171307						324.0	220.0	255.0					10																	99212618		2203	4300	6503	ZDHHC16	SO:0001627	intron_variant	0			-	HGNC	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.528-34C>T	10.37:g.99212618C>T		Somatic	0	41	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370854.3	37	NULL	CCDS7460.1	10																																																																																			-	-		0.522	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC16	protein_coding	OTTHUMT00000049658.2	C	NM_032327	-		99212618	+1	no_errors	ENST00000462924	ensembl	human	known	74_37	rna	SNP	0.997	T
INVS	27130	genome.wustl.edu	37	9	103055210	103055249	+	Frame_Shift_Del	DEL	ATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	ATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	-	rs371932940|rs142177132|rs200844390|rs114847355	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	ATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	ATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr9:103055210_103055249delATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	ENST00000262457.2	+	14	2856_2895	c.2671_2710delATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	c.(2671-2712)attgaccttctccccgtagagctccgactgcagataattcagfs	p.IDLLPVELRLQIIQ891fs	INVS_ENST00000541287.1_Frame_Shift_Del_p.IDLLPVELRLQIIQ795fs|INVS_ENST00000262456.2_Splice_Site_p.IDLLPVEL727fs	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	891					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				GAGTGTGAATATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTCAGAGAGAACG	0.546																																																	0			GRCh37	CM032002	INVS	M		ENSG00000119509																																			INVS	SO:0001589	frameshift_variant	0				HGNC	AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2671_2710delATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	9.37:g.103055210_103055249delATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	ENSP00000262457:p.Ile891fs	Somatic	NA	NA	NA		0.5694851509381481	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_IQ_motif_EF-hand-BS,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Ankyrin_rpt	p.I891fs	ENST00000262457.2	37	c.2671_2710	CCDS6746.1	9																																																																																			-	NULL		0.546	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	protein_coding	OTTHUMT00000053407.1	ATTGACCTTCTCCCCGTAGAGCTCCGACTGCAGATAATTC	NM_014425			103055249	+1	no_errors	ENST00000262457	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.995:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.995:0.746:0.872:0.907:0.908:0.996:1.000:1.000:0.999:0.991:0.976:0.991:0.985:0.643:0.990:0.996:0.994:0.995:0.994:1.000:1.000:1.000:0.995:1.000:1.000:1.000:1.000	-
EOMES	8320	genome.wustl.edu	37	3	27763427	27763428	+	In_Frame_Ins	INS	-	-	CGGCGC	rs368178421|rs1874198|rs3062761	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr3:27763427_27763428insCGGCGC	ENST00000295743.4	-	1	561_562	c.358_359insGCGCCG	c.(358-360)gcc>gGCGCCGcc	p.119_120insGA	EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron|EOMES_ENST00000449599.1_In_Frame_Ins_p.119_120insGA			O95936	EOMES_HUMAN	eomesodermin	119	Ala-rich.		A -> G (in dbSNP:rs12715125).		brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ggcggcggcggctgcagcggcg	0.767														2685	0.536142	0.3147	0.5274	5008	,	,		7250	0.8363		0.3837	False		,,,				2504	0.6892																0								ENSG00000163508			101,91,844		44,2,11,38,13,410						-0.4	0.1		dbSNP_102	1	316,357,1963		136,0,44,143,71,924	no	codingComplex	EOMES	NM_005442.2		180,2,55,181,84,1334	A1A1,A1A2,A1R,A2A2,A2R,RR		25.5311,18.5328,23.5566				417,448,2807				EOMES	SO:0001652	inframe_insertion	0				HGNC	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.358_359insGCGCCG	3.37:g.27763427_27763428insCGGCGC	ENSP00000295743:p.Ala119_Ala120insGlyAla	Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.120in_frame_insGA	ENST00000295743.4	37	c.359_358	CCDS2646.1	3																																																																																			-	NULL		0.767	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	-	NM_005442			27763428	-1	no_errors	ENST00000449599	ensembl	human	known	74_37	in_frame_ins	INS	0.116:0.075	CGGCGC
ICE1	23379	genome.wustl.edu	37	5	5463531	5463531	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:5463531G>T	ENST00000296564.7	+	13	4306	c.4084G>T	c.(4084-4086)Gac>Tac	p.D1362Y		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1362					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TGGGGAAGAAGACCTGCCAGA	0.547																																																	0								ENSG00000164151						32.0	35.0	34.0					5																	5463531		2040	4187	6227	KIAA0947	SO:0001583	missense	0			-	HGNC																												ENST00000296564.7:c.4084G>T	5.37:g.5463531G>T	ENSP00000296564:p.Asp1362Tyr	Somatic	0	67	0.00		0.5694851509381481	14	22.22	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	97	11.82	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Vitellinogen_superhlx	p.D1362Y	ENST00000296564.7	37	c.4084	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	9.852	1.193969	0.22037	.	.	ENSG00000164151	ENST00000296564	T	0.11277	2.79	4.91	0.908	0.19326	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.19331	0.035	B	0.19391	0.025	T	0.39165	-0.9627	9	0.48119	T	0.1	2.3442	5.026	0.14385	0.2717:0.1512:0.5771:0.0	.	1362	Q9Y2F5	K0947_HUMAN	Y	1362	ENSP00000296564:D1362Y	ENSP00000296564:D1362Y	D	+	1	0	KIAA0947	5516531	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	0.115000	0.15540	0.117000	0.18138	0.305000	0.20034	GAC	-	NULL		0.547	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	protein_coding	OTTHUMT00000365575.1	G		-		5463531	+1	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	SNP	0.001	T
NUDT7	283927	genome.wustl.edu	37	16	77775652	77775652	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr16:77775652delC	ENST00000268533.5	+	4	591	c.522delC	c.(520-522)atcfs	p.I174fs	NUDT7_ENST00000437314.3_Frame_Shift_Del_p.I121fs|RP11-264M12.2_ENST00000563690.1_RNA|NUDT7_ENST00000563839.1_3'UTR|NUDT7_ENST00000564031.1_3'UTR|NUDT7_ENST00000564085.1_3'UTR	NM_001105663.2	NP_001099133.1	P0C024	NUDT7_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 7	174					acetyl-CoA catabolic process (GO:0046356)|brown fat cell differentiation (GO:0050873)|coenzyme A catabolic process (GO:0015938)|nucleoside diphosphate metabolic process (GO:0009132)	peroxisome (GO:0005777)	acetyl-CoA hydrolase activity (GO:0003986)|hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides (GO:0016818)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|receptor binding (GO:0005102)|snoRNA binding (GO:0030515)	p.I174I(1)		breast(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|skin(1)	18						TTAATCATATCTTTGAGTACA	0.443																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000140876						102.0	95.0	97.0					16																	77775652		1930	4144	6074	NUDT7	SO:0001589	frameshift_variant	0				HGNC	AA227330	CCDS42195.1, CCDS58480.1, CCDS58479.1, CCDS73916.1	16q23.1	2007-06-15				ENSG00000140876		"""Nudix motif containing"""	8054	protein-coding gene	gene with protein product		609231				11415433	Standard	NM_001105663		Approved		uc010chd.3	P0C024		ENST00000268533.5:c.522delC	16.37:g.77775652delC	ENSP00000268533:p.Ile174fs	Somatic	0	72	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	48	44.83	B4DLE5|H3BUB8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.F175fs	ENST00000268533.5	37	c.522	CCDS42195.1	16																																																																																			-	superfamily_NUDIX_hydrolase_dom-like		0.443	NUDT7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT7	protein_coding	OTTHUMT00000433873.1	C				77775652	+1	no_errors	ENST00000268533	ensembl	human	known	74_37	frame_shift_del	DEL	0.625	-
RHPN2	85415	genome.wustl.edu	37	19	33498977	33498977	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:33498977C>T	ENST00000254260.3	-	7	738	c.703G>A	c.(703-705)Gat>Aat	p.D235N	RHPN2_ENST00000400226.4_Missense_Mutation_p.D84N	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	235	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GTCTGCCGATCACACCGGGTC	0.627																																																	0								ENSG00000131941						30.0	26.0	27.0					19																	33498977		2202	4300	6502	RHPN2	SO:0001583	missense	0			-	HGNC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.703G>A	19.37:g.33498977C>T	ENSP00000254260:p.Asp235Asn	Somatic	0	101	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	133	18.40	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BRO1_dom,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,superfamily_PDZ,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom	p.D235N	ENST00000254260.3	37	c.703	CCDS12427.1	19	.	.	.	.	.	.	.	.	.	.	C	0.636	-0.815428	0.02776	.	.	ENSG00000131941	ENST00000254260;ENST00000400226	T;T	0.16457	2.34;2.34	4.36	-2.36	0.06663	BRO1 domain (3);	0.245363	0.46758	N	0.000264	T	0.04137	0.0115	N	0.02181	-0.65	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43861	-0.9365	10	0.12430	T	0.62	0.7469	5.9088	0.19016	0.0:0.2975:0.1284:0.5741	.	235	Q8IUC4	RHPN2_HUMAN	N	235;84	ENSP00000254260:D235N;ENSP00000402244:D84N	ENSP00000254260:D235N	D	-	1	0	RHPN2	38190817	0.042000	0.20092	0.479000	0.27329	0.124000	0.20399	0.292000	0.19011	-0.799000	0.04439	-0.693000	0.03709	GAT	-	pfam_BRO1_dom,pfscan_BRO1_dom		0.627	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	protein_coding	OTTHUMT00000450828.2	C	NM_033103	-		33498977	-1	no_errors	ENST00000254260	ensembl	human	known	74_37	missense	SNP	0.149	T
TBKBP1	9755	genome.wustl.edu	37	17	45787898	45787898	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr17:45787898G>A	ENST00000361722.3	+	9	2603	c.1754G>A	c.(1753-1755)aGc>aAc	p.S585N		NM_014726.2	NP_055541.1			TBK1 binding protein 1											endometrium(5)|kidney(1)|lung(1)	7						GACATCCGCAGCTGCCCCCTC	0.602																																																	0								ENSG00000198933						40.0	47.0	45.0					17																	45787898		1995	4144	6139	TBKBP1	SO:0001583	missense	0			-	HGNC	AB018318	CCDS45722.1	17q21.32	2012-05-17				ENSG00000198933			30140	protein-coding gene	gene with protein product		608476				14743216, 19481056	Standard	NM_014726		Approved	ProSAPiP2, KIAA0775	uc002ilu.3	A7MCY6		ENST00000361722.3:c.1754G>A	17.37:g.45787898G>A	ENSP00000354777:p.Ser585Asn	Somatic	0	71	0.00		0.5694851509381481	6	66.67	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	11	78.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S585N	ENST00000361722.3	37	c.1754	CCDS45722.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.262943	0.95399	.	.	ENSG00000198933	ENST00000361722	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.70117	-0.4960	9	0.87932	D	0	-20.6956	18.5721	0.91138	0.0:0.0:1.0:0.0	.	585	A7MCY6	TBKB1_HUMAN	N	585	.	ENSP00000354777:S585N	S	+	2	0	TBKBP1	43142897	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.095000	0.94175	2.687000	0.91594	0.462000	0.41574	AGC	-	NULL		0.602	TBKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBKBP1	protein_coding	OTTHUMT00000441363.1	G	NM_014726	-		45787898	+1	no_errors	ENST00000361722	ensembl	human	known	74_37	missense	SNP	1.000	A
CDK13	8621	genome.wustl.edu	37	7	40127771	40127771	+	Nonsense_Mutation	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:40127771A>T	ENST00000181839.4	+	12	3681	c.3076A>T	c.(3076-3078)Aga>Tga	p.R1026*	CDK13_ENST00000340829.5_Nonsense_Mutation_p.R1026*	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1026					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TAAAAAGCGAAGAAGACAGAA	0.398																																																	0								ENSG00000065883						86.0	85.0	85.0					7																	40127771		2203	4300	6503	CDK13	SO:0001587	stop_gained	0			-	HGNC	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3076A>T	7.37:g.40127771A>T	ENSP00000181839:p.Arg1026*	Somatic	0	36	0.00		0.5694851509381481	20	16.67	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1026*	ENST00000181839.4	37	c.3076	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	A	42	9.577241	0.99210	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	.	.	.	5.56	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.2395	12.5813	0.56391	0.8616:0.1384:0.0:0.0	.	.	.	.	X	1026	.	.	R	+	1	2	CDK13	40094296	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.760000	0.55235	2.250000	0.74265	0.477000	0.44152	AGA	-	superfamily_Kinase-like_dom		0.398	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	protein_coding	OTTHUMT00000250726.2	A	NM_003718	-		40127771	+1	no_errors	ENST00000181839	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76889149	76889159	+	Frame_Shift_Del	DEL	TGCTGAAATCC	TGCTGAAATCC	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	TGCTGAAATCC	TGCTGAAATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:76889149_76889159delTGCTGAAATCC	ENST00000373344.5	-	18	5065_5075	c.4851_4861delGGATTTCAGCA	c.(4849-4863)ctggatttcagcacgfs	p.DFST1618fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.DFST1580fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1618	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACTAACGCCGTGCTGAAATCCAGTTTGTCAC	0.341			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4851_4861delGGATTTCAGCA	X.37:g.76889149_76889159delTGCTGAAATCC	ENSP00000362441:p.Asp1618fs	Somatic	NA	NA	NA		0.5694851509381481	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1618fs	ENST00000373344.5	37	c.4861_4851	CCDS14434.1	X																																																																																			-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.341	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TGCTGAAATCC	NM_000489			76889159	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
DMXL1	1657	genome.wustl.edu	37	5	118469962	118469962	+	Splice_Site	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:118469962G>T	ENST00000311085.8	+	13	2334		c.e13-1		DMXL1_ENST00000539542.1_Splice_Site	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1											breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATACTTTCTAGGTGCATACTG	0.323																																																	0								ENSG00000172869						101.0	106.0	104.0					5																	118469962		2202	4299	6501	DMXL1	SO:0001630	splice_region_variant	0			-	HGNC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2255-1G>T	5.37:g.118469962G>T		Somatic	0	40	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	23	37.84		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e13-1	ENST00000311085.8	37	c.2255-1	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702342	0.48307	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7464	0.96253	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DMXL1	118497861	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	6.275000	0.72594	2.667000	0.90743	0.563000	0.77884	.	-	-		0.323	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	G	NM_005509	-	Intron	118469962	+1	no_errors	ENST00000539542	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ERICH6B	220081	genome.wustl.edu	37	13	46170720	46170737	+	In_Frame_Del	DEL	CCAGATACTCTTCCTCCT	CCAGATACTCTTCCTCCT	-	rs373081063|rs117004691|rs28548352|rs142875900|rs28460344|rs45625342|rs375947127	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	CCAGATACTCTTCCTCCT	CCAGATACTCTTCCTCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr13:46170720_46170737delCCAGATACTCTTCCTCCT	ENST00000298738.2	-	3	568_585	c.404_421delAGGAGGAAGAGTATCTGG	c.(403-423)gaggaggaagagtatctgggg>ggg	p.EEEEYL135del		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCTTCCTTCCCCAGATActcttcctcctccagatgctc	0.486														1379	0.275359	0.1362	0.4308	5008	,	,		23489	0.1607		0.493	False		,,,				2504	0.2474																0								ENSG00000165837			414,2088		68,278,905						-4.5	0.0		dbSNP_134	119	2412,2596		704,1004,796	no	coding	FAM194B	NM_182542.2		772,1282,1701	A1A1,A1R,RR		48.1629,16.5468,37.6298				2826,4684				FAM194B	SO:0001651	inframe_deletion	0				HGNC																												ENST00000298738.2:c.404_421delAGGAGGAAGAGTATCTGG	13.37:g.46170720_46170737delCCAGATACTCTTCCTCCT	ENSP00000298738:p.Glu135_Leu140del	Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96MB5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.EEEEYL135in_frame_del	ENST00000298738.2	37	c.421_404	CCDS45045.1	13																																																																																			-	NULL		0.486	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	protein_coding	OTTHUMT00000044781.3	CCAGATACTCTTCCTCCT				46170737	-1	no_errors	ENST00000298738	ensembl	human	known	74_37	in_frame_del	DEL	0.119:0.974:0.981:0.958:0.691:0.046:0.004:0.002:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
RHOBTB2	23221	genome.wustl.edu	37	8	22874836	22874836	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr8:22874836C>T	ENST00000251822.6	+	10	2575	c.2038C>T	c.(2038-2040)Cgg>Tgg	p.R680W	RP11-875O11.1_ENST00000502083.2_RNA|RHOBTB2_ENST00000519685.1_Missense_Mutation_p.R702W|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.R687W	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	680					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		TCATTACCAGCGGGCACGGAA	0.572																																																	0								ENSG00000008853						144.0	115.0	125.0					8																	22874836		2203	4300	6503	RHOBTB2	SO:0001583	missense	0			-	HGNC	AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.2038C>T	8.37:g.22874836C>T	ENSP00000251822:p.Arg680Trp	Somatic	0	27	0.00		0.5694851509381481	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.R680W	ENST00000251822.6	37	c.2038	CCDS6034.1	8	.	.	.	.	.	.	.	.	.	.	c	19.66	3.869850	0.72065	.	.	ENSG00000008853	ENST00000519685;ENST00000522948;ENST00000251822	T;T;T	0.11495	2.77;2.78;2.78	5.66	-1.25	0.09405	.	0.000000	0.85682	D	0.000000	T	0.32285	0.0824	M	0.79475	2.455	0.49389	D	0.999787	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.36407	-0.9749	10	0.87932	D	0	.	17.4539	0.87602	0.761:0.239:0.0:0.0	.	687;680;702	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	W	702;687;680	ENSP00000427926:R702W;ENSP00000429141:R687W;ENSP00000251822:R680W	ENSP00000251822:R680W	R	+	1	2	RHOBTB2	22930781	0.999000	0.42202	0.976000	0.42696	0.958000	0.62258	0.740000	0.26188	-0.212000	0.10109	-0.181000	0.13052	CGG	-	NULL		0.572	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RHOBTB2	protein_coding	OTTHUMT00000215101.2	C		-		22874836	+1	no_errors	ENST00000251822	ensembl	human	known	74_37	missense	SNP	0.962	T
SPEG	10290	genome.wustl.edu	37	2	220330645	220330646	+	Intron	DEL	GC	GC	-	rs370532066|rs1976618	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:220330645_220330646delGC	ENST00000312358.7	+	10	3013				SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396688.1_Intron|SPEG_ENST00000396686.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000396698.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		gtgtgtgtgtgcgcgcgtgtgc	0.604																																																	0								ENSG00000072195																																			SPEG	SO:0001627	intron_variant	0				HGNC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1250GC>-	2.37:g.220330649_220330650delGC		Somatic	0	8	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																			-	-		0.604	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	protein_coding	OTTHUMT00000130252.2	GC	NM_005876			220330646	+1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	DEL	0.015:0.006	-
KRT8P47	644743	genome.wustl.edu	37	1	44569970	44569971	+	lincRNA	INS	-	-	GCTTCTCCTGGCCCAGAGTCTCCAGCTGCCGCC	rs71587039|rs138979038		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:44569970_44569971insGCTTCTCCTGGCCCAGAGTCTCCAGCTGCCGCC	ENST00000434244.1	+	0	1967_1968																											CTCCAGCTTCAGCTTCTCCTGG	0.55																																																	0								ENSG00000230615																																			RP5-1198O20.4			0				Clone_based_vega_gene																													1.37:g.44569970_44569971insGCTTCTCCTGGCCCAGAGTCTCCAGCTGCCGCC		Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000434244.1	37	NULL		1																																																																																			-	-		0.550	RP5-1198O20.4-001	KNOWN	basic	lincRNA	ENSG00000230615	lincRNA	OTTHUMT00000022875.2	-				44569971	+1	no_errors	ENST00000434244	ensembl	human	known	74_37	rna	INS	1.000:0.999	GCTTCTCCTGGCCCAGAGTCTCCAGCTGCCGCC
INPP4A	3631	genome.wustl.edu	37	2	99163121	99163121	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:99163121G>A	ENST00000523221.1	+	11	1127	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H	INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000545415.1_Missense_Mutation_p.R376H|INPP4A_ENST00000409540.3_Missense_Mutation_p.R376H|INPP4A_ENST00000409016.4_Missense_Mutation_p.R376H|INPP4A_ENST00000409851.3_Missense_Mutation_p.R376H|INPP4A_ENST00000074304.5_Missense_Mutation_p.R376H			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	376					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GGAGGTCTCCGCAAAAAGCTG	0.458																																																	0								ENSG00000040933						64.0	64.0	64.0					2																	99163121		1903	4124	6027	INPP4A	SO:0001583	missense	0			-	HGNC	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1127G>A	2.37:g.99163121G>A	ENSP00000427722:p.Arg376His	Somatic	0	59	0.00		0.5694851509381481	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.R376H	ENST00000523221.1	37	c.1127	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.523740	0.96431	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.999;0.999	T	0.43637	-0.9379	10	0.12430	T	0.62	-21.0946	18.117	0.89559	0.0:0.0:1.0:0.0	.	376;376;376;376	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	H	376	ENSP00000386704:R376H;ENSP00000386777:R376H;ENSP00000074304:R376H;ENSP00000442149:R376H;ENSP00000387294:R376H;ENSP00000427722:R376H	ENSP00000074304:R376H	R	+	2	0	INPP4A	98529553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.592000	0.98245	2.757000	0.94681	0.655000	0.94253	CGC	-	NULL		0.458	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	protein_coding	OTTHUMT00000376095.1	G	NM_001566	-		99163121	+1	no_errors	ENST00000074304	ensembl	human	known	74_37	missense	SNP	1.000	A
C16orf96	342346	genome.wustl.edu	37	16	4626242	4626242	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr16:4626242G>A	ENST00000444310.4	+	5	1761	c.1761G>A	c.(1759-1761)caG>caA	p.Q587Q		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCGCTGCCCAGGCAGCCAAAG	0.647																																																	0								ENSG00000205832						12.0	18.0	16.0					16																	4626242		692	1589	2281	C16orf96	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.1761G>A	16.37:g.4626242G>A		Somatic	0	59	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	66	27.47		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q587	ENST00000444310.4	37	c.1761	CCDS53986.1	16																																																																																			-	NULL		0.647	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	protein_coding	OTTHUMT00000432384.1	G	NM_001145011	-		4626242	+1	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	SNP	0.001	A
TROVE2	6738	genome.wustl.edu	37	1	193054346	193054347	+	3'UTR	INS	-	-	A	rs567626813|rs56152513|rs397940332		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:193054346_193054347insA	ENST00000367446.3	+	0	2312_2313				TROVE2_ENST00000367444.3_Intron|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367445.3_Intron|TROVE2_ENST00000367443.1_Intron|TROVE2_ENST00000432079.1_3'UTR	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						ACCAAGGGGGTAAAAAAAAAAA	0.297																																																	0								ENSG00000116747																																			TROVE2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.*486->A	1.37:g.193054357_193054357dupA		Somatic	0	51	0.00		0.5694851509381481	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367446.3	37	NULL	CCDS1379.1	1																																																																																			-	-		0.297	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	protein_coding	OTTHUMT00000086688.1	-	NM_004600			193054347	+1	no_errors	ENST00000460715	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
PPAP2C	8612	genome.wustl.edu	37	19	288083	288083	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:288083G>T	ENST00000269812.3	-	2	190	c.141C>A	c.(139-141)taC>taA	p.Y47*	PPAP2C_ENST00000327790.3_Nonsense_Mutation_p.Y68*|PPAP2C_ENST00000434325.2_5'UTR	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	47					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATCTGGACGGTAGGGGTACC	0.627																																																	0								ENSG00000141934						157.0	126.0	136.0					19																	288083		2203	4300	6503	PPAP2C	SO:0001587	stop_gained	0			-	HGNC	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.141C>A	19.37:g.288083G>T	ENSP00000269812:p.Tyr47*	Somatic	0	177	0.00		0.5694851509381481	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	136	21.39	A6NLV0|E9PAY8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.Y68*	ENST00000269812.3	37	c.204	CCDS12023.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.299988	0.97453	.	.	ENSG00000141934	ENST00000269812;ENST00000327790	.	.	.	4.7	4.7	0.59300	.	0.369090	0.24470	N	0.038258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.604	16.6041	0.84824	0.0:0.0:1.0:0.0	.	.	.	.	X	47;68	.	ENSP00000269812:Y47X	Y	-	3	2	PPAP2C	239083	1.000000	0.71417	0.515000	0.27774	0.980000	0.70556	3.794000	0.55492	2.335000	0.79485	0.650000	0.86243	TAC	-	superfamily_P_Acid_Pase_2/haloperoxidase		0.627	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2C	protein_coding	OTTHUMT00000451777.2	G		-		288083	-1	no_errors	ENST00000327790	ensembl	human	known	74_37	nonsense	SNP	0.865	T
ZNF890P	645700	genome.wustl.edu	37	7	5161807	5161807	+	RNA	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:5161807C>T	ENST00000422060.2	-	0	747					NR_034163.1				zinc finger protein 890, pseudogene																		TGTTGGTCTTCGTGTTGCTGT	0.393																																																	0								ENSG00000159904																																			ZNF890P			0			-	HGNC			7p22.1	2011-05-24			ENSG00000159904	ENSG00000159904			38691	pseudogene	pseudogene							Standard	NR_034163		Approved		uc003snu.1		OTTHUMG00000166790		7.37:g.5161807C>T		Somatic	0	50	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	28	24.32		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422060.2	37	NULL		7																																																																																			-	-		0.393	ZNF890P-002	KNOWN	basic	processed_transcript	ZNF890P	pseudogene	OTTHUMT00000391474.1	C	NR_034163	-		5161807	-1	no_errors	ENST00000422060	ensembl	human	known	74_37	rna	SNP	0.177	T
ANKRD30B	374860	genome.wustl.edu	37	18	14779966	14779966	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr18:14779966G>A	ENST00000358984.4	+	11	1608	c.1428G>A	c.(1426-1428)atG>atA	p.M476I	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.M476I|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	476										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TAGATCAGATGTTCCCATCAG	0.279																																																	0								ENSG00000180777						178.0	160.0	165.0					18																	14779966		692	1591	2283	ANKRD30B	SO:0001583	missense	0			-	HGNC	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1428G>A	18.37:g.14779966G>A	ENSP00000351875:p.Met476Ile	Somatic	0	100	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	86	20.37	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M476I	ENST00000358984.4	37	c.1428	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	1.808	-0.475490	0.04414	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.34667	3.45;1.35	1.69	-1.51	0.08664	.	.	.	.	.	T	0.22244	0.0536	L	0.36672	1.1	0.09310	N	1	B	0.19817	0.039	B	0.15870	0.014	T	0.23511	-1.0186	9	0.48119	T	0.1	.	2.0333	0.03534	0.3537:0.0:0.389:0.2574	.	476	F8WAG3	.	I	476	ENSP00000351875:M476I;ENSP00000399031:M476I	ENSP00000351875:M476I	M	+	3	0	ANKRD30B	14769966	1.000000	0.71417	0.000000	0.03702	0.126000	0.20510	1.238000	0.32707	-0.447000	0.07138	0.297000	0.19635	ATG	-	NULL		0.279	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	protein_coding	OTTHUMT00000443557.1	G	NM_001145029	-		14779966	+1	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	SNP	0.000	A
TJAP1	93643	genome.wustl.edu	37	6	43470514	43470528	+	Intron	DEL	AGGAGAGAGGTGGGG	AGGAGAGAGGTGGGG	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	AGGAGAGAGGTGGGG	AGGAGAGAGGTGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:43470514_43470528delAGGAGAGAGGTGGGG	ENST00000372445.5	+	8	763				TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Intron|TJAP1_ENST00000259751.1_Intron|TJAP1_ENST00000438588.2_Intron|TJAP1_ENST00000372444.2_Intron|TJAP1_ENST00000372449.1_Intron|TJAP1_ENST00000372452.1_Intron	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)						Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCTCCCTCCCAGGAGAGAGGTGGGGAGCCTAGCCT	0.581																																																	0								ENSG00000137221																																			TJAP1	SO:0001627	intron_variant	0				HGNC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.387+159AGGAGAGAGGTGGGG>-	6.37:g.43470514_43470528delAGGAGAGAGGTGGGG		Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372445.5	37	NULL	CCDS55004.1	6																																																																																			-	-		0.581	TJAP1-202	KNOWN	basic|CCDS	protein_coding	TJAP1	protein_coding	OTTHUMT00000040629.1	AGGAGAGAGGTGGGG	NM_080604			43470528	+1	no_errors	ENST00000483640	ensembl	human	known	74_37	rna	DEL	0.000:0.010:0.002:0.000:0.000:0.001:0.001:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000	-
PCSK9	255738	genome.wustl.edu	37	1	55521749	55521749	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:55521749C>G	ENST00000302118.5	+	6	1173	c.883C>G	c.(883-885)Cgc>Ggc	p.R295G	PCSK9_ENST00000490692.1_3'UTR|PCSK9_ENST00000543384.1_Missense_Mutation_p.R95G	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	295	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TGGGTACAGCCGCGTCCTCAA	0.682																																					Pancreas(137;1454 1827 5886 22361 42375)												0								ENSG00000169174						17.0	19.0	18.0					1																	55521749		2195	4297	6492	PCSK9	SO:0001583	missense	0			-	HGNC	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.883C>G	1.37:g.55521749C>G	ENSP00000303208:p.Arg295Gly	Somatic	0	51	0.00		0.5694851509381481	36	14.29	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	159	8.09	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_Inhibitor_I9,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.R295G	ENST00000302118.5	37	c.883	CCDS603.1	1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331316	0.41297	.	.	ENSG00000169174	ENST00000302118;ENST00000543384	T;T	0.75938	-0.98;-0.98	3.88	2.67	0.31697	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.231782	0.35677	U	0.003050	T	0.66268	0.2772	L	0.54908	1.71	0.41689	D	0.989331	D	0.53619	0.961	B	0.40038	0.317	T	0.67126	-0.5749	10	0.62326	D	0.03	-10.4314	10.2589	0.43414	0.0:0.8811:0.0:0.1189	.	295	Q8NBP7	PCSK9_HUMAN	G	295;95	ENSP00000303208:R295G;ENSP00000441859:R95G	ENSP00000303208:R295G	R	+	1	0	PCSK9	55294337	1.000000	0.71417	0.455000	0.27031	0.967000	0.64934	3.024000	0.49674	0.517000	0.28361	0.563000	0.77884	CGC	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom		0.682	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK9	protein_coding	OTTHUMT00000022280.1	C	NM_174936	-		55521749	+1	no_errors	ENST00000302118	ensembl	human	known	74_37	missense	SNP	0.996	G
IVL	3713	genome.wustl.edu	37	1	152883319	152883319	+	Missense_Mutation	SNP	A	A	G	rs370427172		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:152883319A>G	ENST00000368764.3	+	2	1110	c.1046A>G	c.(1045-1047)cAg>cGg	p.Q349R	IVL_ENST00000392667.2_Missense_Mutation_p.Q203R			P07476	INVO_HUMAN	involucrin	349	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ctggagcagcaggaggggcag	0.662																																																	0								ENSG00000163207						15.0	14.0	14.0					1																	152883319		2119	4168	6287	IVL	SO:0001583	missense	0			-	HGNC	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1046A>G	1.37:g.152883319A>G	ENSP00000357753:p.Gln349Arg	Somatic	0	89	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	82	9.89	Q5T7P4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q349R	ENST00000368764.3	37	c.1046	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550225	0.45383	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11169	3.02;2.8	3.82	3.82	0.43975	.	.	.	.	.	T	0.04318	0.0119	L	0.34521	1.04	0.09310	N	1	P	0.42078	0.77	B	0.42995	0.404	T	0.33343	-0.9872	9	0.38643	T	0.18	.	10.8514	0.46771	1.0:0.0:0.0:0.0	.	349	P07476	INVO_HUMAN	R	349;203	ENSP00000357753:Q349R;ENSP00000376435:Q203R	ENSP00000357753:Q349R	Q	+	2	0	IVL	151149943	0.000000	0.05858	0.012000	0.15200	0.011000	0.07611	0.411000	0.21115	1.515000	0.48885	0.456000	0.33151	CAG	-	pfam_Involucrin_rpt		0.662	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	protein_coding	OTTHUMT00000034664.1	A	NM_005547	-		152883319	+1	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	SNP	0.063	G
PCDHA10	56139	genome.wustl.edu	37	5	140236983	140236983	+	Silent	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:140236983C>T	ENST00000307360.5	+	1	1350	c.1350C>T	c.(1348-1350)aaC>aaT	p.N450N	PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.N450N|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	450	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N450K(2)|p.N450N(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAACGACAACGCGCCTGCGT	0.682																																																	4	Substitution - Missense(2)|Substitution - coding silent(2)	ovary(2)|endometrium(2)						ENSG00000250120						102.0	95.0	97.0					5																	140236983		2196	4276	6472	PCDHA10	SO:0001819	synonymous_variant	0			-	HGNC	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1350C>T	5.37:g.140236983C>T		Somatic	1	156	0.64		0.5694851509381481	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	86	111	43.65	A1L493|O75280|Q9NRU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N450	ENST00000307360.5	37	c.1350	CCDS54921.1	5																																																																																			-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	protein_coding	OTTHUMT00000372895.2	C	NM_018901	-		140236983	+1	no_errors	ENST00000307360	ensembl	human	known	74_37	silent	SNP	0.906	T
ST6GALNAC3	256435	genome.wustl.edu	37	1	77042702	77042702	+	Intron	SNP	G	G	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:77042702G>C	ENST00000328299.3	+	4	771				ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3						glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						CAAAGATTAAGATTGTGGCTT	0.328																																																	0								ENSG00000184005																																			ST6GALNAC3	SO:0001627	intron_variant	0			-	HGNC		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.624-50435G>C	1.37:g.77042702G>C		Somatic	0	10	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	Q6PCE0|Q6UX29|Q8N259	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328299.3	37	NULL	CCDS672.1	1																																																																																			-	-		0.328	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC3	protein_coding	OTTHUMT00000026501.1	G	NM_152996	-		77042702	+1	no_errors	ENST00000464140	ensembl	human	known	74_37	rna	SNP	0.000	C
HYAL4	23553	genome.wustl.edu	37	7	123516947	123516947	+	Missense_Mutation	SNP	C	C	T	rs141828412		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:123516947C>T	ENST00000223026.4	+	5	1822	c.1184C>T	c.(1183-1185)cCc>cTc	p.P395L	HYAL4_ENST00000476325.1_Missense_Mutation_p.P395L	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	395					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TGGAACGCGCCCAGTTACCTT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		18488	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000106302	C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	138.0	127.0	131.0		1184	4.9	0.1	7	dbSNP_134	131	6,8594	5.0+/-18.6	0,6,4294	yes	missense	HYAL4	NM_012269.2	98	0,7,6496	TT,TC,CC		0.0698,0.0227,0.0538	benign	395/482	123516947	7,12999	2203	4300	6503	HYAL4	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1184C>T	7.37:g.123516947C>T	ENSP00000223026:p.Pro395Leu	Somatic	0	112	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	122	9.56	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.P395L	ENST00000223026.4	37	c.1184	CCDS5789.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.161	-1.081417	0.01888	2.27E-4	6.98E-4	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.16597	2.33;2.33	5.86	4.93	0.64822	Epidermal growth factor-like (1);	0.466272	0.22016	N	0.065793	T	0.14056	0.0340	L	0.46157	1.445	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.10268	-1.0637	10	0.23891	T	0.37	-7.0373	8.1482	0.31124	0.2692:0.6571:0.0:0.0737	.	395	Q2M3T9	HYAL4_HUMAN	L	395	ENSP00000223026:P395L;ENSP00000417186:P395L	ENSP00000223026:P395L	P	+	2	0	HYAL4	123304183	0.000000	0.05858	0.061000	0.19648	0.015000	0.08874	-0.143000	0.10296	2.937000	0.99478	0.650000	0.86243	CCC	-	pirsf_Hyaluronidase		0.512	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	protein_coding	OTTHUMT00000348545.1	C	NM_012269	rs141828412		123516947	+1	no_errors	ENST00000223026	ensembl	human	known	74_37	missense	SNP	0.001	T
CTB-52I2.4	0	genome.wustl.edu	37	19	18142291	18142291	+	RNA	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:18142291C>A	ENST00000594957.3	+	0	1052																											CCTTTCAGACCCTTACCTGTC	0.567																																																	0								ENSG00000268032																																			CTB-52I2.4			0			-	Clone_based_vega_gene																													19.37:g.18142291C>A		Somatic	0	35	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000594957.3	37	NULL		19																																																																																			-	-		0.567	CTB-52I2.4-002	KNOWN	basic	processed_transcript	ENSG00000268032	pseudogene	OTTHUMT00000466852.4	C		-		18142291	+1	no_errors	ENST00000594957	ensembl	human	known	74_37	rna	SNP	1.000	A
GRID1	2894	genome.wustl.edu	37	10	88024517	88024517	+	Intron	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr10:88024517C>T	ENST00000327946.7	-	3	321				MIR346_ENST00000362234.2_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GGCAGGCATGCGGGCAGACAG	0.647										Multiple Myeloma(13;0.14)																																							0								ENSG00000199104						23.0	35.0	31.0					10																	88024517		1551	3550	5101	MIR346	SO:0001627	intron_variant	0			-	HGNC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.236-58112G>A	10.37:g.88024517C>T		Somatic	0	38	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	B3KXD5|B7Z7L0|Q8IXT3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000327946.7	37	NULL	CCDS31236.1	10																																																																																			-	-		0.647	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR346	protein_coding	OTTHUMT00000049148.3	C	XM_043613	-		88024517	-1	no_errors	ENST00000362234	ensembl	human	known	74_37	rna	SNP	0.998	T
PTH2R	5746	genome.wustl.edu	37	2	209358326	209358326	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:209358326C>T	ENST00000272847.2	+	13	1808	c.1595C>T	c.(1594-1596)cCt>cTt	p.P532L	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	532					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.P532H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	CCTTCCAGGCCTATGGAATCT	0.502																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000144407						85.0	85.0	85.0					2																	209358326		2203	4300	6503	PTH2R	SO:0001583	missense	0			-	HGNC	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1595C>T	2.37:g.209358326C>T	ENSP00000272847:p.Pro532Leu	Somatic	0	28	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	Q8N429	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.P532L	ENST00000272847.2	37	c.1595	CCDS2383.1	2	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012145	0.35511	.	.	ENSG00000144407	ENST00000272847	T	0.52754	0.65	5.71	3.91	0.45181	.	0.221037	0.22917	U	0.054073	T	0.43188	0.1236	M	0.65498	2.005	0.28284	N	0.923869	B;B	0.21309	0.054;0.002	B;B	0.17979	0.02;0.001	T	0.35475	-0.9787	9	.	.	.	.	8.7866	0.34825	0.1507:0.7705:0.0:0.0788	.	421;532	B4DFN8;P49190	.;PTH2R_HUMAN	L	532	ENSP00000272847:P532L	.	P	+	2	0	PTH2R	209066571	0.008000	0.16893	0.351000	0.25721	0.025000	0.11179	0.972000	0.29409	0.762000	0.33152	0.591000	0.81541	CCT	-	NULL		0.502	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	protein_coding	OTTHUMT00000256519.2	C	NM_005048	-		209358326	+1	no_errors	ENST00000272847	ensembl	human	known	74_37	missense	SNP	0.122	T
RYR3	6263	genome.wustl.edu	37	15	34028478	34028478	+	Silent	SNP	C	C	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr15:34028478C>G	ENST00000389232.4	+	49	7537	c.7467C>G	c.(7465-7467)ctC>ctG	p.L2489L	RYR3_ENST00000415757.3_Silent_p.L2489L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2489	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGCGACGCCTCGTTTTTGATG	0.393																																																	0								ENSG00000198838						125.0	115.0	118.0					15																	34028478		1905	4145	6050	RYR3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7467C>G	15.37:g.34028478C>G		Somatic	0	89	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	63	13.70	O15175|Q15412	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L2489	ENST00000389232.4	37	c.7467	CCDS45210.1	15																																																																																			-	superfamily_ARM-type_fold		0.393	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	C		-		34028478	+1	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	SNP	0.286	G
IQGAP1	8826	genome.wustl.edu	37	15	91034675	91034675	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr15:91034675A>T	ENST00000268182.5	+	34	4483	c.4359A>T	c.(4357-4359)caA>caT	p.Q1453H	IQGAP1_ENST00000560738.1_Missense_Mutation_p.Q881H	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1453	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TCACTCTTCAAGAGAAGAAAG	0.438																																																	0								ENSG00000140575						129.0	125.0	127.0					15																	91034675		2198	4298	6496	IQGAP1	SO:0001583	missense	0			-	HGNC	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4359A>T	15.37:g.91034675A>T	ENSP00000268182:p.Gln1453His	Somatic	0	65	0.00		0.5694851509381481	215	18.11	48	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	73	14.12	A7MBM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_WW_dom,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.Q1453H	ENST00000268182.5	37	c.4359	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	A	19.16	3.774274	0.69992	.	.	ENSG00000140575	ENST00000268182	T	0.40476	1.03	6.08	0.857	0.19025	RasGAP protein, C-terminal (1);	0.059187	0.64402	D	0.000002	T	0.41971	0.1182	L	0.36672	1.1	0.58432	D	0.999997	P;P	0.48834	0.916;0.865	P;P	0.57009	0.811;0.637	T	0.14227	-1.0480	10	0.13470	T	0.59	-24.4073	11.2826	0.49203	0.3652:0.0:0.6348:0.0	.	74;1453	B4DNP4;P46940	.;IQGA1_HUMAN	H	1453	ENSP00000268182:Q1453H	ENSP00000268182:Q1453H	Q	+	3	2	IQGAP1	88835679	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	0.538000	0.23160	0.169000	0.19679	-0.959000	0.02639	CAA	-	pfam_RasGAP_C		0.438	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	protein_coding	OTTHUMT00000313493.1	A	NM_003870	-		91034675	+1	no_errors	ENST00000268182	ensembl	human	known	74_37	missense	SNP	1.000	T
NKRF	55922	genome.wustl.edu	37	X	118722358	118722358	+	3'UTR	DEL	T	T	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:118722358delT	ENST00000371527.1	-	0	3682				NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000542113.1_3'UTR|NKRF_ENST00000304449.5_3'UTR	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TTTTTATACATTTTTTTTTTT	0.368																																																	0								ENSG00000186416																																			NKRF	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.*957A>-	X.37:g.118722358delT		Somatic	0	25	0.00		0.5694851509381481	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	G3V1N1|Q4VC41|Q9UJ91	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371527.1	37	NULL	CCDS35375.1	X																																																																																			-	-		0.368	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	protein_coding	OTTHUMT00000058044.1	T	NM_017544			118722358	-1	no_errors	ENST00000487600	ensembl	human	known	74_37	rna	DEL	0.949	-
HTR2C	3358	genome.wustl.edu	37	X	113886028	113886028	+	Intron	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:113886028G>T	ENST00000276198.1	+	2	649				HTR2C_ENST00000371951.1_Intron|HTR2C_ENST00000371950.3_Intron|MIR1912_ENST00000410389.1_RNA	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCTCTAGGATGTGCTCATTGC	0.353																																																	0								ENSG00000222321						125.0	98.0	107.0					X																	113886028		692	1591	2283	MIR1912	SO:0001627	intron_variant	0			-	HGNC		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.-80+37689G>T	X.37:g.113886028G>T		Somatic	0	36	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B1AMW4|Q5VUF8|Q9NP28	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000276198.1	37	NULL	CCDS14564.1	X																																																																																			-	-		0.353	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1912	protein_coding	OTTHUMT00000057962.1	G	NM_000868	-		113886028	+1	no_errors	ENST00000410389	ensembl	human	known	74_37	rna	SNP	1.000	T
GLI2	2736	genome.wustl.edu	37	2	121746805	121746805	+	Silent	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:121746805C>T	ENST00000452319.1	+	14	3375	c.3315C>T	c.(3313-3315)caC>caT	p.H1105H	GLI2_ENST00000361492.4_Silent_p.H1105H|GLI2_ENST00000314490.11_Silent_p.H777H					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CGGGGCTGCACGGCCAGCGCA	0.677																																																	0								ENSG00000074047						48.0	55.0	52.0					2																	121746805		2203	4300	6503	GLI2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3315C>T	2.37:g.121746805C>T		Somatic	0	51	0.00		0.5694851509381481	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1105	ENST00000452319.1	37	c.3315	CCDS33283.1	2																																																																																			-	NULL		0.677	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	protein_coding	OTTHUMT00000332293.3	C	NM_005270	-		121746805	+1	no_errors	ENST00000361492	ensembl	human	known	74_37	silent	SNP	0.290	T
D2HGDH	728294	genome.wustl.edu	37	2	242688377	242688377	+	Intron	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:242688377C>T	ENST00000321264.4	+	7	1062				D2HGDH_ENST00000537090.1_Silent_p.L317L|D2HGDH_ENST00000342518.6_Intron|D2HGDH_ENST00000403782.1_Intron	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase						2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		AGGAGTCACTCGCCTCTTCGT	0.677																																																	0								ENSG00000180902																																			D2HGDH	SO:0001627	intron_variant	0			-	HGNC	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.854-1189C>T	2.37:g.242688377C>T		Somatic	0	22	0.00		0.5694851509381481	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	12	61.29	B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	p.L317	ENST00000321264.4	37	c.951	CCDS33426.1	2																																																																																			-	NULL		0.677	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	D2HGDH	protein_coding	OTTHUMT00000322794.2	C	NM_152783	-		242688377	+1	no_errors	ENST00000537090	ensembl	human	known	74_37	silent	SNP	0.017	T
UTP23	84294	genome.wustl.edu	37	8	117798782	117798782	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr8:117798782G>T	ENST00000357148.3	+	3	505	c.404G>T	c.(403-405)gGa>gTa	p.G135V	UTP23_ENST00000520733.1_Intron|UTP23_ENST00000517820.1_Intron			Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	0					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						aattatggaggacaacagtat	0.418																																																	0								ENSG00000147679																																			UTP23	SO:0001583	missense	0			-	HGNC		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000357148.3:c.404G>T	8.37:g.117798782G>T	ENSP00000349670:p.Gly135Val	Somatic	0	66	0.00		0.5694851509381481	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	B2RE25|Q96NJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fcf1/Utp23	p.G135V	ENST00000357148.3	37	c.404		8	.	.	.	.	.	.	.	.	.	.	G	5.523	0.281516	0.10458	.	.	ENSG00000147679	ENST00000357148	.	.	.	1.79	0.827	0.18835	.	.	.	.	.	T	0.38772	0.1053	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36744	-0.9735	5	0.72032	D	0.01	.	5.3289	0.15922	0.0:0.0:0.6262:0.3738	.	.	.	.	V	135	.	ENSP00000349670:G135V	G	+	2	0	UTP23	117867963	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.322000	0.08007	0.252000	0.21531	0.563000	0.77884	GGA	-	NULL		0.418	UTP23-201	KNOWN	basic	protein_coding	UTP23	protein_coding		G	NM_032334	-		117798782	+1	no_errors	ENST00000357148	ensembl	human	known	74_37	missense	SNP	0.000	T
CSF2RA	1438	genome.wustl.edu	37	X	1412870	1412870	+	Intron	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:1412870A>T	ENST00000381524.3	+	8	832				BX649553.1_ENST00000583047.1_RNA|BX649553.2_ENST00000578699.1_RNA|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000355432.3_Intron|MIR3690_ENST00000580266.1_RNA|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Intron|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000381529.3_Intron|CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000381509.3_Intron|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000355805.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ATCTACCTGGACCCAGTGTAG	0.577																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												0								ENSG00000265658																																			MIR3690	SO:0001627	intron_variant	0			-	HGNC	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.647-351A>T	X.37:g.1412870A>T		Somatic	0	93	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	84	17.65	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			-	-		0.577	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MIR3690	protein_coding	OTTHUMT00000035013.2	A		-		1412870	+1	no_errors	ENST00000580266	ensembl	human	known	74_37	rna	SNP	0.976	T
TXNRD2	10587	genome.wustl.edu	37	22	19907112	19907112	+	Silent	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr22:19907112C>A	ENST00000400521.1	-	3	189	c.183G>T	c.(181-183)ctG>ctT	p.L61L	TXNRD2_ENST00000400519.1_Silent_p.L60L|TXNRD2_ENST00000400518.1_Silent_p.L31L|TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000542719.1_Silent_p.L31L|TXNRD2_ENST00000535882.1_Silent_p.L60L|TXNRD2_ENST00000334363.9_Silent_p.L61L	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	61					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CCTTCCTTCCCAGCTGGGCGG	0.627																																																	0								ENSG00000184470						20.0	23.0	22.0					22																	19907112		2069	4201	6270	TXNRD2	SO:0001819	synonymous_variant	0			-	HGNC	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.183G>T	22.37:g.19907112C>A		Somatic	0	89	0.00		0.5694851509381481	26	10.34	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	82	13.68	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase	p.L60	ENST00000400521.1	37	c.180	CCDS42981.1	22																																																																																			-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_FAD_bind_dom,pfam_GIDA-rel,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase		0.627	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	TXNRD2	protein_coding	OTTHUMT00000314903.3	C	NM_006440	-		19907112	-1	no_errors	ENST00000535882	ensembl	human	known	74_37	silent	SNP	1.000	A
SIKE1	80143	genome.wustl.edu	37	1	115316834	115316834	+	3'UTR	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:115316834G>T	ENST00000060969.5	-	0	751				SIKE1_ENST00000369528.5_3'UTR|SIKE1_ENST00000506320.1_5'Flank			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1						innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						GTACTTGAATGGGAAGACAGT	0.388																																																	0								ENSG00000052723																																			SIKE1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.*58C>A	1.37:g.115316834G>T		Somatic	0	68	0.00		0.5694851509381481	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000060969.5	37	NULL	CCDS878.1	1																																																																																			-	-		0.388	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIKE1	protein_coding	OTTHUMT00000033401.1	G	NM_025073	-		115316834	-1	no_errors	ENST00000369524	ensembl	human	known	74_37	rna	SNP	0.000	T
RSPH10B2	728194	genome.wustl.edu	37	7	6790900	6790900	+	5'Flank	SNP	T	T	C	rs200453156		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:6790900T>C	ENST00000403107.1	+	0	0				PMS2CL_ENST00000486256.1_RNA|RSPH10B2_ENST00000404077.1_5'Flank			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)											breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GGACTGCTCTTAACACAAGCG	0.488																																																	0								ENSG00000187953																																			PMS2CL	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856		7.37:g.6790900T>C	Exception_encountered	Somatic	0	19	0.00		0.5694851509381481	8	20.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000403107.1	37	NULL	CCDS43552.1	7																																																																																			-	-		0.488	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2CL	protein_coding	OTTHUMT00000324184.4	T	NM_001099697	rs200453156		6790900	+1	no_errors	ENST00000486256	ensembl	human	known	74_37	rna	SNP	0.489	C
ABCB1	5243	genome.wustl.edu	37	7	87174310	87174310	+	Silent	SNP	T	T	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:87174310T>G	ENST00000265724.3	-	17	2310	c.1893A>C	c.(1891-1893)gcA>gcC	p.A631A	ABCB1_ENST00000543898.1_Silent_p.A567A	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	631					drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CTTCATTTCCTGCTGTCTAAA	0.333																																																	0								ENSG00000085563						58.0	55.0	56.0					7																	87174310		2203	4300	6503	ABCB1	SO:0001819	synonymous_variant	0			-	HGNC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1893A>C	7.37:g.87174310T>G		Somatic	0	42	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.A631	ENST00000265724.3	37	c.1893	CCDS5608.1	7																																																																																			-	NULL		0.333	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	protein_coding	OTTHUMT00000335444.2	T	NM_000927	-		87174310	-1	no_errors	ENST00000265724	ensembl	human	known	74_37	silent	SNP	0.089	G
CMPK2	129607	genome.wustl.edu	37	2	6989960	6989960	+	3'UTR	SNP	C	C	T	rs189991705	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:6989960C>T	ENST00000256722.5	-	0	1370				CMPK2_ENST00000458098.1_Intron|CMPK2_ENST00000478738.1_5'UTR	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial						cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCTAGTTAGACGTGGCACCTG	0.433													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		20571	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000134326						110.0	111.0	110.0					2																	6989960		1921	4133	6054	CMPK2	SO:0001624	3_prime_UTR_variant	0			GMAF=0.0005	HGNC		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.*21G>A	2.37:g.6989960C>T		Somatic	0	52	0.00		0.5694851509381481	12	29.41	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	50	10.71	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000256722.5	37	NULL	CCDS42648.1	2																																																																																			-	-		0.433	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	protein_coding	OTTHUMT00000323339.2	C	NM_207315	rs189991705		6989960	-1	no_errors	ENST00000478738	ensembl	human	known	74_37	rna	SNP	0.000	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143196624	143196624	+	lincRNA	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:143196624C>T	ENST00000412204.2	-	0	1970				RP11-782C8.1_ENST00000438000.1_lincRNA																							TACTGTTTTCCATATGTGTCT	0.308																																																	0								ENSG00000232274																																			RP11-782C8.2			0			-	Clone_based_vega_gene																													1.37:g.143196624C>T		Somatic	0	76	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	51	32.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.308	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	lincRNA	OTTHUMT00000037567.2	C		-		143196624	-1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	SNP	0.024	T
LPIN2	9663	genome.wustl.edu	37	18	2951057	2951057	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr18:2951057C>A	ENST00000261596.4	-	4	824	c.586G>T	c.(586-588)Gca>Tca	p.A196S	RP11-737O24.2_ENST00000581488.1_RNA|RP11-737O24.2_ENST00000584431.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	196					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TCCTACCGTGCTGCCTGGGCC	0.542																																																	0								ENSG00000101577						131.0	113.0	119.0					18																	2951057		2203	4300	6503	LPIN2	SO:0001583	missense	0			-	HGNC	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.586G>T	18.37:g.2951057C>A	ENSP00000261596:p.Ala196Ser	Somatic	0	34	0.00		0.5694851509381481	12	20.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	10.14	A7MD25|D3DUH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.A196S	ENST00000261596.4	37	c.586	CCDS11829.1	18	.	.	.	.	.	.	.	.	.	.	C	1.111	-0.658167	0.03454	.	.	ENSG00000101577	ENST00000261596;ENST00000455369	T	0.79454	-1.27	5.92	1.61	0.23674	.	0.462131	0.26424	N	0.024460	T	0.52725	0.1752	N	0.16166	0.38	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.36286	-0.9754	10	0.02654	T	1	.	8.5588	0.33498	0.0:0.4511:0.3907:0.1582	.	196	Q92539	LPIN2_HUMAN	S	196	ENSP00000261596:A196S	ENSP00000261596:A196S	A	-	1	0	LPIN2	2941057	0.000000	0.05858	0.959000	0.39883	0.027000	0.11550	0.052000	0.14163	0.821000	0.34540	-0.136000	0.14681	GCA	-	NULL		0.542	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	protein_coding	OTTHUMT00000254363.2	C	NM_014646	-		2951057	-1	no_errors	ENST00000261596	ensembl	human	known	74_37	missense	SNP	0.004	A
C1QBP	708	genome.wustl.edu	37	17	5334804	5334805	+	IGR	INS	-	-	A	rs377236515		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr17:5334804_5334805insA	ENST00000225698.4	-	0	1169				RPAIN_ENST00000536255.2_Intron|CTC-524C5.2_ENST00000575890.1_RNA|RPAIN_ENST00000327154.6_Intron|RPAIN_ENST00000381208.5_Intron|RPAIN_ENST00000381209.3_Intron	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein						apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	gattgtgccttaaaaaaaaaaa	0.48																																																	0								ENSG00000263272																																			CTC-524C5.2	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021			17.37:g.5334815_5334815dupA		Somatic	0	28	0.00		0.5694851509381481	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q2HXR8|Q9NNY8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000225698.4	37	NULL	CCDS11071.1	17																																																																																			-	-		0.480	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263272	protein_coding	OTTHUMT00000439388.1	-	NM_001212			5334805	-1	no_errors	ENST00000575890	ensembl	human	known	74_37	rna	INS	0.000:0.001	A
PCDH9	5101	genome.wustl.edu	37	13	66879148	66879148	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr13:66879148C>A	ENST00000377865.2	-	4	3487	c.3353G>T	c.(3352-3354)gGt>gTt	p.G1118V	PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000456367.1_Missense_Mutation_p.G1084V|PCDH9_ENST00000544246.1_Missense_Mutation_p.G1118V|PCDH9_ENST00000328454.5_Missense_Mutation_p.G1084V			Q9HC56	PCDH9_HUMAN	protocadherin 9	1118					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1118V(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TCCTCGGGGACCCAAAGGCCC	0.408																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000184226						39.0	38.0	38.0					13																	66879148		2203	4300	6503	PCDH9	SO:0001583	missense	0			-	HGNC	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3353G>T	13.37:g.66879148C>A	ENSP00000367096:p.Gly1118Val	Somatic	0	33	0.00		0.5694851509381481	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G1118V	ENST00000377865.2	37	c.3353	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688722	0.48097	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.55234	0.6;0.6;0.53;0.53	6.07	6.07	0.98685	.	0.000000	0.50627	D	0.000119	T	0.62660	0.2446	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.996	P;P;P	0.62298	0.797;0.9;0.853	T	0.62581	-0.6824	10	0.62326	D	0.03	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1076;1084;1118	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	V	1118;1118;1084;1084	ENSP00000442186:G1118V;ENSP00000367096:G1118V;ENSP00000401699:G1084V;ENSP00000332060:G1084V	ENSP00000332060:G1084V	G	-	2	0	PCDH9	65777149	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.463000	0.80869	2.890000	0.99128	0.650000	0.86243	GGT	-	NULL		0.408	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	protein_coding	OTTHUMT00000276387.1	C	NM_203487	-		66879148	-1	no_errors	ENST00000377865	ensembl	human	known	74_37	missense	SNP	1.000	A
NOS1	4842	genome.wustl.edu	37	12	117768198	117768198	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:117768198C>T	ENST00000338101.4	-	1	681	c.677G>A	c.(676-678)gGg>gAg	p.G226E	NOS1_ENST00000317775.6_Missense_Mutation_p.G226E|NOS1_ENST00000344089.3_Missense_Mutation_p.G226E|NOS1_ENST00000549189.1_5'Flank			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GGCAGGTGCCCCTCCCTTGAC	0.557																																					Esophageal Squamous(162;1748 2599 51982 52956)												0								ENSG00000089250						110.0	120.0	117.0					12																	117768198		2073	4211	6284	NOS1	SO:0001583	missense	0			-	HGNC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.677G>A	12.37:g.117768198C>T	ENSP00000337459:p.Gly226Glu	Somatic	0	32	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.G226E	ENST00000338101.4	37	c.677	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	8.711	0.912005	0.17907	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000344089;ENST00000338101	T;T;T	0.04454	5.17;3.62;5.2	4.65	2.75	0.32379	.	0.299368	0.38005	N	0.001844	T	0.02649	0.0080	L	0.31207	0.915	0.36515	D	0.869812	B	0.09022	0.002	B	0.11329	0.006	T	0.38908	-0.9639	10	0.02654	T	1	-11.2822	3.094	0.06303	0.4263:0.3909:0.0:0.1828	.	226	P29475	NOS1_HUMAN	E	226	ENSP00000320758:G226E;ENSP00000339862:G226E;ENSP00000337459:G226E	ENSP00000320758:G226E	G	-	2	0	NOS1	116252581	0.988000	0.35896	0.005000	0.12908	0.856000	0.48823	2.319000	0.43788	0.526000	0.28541	0.484000	0.47621	GGG	-	pirsf_NOS_euk		0.557	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	protein_coding	OTTHUMT00000268053.1	C		-		117768198	-1	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	SNP	0.926	T
SIGLEC16	400709	genome.wustl.edu	37	19	50472930	50472930	+	RNA	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:50472930C>T	ENST00000602139.1	+	0	1							A6NMB1	SIG16_HUMAN	sialic acid binding Ig-like lectin 16 (gene/pseudogene)						cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|lung(6)	10						CAGATGGTCCCGGGACAGGCC	0.701																																																	0								ENSG00000161643																																			SIGLEC16			0			-	HGNC	BC030222		19q13.33	2014-03-20	2008-08-04	2008-08-04	ENSG00000161643	ENSG00000161643		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24851	protein-coding gene	gene with protein product			"""sialic acid binding Ig-like lectin, pseudogene 16"""	SIGLECP16		11986327, 18629938	Standard	NR_002825		Approved	Siglec-P16	uc002prf.3	A6NMB1	OTTHUMG00000183074		19.37:g.50472930C>T		Somatic	0	27	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602139.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.230295	0.00280	.	.	ENSG00000161643	ENST00000417280	.	.	.	1.64	-2.51	0.06365	.	.	.	.	.	T	0.12092	0.0294	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31138	-0.9954	5	0.02654	T	1	.	6.7156	0.23302	0.0:0.4176:0.0:0.5824	.	.	.	.	L	3	.	ENSP00000396157:P3L	P	+	2	0	SIGLEC16	55164742	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.398000	0.00484	-1.103000	0.03019	-1.917000	0.00517	CCG	-	-		0.701	SIGLEC16-001	KNOWN	basic	processed_transcript	SIGLEC16	pseudogene	OTTHUMT00000464979.1	C	NR_002825	-		50472930	+1	no_errors	ENST00000602139	ensembl	human	known	74_37	rna	SNP	0.000	T
CDCA3	83461	genome.wustl.edu	37	12	6959716	6959716	+	Silent	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:6959716C>A	ENST00000538862.2	-	3	1066	c.165G>T	c.(163-165)ctG>ctT	p.L55L	CDCA3_ENST00000540683.1_Silent_p.L55L|CDCA3_ENST00000422785.3_Silent_p.L55L|CDCA3_ENST00000535406.1_Silent_p.L55L|CDCA3_ENST00000604599.1_5'Flank|USP5_ENST00000389231.5_5'Flank|CDCA3_ENST00000229265.6_Silent_p.L55L|USP5_ENST00000229268.8_5'Flank			Q99618	CDCA3_HUMAN	cell division cycle associated 3	55					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|large_intestine(4)|lung(1)|stomach(1)	8						TAAGACCCTCCAGTTGCTCCC	0.572																																																	0								ENSG00000111665						137.0	128.0	131.0					12																	6959716		2203	4300	6503	CDCA3	SO:0001819	synonymous_variant	0			-	HGNC	BG354576	CCDS8565.1, CCDS73428.1	12p13.31	2010-07-20				ENSG00000111665			14624	protein-coding gene	gene with protein product	"""trigger of mitotic entry 1"""	607749				9074930, 12188893	Standard	XR_242988		Approved	TOME-1, GRCC8	uc001qrg.2	Q99618		ENST00000538862.2:c.165G>T	12.37:g.6959716C>A		Somatic	0	60	0.00		0.5694851509381481	45	22.41	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92	A8K5V6|D3DUS6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L55	ENST00000538862.2	37	c.165	CCDS8565.1	12																																																																																			-	NULL		0.572	CDCA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA3	protein_coding	OTTHUMT00000401940.2	C	NM_031299	-		6959716	-1	no_errors	ENST00000538862	ensembl	human	known	74_37	silent	SNP	0.002	A
APOB	338	genome.wustl.edu	37	2	21234165	21234165	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:21234165C>A	ENST00000233242.1	-	26	5702	c.5575G>T	c.(5575-5577)Gtt>Ttt	p.V1859F		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1859					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACACCCTGAACCTTAGCAACA	0.433																																																	0								ENSG00000084674						153.0	144.0	147.0					2																	21234165		2203	4300	6503	APOB	SO:0001583	missense	0			-	HGNC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5575G>T	2.37:g.21234165C>A	ENSP00000233242:p.Val1859Phe	Somatic	0	57	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	79	11.24	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.V1859F	ENST00000233242.1	37	c.5575	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	10.27	1.302592	0.23736	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00958	5.5	5.26	2.51	0.30379	.	0.296355	0.23539	N	0.047083	T	0.01730	0.0055	L	0.60455	1.87	0.22581	N	0.998961	P	0.45902	0.868	P	0.45577	0.486	T	0.42120	-0.9470	10	0.87932	D	0	.	8.9984	0.36066	0.0:0.5707:0.0:0.4293	.	1859	P04114	APOB_HUMAN	F	1859	ENSP00000233242:V1859F	ENSP00000233242:V1859F	V	-	1	0	APOB	21087670	0.000000	0.05858	0.008000	0.14137	0.702000	0.40608	-0.364000	0.07583	0.232000	0.21100	-0.806000	0.03193	GTT	-	NULL		0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	C		-		21234165	-1	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	SNP	0.001	A
SCN7A	6332	genome.wustl.edu	37	2	167313506	167313506	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:167313506C>A	ENST00000409855.1	-	10	1290	c.1164G>T	c.(1162-1164)ttG>ttT	p.L388F		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	388					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TGCCTAAGAACAAACTTGCCA	0.348																																																	0								ENSG00000136546						76.0	65.0	69.0					2																	167313506		1813	4081	5894	SCN7A	SO:0001583	missense	0			-	HGNC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1164G>T	2.37:g.167313506C>A	ENSP00000386796:p.Leu388Phe	Somatic	0	69	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	28	40.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L388F	ENST00000409855.1	37	c.1164	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464848	0.63513	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.99282	-5.68;-5.68;-5.68	5.35	3.46	0.39613	Ion transport (1);	0.339635	0.20677	N	0.087732	D	0.99321	0.9762	M	0.87971	2.92	0.33640	D	0.607124	D	0.89917	1.0	D	0.87578	0.998	D	0.99880	1.1112	10	0.87932	D	0	.	9.1405	0.36901	0.0:0.8095:0.0:0.1905	.	388	Q01118	SCN7A_HUMAN	F	388	ENSP00000386796:L388F;ENSP00000413699:L388F;ENSP00000403846:L388F	ENSP00000259060:L388F	L	-	3	2	SCN7A	167021752	0.998000	0.40836	1.000000	0.80357	0.885000	0.51271	0.567000	0.23608	0.548000	0.28955	-0.378000	0.06908	TTG	-	pfam_Ion_trans_dom		0.348	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	protein_coding	OTTHUMT00000333745.1	C		-		167313506	-1	no_errors	ENST00000409855	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA0825	285600	genome.wustl.edu	37	5	93752974	93752974	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:93752974G>A	ENST00000513200.3	-	14	2666	c.2594C>T	c.(2593-2595)aCa>aTa	p.T865I	KIAA0825_ENST00000427991.2_Missense_Mutation_p.T865I|KIAA0825_ENST00000312498.7_Missense_Mutation_p.T870I	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	865										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						GTTTGCAAATGTTTGTGGAGA	0.363																																																	0								ENSG00000185261						190.0	157.0	167.0					5																	93752974		692	1591	2283	KIAA0825	SO:0001583	missense	0			-	HGNC	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2594C>T	5.37:g.93752974G>A	ENSP00000424618:p.Thr865Ile	Somatic	0	79	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	O94914|Q6ZNN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T865I	ENST00000513200.3	37	c.2594		5	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114590	0.37339	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498	T;T;T	0.44083	0.94;0.94;0.93	5.72	3.95	0.45737	.	0.166906	0.38897	N	0.001532	T	0.28797	0.0714	N	0.21448	0.665	0.24828	N	0.992549	B	0.12630	0.006	B	0.17433	0.018	T	0.21895	-1.0232	10	0.56958	D	0.05	.	9.643	0.39850	0.1627:0.0:0.8373:0.0	.	865	Q8IV33	K0825_HUMAN	I	865;865;870	ENSP00000424618:T865I;ENSP00000400288:T865I;ENSP00000312205:T870I	ENSP00000312205:T870I	T	-	2	0	KIAA0825	93778730	0.998000	0.40836	1.000000	0.80357	0.974000	0.67602	0.512000	0.22755	0.778000	0.33520	0.557000	0.71058	ACA	-	NULL		0.363	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	protein_coding	OTTHUMT00000254102.5	G	NM_173665	-		93752974	-1	no_errors	ENST00000427991	ensembl	human	known	74_37	missense	SNP	1.000	A
PTCHD2	57540	genome.wustl.edu	37	1	11577619	11577619	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:11577619A>T	ENST00000294484.6	+	7	1987	c.1849A>T	c.(1849-1851)Agc>Tgc	p.S617C	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S617C	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	617					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGGCCTCTGGAGCCTCTACCT	0.617																																																	0								ENSG00000204624						63.0	67.0	66.0					1																	11577619		2019	4192	6211	PTCHD2	SO:0001583	missense	0			-	HGNC	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1849A>T	1.37:g.11577619A>T	ENSP00000294484:p.Ser617Cys	Somatic	0	54	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	66	22.35	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.S617C	ENST00000294484.6	37	c.1849	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.775642	0.70107	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.85861	-2.04;-2.04	5.67	4.54	0.55810	.	0.315431	0.39985	N	0.001201	D	0.87966	0.6311	L	0.53249	1.67	0.39375	D	0.966157	D	0.63046	0.992	P	0.59761	0.863	D	0.88204	0.2886	10	0.62326	D	0.03	-33.5778	10.7531	0.46221	0.9258:0.0:0.0742:0.0	.	617	Q9P2K9	PTHD2_HUMAN	C	617	ENSP00000294484:S617C;ENSP00000374226:S617C	ENSP00000294484:S617C	S	+	1	0	PTCHD2	11500206	0.997000	0.39634	1.000000	0.80357	0.933000	0.57130	2.933000	0.48948	0.974000	0.38366	0.459000	0.35465	AGC	-	pfam_Patched		0.617	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	A	XM_052561	-		11577619	+1	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	SNP	0.998	T
WEE1	7465	genome.wustl.edu	37	11	9606871	9606871	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:9606871G>T	ENST00000450114.2	+	7	1608	c.1355G>T	c.(1354-1356)tGg>tTg	p.W452L	WEE1_ENST00000299613.6_Missense_Mutation_p.W238L	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	452	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		GAAGATGATTGGGCATCCAAC	0.348																																																	0								ENSG00000166483						121.0	129.0	127.0					11																	9606871		2201	4294	6495	WEE1	SO:0001583	missense	0			-	HGNC	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.1355G>T	11.37:g.9606871G>T	ENSP00000402084:p.Trp452Leu	Somatic	0	66	0.00		0.5694851509381481	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B3KVE1|D3DQV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	p.W452L	ENST00000450114.2	37	c.1355	CCDS7800.1	11	.	.	.	.	.	.	.	.	.	.	G	7.921	0.738571	0.15642	.	.	ENSG00000166483	ENST00000450114;ENST00000299613;ENST00000524612;ENST00000530712	T;T;T;T	0.51325	0.84;0.71;1.33;1.92	4.93	4.0	0.46444	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.234232	0.36519	N	0.002548	T	0.24624	0.0597	N	0.04297	-0.235	0.80722	D	1	B	0.09022	0.002	B	0.20577	0.03	T	0.05716	-1.0868	10	0.11485	T	0.65	-4.9212	13.1646	0.59562	0.0:0.0:0.8398:0.1602	.	452	P30291	WEE1_HUMAN	L	452;238;80;58	ENSP00000402084:W452L;ENSP00000299613:W238L;ENSP00000434446:W80L;ENSP00000434148:W58L	ENSP00000299613:W238L	W	+	2	0	WEE1	9563447	1.000000	0.71417	0.935000	0.37517	0.830000	0.47004	2.254000	0.43214	1.191000	0.43056	-0.293000	0.09583	TGG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom		0.348	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE1	protein_coding	OTTHUMT00000386757.1	G	NM_003390	-		9606871	+1	no_errors	ENST00000450114	ensembl	human	known	74_37	missense	SNP	0.987	T
RBM4	5936	genome.wustl.edu	37	11	66413655	66413655	+	3'UTR	SNP	T	T	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:66413655T>A	ENST00000409406.1	+	0	2038				RBM4_ENST00000398692.4_3'UTR|RBM4_ENST00000310092.7_3'UTR|RBM4_ENST00000514361.3_3'UTR|RBM4_ENST00000530235.1_3'UTR|RBM4_ENST00000506523.2_Intron|RBM4_ENST00000515838.2_3'UTR|RBM14-RBM4_ENST00000412278.2_3'UTR|RBM4_ENST00000396053.4_Intron|RBM4_ENST00000408993.2_3'UTR|RBM4_ENST00000578778.1_Intron|RBM14-RBM4_ENST00000500635.2_3'UTR			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		ttctcttcctttcctttcctt	0.502																																																	0								ENSG00000173933																																			RBM4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.*166T>A	11.37:g.66413655T>A		Somatic	0	83	0.00		0.5694851509381481	259	10.07	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	67	9.46	B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409406.1	37	NULL	CCDS41676.1	11																																																																																			-	-		0.502	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4	protein_coding	OTTHUMT00000334212.1	T	NM_002896	-		66413655	+1	no_errors	ENST00000515838	ensembl	human	putative	74_37	rna	SNP	0.179	A
RP5-1198O20.4	0	genome.wustl.edu	37	1	44570492	44570499	+	lincRNA	DEL	ACTACAGC	ACTACAGC	-	rs145358853|rs61243853|rs1291051	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	ACTACAGC	ACTACAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:44570492_44570499delACTACAGC	ENST00000434244.1	+	0	2489_2496																											gaatgactgaactacagcactatgaatc	0.303														561	0.112021	0.0106	0.2176	5008	,	,		21015	0.1617		0.1819	False		,,,				2504	0.0511																0								ENSG00000230615																																			RP5-1198O20.4			0				Clone_based_vega_gene																													1.37:g.44570492_44570499delACTACAGC		Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000434244.1	37	NULL		1																																																																																			-	-		0.303	RP5-1198O20.4-001	KNOWN	basic	lincRNA	ENSG00000230615	lincRNA	OTTHUMT00000022875.2	ACTACAGC				44570499	+1	no_errors	ENST00000434244	ensembl	human	known	74_37	rna	DEL	0.190:0.184:0.188:0.207:0.219:0.225:0.226:0.240	-
BLNK	29760	genome.wustl.edu	37	10	97956691	97956691	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr10:97956691G>A	ENST00000224337.5	-	16	1365	c.1224C>T	c.(1222-1224)gcC>gcT	p.A408A	BLNK_ENST00000413476.2_Intron|BLNK_ENST00000371176.2_Silent_p.A385A|BLNK_ENST00000427367.2_Intron	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	408	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		TTCTGCCCAAGGCATATTGTT	0.313																																																	0								ENSG00000095585						101.0	106.0	104.0					10																	97956691		2203	4299	6502	BLNK	SO:0001819	synonymous_variant	0			-	HGNC	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.1224C>T	10.37:g.97956691G>A		Somatic	0	42	0.00		0.5694851509381481	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	31	31.11	O75498|O75499|Q2MD49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.A408	ENST00000224337.5	37	c.1224	CCDS7446.1	10	.	.	.	.	.	.	.	.	.	.	G	7.598	0.672230	0.14776	.	.	ENSG00000095585	ENST00000393889	.	.	.	5.21	1.49	0.22878	.	.	.	.	.	T	0.56217	0.1970	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54207	-0.8328	5	0.87932	D	0	-13.194	2.652	0.05002	0.4942:0.2877:0.0794:0.1386	.	.	.	.	L	134	.	ENSP00000377467:P134L	P	-	2	0	BLNK	97946681	0.998000	0.40836	1.000000	0.80357	0.916000	0.54674	0.426000	0.21363	0.051000	0.15978	-1.261000	0.01458	CCT	-	pfam_SH2,smart_SH2,pfscan_SH2		0.313	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	protein_coding	OTTHUMT00000049593.1	G	NM_013314	-		97956691	-1	no_errors	ENST00000224337	ensembl	human	known	74_37	silent	SNP	1.000	A
GUK1	2987	genome.wustl.edu	37	1	228333784	228333784	+	Intron	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:228333784C>T	ENST00000366718.1	+	3	581				GUK1_ENST00000366730.1_Intron|GUK1_ENST00000366726.1_Intron|GUK1_ENST00000470040.1_3'UTR|GUK1_ENST00000366721.1_Intron|GUK1_ENST00000391865.3_Intron|GUK1_ENST00000366728.2_Intron|GUK1_ENST00000366722.1_Intron|GUK1_ENST00000312726.4_Intron|GUK1_ENST00000366723.1_Intron|GUK1_ENST00000366716.1_Intron	NM_001159391.1	NP_001152863.1	Q16774	KGUA_HUMAN	guanylate kinase 1						ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				TGGGGTGGGGCCCTATGGCTG	0.662																																																	0								ENSG00000143774						49.0	52.0	51.0					1																	228333784		2203	4300	6503	GUK1	SO:0001627	intron_variant	0			-	HGNC	BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000366718.1:c.154+16C>T	1.37:g.228333784C>T		Somatic	0	63	0.00		0.5694851509381481	23	14.81	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	62	22.22	B1ANH1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366718.1	37	NULL	CCDS1568.1	1																																																																																			-	-		0.662	GUK1-021	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	GUK1	protein_coding	OTTHUMT00000095944.1	C	NM_000858	-		228333784	+1	no_errors	ENST00000470040	ensembl	human	known	74_37	rna	SNP	0.001	T
PDLIM2	64236	genome.wustl.edu	37	8	22447119	22447119	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr8:22447119G>A	ENST00000397760.4	+	8	1028	c.628G>A	c.(628-630)Gaa>Aaa	p.E210K	PDLIM2_ENST00000397761.2_Missense_Mutation_p.E210K|PDLIM2_ENST00000409141.1_Missense_Mutation_p.E210K|PDLIM2_ENST00000265810.4_Missense_Mutation_p.E210K|PDLIM2_ENST00000448520.1_3'UTR|AC037459.4_ENST00000430850.2_Missense_Mutation_p.E4K|PDLIM2_ENST00000339162.7_Missense_Mutation_p.E210K|PDLIM2_ENST00000308354.7_Missense_Mutation_p.E460K|PDLIM2_ENST00000409417.1_Missense_Mutation_p.E210K			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	210						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CATGGACTCGGAAGGGGGAAG	0.657																																																	0								ENSG00000120913						19.0	18.0	19.0					8																	22447119		2200	4298	6498	PDLIM2	SO:0001583	missense	0			-	HGNC	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.628G>A	8.37:g.22447119G>A	ENSP00000380867:p.Glu210Lys	Somatic	0	107	0.00		0.5694851509381481	99	42.11	72	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	59	35.87	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.E460K	ENST00000397760.4	37	c.1378		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.1|24.1	4.494948|4.494948	0.85069|0.85069	.|.	.|.	ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000248235;ENSG00000248235|ENSG00000120913;ENSG00000248235	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000397761;ENST00000409141;ENST00000265810;ENST00000409417;ENST00000450780;ENST00000430850|ENST00000381194;ENST00000447849	T;T;T;T;T;T;T;T;T;T|.	0.32023|.	1.91;3.56;2.63;2.64;2.63;2.64;2.63;2.73;2.64;1.47|.	3.59|3.59	3.59|3.59	0.41128|0.41128	.|.	0.405035|.	0.21119|.	N|.	0.079857|.	T|T	0.50034|0.50034	0.1592|0.1592	L|L	0.51422|0.51422	1.61|1.61	0.25715|0.25715	N|N	0.985431|0.985431	D;B;P;D|.	0.89917|.	1.0;0.275;0.557;0.993|.	D;B;B;D|.	0.79108|.	0.992;0.037;0.217;0.968|.	T|T	0.40739|0.40739	-0.9547|-0.9547	10|5	0.14656|.	T|.	0.56|.	0.1693|0.1693	12.5755|12.5755	0.56362|0.56362	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4;210;210;210|.	B3KPU0;Q96JY6-3;Q96JY6-4;Q96JY6|.	.;.;.;PDLI2_HUMAN|.	K|E	210;460;210;210;210;210;210;210;210;38;4|183;21	ENSP00000401992:E210K;ENSP00000312634:E460K;ENSP00000394376:E210K;ENSP00000380867:E210K;ENSP00000342035:E210K;ENSP00000380868:E210K;ENSP00000386868:E210K;ENSP00000265810:E210K;ENSP00000387084:E210K;ENSP00000428700:E4K|.	ENSP00000428700:E4K|.	E|G	+|+	1|2	0|0	AC037459.4;PDLIM2|AC037459.4;PDLIM2	22503064|22503064	0.841000|0.841000	0.29509|0.29509	0.055000|0.055000	0.19348|0.19348	0.014000|0.014000	0.08584|0.08584	4.575000|4.575000	0.60908|0.60908	1.729000|1.729000	0.51567|0.51567	0.558000|0.558000	0.71614|0.71614	GAA|GGA	-	NULL		0.657	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	protein_coding	OTTHUMT00000334167.1	G		-		22447119	+1	no_errors	ENST00000308354	ensembl	human	known	74_37	missense	SNP	0.704	A
DNAH11	8701	genome.wustl.edu	37	7	21788227	21788227	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:21788227C>A	ENST00000409508.3	+	52	8571	c.8540C>A	c.(8539-8541)cCt>cAt	p.P2847H	DNAH11_ENST00000328843.6_Missense_Mutation_p.P2854H	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2854	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTACGAACCCCTCAGGGCTGT	0.532									Kartagener syndrome																																								0								ENSG00000105877						57.0	58.0	58.0					7																	21788227		1953	4145	6098	DNAH11	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8540C>A	7.37:g.21788227C>A	ENSP00000475939:p.Pro2847His	Somatic	0	51	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	Q9UJ82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2854H	ENST00000409508.3	37	c.8561		7	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154194	0.57259	.	.	ENSG00000105877	ENST00000328843	T	0.59224	0.28	6.06	6.06	0.98353	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.047910	0.85682	D	0.000000	T	0.76659	0.4018	.	.	.	0.58432	D	0.999998	D	0.89917	1.0	D	0.77004	0.989	T	0.78298	-0.2258	9	0.87932	D	0	.	15.7227	0.77724	0.0:0.9333:0.0:0.0667	.	2854	Q96DT5	DYH11_HUMAN	H	2854	ENSP00000330671:P2854H	ENSP00000330671:P2854H	P	+	2	0	DNAH11	21754752	0.373000	0.25073	0.555000	0.28281	0.056000	0.15407	3.184000	0.50926	2.879000	0.98667	0.650000	0.86243	CCT	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.532	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	C	NM_003777	-		21788227	+1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	SNP	0.972	A
OTOGL	283310	genome.wustl.edu	37	12	80770909	80770909	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:80770909G>A	ENST00000547103.1	+	57	6731	c.6725G>A	c.(6724-6726)cGa>cAa	p.R2242Q	OTOGL_ENST00000546620.1_Missense_Mutation_p.R273Q|OTOGL_ENST00000458043.2_Missense_Mutation_p.R2254Q			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2242	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCAGGCAAACGAGAAGAAAGA	0.303																																																	0								ENSG00000165899						66.0	68.0	67.0					12																	80770909		2203	4300	6503	OTOGL	SO:0001583	missense	0			-	HGNC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6725G>A	12.37:g.80770909G>A	ENSP00000447211:p.Arg2242Gln	Somatic	0	154	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	103	30.41	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.R2254Q	ENST00000547103.1	37	c.6761		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.4|22.4	4.279024|4.279024	0.80692|0.80692	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000298820|ENST00000547103;ENST00000458043;ENST00000546620	.|T;T;T	.|0.16196	.|2.48;2.48;2.36	5.32|5.32	3.46|3.46	0.39613|0.39613	.|Cystine knot, C-terminal (1);	.|0.564956	.|0.16688	.|N	.|0.203643	T|T	0.15219|0.15219	0.0367|0.0367	L|L	0.54323|0.54323	1.7|1.7	0.23661|0.23661	N|N	0.997179|0.997179	.|D	.|0.53312	.|0.959	.|B	.|0.39617	.|0.305	T|T	0.13495|0.13495	-1.0507|-1.0507	5|10	.|0.41790	.|T	.|0.15	.|.	8.9246|8.9246	0.35632|0.35632	0.29:0.0:0.71:0.0|0.29:0.0:0.71:0.0	.|.	.|619	.|Q3ZCN5	.|OTOGL_HUMAN	K|Q	662|2242;2254;273	.|ENSP00000447211:R2242Q;ENSP00000400895:R2254Q;ENSP00000449094:R273Q	.|ENSP00000400895:R2254Q	E|R	+|+	1|2	0|0	OTOGL|OTOGL	79295040|79295040	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	2.434000|2.434000	0.44802|0.44802	1.364000|1.364000	0.46038|0.46038	0.467000|0.467000	0.42956|0.42956	GAG|CGA	-	pfscan_Cys_knot_C		0.303	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	protein_coding	OTTHUMT00000407438.1	G	NM_173591	-		80770909	+1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	SNP	1.000	A
EPHA6	285220	genome.wustl.edu	37	3	97365050	97365050	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr3:97365050G>C	ENST00000514100.1	+	12	1290	c.1048G>C	c.(1048-1050)Ggt>Cgt	p.G350R	EPHA6_ENST00000389672.5_Intron|EPHA6_ENST00000502694.1_Intron	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GTCCAGCTCTGGTTATGGTAC	0.488																																																	0								ENSG00000080224																																			EPHA6	SO:0001583	missense	0			-	HGNC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.1048G>C	3.37:g.97365050G>C	ENSP00000421711:p.Gly350Arg	Somatic	0	79	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	D6RAL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G350R	ENST00000514100.1	37	c.1048		3	.	.	.	.	.	.	.	.	.	.	G	4.656	0.122028	0.08931	.	.	ENSG00000080224	ENST00000514100	D	0.81739	-1.53	3.04	2.16	0.27623	.	.	.	.	.	T	0.67822	0.2934	.	.	.	0.09310	N	1	B	0.32693	0.38	B	0.26517	0.07	T	0.60722	-0.7207	8	0.87932	D	0	.	6.0	0.19515	0.1435:0.0:0.8565:0.0	.	350	D6RAL5	.	R	350	ENSP00000421711:G350R	ENSP00000421711:G350R	G	+	1	0	EPHA6	98847740	0.031000	0.19500	0.013000	0.15412	0.005000	0.04900	0.437000	0.21543	0.847000	0.35167	0.655000	0.94253	GGT	-	smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.488	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	protein_coding	OTTHUMT00000359997.1	G	NM_001080448	-		97365050	+1	no_errors	ENST00000514100	ensembl	human	novel	74_37	missense	SNP	0.015	C
FOXH1	8928	genome.wustl.edu	37	8	145700634	145700634	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr8:145700634T>G	ENST00000377317.4	-	2	763	c.185A>C	c.(184-186)cAg>cCg	p.Q62P	FOXH1_ENST00000525197.1_Intron	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	62					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCCTGGACCTGACGGATGAT	0.667																																																	0								ENSG00000160973						30.0	31.0	31.0					8																	145700634		2202	4298	6500	FOXH1	SO:0001583	missense	0			-	HGNC	AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.185A>C	8.37:g.145700634T>G	ENSP00000366534:p.Gln62Pro	Somatic	0	128	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	137	19.77	D3DWM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q62P	ENST00000377317.4	37	c.185	CCDS6428.1	8	.	.	.	.	.	.	.	.	.	.	T	19.63	3.864347	0.71949	.	.	ENSG00000160973	ENST00000377317;ENST00000292541	D	0.95412	-3.7	5.31	4.16	0.48862	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.128822	0.50627	D	0.000104	D	0.94029	0.8087	N	0.22421	0.69	0.41726	D	0.989539	D	0.71674	0.998	D	0.66351	0.943	D	0.92360	0.5896	10	0.35671	T	0.21	-46.6183	8.6225	0.33870	0.0:0.0906:0.0:0.9094	.	62	O75593	FOXH1_HUMAN	P	62;89	ENSP00000366534:Q62P	ENSP00000292541:Q89P	Q	-	2	0	FOXH1	145671442	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	6.735000	0.74806	2.010000	0.58986	0.460000	0.39030	CAG	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head		0.667	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXH1	protein_coding	OTTHUMT00000382451.1	T		-		145700634	-1	no_errors	ENST00000377317	ensembl	human	known	74_37	missense	SNP	0.999	G
RBMXL2	27288	genome.wustl.edu	37	11	7110702	7110702	+	Silent	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:7110702C>A	ENST00000306904.5	+	1	538	c.351C>A	c.(349-351)ggC>ggA	p.G117G		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	117	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		gtggcggcggcccgcggcgTT	0.771																																																	0								ENSG00000170748						1.0	1.0	1.0					11																	7110702		513	1196	1709	RBMXL2	SO:0001819	synonymous_variant	0			-	HGNC	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.351C>A	11.37:g.7110702C>A		Somatic	0	16	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	Q6PEZ2|Q9NQU0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.G117	ENST00000306904.5	37	c.351	CCDS7777.1	11																																																																																			-	NULL		0.771	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	protein_coding	OTTHUMT00000384552.1	C	NM_014469	-		7110702	+1	no_errors	ENST00000306904	ensembl	human	known	74_37	silent	SNP	0.716	A
SLC47A2	146802	genome.wustl.edu	37	17	19611114	19611114	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr17:19611114G>A	ENST00000325411.5	-	8	830	c.780C>T	c.(778-780)acC>acT	p.T260T	SLC47A2_ENST00000350657.5_Silent_p.T224T|SLC47A2_ENST00000463318.1_5'UTR	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	260					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)			endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	GGAGGAAGACGGTCTGTGCAA	0.622																																																	0								ENSG00000180638						122.0	100.0	108.0					17																	19611114		2203	4298	6501	SLC47A2	SO:0001819	synonymous_variant	0			-	HGNC	AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.780C>T	17.37:g.19611114G>A		Somatic	0	47	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	114	12.98	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MATE,tigrfam_MATE	p.T260	ENST00000325411.5	37	c.780	CCDS11211.1	17																																																																																			-	tigrfam_MATE		0.622	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	SLC47A2	protein_coding	OTTHUMT00000132242.2	G	NM_152908	-		19611114	-1	no_errors	ENST00000325411	ensembl	human	known	74_37	silent	SNP	0.000	A
LIMCH1	22998	genome.wustl.edu	37	4	41607964	41607964	+	Silent	SNP	C	C	T	rs376258134		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:41607964C>T	ENST00000313860.7	+	6	483	c.429C>T	c.(427-429)taC>taT	p.Y143Y	LIMCH1_ENST00000513024.1_5'UTR|LIMCH1_ENST00000511496.1_5'UTR|LIMCH1_ENST00000512946.1_Silent_p.Y143Y|LIMCH1_ENST00000508501.1_Silent_p.Y143Y|LIMCH1_ENST00000512820.1_Silent_p.Y143Y|LIMCH1_ENST00000512632.1_Silent_p.Y143Y|LIMCH1_ENST00000509638.1_5'UTR|LIMCH1_ENST00000503057.1_5'UTR	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	143					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						GCACATCCTACAGCGGAACGA	0.443																																																	0								ENSG00000064042	C	,,	1,4405	2.1+/-5.4	0,1,2202	140.0	124.0	129.0		429,429,429	-2.8	0.0	4		129	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	LIMCH1	NM_001112717.1,NM_001112718.1,NM_014988.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	143/1058,143/1057,143/1084	41607964	1,13005	2203	4300	6503	LIMCH1	SO:0001819	synonymous_variant	0			-	HGNC	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.429C>T	4.37:g.41607964C>T		Somatic	0	55	0.00		0.5694851509381481	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	59	14.49	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_SM22_calponin,prints_Calponin	p.Y143	ENST00000313860.7	37	c.429	CCDS33977.1	4																																																																																			-	superfamily_CH-domain		0.443	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LIMCH1	protein_coding	OTTHUMT00000361249.2	C	NM_014988	-		41607964	+1	no_errors	ENST00000313860	ensembl	human	known	74_37	silent	SNP	0.901	T
INSR	3643	genome.wustl.edu	37	19	7267849	7267849	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:7267849G>A	ENST00000302850.5	-	2	301	c.159C>T	c.(157-159)tgC>tgT	p.C53C	INSR_ENST00000341500.5_Silent_p.C53C	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	53	Leu-rich.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CGATGACAGAGCAATTCTCCA	0.468																																																	0								ENSG00000171105						65.0	61.0	62.0					19																	7267849		2203	4300	6503	INSR	SO:0001819	synonymous_variant	0			-	HGNC	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.159C>T	19.37:g.7267849G>A		Somatic	0	39	0.00		0.5694851509381481	16	5.88	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	31	34.04	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.C53	ENST00000302850.5	37	c.159	CCDS12176.1	19																																																																																			-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L		0.468	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	protein_coding	OTTHUMT00000458544.1	G		-		7267849	-1	no_errors	ENST00000302850	ensembl	human	known	74_37	silent	SNP	1.000	A
MOV10	4343	genome.wustl.edu	37	1	113217542	113217542	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:113217542delG	ENST00000413052.2	+	2	398	c.8delG	c.(7-9)agtfs	p.S3fs	MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000357443.2_Frame_Shift_Del_p.S3fs|MOV10_ENST00000369644.1_5'UTR|MOV10_ENST00000544796.1_Frame_Shift_Del_p.S3fs|MOV10_ENST00000369645.1_Frame_Shift_Del_p.S3fs	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	3					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GCGATGCCCAGTAAGTTCAGC	0.657																																																	0								ENSG00000155363						40.0	49.0	46.0					1																	113217542		2203	4299	6502	MOV10	SO:0001589	frameshift_variant	0				HGNC	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.8delG	1.37:g.113217542delG	ENSP00000399797:p.Ser3fs	Somatic	0	102	0.00		0.5694851509381481	27	3.57	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	50	24.24	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.S3fs	ENST00000413052.2	37	c.8	CCDS853.1	1																																																																																			-	NULL		0.657	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	protein_coding	OTTHUMT00000032906.1	G	NM_020963			113217542	+1	no_errors	ENST00000357443	ensembl	human	known	74_37	frame_shift_del	DEL	0.938	-
DUSP10	11221	genome.wustl.edu	37	1	221875156	221875157	+	3'UTR	INS	-	-	A	rs571834010		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:221875156_221875157insA	ENST00000366899.3	-	0	2284_2285				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCCAGAGAAGGAAAAAAAAAAA	0.351																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*598->T	1.37:g.221875167_221875167dupA		Somatic	0	30	0.00		0.5694851509381481	92	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	-	NM_007207			221875157	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	INS	0.002:0.000	A
HNF1A	6927	genome.wustl.edu	37	12	121434799	121434799	+	Nonstop_Mutation	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:121434799A>T	ENST00000402929.1	+	6	1698	c.1563A>T	c.(1561-1563)tgA>tgT	p.*521C	HNF1A_ENST00000400024.2_Intron|HNF1A_ENST00000257555.6_Intron|HNF1A_ENST00000541395.1_Intron|HNF1A_ENST00000543427.1_Nonstop_Mutation_p.*404C|HNF1A_ENST00000544413.1_Intron|HNF1A_ENST00000538626.1_Intron			P20823	HNF1A_HUMAN	HNF1 homeobox A	0					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					tcagaaggtgaagggtctatg	0.433									Hepatic Adenoma, Familial Clustering of																																								0								ENSG00000135100																																			HNF1A	SO:0001578	stop_lost	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	-	HGNC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000402929.1:c.1563A>T	12.37:g.121434799A>T	ENSP00000475300:p.*521Cysext*10	Somatic	0	62	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	55	22.54	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.*404C	ENST00000402929.1	37	c.1212		12	.	.	.	.	.	.	.	.	.	.	A	1.422	-0.572519	0.03882	.	.	ENSG00000135100	ENST00000543427	.	.	.	2.73	0.254	0.15557	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0643	0.06210	0.602:0.2542:0.1437:0.0	.	.	.	.	C	404	.	.	X	+	3	0	HNF1A	119919182	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.002000	0.12924	0.052000	0.16007	-0.486000	0.04755	TGA	-	NULL		0.433	HNF1A-003	PUTATIVE	basic	protein_coding	HNF1A	protein_coding	OTTHUMT00000320959.3	A	NM_000545	-		121434799	+1	no_errors	ENST00000543427	ensembl	human	known	74_37	nonstop	SNP	0.000	T
TLDC2	140711	genome.wustl.edu	37	20	35506417	35506417	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr20:35506417C>T	ENST00000217320.3	+	2	193	c.149C>T	c.(148-150)aCa>aTa	p.T50I	TLDC2_ENST00000602922.1_Missense_Mutation_p.T50I	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	50																	CCCCAGCTGACAGAAGCCAGC	0.587																																																	0								ENSG00000101342						67.0	65.0	66.0					20																	35506417		2203	4300	6503	TLDC2	SO:0001583	missense	0			-	HGNC	AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.149C>T	20.37:g.35506417C>T	ENSP00000217320:p.Thr50Ile	Somatic	0	37	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	40	32.20	B3KVU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TLDc,smart_TLDc	p.T50I	ENST00000217320.3	37	c.149	CCDS33465.1	20	.	.	.	.	.	.	.	.	.	.	C	9.519	1.107884	0.20714	.	.	ENSG00000101342	ENST00000217320	T	0.32023	1.47	3.58	2.64	0.31445	.	0.476413	0.18874	N	0.128779	T	0.15349	0.0370	N	0.14661	0.345	0.28683	N	0.904982	B	0.09022	0.002	B	0.06405	0.002	T	0.12837	-1.0532	10	0.27082	T	0.32	-26.3395	6.8146	0.23822	0.0:0.8725:0.0:0.1275	.	50	A0PJX2	CT118_HUMAN	I	50	ENSP00000217320:T50I	ENSP00000217320:T50I	T	+	2	0	C20orf118	34939831	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	1.675000	0.37555	1.089000	0.41292	0.561000	0.74099	ACA	-	NULL		0.587	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TLDC2	protein_coding	OTTHUMT00000079060.2	C	NM_080628	-		35506417	+1	no_errors	ENST00000217320	ensembl	human	known	74_37	missense	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	39051993	39051993	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:39051993C>T	ENST00000359596.3	+	90	12523	c.12523C>T	c.(12523-12525)Ccc>Tcc	p.P4175S	RYR1_ENST00000355481.4_Missense_Mutation_p.P4170S|RYR1_ENST00000360985.3_Missense_Mutation_p.P4170S			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4175					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTACTTCCGCCCCTACCTGGG	0.637																																																	0								ENSG00000196218						94.0	71.0	79.0					19																	39051993		2203	4300	6503	RYR1	SO:0001583	missense	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12523C>T	19.37:g.39051993C>T	ENSP00000352608:p.Pro4175Ser	Somatic	0	34	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	38	39.68	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.P4175S	ENST00000359596.3	37	c.12523	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657850	0.47467	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97455	-4.39;-4.39;-4.39	3.67	3.67	0.42095	.	0.000000	0.64402	U	0.000002	D	0.97860	0.9297	M	0.74467	2.265	0.58432	D	0.999997	D;D;D	0.71674	0.998;0.997;0.994	D;P;P	0.66351	0.943;0.9;0.796	D	0.97512	1.0067	10	0.38643	T	0.18	.	15.5959	0.76578	0.0:1.0:0.0:0.0	.	4170;4170;4175	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	S	4175;4170;4170	ENSP00000352608:P4175S;ENSP00000347667:P4170S;ENSP00000354254:P4170S	ENSP00000347667:P4170S	P	+	1	0	RYR1	43743833	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.569000	0.82380	2.082000	0.62665	0.298000	0.19748	CCC	-	NULL		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C		-		39051993	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00272	388719	genome.wustl.edu	37	1	182377727	182377727	+	lincRNA	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:182377727G>T	ENST00000367563.3	+	0	477					NR_034131.1				long intergenic non-protein coding RNA 272																		GCATTTCTATGGGGAATCAGC	0.438																																																	0								ENSG00000203729																																			LINC00272			0			-	HGNC	AF508909		1q25.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000203729	ENSG00000203729		"""Long non-coding RNAs"""	26898	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 120"", ""non-protein coding RNA 272"""	C1orf120, NCRNA00272		12801632	Standard	NR_034131		Approved	RP1-223H12.3	uc009wxv.1		OTTHUMG00000037402		1.37:g.182377727G>T		Somatic	0	53	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367563.3	37	NULL		1																																																																																			-	-		0.438	LINC00272-001	KNOWN	basic	lincRNA	LINC00272	lincRNA	OTTHUMT00000091036.2	G	NM_001010899	-		182377727	+1	no_errors	ENST00000367563	ensembl	human	known	74_37	rna	SNP	0.091	T
MANEA	79694	genome.wustl.edu	37	6	96034835	96034835	+	Nonsense_Mutation	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:96034835A>T	ENST00000358812.4	+	2	654	c.520A>T	c.(520-522)Aga>Tga	p.R174*	MANEA_ENST00000369293.1_Nonsense_Mutation_p.R174*	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	174	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AACTCACATGAGACAAATGCG	0.363																																																	0								ENSG00000172469						68.0	71.0	70.0					6																	96034835		2170	4143	6313	MANEA	SO:0001587	stop_gained	0			-	HGNC	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.520A>T	6.37:g.96034835A>T	ENSP00000351669:p.Arg174*	Somatic	0	134	0.00		0.5694851509381481	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	72	25.00	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Glycoside_hydrolase_SF	p.R174*	ENST00000358812.4	37	c.520	CCDS5032.1	6	.	.	.	.	.	.	.	.	.	.	A	36	5.695015	0.96793	.	.	ENSG00000172469	ENST00000358812;ENST00000369293;ENST00000542500	.	.	.	5.66	5.66	0.87406	.	0.341334	0.37437	N	0.002097	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-3.962	15.0823	0.72125	1.0:0.0:0.0:0.0	.	.	.	.	X	174	.	ENSP00000351669:R174X	R	+	1	2	MANEA	96141556	0.760000	0.28428	1.000000	0.80357	0.984000	0.73092	1.407000	0.34657	2.158000	0.67659	0.528000	0.53228	AGA	-	superfamily_Glycoside_hydrolase_SF		0.363	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	protein_coding	OTTHUMT00000043644.1	A	NM_024641	-		96034835	+1	no_errors	ENST00000358812	ensembl	human	known	74_37	nonsense	SNP	1.000	T
AKAP2	11217	genome.wustl.edu	37	9	112930757	112930757	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr9:112930757G>T	ENST00000259318.7	+	4	2767	c.2560G>T	c.(2560-2562)Gag>Tag	p.E854*	AKAP2_ENST00000510514.5_Nonsense_Mutation_p.E1085*|AKAP2_ENST00000434623.2_Nonsense_Mutation_p.E956*|PALM2-AKAP2_ENST00000302798.7_Nonsense_Mutation_p.E1085*|AKAP2_ENST00000555236.1_Nonsense_Mutation_p.E1098*|PALM2-AKAP2_ENST00000374530.3_Nonsense_Mutation_p.E1098*|AKAP2_ENST00000482335.1_3'UTR|AKAP2_ENST00000374525.1_Nonsense_Mutation_p.E943*	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	854										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TGCCAACCAGGAGGAAGAAGA	0.468																																																	0								ENSG00000157654						87.0	85.0	86.0					9																	112930757		2203	4300	6503	PALM2-AKAP2	SO:0001587	stop_gained	0			-	HGNC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.2560G>T	9.37:g.112930757G>T	ENSP00000259318:p.Glu854*	Somatic	0	67	0.00		0.5694851509381481	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Paralemmin,pfam_RII_binding_1	p.E1098*	ENST00000259318.7	37	c.3292	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	41	8.587548	0.98875	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000259318	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.48511	D	0.999667	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-31.8629	18.385	0.90464	0.0:0.0:1.0:0.0	.	.	.	.	X	1098;1085;1098;1085;956;943;854	.	ENSP00000259318:E854X	E	+	1	0	PALM2-AKAP2;AKAP2	111970578	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.519000	0.81809	2.565000	0.86533	0.655000	0.94253	GAG	-	NULL		0.468	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	protein_coding	OTTHUMT00000346067.3	G	NM_001004065	-		112930757	+1	no_errors	ENST00000374530	ensembl	human	known	74_37	nonsense	SNP	1.000	T
DEFB113	245927	genome.wustl.edu	37	6	49936404	49936404	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:49936404G>A	ENST00000398718.1	-	2	234	c.235C>T	c.(235-237)Ctc>Ttc	p.L79F		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	79					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					ttttGATGGAGTTTACTAGTG	0.279																																																	0								ENSG00000214642						39.0	35.0	36.0					6																	49936404		1777	4012	5789	DEFB113	SO:0001583	missense	0			-	HGNC	DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.235C>T	6.37:g.49936404G>A	ENSP00000381703:p.Leu79Phe	Somatic	0	37	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L79F	ENST00000398718.1	37	c.235	CCDS43472.1	6	.	.	.	.	.	.	.	.	.	.	G	9.676	1.148044	0.21288	.	.	ENSG00000214642	ENST00000398718	.	.	.	3.62	-3.27	0.05048	.	.	.	.	.	T	0.04588	0.0125	.	.	.	0.09310	N	1	B	0.23540	0.087	B	0.17098	0.017	T	0.35699	-0.9778	6	.	.	.	11.5886	0.4116	0.00442	0.2278:0.179:0.1949:0.3982	.	79	Q30KQ7	DB113_HUMAN	F	79	.	.	L	-	1	0	DEFB113	50044363	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.878000	0.01630	-0.791000	0.04486	-0.321000	0.08615	CTC	-	NULL		0.279	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB113	protein_coding	OTTHUMT00000359666.1	G		-		49936404	-1	no_errors	ENST00000398718	ensembl	human	known	74_37	missense	SNP	0.000	A
DOCK6	57572	genome.wustl.edu	37	19	11354301	11354301	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:11354301G>A	ENST00000294618.7	-	11	1201	c.1190C>T	c.(1189-1191)aCg>aTg	p.T397M		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	397					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GTGCACGGCCGTCCAGGCGAA	0.682											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000130158						26.0	35.0	32.0					19																	11354301		2162	4270	6432	DOCK6	SO:0001583	missense	0			-	HGNC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1190C>T	19.37:g.11354301G>A	ENSP00000294618:p.Thr397Met	Somatic	0	25	0.00	671	0.5694851509381481	10	16.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N	p.T397M	ENST00000294618.7	37	c.1190	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.078115	0.94000	.	.	ENSG00000130158	ENST00000294618	T	0.17691	2.26	4.48	4.48	0.54585	.	0.061993	0.64402	D	0.000005	T	0.45175	0.1329	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.52381	-0.8583	10	0.59425	D	0.04	-13.7507	15.913	0.79485	0.0:0.0:1.0:0.0	.	397	Q96HP0	DOCK6_HUMAN	M	397	ENSP00000294618:T397M	ENSP00000294618:T397M	T	-	2	0	DOCK6	11215301	1.000000	0.71417	0.991000	0.47740	0.953000	0.61014	7.339000	0.79282	2.039000	0.60335	0.462000	0.41574	ACG	-	NULL		0.682	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	protein_coding	OTTHUMT00000453155.1	G	NM_020812	-		11354301	-1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	SNP	1.000	A
LY9	4063	genome.wustl.edu	37	1	160771614	160771614	+	Intron	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:160771614C>T	ENST00000263285.6	+	2	484				LY9_ENST00000341032.4_Intron|LY9_ENST00000368041.2_Intron|LY9_ENST00000471816.1_Intron|LY9_ENST00000368037.5_Intron|LY9_ENST00000392203.4_Intron|LY9_ENST00000368040.1_Intron|LY9_ENST00000368039.2_Silent_p.I163I			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCCACGTCATCGAGGGTGACC	0.527																																																	0								ENSG00000122224						115.0	119.0	118.0					1																	160771614		2203	4300	6503	LY9	SO:0001627	intron_variant	0			-	HGNC	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.454+1742C>T	1.37:g.160771614C>T		Somatic	0	90	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	64	21.95	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub	p.I163	ENST00000263285.6	37	c.489	CCDS30916.1	1																																																																																			-	NULL		0.527	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LY9	protein_coding	OTTHUMT00000060457.3	C	NM_002348	-		160771614	+1	no_errors	ENST00000368039	ensembl	human	known	74_37	silent	SNP	0.999	T
RPH3A	22895	genome.wustl.edu	37	12	113307826	113307826	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr12:113307826T>C	ENST00000389385.4	+	10	1275	c.778T>C	c.(778-780)Tcc>Ccc	p.S260P	RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000551052.1_Missense_Mutation_p.S256P|RPH3A_ENST00000420983.2_Missense_Mutation_p.S260P|RPH3A_ENST00000548866.1_Missense_Mutation_p.S211P|RPH3A_ENST00000415485.3_Missense_Mutation_p.S260P|RPH3A_ENST00000543106.2_Missense_Mutation_p.S260P|RPH3A_ENST00000447659.2_Missense_Mutation_p.S211P	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	260	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TGCTGGAGACTCCAGCCGGAG	0.552																																																	0								ENSG00000089169						30.0	36.0	34.0					12																	113307826		2203	4300	6503	RPH3A	SO:0001583	missense	0			-	HGNC	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.778T>C	12.37:g.113307826T>C	ENSP00000374036:p.Ser260Pro	Somatic	0	34	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	25.00	B7Z3C3|Q96AE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Znf_FYVE-typ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel,prints_Synaptotagmin,prints_C2_dom	p.S260P	ENST00000389385.4	37	c.778	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	T	11.87	1.767189	0.31320	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.62232	0.08;0.08;0.05;0.08;0.08;0.04;0.08	5.55	-1.7	0.08159	.	0.851661	0.10142	N	0.710697	T	0.47801	0.1465	L	0.38175	1.15	0.25285	N	0.989409	B;B;B;B	0.26258	0.0;0.09;0.09;0.145	B;B;B;B	0.34779	0.0;0.063;0.063;0.189	T	0.48091	-0.9065	10	0.46703	T	0.11	.	1.7996	0.03068	0.2063:0.0965:0.3835:0.3137	.	211;260;260;256	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	P	260;260;211;256;260;211;260	ENSP00000440384:S260P;ENSP00000374036:S260P;ENSP00000413254:S211P;ENSP00000448297:S256P;ENSP00000405357:S260P;ENSP00000450347:S211P;ENSP00000408889:S260P	ENSP00000374036:S260P	S	+	1	0	RPH3A	111792209	0.011000	0.17503	0.836000	0.33094	0.726000	0.41606	-0.350000	0.07721	-0.131000	0.11578	0.523000	0.50628	TCC	-	NULL		0.552	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	protein_coding	OTTHUMT00000405561.1	T	NM_014954	-		113307826	+1	no_errors	ENST00000389385	ensembl	human	known	74_37	missense	SNP	0.997	C
COL1A1	1277	genome.wustl.edu	37	17	48271338	48271338	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr17:48271338C>A	ENST00000225964.5	-	25	1851	c.1733G>T	c.(1732-1734)gGt>gTt	p.G578V		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	578	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	TCCCATCACACCAGCCTGACC	0.592			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																	Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0								ENSG00000108821						56.0	59.0	58.0					17																	48271338		2203	4300	6503	COL1A1	SO:0001583	missense	0			-	HGNC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.1733G>T	17.37:g.48271338C>A	ENSP00000225964:p.Gly578Val	Somatic	0	49	0.00		0.5694851509381481	23387	45.66	19707	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	26	42.22	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G578V	ENST00000225964.5	37	c.1733	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932061	0.73442	.	.	ENSG00000108821	ENST00000225964	D	0.99637	-6.29	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	H	0.97659	4.05	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96798	0.9587	10	0.87932	D	0	.	15.9855	0.80147	0.0:1.0:0.0:0.0	.	578	P02452	CO1A1_HUMAN	V	578	ENSP00000225964:G578V	ENSP00000225964:G578V	G	-	2	0	COL1A1	45626337	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.561000	0.82288	2.309000	0.77851	0.655000	0.94253	GGT	-	NULL		0.592	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	protein_coding	OTTHUMT00000309036.2	C		-		48271338	-1	no_errors	ENST00000225964	ensembl	human	known	74_37	missense	SNP	1.000	A
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.5694851509381481	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
IL4	3565	genome.wustl.edu	37	5	132010060	132010060	+	Intron	SNP	T	T	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr5:132010060T>A	ENST00000231449.2	+	2	200				IL4_ENST00000350025.2_Intron|IL4_ENST00000495905.1_3'UTR	NM_000589.3	NP_000580.1	P05112	IL4_HUMAN	interleukin 4						B cell costimulation (GO:0031296)|B cell differentiation (GO:0030183)|cellular defense response (GO:0006968)|cellular response to mercury ion (GO:0071288)|chemotaxis (GO:0006935)|cholesterol metabolic process (GO:0008203)|connective tissue growth factor biosynthetic process (GO:0045189)|defense response to protozoan (GO:0042832)|dendritic cell differentiation (GO:0097028)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female pregnancy (GO:0007565)|immune response (GO:0006955)|innate immune response in mucosa (GO:0002227)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of macrophage activation (GO:0043031)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of T-helper 17 cell differentiation (GO:2000320)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of immune response (GO:0050776)|regulation of isotype switching (GO:0045191)|regulation of phosphorylation (GO:0042325)|regulation of proton transport (GO:0010155)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|T-helper 1 cell lineage commitment (GO:0002296)|T-helper 2 cell cytokine production (GO:0035745)|T-helper 2 cell differentiation (GO:0045064)|type 2 immune response (GO:0042092)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-4 receptor binding (GO:0005136)			NS(1)|large_intestine(3)|lung(3)|prostate(1)	8		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)		GTTTCCTCAGTTGGAGGGAGT	0.522																																																	0								ENSG00000113520																																			IL4	SO:0001627	intron_variant	0			-	HGNC	M23442	CCDS4158.1, CCDS4159.1	5q23-q31	2011-07-14			ENSG00000113520	ENSG00000113520		"""Interleukins and interleukin receptors"""	6014	protein-coding gene	gene with protein product	"""B_cell stimulatory factor 1"", ""lymphocyte stimulatory factor 1"", ""B cell growth factor 1"""	147780				3016727	Standard	NM_000589		Approved	BSF1, IL-4, BCGF1, BCGF-1, MGC79402	uc003kxk.2	P05112	OTTHUMG00000059724	ENST00000231449.2:c.136-91T>A	5.37:g.132010060T>A		Somatic	0	53	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	47	25.40	Q14630|Q6NZ77	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000231449.2	37	NULL	CCDS4158.1	5																																																																																			-	-		0.522	IL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4	protein_coding	OTTHUMT00000132786.1	T	NM_000589	-		132010060	+1	no_errors	ENST00000495905	ensembl	human	putative	74_37	rna	SNP	0.002	A
MYB	4602	genome.wustl.edu	37	6	135521663	135521663	+	Intron	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:135521663G>A	ENST00000367814.4	+	12	1773				MYB_ENST00000528774.1_Intron|MYB_ENST00000442647.2_Intron|MYB_ENST00000533624.1_Intron|MYB_ENST00000531845.1_Intron|MYB_ENST00000534044.1_Intron|MYB_ENST00000527615.1_Intron|MYB_ENST00000341911.5_Intron|MYB_ENST00000525369.1_Intron|MYB_ENST00000534121.1_Intron|MYB_ENST00000316528.8_Intron	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ACGACTTTTCGTGCAAGATTT	0.478			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0								ENSG00000118513																																			MYB	SO:0001627	intron_variant	0			-	HGNC		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1587+110G>A	6.37:g.135521663G>A		Somatic	0	22	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R566H	ENST00000367814.4	37	c.1697	CCDS5174.1	6																																																																																			-	NULL		0.478	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	protein_coding	OTTHUMT00000042347.4	G		-		135521663	+1	no_errors	ENST00000525002	ensembl	human	known	74_37	missense	SNP	0.000	A
ATP12A	479	genome.wustl.edu	37	13	25283514	25283514	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr13:25283514G>T	ENST00000381946.3	+	18	2673	c.2506G>T	c.(2506-2508)Gcc>Tcc	p.A836S	ATP12A_ENST00000218548.6_Missense_Mutation_p.A842S			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	836					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CCCCTCCATTGCCTTGGCGTA	0.572																																					Pancreas(156;1582 1935 18898 22665 26498)												0								ENSG00000075673						87.0	82.0	84.0					13																	25283514		2203	4300	6503	ATP12A	SO:0001583	missense	0			-	HGNC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2506G>T	13.37:g.25283514G>T	ENSP00000371372:p.Ala836Ser	Somatic	1	132	0.75		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	85	27.12	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.A842S	ENST00000381946.3	37	c.2524	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	G	1.460	-0.562683	0.03939	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.97186	-4.28;-4.28	5.92	5.92	0.95590	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.070452	0.64402	D	0.000013	D	0.88573	0.6473	N	0.02985	-0.445	0.53005	D	0.999964	B;P	0.38300	0.099;0.626	B;B	0.36092	0.108;0.217	D	0.89322	0.3641	10	0.02654	T	1	.	12.7114	0.57092	0.0:0.0:0.8356:0.1644	.	842;836	P54707-2;P54707	.;AT12A_HUMAN	S	842;836	ENSP00000218548:A842S;ENSP00000371372:A836S	ENSP00000218548:A842S	A	+	1	0	ATP12A	24181514	1.000000	0.71417	0.987000	0.45799	0.052000	0.14988	5.842000	0.69417	2.795000	0.96236	0.655000	0.94253	GCC	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Na/K_IIC		0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	protein_coding	OTTHUMT00000044199.1	G	NM_001676	-		25283514	+1	no_errors	ENST00000218548	ensembl	human	known	74_37	missense	SNP	1.000	T
IGSF5	150084	genome.wustl.edu	37	21	41137760	41137760	+	Silent	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr21:41137760T>C	ENST00000380588.4	+	3	502	c.399T>C	c.(397-399)tcT>tcC	p.S133S	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	133	Ig-like V-type 1.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				TGCATGGATCTGCTTACCTTA	0.527																																																	0								ENSG00000183067						89.0	78.0	82.0					21																	41137760		2203	4300	6503	IGSF5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.399T>C	21.37:g.41137760T>C		Somatic	0	36	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	26	31.58		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S133	ENST00000380588.4	37	c.399	CCDS33562.1	21																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.527	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IGSF5	protein_coding	OTTHUMT00000195005.1	T		-		41137760	+1	no_errors	ENST00000380588	ensembl	human	novel	74_37	silent	SNP	0.004	C
TANGO6	79613	genome.wustl.edu	37	16	68896912	68896912	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr16:68896912A>G	ENST00000261778.1	+	3	812	c.800A>G	c.(799-801)tAt>tGt	p.Y267C		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	267						integral component of membrane (GO:0016021)											GATCAAGTCTATCAGCCCTTA	0.498																																																	0								ENSG00000103047						32.0	33.0	33.0					16																	68896912		1868	4115	5983	TANGO6	SO:0001583	missense	0			-	HGNC		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.800A>G	16.37:g.68896912A>G	ENSP00000261778:p.Tyr267Cys	Somatic	0	37	0.00		0.5694851509381481	5	37.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	22	56.00	Q569F9|Q9H9K1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.Y267C	ENST00000261778.1	37	c.800	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322544	0.81580	.	.	ENSG00000103047	ENST00000261778	T	0.68765	-0.35	5.73	5.73	0.89815	.	.	.	.	.	T	0.78660	0.4318	M	0.81239	2.535	0.53688	D	0.99997	D;D	0.64830	0.994;0.994	P;P	0.57371	0.819;0.819	T	0.80484	-0.1362	9	0.48119	T	0.1	-0.6102	13.5206	0.61566	1.0:0.0:0.0:0.0	.	267;106	Q9C0B7;B3KTB6	TMCO7_HUMAN;.	C	267	ENSP00000261778:Y267C	ENSP00000261778:Y267C	Y	+	2	0	TMCO7	67454413	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.863000	0.75489	2.176000	0.68965	0.528000	0.53228	TAT	-	NULL		0.498	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	protein_coding	OTTHUMT00000433471.2	A	XM_928235.2	-		68896912	+1	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	SNP	1.000	G
GPALPP1	55425	genome.wustl.edu	37	13	45589177	45589177	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr13:45589177A>G	ENST00000379151.4	+	5	602	c.499A>G	c.(499-501)Agg>Ggg	p.R167G	GPALPP1_ENST00000361121.2_Missense_Mutation_p.R167G|GPALPP1_ENST00000357537.3_5'UTR|RP11-321C24.1_ENST00000437748.2_lincRNA	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	167																	GTTTGAAAAAAGGGCCCAGAG	0.318																																																	0								ENSG00000133114						63.0	65.0	64.0					13																	45589177		2203	4300	6503	GPALPP1	SO:0001583	missense	0			-	HGNC	AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.499A>G	13.37:g.45589177A>G	ENSP00000368447:p.Arg167Gly	Somatic	0	64	0.00		0.5694851509381481	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3752	p.R167G	ENST00000379151.4	37	c.499	CCDS9394.1	13	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683820	0.68157	.	.	ENSG00000133114	ENST00000379151;ENST00000361121	.	.	.	5.57	3.03	0.35002	.	0.090691	0.85682	D	0.000000	T	0.78830	0.4345	M	0.84773	2.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	T	0.78783	-0.2069	9	0.49607	T	0.09	-0.4172	11.9741	0.53081	0.7249:0.2751:0.0:0.0	.	18;167	Q8IXQ4-2;Q8IXQ4	.;K1704_HUMAN	G	167	.	ENSP00000355211:R167G	R	+	1	2	KIAA1704	44487177	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.432000	0.52824	0.437000	0.26423	0.528000	0.53228	AGG	-	NULL		0.318	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPALPP1	protein_coding	OTTHUMT00000044749.2	A	NM_018559	-		45589177	+1	no_errors	ENST00000361121	ensembl	human	known	74_37	missense	SNP	1.000	G
RP11-51O6.1	0	genome.wustl.edu	37	16	61089587	61089587	+	RNA	SNP	T	T	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr16:61089587T>G	ENST00000591758.1	-	0	281																											CTTCCTTTTCTTAGCACCACC	0.418																																																	0								ENSG00000224631																																			RP11-51O6.1			0			-	Clone_based_vega_gene																													16.37:g.61089587T>G		Somatic	0	32	0.00		0.5694851509381481	892	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	23.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591758.1	37	NULL		16																																																																																			-	-		0.418	RP11-51O6.1-002	KNOWN	basic	processed_transcript	ENSG00000224631	pseudogene	OTTHUMT00000460612.1	T		-		61089587	-1	no_errors	ENST00000591758	ensembl	human	known	74_37	rna	SNP	1.000	G
IARS2	55699	genome.wustl.edu	37	1	220273947	220273947	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:220273947G>T	ENST00000302637.5	+	3	610	c.506G>T	c.(505-507)gGt>gTt	p.G169V	IARS2_ENST00000366922.1_Missense_Mutation_p.G97V	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	169					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TCAGAACTTGGTAGAGAAGCT	0.358																																																	0								ENSG00000067704						61.0	67.0	65.0					1																	220273947		2203	4300	6503	IARS2	SO:0001583	missense	0			-	HGNC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.506G>T	1.37:g.220273947G>T	ENSP00000303279:p.Gly169Val	Somatic	0	114	0.00		0.5694851509381481	12	36.84	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	39	59.79	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_Znf_DNA_glyclase/IsotRNA_synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Ile-tRNA-ligase,tigrfam_Ile-tRNA-ligase	p.G169V	ENST00000302637.5	37	c.506	CCDS1523.1	1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.272175	0.59649	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.55930	0.49;0.49	5.95	5.05	0.67936	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.092799	0.85682	D	0.000000	T	0.69780	0.3149	M	0.93241	3.395	0.80722	D	1	P	0.48998	0.918	P	0.49853	0.624	T	0.77624	-0.2518	10	0.87932	D	0	-9.2427	10.9359	0.47245	0.0686:0.0:0.7947:0.1367	.	169	Q9NSE4	SYIM_HUMAN	V	97;169	ENSP00000355889:G97V;ENSP00000303279:G169V	ENSP00000303279:G169V	G	+	2	0	IARS2	218340570	0.998000	0.40836	0.964000	0.40570	0.787000	0.44495	2.684000	0.46951	1.536000	0.49237	0.655000	0.94253	GGT	-	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,tigrfam_Ile-tRNA-ligase		0.358	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS2	protein_coding		G	NM_018060	-		220273947	+1	no_errors	ENST00000302637	ensembl	human	known	74_37	missense	SNP	0.958	T
CALCR	799	genome.wustl.edu	37	7	93112121	93112121	+	Intron	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:93112121G>A	ENST00000394441.1	-	3	367				CALCR_ENST00000360249.4_Intron|MIR653_ENST00000385279.1_RNA|CALCR_ENST00000421592.1_Intron|CALCR_ENST00000359558.2_Intron|MIR489_ENST00000384923.1_RNA|CALCR_ENST00000426151.1_Intron	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CAGTGAACTTGTTTGAAGCTG	0.358																																																	0								ENSG00000208014						105.0	102.0	103.0					7																	93112121		1568	3582	5150	MIR653	SO:0001627	intron_variant	0			-	HGNC	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.52-3302C>T	7.37:g.93112121G>A		Somatic	0	49	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394441.1	37	NULL	CCDS5631.1	7																																																																																			-	-		0.358	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	MIR653	protein_coding	OTTHUMT00000254661.2	G	NM_001742	-		93112121	-1	no_errors	ENST00000385279	ensembl	human	known	74_37	rna	SNP	0.004	A
CIB4	130106	genome.wustl.edu	37	2	26818157	26818157	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:26818157C>T	ENST00000288861.4	-	4	268	c.215G>A	c.(214-216)aGa>aAa	p.R72K	CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	72	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGAACACTCTGCAGATACG	0.572																																																	0								ENSG00000157884						114.0	96.0	102.0					2																	26818157		2203	4300	6503	CIB4	SO:0001583	missense	0			-	HGNC		CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.215G>A	2.37:g.26818157C>T	ENSP00000288861:p.Arg72Lys	Somatic	0	53	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	46	22.03	B2RU18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R72K	ENST00000288861.4	37	c.215	CCDS33160.1	2	.	.	.	.	.	.	.	.	.	.	C	2.461	-0.324089	0.05350	.	.	ENSG00000157884	ENST00000288861;ENST00000403670;ENST00000405346	T	0.66638	-0.22	6.08	0.0854	0.14441	EF-hand-like domain (1);	0.354917	0.27744	N	0.018034	T	0.32704	0.0838	N	0.02854	-0.475	0.22034	N	0.999404	B	0.02656	0.0	B	0.01281	0.0	T	0.26780	-1.0093	10	0.08179	T	0.78	.	8.4457	0.32841	0.0:0.4812:0.0:0.5188	.	72	A0PJX0	CIB4_HUMAN	K	72;27;74	ENSP00000288861:R72K	ENSP00000288861:R72K	R	-	2	0	CIB4	26671661	0.431000	0.25546	0.465000	0.27155	0.265000	0.26407	0.399000	0.20916	-0.054000	0.13266	-0.229000	0.12294	AGA	-	NULL		0.572	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB4	protein_coding	OTTHUMT00000324709.1	C		-		26818157	-1	no_errors	ENST00000288861	ensembl	human	known	74_37	missense	SNP	0.606	T
DUSP5	1847	genome.wustl.edu	37	10	112270097	112270097	+	Frame_Shift_Del	DEL	C	C	-	rs565671192	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr10:112270097delC	ENST00000369583.3	+	4	1352	c.1068delC	c.(1066-1068)ttcfs	p.F356fs	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	356	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		ACTGCACATTCCCTGCCTCGG	0.607																																																	0								ENSG00000138166						28.0	27.0	27.0					10																	112270097		2203	4300	6503	DUSP5	SO:0001589	frameshift_variant	0				HGNC	U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.1068delC	10.37:g.112270097delC	ENSP00000358596:p.Phe356fs	Somatic	0	27	0.00		0.5694851509381481	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q12997|Q5T603	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.P357fs	ENST00000369583.3	37	c.1068	CCDS7566.1	10																																																																																			-	pirsf_MKP		0.607	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP5	protein_coding	OTTHUMT00000050333.1	C	NM_004419			112270097	+1	no_errors	ENST00000369583	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DNAH11	8701	genome.wustl.edu	37	7	21784177	21784177	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:21784177T>C	ENST00000409508.3	+	50	8307	c.8276T>C	c.(8275-8277)tTt>tCt	p.F2759S	DNAH11_ENST00000328843.6_Missense_Mutation_p.F2766S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2766					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGTGATTTGTTTCAGAGAAGA	0.373									Kartagener syndrome																																								0								ENSG00000105877						106.0	103.0	104.0					7																	21784177		1851	4103	5954	DNAH11	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8276T>C	7.37:g.21784177T>C	ENSP00000475939:p.Phe2759Ser	Somatic	0	70	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	74	13.95	Q9UJ82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F2766S	ENST00000409508.3	37	c.8297		7	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273007	0.80580	.	.	ENSG00000105877	ENST00000328843	T	0.42513	0.97	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65281	0.2676	.	.	.	0.54753	D	0.999989	D	0.76494	0.999	D	0.85130	0.997	T	0.69558	-0.5113	9	0.87932	D	0	.	13.3502	0.60597	0.0:0.0:0.131:0.869	.	2766	Q96DT5	DYH11_HUMAN	S	2766	ENSP00000330671:F2766S	ENSP00000330671:F2766S	F	+	2	0	DNAH11	21750702	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.504000	0.60414	2.254000	0.74563	0.533000	0.62120	TTT	-	superfamily_P-loop_NTPase		0.373	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	T	NM_003777	-		21784177	+1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	SNP	1.000	C
OR5AP2	338675	genome.wustl.edu	37	11	56409257	56409257	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:56409257A>G	ENST00000302981.1	-	1	658	c.659T>C	c.(658-660)gTc>gCc	p.V220A	OR5AP2_ENST00000544374.1_Missense_Mutation_p.V221A	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						GGAAATGAGGACAATCATAAC	0.473																																																	0								ENSG00000172464						200.0	189.0	193.0					11																	56409257		2201	4296	6497	OR5AP2	SO:0001583	missense	0			-	HGNC	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.659T>C	11.37:g.56409257A>G	ENSP00000303111:p.Val220Ala	Somatic	0	60	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	B2RNM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V221A	ENST00000302981.1	37	c.662	CCDS31534.1	11	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541993	0.65198	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00198	8.57;8.57	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.314247	0.22891	N	0.054381	T	0.00440	0.0014	M	0.88310	2.945	0.09310	N	1	P	0.48294	0.908	P	0.51055	0.657	T	0.30060	-0.9991	10	0.87932	D	0	.	10.2353	0.43280	0.9208:0.0:0.0792:0.0	.	220	Q8NGF4	O5AP2_HUMAN	A	221;220	ENSP00000442701:V221A;ENSP00000303111:V220A	ENSP00000303111:V220A	V	-	2	0	OR5AP2	56165833	0.072000	0.21174	0.871000	0.34182	0.882000	0.50991	3.655000	0.54460	2.153000	0.67306	0.519000	0.50382	GTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.473	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	protein_coding	OTTHUMT00000391613.1	A	NM_001002925	-		56409257	-1	no_errors	ENST00000544374	ensembl	human	known	74_37	missense	SNP	0.102	G
PPP1R3E	90673	genome.wustl.edu	37	14	23771747	23771747	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr14:23771747G>A	ENST00000452015.4	-	1	310	c.39C>T	c.(37-39)cgC>cgT	p.R13R		NM_001276318.1	NP_001263247.1	Q9H7J1	PPR3E_HUMAN	protein phosphatase 1, regulatory subunit 3E	13					glycogen metabolic process (GO:0005977)												AGCTCAGGTTGCGGGGAATGT	0.726																																																	0								ENSG00000235194																																			PPP1R3E	SO:0001819	synonymous_variant	0			-	HGNC	AK024489	CCDS61403.1	14q11.2	2013-01-29	2011-10-04		ENSG00000235194	ENSG00000235194		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14943	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3E"""			11948623, 15752363	Standard	NM_001276318		Approved	FLJ00089	uc031qns.1	Q9H7J1	OTTHUMG00000172116	ENST00000452015.4:c.39C>T	14.37:g.23771747G>A		Somatic	0	22	0.00		0.5694851509381481	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	D3DS47	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CBM_21,pfscan_CBM_21	p.R13	ENST00000452015.4	37	c.39		14																																																																																			-	NULL		0.726	PPP1R3E-001	KNOWN	NMD_exception|basic|appris_principal|readthrough_transcript	protein_coding	PPP1R3E	protein_coding	OTTHUMT00000416883.2	G		-		23771747	-1	no_errors	ENST00000452015	ensembl	human	known	74_37	silent	SNP	1.000	A
GRID2IP	392862	genome.wustl.edu	37	7	6554123	6554123	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr7:6554123G>T	ENST00000457091.2	-	8	1305	c.1306C>A	c.(1306-1308)Ctg>Atg	p.L436M	GRID2IP_ENST00000435185.1_Missense_Mutation_p.L253M|GRID2IP_ENST00000452113.1_Missense_Mutation_p.L246M	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	436					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGGGTGTCCAGCACAGGGTAG	0.562																																																	0								ENSG00000215045						102.0	110.0	108.0					7																	6554123		692	1591	2283	GRID2IP	SO:0001583	missense	0			-	HGNC		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1306C>A	7.37:g.6554123G>T	ENSP00000397351:p.Leu436Met	Somatic	0	58	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	50	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.L436M	ENST00000457091.2	37	c.1306	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354357	0.61293	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.63744	-0.05;-0.06;-0.05	4.61	3.73	0.42828	.	0.000000	0.64402	U	0.000005	T	0.74129	0.3676	M	0.63843	1.955	0.50171	D	0.999851	D	0.76494	0.999	D	0.85130	0.997	T	0.75687	-0.3231	10	0.87932	D	0	.	10.7408	0.46152	0.0952:0.0:0.9048:0.0	.	436	A4D2P6	GRD2I_HUMAN	M	246;253;436	ENSP00000397887:L246M;ENSP00000408364:L253M;ENSP00000397351:L436M	ENSP00000408364:L253M	L	-	1	2	GRID2IP	6520648	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	2.254000	0.43214	1.061000	0.40601	0.563000	0.77884	CTG	-	NULL		0.562	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	protein_coding	OTTHUMT00000340534.1	G	XM_294249	-		6554123	-1	no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	SNP	1.000	T
ZNF729	100287226	genome.wustl.edu	37	19	22498012	22498012	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:22498012A>C	ENST00000601693.1	+	4	1911	c.1793A>C	c.(1792-1794)aAa>aCa	p.K598T	ZNF729_ENST00000357491.6_Missense_Mutation_p.K598T			A6NN14	ZN729_HUMAN	zinc finger protein 729	598					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						ACTAGGGAGAAATTGTACAAA	0.358																																																	0								ENSG00000196350																																			ZNF729	SO:0001583	missense	0			-	HGNC		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.1793A>C	19.37:g.22498012A>C	ENSP00000469582:p.Lys598Thr	Somatic	0	77	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	74	18.68	M0QY45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K598T	ENST00000601693.1	37	c.1793	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	11.66	1.704857	0.30232	.	.	ENSG00000196350	ENST00000357491	T	0.24908	1.83	1.01	1.01	0.19927	.	.	.	.	.	T	0.33731	0.0873	M	0.65498	2.005	.	.	.	.	.	.	.	.	.	T	0.46133	-0.9213	6	0.66056	D	0.02	.	6.9138	0.24349	1.0:0.0:0.0:0.0	.	.	.	.	T	598	ENSP00000350085:K598T	ENSP00000350085:K598T	K	+	2	0	ZNF729	22289852	0.000000	0.05858	0.008000	0.14137	0.007000	0.05969	0.365000	0.20348	0.357000	0.24183	0.346000	0.21813	AAA	-	pfscan_Znf_C2H2		0.358	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	protein_coding	OTTHUMT00000464396.1	A	XM_496301	-		22498012	+1	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	SNP	0.989	C
SIGLEC9	27180	genome.wustl.edu	37	19	51629011	51629011	+	Silent	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:51629011C>A	ENST00000250360.3	+	2	646	c.579C>A	c.(577-579)acC>acA	p.T193T	SIGLEC9_ENST00000440804.3_Silent_p.T193T	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	193	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCTCCACCACCCGCTCCTCGG	0.647																																																	0								ENSG00000129450						69.0	69.0	69.0					19																	51629011		2203	4300	6503	SIGLEC9	SO:0001819	synonymous_variant	0			-	HGNC	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.579C>A	19.37:g.51629011C>A		Somatic	0	56	0.00		0.5694851509381481	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	29	56.76	Q6GTU4|Q9BYI9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.T193	ENST00000250360.3	37	c.579	CCDS12825.1	19																																																																																			-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom		0.647	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	protein_coding	OTTHUMT00000464224.1	C	NM_014441	-		51629011	+1	no_errors	ENST00000440804	ensembl	human	known	74_37	silent	SNP	0.000	A
OR2J2	26707	genome.wustl.edu	37	6	29141721	29141721	+	Silent	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:29141721C>T	ENST00000377167.2	+	1	411	c.309C>T	c.(307-309)taC>taT	p.Y103Y		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						TTCAACTTTACTTTGTTCTTG	0.483																																																	0								ENSG00000204700						246.0	224.0	231.0					6																	29141721		2046	4188	6234	OR2J2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.309C>T	6.37:g.29141721C>T		Somatic	0	73	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	44	24.14	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y103	ENST00000377167.2	37	c.309	CCDS43434.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.483	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	protein_coding	OTTHUMT00000076131.2	C		-		29141721	+1	no_errors	ENST00000377167	ensembl	human	known	74_37	silent	SNP	0.400	T
KIAA1211	57482	genome.wustl.edu	37	4	57180576	57180577	+	In_Frame_Ins	INS	-	-	GGAGCGGAGGGAGCGGAG	rs71921617|rs138358443|rs11276076	byFrequency	TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:57180576_57180577insGGAGCGGAGGGAGCGGAG	ENST00000504228.1	+	6	1013_1014	c.908_909insGGAGCGGAGGGAGCGGAG	c.(907-912)gcggag>gcGGAGCGGAGGGAGCGGAGggag	p.304_305insRRERRE	KIAA1211_ENST00000541073.1_In_Frame_Ins_p.297_298insRRERRE|KIAA1211_ENST00000264229.6_In_Frame_Ins_p.304_305insRRERRE			Q6ZU35	K1211_HUMAN	KIAA1211	304	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGGAGGACGCGGAGCGGAGGG	0.733														1350	0.269569	0.2716	0.2781	5008	,	,		14300	0.0694		0.4076	False		,,,				2504	0.3252																0								ENSG00000109265			903,2311		258,387,962						-10.2	0.0		dbSNP_130	6	2065,4451		612,841,1805	no	coding	KIAA1211	NM_020722.1		870,1228,2767	A1A1,A1R,RR		31.6912,28.0958,30.5036				2968,6762				KIAA1211	SO:0001652	inframe_insertion	0				HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	Exception_encountered	4.37:g.57180576_57180577insGGAGCGGAGGGAGCGGAG	ENSP00000423366:p.Glu304_Arg305insArgArgGluArgArgGlu	Somatic	NA	NA	NA		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9NTE2|Q9NTP8|Q9ULK9	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.307in_frame_insERRERR	ENST00000504228.1	37	c.908_909	CCDS43230.1	4																																																																																			-	NULL		0.733	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	-	NM_020722			57180577	+1	no_errors	ENST00000504228	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	GGAGCGGAGGGAGCGGAG
TRIML2	205860	genome.wustl.edu	37	4	189026036	189026036	+	Silent	SNP	A	A	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:189026036A>T	ENST00000512729.1	-	2	464	c.90T>A	c.(88-90)gcT>gcA	p.A30A	TRIML2_ENST00000326754.3_Silent_p.A30A|TRIML2_ENST00000502707.1_5'Flank|TRIML2_ENST00000536972.1_Silent_p.A80A	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	30					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		ATATGCTTTTAGCTGCTTCAA	0.383																																																	0								ENSG00000179046						223.0	207.0	212.0					4																	189026036		2203	4300	6503	TRIML2	SO:0001819	synonymous_variant	0			-	HGNC	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.90T>A	4.37:g.189026036A>T		Somatic	0	60	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	11	67.65	B7Z6J6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.A30	ENST00000512729.1	37	c.90	CCDS3850.1	4																																																																																			-	NULL		0.383	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	protein_coding	OTTHUMT00000359733.1	A	NM_173553	-		189026036	-1	no_errors	ENST00000512729	ensembl	human	known	74_37	silent	SNP	0.211	T
PPP1R12B	4660	genome.wustl.edu	37	1	202385935	202385935	+	Silent	SNP	G	G	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:202385935G>A	ENST00000608999.1	+	2	465	c.312G>A	c.(310-312)ttG>ttA	p.L104L	PPP1R12B_ENST00000356764.2_Silent_p.L104L|PPP1R12B_ENST00000336894.4_Silent_p.L104L|PPP1R12B_ENST00000480184.1_Silent_p.L104L	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	104					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			ATGAAAATTTGGACATGGTGA	0.453																																																	0								ENSG00000077157						130.0	127.0	128.0					1																	202385935		2203	4300	6503	PPP1R12B	SO:0001819	synonymous_variant	0			-	HGNC	AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.312G>A	1.37:g.202385935G>A		Somatic	0	81	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	63	21.25	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L104	ENST00000608999.1	37	c.312	CCDS1426.1	1																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.453	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	protein_coding	OTTHUMT00000099166.3	G	NM_032105	-		202385935	+1	no_errors	ENST00000336894	ensembl	human	known	74_37	silent	SNP	1.000	A
OR1S2	219958	genome.wustl.edu	37	11	57971208	57971208	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr11:57971208A>C	ENST00000302592.6	-	1	445	c.446T>G	c.(445-447)aTg>aGg	p.M149R		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCTGGCCCGCATGAAAGTTGT	0.463																																																	0								ENSG00000197887						158.0	150.0	152.0					11																	57971208		2201	4296	6497	OR1S2	SO:0001583	missense	0			-	HGNC	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.446T>G	11.37:g.57971208A>C	ENSP00000305469:p.Met149Arg	Somatic	0	89	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	Q6IFG5|Q96R85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M149R	ENST00000302592.6	37	c.446	CCDS31545.1	11	.	.	.	.	.	.	.	.	.	.	A	14.68	2.609133	0.46527	.	.	ENSG00000197887	ENST00000302592	T	0.00601	6.29	4.47	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000013	T	0.05960	0.0155	H	0.99391	4.545	0.45733	D	0.998638	D	0.69078	0.997	P	0.62184	0.899	T	0.01093	-1.1454	10	0.87932	D	0	.	13.0257	0.58814	1.0:0.0:0.0:0.0	.	149	Q8NGQ3	OR1S2_HUMAN	R	149	ENSP00000305469:M149R	ENSP00000305469:M149R	M	-	2	0	OR1S2	57727784	1.000000	0.71417	0.860000	0.33809	0.023000	0.10783	8.482000	0.90439	2.009000	0.58944	0.533000	0.62120	ATG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.463	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S2	protein_coding	OTTHUMT00000394703.2	A	NM_001004459	-		57971208	-1	no_errors	ENST00000302592	ensembl	human	known	74_37	missense	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	C	T	rs397516437		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr17:7577551C>T	ENST00000269305.4	-	7	919	c.730G>A	c.(730-732)Ggc>Agc	p.G244S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G244S|TP53_ENST00000420246.2_Missense_Mutation_p.G244S|TP53_ENST00000413465.2_Missense_Mutation_p.G244S|TP53_ENST00000445888.2_Missense_Mutation_p.G244S|TP53_ENST00000359597.4_Missense_Mutation_p.G244S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244C(45)|p.G244S(38)|p.0?(8)|p.G244R(6)|p.?(5)|p.G244fs*3(4)|p.G151C(4)|p.G244fs*4(3)|p.M243_G244>IC(1)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151S(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.G151R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCATGCCGCCCATGCAGGAA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	125	Substitution - Missense(95)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Deletion - In frame(3)|Complex - deletion inframe(1)|Complex - compound substitution(1)	lung(23)|upper_aerodigestive_tract(11)|large_intestine(10)|liver(10)|stomach(9)|endometrium(8)|oesophagus(8)|kidney(7)|breast(7)|biliary_tract(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|central_nervous_system(3)|skin(2)|adrenal_gland(1)|soft_tissue(1)|pancreas(1)|prostate(1)						ENSG00000141510						147.0	111.0	123.0					17																	7577551		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.730G>A	17.37:g.7577551C>T	ENSP00000269305:p.Gly244Ser	Somatic	0	51	0.00		0.5694851509381481	26	75.00	78	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	18	78.82	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G244S	ENST00000269305.4	37	c.730	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.204381	0.95033	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.995;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.946;1.0;1.0;1.0;1.0	D	0.96039	0.9023	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	.	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244S;ENSP00000352610:G244S;ENSP00000269305:G244S;ENSP00000398846:G244S;ENSP00000391127:G244S;ENSP00000391478:G244S;ENSP00000425104:G112S;ENSP00000423862:G151S	ENSP00000269305:G244S	G	-	1	0	TP53	7518276	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577551	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
DHRS2	10202	genome.wustl.edu	37	14	24113363	24113363	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr14:24113363C>A	ENST00000250383.6	+	6	1008	c.532C>A	c.(532-534)Cca>Aca	p.P178T	DHRS2_ENST00000344777.7_Missense_Mutation_p.P178T	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	178					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)	p.P178S(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		AGCTTATAATCCAGTAGTGGT	0.488																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						ENSG00000100867						260.0	217.0	232.0					14																	24113363		2203	4300	6503	DHRS2	SO:0001583	missense	0			-	HGNC		CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.532C>A	14.37:g.24113363C>A	ENSP00000250383:p.Pro178Thr	Somatic	0	55	0.00		0.5694851509381481	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	38	52.50	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.P178T	ENST00000250383.6	37	c.532	CCDS9604.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.34|14.34	2.506597|2.506597	0.44558|0.44558	.|.	.|.	ENSG00000100867|ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777;ENST00000553600|ENST00000557535	T;T;T;T|.	0.39787|.	1.06;1.06;1.06;1.06|.	5.08|5.08	2.71|2.71	0.32032|0.32032	.|.	0.112546|.	0.64402|.	D|.	0.000008|.	T|T	0.37433|0.37433	0.1003|0.1003	L|L	0.48935|0.48935	1.535|1.535	0.18873|0.18873	N|N	0.999988|0.999988	P;D;P|.	0.71674|.	0.837;0.998;0.723|.	P;D;P|.	0.73708|.	0.892;0.981;0.582|.	T|T	0.25606|0.25606	-1.0127|-1.0127	10|5	0.62326|.	D|.	0.03|.	.|.	5.1926|5.1926	0.15218|0.15218	0.0:0.6635:0.187:0.1495|0.0:0.6635:0.187:0.1495	.|.	178;178;156|.	C9JZP6;D3DS54;Q13268-2|.	.;.;.|.	T|Y	178;178;178;78|93	ENSP00000401213:P178T;ENSP00000250383:P178T;ENSP00000344674:P178T;ENSP00000451485:P78T|.	ENSP00000250383:P178T|.	P|S	+|+	1|2	0|0	DHRS2|DHRS2	23183203|23183203	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	0.597000|0.597000	0.24059|0.24059	0.429000|0.429000	0.26202|0.26202	0.655000|0.655000	0.94253|0.94253	CCA|TCC	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_ADH_insect		0.488	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHRS2	protein_coding	OTTHUMT00000071842.2	C	NM_182908	-		24113363	+1	no_errors	ENST00000344777	ensembl	human	known	74_37	missense	SNP	0.004	A
TCHHL1	126637	genome.wustl.edu	37	1	152058678	152058678	+	Missense_Mutation	SNP	C	C	T	rs573540377		TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr1:152058678C>T	ENST00000368806.1	-	3	1544	c.1480G>A	c.(1480-1482)Ggg>Agg	p.G494R		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	494							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCTCTTGCCCCCAGTGTCCTT	0.483													c|||	1	0.000199681	0.0	0.0	5008	,	,		22811	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000182898						248.0	212.0	224.0					1																	152058678		2203	4300	6503	TCHHL1	SO:0001583	missense	0			-	HGNC		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1480G>A	1.37:g.152058678C>T	ENSP00000357796:p.Gly494Arg	Somatic	0	38	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub	p.G494R	ENST00000368806.1	37	c.1480	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	6.468	0.454596	0.12283	.	.	ENSG00000182898	ENST00000368806	T	0.27402	1.67	5.42	2.33	0.28932	.	0.799532	0.10597	N	0.656103	T	0.08088	0.0202	L	0.39898	1.24	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.41124	-0.9526	10	0.18710	T	0.47	-0.6338	6.8261	0.23885	0.0:0.6691:0.0:0.3309	.	494	Q5QJ38	TCHL1_HUMAN	R	494	ENSP00000357796:G494R	ENSP00000357796:G494R	G	-	1	0	TCHHL1	150325302	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.231000	0.17872	0.176000	0.19873	-0.157000	0.13467	GGG	-	NULL		0.483	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	protein_coding	OTTHUMT00000036638.2	C	XM_060104	-		152058678	-1	no_errors	ENST00000368806	ensembl	human	known	74_37	missense	SNP	0.002	T
ADAMTSL3	57188	genome.wustl.edu	37	15	84611408	84611408	+	Silent	SNP	A	A	G			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr15:84611408A>G	ENST00000286744.5	+	18	2402	c.2178A>G	c.(2176-2178)cgA>cgG	p.R726R	ADAMTSL3_ENST00000567476.1_Silent_p.R726R	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	726	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TTCAGACCCGAGATGTGTACT	0.542																																																	0								ENSG00000156218						95.0	95.0	95.0					15																	84611408		2203	4300	6503	ADAMTSL3	SO:0001819	synonymous_variant	0			-	HGNC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2178A>G	15.37:g.84611408A>G		Somatic	0	56	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	51	16.39	A1A566|A1A567|Q9ULI7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.R726	ENST00000286744.5	37	c.2178	CCDS10326.1	15																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.542	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	A	NM_207517	-		84611408	+1	no_errors	ENST00000286744	ensembl	human	known	74_37	silent	SNP	0.103	G
RP11-355I22.2	0	genome.wustl.edu	37	14	62583949	62583949	+	lincRNA	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr14:62583949C>T	ENST00000554252.1	-	0	0				RP11-355I22.6_ENST00000553426.1_lincRNA|LINC00643_ENST00000334389.4_lincRNA																							TTGCTCCCAGCAGCCCCCGCC	0.652																																																	0								ENSG00000258403																																			RP11-355I22.6			0			-	Clone_based_vega_gene																													14.37:g.62583949C>T		Somatic	0	61	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000554252.1	37	NULL		14																																																																																			-	-		0.652	RP11-355I22.2-001	KNOWN	basic	lincRNA	ENSG00000258403	lincRNA	OTTHUMT00000411702.1	C		-		62583949	+1	no_errors	ENST00000553426	ensembl	human	known	74_37	rna	SNP	0.928	T
SLC25A25	114789	genome.wustl.edu	37	9	130863607	130863607	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr9:130863607G>C	ENST00000373064.5	+	3	569	c.306G>C	c.(304-306)gaG>gaC	p.E102D	SLC25A25_ENST00000373066.5_Missense_Mutation_p.E122D|SLC25A25_ENST00000433501.1_5'UTR|SLC25A25_ENST00000373069.5_Missense_Mutation_p.E136D|SLC25A25_ENST00000373068.2_Missense_Mutation_p.E136D|SLC25A25_ENST00000432073.2_Missense_Mutation_p.E122D	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	102	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						ACGCGCAGGAGATCATGCAGT	0.582																																																	0								ENSG00000148339						56.0	62.0	60.0					9																	130863607		2203	4300	6503	SLC25A25	SO:0001583	missense	0			-	HGNC	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.306G>C	9.37:g.130863607G>C	ENSP00000362155:p.Glu102Asp	Somatic	0	70	0.00		0.5694851509381481	15	31.82	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	47	31.88	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Graves_DC	p.E136D	ENST00000373064.5	37	c.408	CCDS6890.1	9	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978362	0.53720	.	.	ENSG00000148339	ENST00000373068;ENST00000373069;ENST00000432073;ENST00000373066;ENST00000373064	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	5.25	3.41	0.39046	EF-hand-like domain (1);	0.096994	0.64402	D	0.000001	T	0.79673	0.4486	M	0.86502	2.82	0.80722	D	1	B;B;P;B	0.36065	0.26;0.334;0.535;0.106	B;B;B;B	0.43508	0.319;0.309;0.422;0.16	T	0.79831	-0.1637	10	0.45353	T	0.12	-20.4685	10.583	0.45267	0.1562:0.0:0.8438:0.0	.	102;122;122;136	Q6KCM7;Q6KCM7-5;Q6KCM7-4;Q6KCM7-2	SCMC2_HUMAN;.;.;.	D	136;136;122;122;102	ENSP00000362159:E136D;ENSP00000362160:E136D;ENSP00000410053:E122D;ENSP00000362157:E122D;ENSP00000362155:E102D	ENSP00000362155:E102D	E	+	3	2	SLC25A25	129903428	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	1.496000	0.35638	1.212000	0.43366	0.456000	0.33151	GAG	-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.582	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	protein_coding	OTTHUMT00000054407.1	G	NM_052901	-		130863607	+1	no_errors	ENST00000373069	ensembl	human	known	74_37	missense	SNP	1.000	C
TRPM8	79054	genome.wustl.edu	37	2	234894490	234894490	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr2:234894490C>A	ENST00000324695.4	+	21	2960	c.2920C>A	c.(2920-2922)Ctg>Atg	p.L974M	TRPM8_ENST00000433712.2_Missense_Mutation_p.L552M	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	974					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GCTGGTCAACCTGCTGGTCGC	0.577																																																	0								ENSG00000144481						114.0	76.0	89.0					2																	234894490		2203	4300	6503	TRPM8	SO:0001583	missense	0			-	HGNC	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2920C>A	2.37:g.234894490C>A	ENSP00000323926:p.Leu974Met	Somatic	0	46	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.L974M	ENST00000324695.4	37	c.2920	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553098	0.65425	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	T;T;T	0.75154	-0.91;-0.91;-0.91	5.13	4.26	0.50523	Ion transport (1);	0.000000	0.47852	D	0.000209	D	0.83700	0.5311	M	0.67953	2.075	0.26567	N	0.97364	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77194	-0.2677	10	0.87932	D	0	-13.3469	12.6001	0.56492	0.0:0.919:0.0:0.081	.	552;974	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	M	974;552;235	ENSP00000323926:L974M;ENSP00000404423:L552M;ENSP00000414198:L235M	ENSP00000323926:L974M	L	+	1	2	TRPM8	234559229	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.913000	0.56394	1.177000	0.42855	-0.186000	0.12905	CTG	-	pfam_Ion_trans_dom		0.577	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	protein_coding	OTTHUMT00000131005.4	C	NM_024080	-		234894490	+1	no_errors	ENST00000324695	ensembl	human	known	74_37	missense	SNP	1.000	A
ZBTB7C	201501	genome.wustl.edu	37	18	45566623	45566623	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr18:45566623T>C	ENST00000588982.1	-	3	1357	c.856A>G	c.(856-858)Aat>Gat	p.N286D	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.N286D|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.N286D|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.N286D|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.N286D			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	286							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ATCTTCCGATTCTTGATGACC	0.607																																																	0								ENSG00000184828						36.0	41.0	39.0					18																	45566623		2201	4297	6498	ZBTB7C	SO:0001583	missense	0			-	HGNC	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.856A>G	18.37:g.45566623T>C	ENSP00000468782:p.Asn286Asp	Somatic	0	49	0.00		0.5694851509381481	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	23	35.14	O73453	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N286D	ENST00000588982.1	37	c.856	CCDS32830.1	18	.	.	.	.	.	.	.	.	.	.	T	12.62	1.992609	0.35131	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.10288	2.89;2.89	5.34	5.34	0.76211	.	0.539045	0.20546	N	0.090216	T	0.07324	0.0185	N	0.14661	0.345	0.29028	N	0.885874	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.20405	-1.0276	10	0.14252	T	0.57	.	15.2867	0.73833	0.0:0.0:0.0:1.0	.	286;286	B2RG49;A1YPR0	.;ZBT7C_HUMAN	D	286	ENSP00000439781:N286D;ENSP00000328732:N286D	ENSP00000328732:N286D	N	-	1	0	ZBTB7C	43820621	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	4.888000	0.63164	2.013000	0.59113	0.459000	0.35465	AAT	-	NULL		0.607	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB7C	protein_coding	OTTHUMT00000450731.1	T	NM_001039360	-		45566623	-1	no_errors	ENST00000332053	ensembl	human	known	74_37	missense	SNP	1.000	C
NOTCH4	4855	genome.wustl.edu	37	6	32188548	32188548	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr6:32188548G>C	ENST00000375023.3	-	5	1045	c.907C>G	c.(907-909)Cca>Gca	p.P303A		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	303	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CAGGTTTCTGGGCAGAGGCAG	0.582																																																	0								ENSG00000204301						89.0	85.0	86.0					6																	32188548		2203	4300	6503	NOTCH4	SO:0001583	missense	0			-	HGNC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.907C>G	6.37:g.32188548G>C	ENSP00000364163:p.Pro303Ala	Somatic	0	78	0.00		0.5694851509381481	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	47	47.78	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P303A	ENST00000375023.3	37	c.907	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008572	0.54361	.	.	ENSG00000204301	ENST00000375023	D	0.96073	-3.9	4.6	4.6	0.57074	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.42294	D	0.000725	D	0.95108	0.8415	L	0.37750	1.13	0.80722	D	1	D;B	0.89917	1.0;0.255	D;B	0.91635	0.999;0.31	D	0.94376	0.7600	10	0.36615	T	0.2	.	14.9378	0.70970	0.0:0.0:1.0:0.0	.	303;303	Q6P3V5;Q99466	.;NOTC4_HUMAN	A	303	ENSP00000364163:P303A	ENSP00000364163:P303A	P	-	1	0	NOTCH4	32296526	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	3.906000	0.56340	2.380000	0.81148	0.491000	0.48974	CCA	-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.582	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	G		-		32188548	-1	no_errors	ENST00000375023	ensembl	human	known	74_37	missense	SNP	1.000	C
ATP8A1	10396	genome.wustl.edu	37	4	42445682	42445682	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:42445682T>C	ENST00000381668.5	-	33	3254	c.3023A>G	c.(3022-3024)cAc>cGc	p.H1008R	AC084010.1_ENST00000582816.1_RNA|ATP8A1_ENST00000264449.10_Missense_Mutation_p.H993R	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	1008					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TATCGCTATGTGGCTGAACTG	0.433																																																	0								ENSG00000124406						93.0	83.0	86.0					4																	42445682		2203	4300	6503	ATP8A1	SO:0001583	missense	0			-	HGNC	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.3023A>G	4.37:g.42445682T>C	ENSP00000371084:p.His1008Arg	Somatic	0	106	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	108	13.60	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.H1008R	ENST00000381668.5	37	c.3023	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279958	0.80692	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.67171	-0.25;-0.25	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.82879	0.5133	M	0.92784	3.345	0.80722	D	1	P;P;P	0.50369	0.934;0.905;0.905	P;P;P	0.55455	0.776;0.739;0.739	D	0.86355	0.1713	10	0.51188	T	0.08	.	15.628	0.76878	0.0:0.0:0.0:1.0	.	993;1008;1000	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	R	1008;993	ENSP00000371084:H1008R;ENSP00000264449:H993R	ENSP00000264449:H993R	H	-	2	0	ATP8A1	42140439	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.604000	0.82830	2.103000	0.63969	0.533000	0.62120	CAC	-	tigrfam_ATPase_P-typ_Plipid-transp		0.433	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	protein_coding	OTTHUMT00000216861.2	T	NM_006095	-		42445682	-1	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	SNP	1.000	C
DEPTOR	64798	genome.wustl.edu	37	8	120886034	120886034	+	5'UTR	SNP	C	C	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr8:120886034C>T	ENST00000286234.5	+	0	78				DEPTOR_ENST00000523492.1_5'UTR|KB-1471A8.1_ENST00000500705.3_lincRNA	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein						intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						GATCCGAGCACCCAAACCCTC	0.642																																																	0								ENSG00000245330																																			KB-1471A8.1	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.-53C>T	8.37:g.120886034C>T		Somatic	0	119	0.00		0.5694851509381481	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	68	48.48	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000286234.5	37	NULL	CCDS6331.1	8																																																																																			-	-		0.642	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245330	protein_coding	OTTHUMT00000381601.1	C	NM_022783	-		120886034	-1	no_errors	ENST00000500705	ensembl	human	known	74_37	rna	SNP	0.058	T
CACNA1F	778	genome.wustl.edu	37	X	49067930	49067930	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chrX:49067930C>A	ENST00000376265.2	-	36	4206	c.4145G>T	c.(4144-4146)gGt>gTt	p.G1382V	CACNA1F_ENST00000323022.5_Missense_Mutation_p.G1371V|CACNA1F_ENST00000376251.1_Missense_Mutation_p.G1317V	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1382					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCATGCCTCACCAGTGGCACA	0.552																																																	0								ENSG00000102001						65.0	54.0	58.0					X																	49067930		2203	4300	6503	CACNA1F	SO:0001583	missense	0			-	HGNC	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4145G>T	X.37:g.49067930C>A	ENSP00000365441:p.Gly1382Val	Somatic	0	32	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G1382V	ENST00000376265.2	37	c.4145	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039105	0.75617	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.97378	-4.36;-4.36;-4.36	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98998	0.9658	H	0.96430	3.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99533	1.0961	10	0.87932	D	0	.	16.9052	0.86124	0.0:1.0:0.0:0.0	.	1371;1382	F5CIQ9;O60840	.;CAC1F_HUMAN	V	1317;1371;1382	ENSP00000365427:G1317V;ENSP00000321618:G1371V;ENSP00000365441:G1382V	ENSP00000321618:G1371V	G	-	2	0	CACNA1F	48954874	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.698000	0.84413	2.254000	0.74563	0.523000	0.50628	GGT	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.552	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	protein_coding	OTTHUMT00000358157.1	C	NM_005183	-		49067930	-1	no_errors	ENST00000376265	ensembl	human	known	74_37	missense	SNP	1.000	A
TGM5	9333	genome.wustl.edu	37	15	43552427	43552427	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr15:43552427G>T	ENST00000220420.5	-	3	266	c.259C>A	c.(259-261)Ccc>Acc	p.P87T	TGM5_ENST00000349114.4_Intron	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	87					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GCAATCCAGGGGCTGGGGCTG	0.647																																																	0								ENSG00000104055						37.0	43.0	41.0					15																	43552427		2202	4299	6501	TGM5	SO:0001583	missense	0			-	HGNC	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.259C>A	15.37:g.43552427G>T	ENSP00000220420:p.Pro87Thr	Somatic	0	40	0.00		0.5694851509381481	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.P87T	ENST00000220420.5	37	c.259	CCDS32212.1	15	.	.	.	.	.	.	.	.	.	.	G	0.413	-0.912050	0.02415	.	.	ENSG00000104055	ENST00000220420;ENST00000396996	D	0.84146	-1.81	4.69	1.74	0.24563	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.597682	0.17633	N	0.167340	T	0.68815	0.3042	N	0.19112	0.55	0.09310	N	1	B	0.18968	0.032	B	0.21151	0.033	T	0.50651	-0.8803	10	0.11485	T	0.65	-4.1352	5.6856	0.17801	0.1735:0.0:0.6692:0.1573	.	87	O43548	TGM5_HUMAN	T	87;86	ENSP00000220420:P87T	ENSP00000220420:P87T	P	-	1	0	TGM5	41339719	0.186000	0.23225	0.894000	0.35097	0.026000	0.11368	0.764000	0.26532	0.288000	0.22398	-0.150000	0.13652	CCC	-	pfam_Transglutaminase_N,superfamily_Ig_E-set		0.647	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	protein_coding	OTTHUMT00000432257.1	G	NM_004245	-		43552427	-1	no_errors	ENST00000220420	ensembl	human	known	74_37	missense	SNP	0.001	T
SH3D19	152503	genome.wustl.edu	37	4	152097706	152097706	+	5'UTR	SNP	A	A	C			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr4:152097706A>C	ENST00000409252.2	-	0	376				SH3D19_ENST00000409598.4_5'UTR|SH3D19_ENST00000455740.1_5'UTR|SH3D19_ENST00000427414.2_5'Flank|SH3D19_ENST00000304527.4_5'UTR|SH3D19_ENST00000424281.1_5'UTR|SH3D19_ENST00000514152.1_5'UTR|SH3D19_ENST00000604030.1_5'UTR			Q5HYK7	SH319_HUMAN	SH3 domain containing 19						cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				ATCGTTGTCTATTTCTTCTGA	0.368																																																	0								ENSG00000109686																																			SH3D19	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.-332T>G	4.37:g.152097706A>C		Somatic	0	46	0.00		0.5694851509381481	14	12.50	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	37	27.45	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409252.2	37	NULL	CCDS34077.2	4																																																																																			-	-		0.368	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	protein_coding	OTTHUMT00000335132.3	A	NM_001009555	-		152097706	-1	no_errors	ENST00000604030	ensembl	human	known	74_37	rna	SNP	1.000	C
C3	718	genome.wustl.edu	37	19	6684798	6684798	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A7WC-01A-12D-A351-09	TCGA-X6-A7WC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	efa39e31-447e-403d-bdc4-5109d85fbfdd	f4e49b2c-3b30-4f98-b01d-8c69a8da817a	g.chr19:6684798T>A	ENST00000245907.6	-	31	4109	c.4017A>T	c.(4015-4017)caA>caT	p.Q1339H		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1339					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ACAAGGTGCCTTGGCCTTTTC	0.542																																																	0								ENSG00000125730						212.0	176.0	188.0					19																	6684798		2203	4300	6503	C3	SO:0001583	missense	0			-	HGNC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4017A>T	19.37:g.6684798T>A	ENSP00000245907:p.Gln1339His	Somatic	0	61	0.00		0.5694851509381481	220	0.45	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	67	9.33	A7E236	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.Q1339H	ENST00000245907.6	37	c.4017	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	T	19.42	3.823840	0.71143	.	.	ENSG00000125730	ENST00000245907	T	0.33865	1.39	5.31	2.1	0.27182	.	0.484707	0.23354	N	0.049086	T	0.53498	0.1800	M	0.86028	2.79	0.28896	N	0.893585	D	0.58268	0.982	P	0.58013	0.831	T	0.52147	-0.8614	10	0.45353	T	0.12	.	8.6441	0.33994	0.0:0.2285:0.0:0.7715	.	1339	P01024	CO3_HUMAN	H	1339	ENSP00000245907:Q1339H	ENSP00000245907:Q1339H	Q	-	3	2	C3	6635798	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	1.279000	0.33191	0.100000	0.17581	0.477000	0.44152	CAA	-	NULL		0.542	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	protein_coding	OTTHUMT00000317636.2	T	NM_000064	-		6684798	-1	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	SNP	1.000	A
