#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CHD7	55636	genome.wustl.edu	37	8	61655261	61655261	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr8:61655261G>T	ENST00000423902.2	+	2	1749	c.1270G>T	c.(1270-1272)Gtt>Ttt	p.V424F	CHD7_ENST00000524602.1_Missense_Mutation_p.V424F|CHD7_ENST00000525508.1_Missense_Mutation_p.V424F	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	424	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACCAATGGAAGTTGGCAGTTA	0.552																																																	0			GRCh37	CD060584	CHD7	D		ENSG00000171316						109.0	110.0	110.0					8																	61655261		2018	4170	6188	CHD7	SO:0001583	missense	0			-	HGNC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1270G>T	8.37:g.61655261G>T	ENSP00000392028:p.Val424Phe	Somatic	0	55	0.00		0.7274002212195365	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	40	39.39	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V424F	ENST00000423902.2	37	c.1270	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815828	0.50527	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	D;T;T	0.83755	-1.76;1.38;-1.42	5.54	5.54	0.83059	.	0.000000	0.35179	N	0.003390	D	0.84028	0.5382	L	0.43152	1.355	0.51767	D	0.999933	D	0.61080	0.989	P	0.50825	0.651	T	0.83251	-0.0053	10	0.39692	T	0.17	-14.5643	19.486	0.95028	0.0:0.0:1.0:0.0	.	424	Q9P2D1	CHD7_HUMAN	F	424	ENSP00000392028:V424F;ENSP00000437061:V424F;ENSP00000436027:V424F	ENSP00000307304:V424F	V	+	1	0	CHD7	61817815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.204000	0.65180	2.628000	0.89032	0.563000	0.77884	GTT	-	NULL		0.552	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	G	XM_098762	-		61655261	+1	no_errors	ENST00000423902	ensembl	human	known	74_37	missense	SNP	1.000	T
KDM4A	9682	genome.wustl.edu	37	1	44132716	44132716	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:44132716A>G	ENST00000372396.3	+	8	1003	c.869A>G	c.(868-870)aAt>aGt	p.N290S		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	290	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						GAGTCTACCAATTTTGCTACC	0.443																																																	0								ENSG00000066135						143.0	136.0	138.0					1																	44132716		2203	4300	6503	KDM4A	SO:0001583	missense	0			-	HGNC	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.869A>G	1.37:g.44132716A>G	ENSP00000361473:p.Asn290Ser	Somatic	0	40	0.00		0.7274002212195365	6	77.78	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	4	86.21	Q5VVB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.N290S	ENST00000372396.3	37	c.869	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	A	34	5.337412	0.95758	.	.	ENSG00000066135	ENST00000372396	T	0.79033	-1.23	5.89	5.89	0.94794	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.91656	0.7363	H	0.95294	3.65	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.992	D	0.93971	0.7249	10	0.87932	D	0	-22.6074	16.3011	0.82816	1.0:0.0:0.0:0.0	.	290;290	B4DT38;O75164	.;KDM4A_HUMAN	S	290	ENSP00000361473:N290S	ENSP00000361473:N290S	N	+	2	0	KDM4A	43905303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.265000	0.95647	2.251000	0.74343	0.496000	0.49642	AAT	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom		0.443	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	protein_coding	OTTHUMT00000019960.1	A	NM_014663	-		44132716	+1	no_errors	ENST00000372396	ensembl	human	known	74_37	missense	SNP	1.000	G
SGK223	157285	genome.wustl.edu	37	8	8235488	8235488	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr8:8235488C>G	ENST00000520004.1	-	3	695	c.431G>C	c.(430-432)gGt>gCt	p.G144A	SGK223_ENST00000330777.4_Missense_Mutation_p.G144A			Q86YV5	SG223_HUMAN		144							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGTAGAGGGACCAGCAGGCTT	0.632																																					GBM(34;731 755 10259 33573 33867)												0								ENSG00000182319						66.0	70.0	69.0					8																	8235488		2003	4177	6180	SGK223	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000520004.1:c.431G>C	8.37:g.8235488C>G	ENSP00000428054:p.Gly144Ala	Somatic	0	60	0.00		0.7274002212195365	5	28.57	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	65	41.44	Q8N3N5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.G144A	ENST00000520004.1	37	c.431	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	C	0.796	-0.757095	0.03019	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.58060	0.36;0.36	5.01	3.12	0.35913	.	0.663946	0.12442	N	0.468629	T	0.40297	0.1111	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.22487	-1.0215	10	0.25751	T	0.34	.	11.9911	0.53176	0.0:0.6637:0.3363:0.0	.	144	Q86YV5	SG223_HUMAN	A	144	ENSP00000330930:G144A;ENSP00000428054:G144A	ENSP00000330930:G144A	G	-	2	0	AC068353.1	8272898	0.005000	0.15991	0.004000	0.12327	0.028000	0.11728	0.940000	0.28992	0.700000	0.31782	0.655000	0.94253	GGT	-	NULL		0.632	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	protein_coding	OTTHUMT00000374864.1	C		-		8235488	-1	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	SNP	0.007	G
LPCAT1	79888	genome.wustl.edu	37	5	1463892	1463892	+	Silent	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr5:1463892C>T	ENST00000283415.3	-	14	1611	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	493					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GTGTCTGATCCGGGTACAGGT	0.542																																																	0								ENSG00000153395						123.0	120.0	121.0					5																	1463892		2203	4300	6503	LPCAT1	SO:0001819	synonymous_variant	0			-	HGNC	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1479G>A	5.37:g.1463892C>T		Somatic	0	67	0.00		0.7274002212195365	166	20.57	43	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	78	15.22	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom	p.P493	ENST00000283415.3	37	c.1479	CCDS3864.1	5																																																																																			-	NULL		0.542	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	protein_coding	OTTHUMT00000304032.1	C	NM_024830	-		1463892	-1	no_errors	ENST00000283415	ensembl	human	known	74_37	silent	SNP	0.004	T
RB1	5925	genome.wustl.edu	37	13	48955538	48955538	+	Nonsense_Mutation	SNP	C	C	T	rs121913303		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr13:48955538C>T	ENST00000267163.4	+	17	1792	c.1654C>T	c.(1654-1656)Cga>Tga	p.R552*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	552	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R552*(5)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACATTTAGAACGATGTGAACA	0.323	R552*(NCIH1048_LUNG)	6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(5)	bone(11)|breast(5)|eye(4)|central_nervous_system(3)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	GRCh37	CM961229	RB1	M	rs121913303	ENSG00000139687						85.0	79.0	81.0					13																	48955538		2203	4300	6503	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1654C>T	13.37:g.48955538C>T	ENSP00000267163:p.Arg552*	Somatic	0	48	0.00		0.7274002212195365	8	55.56	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	11	70.27	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R552*	ENST00000267163.4	37	c.1654	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	7.055045	0.98032	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.34	1.21	0.21127	.	0.199610	0.42548	D	0.000698	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4955	0.38986	0.5195:0.4131:0.0:0.0674	.	.	.	.	X	531;552	.	ENSP00000267163:R552X	R	+	1	2	RB1	47853539	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	1.565000	0.36386	-0.113000	0.11958	0.650000	0.86243	CGA	-	pfam_RB_A,superfamily_Cyclin-like		0.323	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		rs121913303		48955538	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LRRK1	79705	genome.wustl.edu	37	15	101609095	101609095	+	3'UTR	SNP	G	G	A	rs376262723		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr15:101609095G>A	ENST00000388948.3	+	0	6449				LRRK1_ENST00000532145.1_3'UTR|LRRK1_ENST00000284395.5_3'UTR|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGGCTGGCCCGGGGCTGCAGC	0.577																																																	0								ENSG00000154237	C		1,3917		0,1,1958	19.0	22.0	21.0			-2.4	0.0	15		21	1,8275		0,1,4137	no	utr-3	LRRK1	NM_024652.3		0,2,6095	AA,AG,GG		0.0121,0.0255,0.0164			101609095	2,12192	1959	4138	6097	LRRK1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.*42G>A	15.37:g.101609095G>A		Somatic	0	43	0.00		0.7274002212195365	15	23.81	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	34	43.55		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000388948.3	37	NULL	CCDS42086.1	15																																																																																			-	-		0.577	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	protein_coding	OTTHUMT00000384567.2	G	NM_024652	-		101609095	+1	no_errors	ENST00000532145	ensembl	human	known	74_37	rna	SNP	0.000	A
OR9G4	283189	genome.wustl.edu	37	11	56510853	56510853	+	Silent	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr11:56510853C>T	ENST00000302957.3	-	1	434	c.435G>A	c.(433-435)ttG>ttA	p.L145L		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						CTGAATAAAGCAATGGGTTAC	0.488																																																	0								ENSG00000172457						114.0	118.0	117.0					11																	56510853		2201	4296	6497	OR9G4	SO:0001819	synonymous_variant	0			-	HGNC	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.435G>A	11.37:g.56510853C>T		Somatic	0	52	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	42	34.85	Q6IF62|Q96RA9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L145	ENST00000302957.3	37	c.435	CCDS31537.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.488	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G4	protein_coding	OTTHUMT00000391945.1	C	NM_001005284	-		56510853	-1	no_errors	ENST00000302957	ensembl	human	known	74_37	silent	SNP	0.000	T
NDFIP1	80762	genome.wustl.edu	37	5	141511526	141511526	+	Intron	DEL	A	A	-	rs556414620		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr5:141511526delA	ENST00000253814.4	+	2	621				NDFIP1_ENST00000509436.1_3'UTR	NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTACAGTTTAAAAAAAAAAA	0.393																																																	0								ENSG00000131507																																			NDFIP1	SO:0001627	intron_variant	0				HGNC	BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.151+66A>-	5.37:g.141511526delA		Somatic	0	13	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253814.4	37	NULL	CCDS4273.1	5																																																																																			-	-		0.393	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP1	protein_coding	OTTHUMT00000251859.2	A	NM_030571			141511526	+1	no_errors	ENST00000509436	ensembl	human	known	74_37	rna	DEL	0.000	-
COL11A2	1302	genome.wustl.edu	37	6	33133463	33133463	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr6:33133463C>T	ENST00000374708.4	-	61	4613	c.4355G>A	c.(4354-4356)gGg>gAg	p.G1452E	COL11A2_ENST00000395197.1_Missense_Mutation_p.G1478E|COL11A2_ENST00000374712.1_Missense_Mutation_p.G1457E|COL11A2_ENST00000374713.1_Missense_Mutation_p.G1491E|COL11A2_ENST00000341947.2_Missense_Mutation_p.G1538E|COL11A2_ENST00000357486.1_Missense_Mutation_p.G1517E|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000361917.1_Missense_Mutation_p.G1431E|COL11A2_ENST00000374714.1_Missense_Mutation_p.G1512E	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1538	Collagen-like 8.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CTCCAGCCCCCCAGGACTGCC	0.652																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						52.0	54.0	53.0					6																	33133463		2203	4300	6503	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.4355G>A	6.37:g.33133463C>T	ENSP00000363840:p.Gly1452Glu	Somatic	0	33	0.00		0.7274002212195365	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1538E	ENST00000374708.4	37	c.4613	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	C	8.846	0.943315	0.18281	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000395196	D;D;D;D;D;D;D;D	0.88277	-2.3;-2.2;-2.26;-2.28;-2.25;-2.25;-2.36;-2.27	4.4	1.51	0.23008	.	0.268004	0.35805	N	0.002964	T	0.42131	0.1189	N	0.03050	-0.425	0.27378	N	0.955499	B;B;B;B	0.20780	0.048;0.0;0.0;0.0	B;B;B;B	0.20184	0.028;0.001;0.001;0.0	T	0.52094	-0.8621	10	0.02654	T	1	.	4.8192	0.13381	0.0:0.4456:0.3548:0.1995	.	134;1431;1452;1538	A2ABA7;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	E	1452;1538;1517;1512;1491;1478;1457;1431;108	ENSP00000363840:G1452E;ENSP00000339915:G1538E;ENSP00000350079:G1517E;ENSP00000363846:G1512E;ENSP00000363845:G1491E;ENSP00000378623:G1478E;ENSP00000363844:G1457E;ENSP00000355123:G1431E	ENSP00000339915:G1538E	G	-	2	0	COL11A2	33241441	0.874000	0.30092	0.993000	0.49108	0.818000	0.46254	2.611000	0.46334	0.106000	0.17784	-0.269000	0.10298	GGG	-	NULL		0.652	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	C		-		33133463	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	1.000	T
ZFC3H1	196441	genome.wustl.edu	37	12	72051082	72051082	+	Splice_Site	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:72051082C>T	ENST00000378743.3	-	2	957		c.e2-1		ZFC3H1_ENST00000552037.1_Splice_Site|ZFC3H1_ENST00000548100.1_Splice_Site|ZFC3H1_ENST00000549407.1_Splice_Site	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing						RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AAACTTTTGGCTGAACAGCAT	0.264																																																	0								ENSG00000133858						29.0	26.0	27.0					12																	72051082		1783	4059	5842	ZFC3H1	SO:0001630	splice_region_variant	0			-	HGNC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.599-1G>A	12.37:g.72051082C>T		Somatic	0	27	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000378743.3	37	c.599-1	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	C	19.57	3.853149	0.71719	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0204	0.97499	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZFC3H1	70337349	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.770000	0.68873	2.729000	0.93468	0.650000	0.86243	.	-	-		0.264	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	protein_coding	OTTHUMT00000404751.1	C	NM_144982	-	Intron	72051082	-1	no_errors	ENST00000378743	ensembl	human	known	74_37	splice_site	SNP	1.000	T
CCDC180	100499483	genome.wustl.edu	37	9	100092984	100092984	+	Missense_Mutation	SNP	A	A	G	rs201085376		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr9:100092984A>G	ENST00000357054.1	+	32	3693	c.2758A>G	c.(2758-2760)Aag>Gag	p.K920E	CCDC180_ENST00000375202.2_Missense_Mutation_p.K781E|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.K778E|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.K781E			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	920	Glu-rich.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ggaggaggagaagctggagga	0.498																																																	0								ENSG00000197816						64.0	76.0	72.0					9																	100092984		2203	4300	6503	CCDC180	SO:0001583	missense	0			-	HGNC	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2758A>G	9.37:g.100092984A>G	ENSP00000349562:p.Lys920Glu	Somatic	0	27	0.00		0.7274002212195365	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K781E	ENST00000357054.1	37	c.2341		9	.	.	.	.	.	.	.	.	.	.	A	1.674	-0.508279	0.04231	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.08008	3.46;3.14;3.46;3.14	1.9	0.972	0.19704	.	1.506390	0.04483	N	0.378176	T	0.04227	0.0117	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.37220	-0.9715	10	0.06757	T	0.87	2.8577	4.1072	0.10041	0.2217:0.0:0.7783:0.0	.	804;778;920;781;920	Q86Y65;F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;.;CI174_HUMAN	E	920;781;778;804;781	ENSP00000349562:K920E;ENSP00000364348:K781E;ENSP00000414000:K778E;ENSP00000434727:K781E	ENSP00000349562:K920E	K	+	1	0	C9orf174	99132805	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.421000	0.07053	0.367000	0.24454	-0.394000	0.06481	AAG	-	NULL		0.498	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	protein_coding		A	NM_020893	rs201085376		100092984	+1	no_errors	ENST00000375202	ensembl	human	known	74_37	missense	SNP	0.004	G
GNPTAB	79158	genome.wustl.edu	37	12	102161768	102161768	+	Intron	SNP	A	A	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:102161768A>C	ENST00000299314.7	-	11	1671				GNPTAB_ENST00000549940.1_Missense_Mutation_p.F485L|RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits						carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GATTAAGAAGAAAATATTCCA	0.353																																																	0								ENSG00000111670						53.0	51.0	52.0					12																	102161768		2203	4300	6503	GNPTAB	SO:0001627	intron_variant	0			-	HGNC	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1408+46T>G	12.37:g.102161768A>C		Somatic	0	43	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	34	49.25	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_Notch_dom	p.F485L	ENST00000299314.7	37	c.1455	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	A	6.204	0.405745	0.11754	.	.	ENSG00000111670	ENST00000549940	D	0.96774	-4.12	5.1	-3.62	0.04543	.	.	.	.	.	D	0.88665	0.6498	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.77635	-0.2514	8	0.24483	T	0.36	.	2.0897	0.03654	0.5038:0.112:0.1566:0.2276	.	485	Q3T906-2	.	L	485	ENSP00000449150:F485L	ENSP00000449150:F485L	F	-	3	2	GNPTAB	100685899	0.006000	0.16342	0.000000	0.03702	0.002000	0.02628	0.942000	0.29017	-0.320000	0.08640	-0.417000	0.06048	TTT	-	NULL		0.353	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	A		-		102161768	-1	no_errors	ENST00000549940	ensembl	human	known	74_37	missense	SNP	0.000	C
GIF	2694	genome.wustl.edu	37	11	59603420	59603420	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr11:59603420T>C	ENST00000257248.2	-	7	981	c.934A>G	c.(934-936)Atc>Gtc	p.I312V	GIF_ENST00000541311.1_Missense_Mutation_p.I287V	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	312					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	ATGACAGTGATGTTAGATGCA	0.473																																					NSCLC(53;1139 1245 16872 38474 42853)												0								ENSG00000134812						172.0	169.0	170.0					11																	59603420		2201	4295	6496	GIF	SO:0001583	missense	0			-	HGNC	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.934A>G	11.37:g.59603420T>C	ENSP00000257248:p.Ile312Val	Somatic	0	39	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	56	38.46	B2RAN8|B4DVZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cbl-bd_transpt_euk	p.I312V	ENST00000257248.2	37	c.934	CCDS7977.1	11	.	.	.	.	.	.	.	.	.	.	T	16.69	3.191869	0.58017	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.34472	1.36;1.36	4.89	4.89	0.63831	.	0.081519	0.50627	D	0.000102	T	0.46268	0.1384	M	0.78049	2.395	0.31015	N	0.71881	P	0.37158	0.585	P	0.45428	0.48	T	0.53265	-0.8463	10	0.29301	T	0.29	-35.1694	10.8166	0.46580	0.0:0.0:0.0:1.0	.	312	P27352	IF_HUMAN	V	312;287	ENSP00000257248:I312V;ENSP00000440427:I287V	ENSP00000257248:I312V	I	-	1	0	GIF	59359996	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	2.176000	0.42500	2.048000	0.60808	0.533000	0.62120	ATC	-	pfam_Cbl-bd_transpt_euk		0.473	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIF	protein_coding	OTTHUMT00000394497.1	T	NM_005142	-		59603420	-1	no_errors	ENST00000257248	ensembl	human	known	74_37	missense	SNP	0.997	C
NPC1L1	29881	genome.wustl.edu	37	7	44578866	44578866	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr7:44578866G>A	ENST00000289547.4	-	2	1185	c.1130C>T	c.(1129-1131)aCg>aTg	p.T377M	NPC1L1_ENST00000546276.1_Missense_Mutation_p.T377M|NPC1L1_ENST00000423141.1_Missense_Mutation_p.T377M|NPC1L1_ENST00000381160.3_Missense_Mutation_p.T377M	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	377					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CACGGGGTCCGTAGTGAGTTC	0.612																																																	0								ENSG00000015520						72.0	81.0	78.0					7																	44578866		2203	4300	6503	NPC1L1	SO:0001583	missense	0			-	HGNC		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1130C>T	7.37:g.44578866G>A	ENSP00000289547:p.Thr377Met	Somatic	0	43	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.T377M	ENST00000289547.4	37	c.1130	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	g	13.80	2.344049	0.41498	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33	5.05	4.17	0.49024	.	0.054204	0.64402	N	0.000001	D	0.94013	0.8082	M	0.77406	2.37	0.48632	D	0.999689	P;P;P;D	0.56035	0.921;0.908;0.939;0.974	P;B;P;B	0.49683	0.502;0.438;0.619;0.199	D	0.93660	0.6981	10	0.72032	D	0.01	-12.9165	11.2932	0.49263	0.0902:0.0:0.9098:0.0	.	377;377;377;377	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	M	377	ENSP00000289547:T377M;ENSP00000370552:T377M;ENSP00000438033:T377M;ENSP00000404670:T377M	ENSP00000289547:T377M	T	-	2	0	NPC1L1	44545391	1.000000	0.71417	0.819000	0.32651	0.180000	0.23129	7.455000	0.80726	1.129000	0.42072	0.462000	0.41574	ACG	-	NULL		0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	protein_coding	OTTHUMT00000251256.1	G	NM_013389	-		44578866	-1	no_errors	ENST00000289547	ensembl	human	known	74_37	missense	SNP	0.997	A
NMRK2	27231	genome.wustl.edu	37	19	3939924	3939924	+	Missense_Mutation	SNP	G	G	A	rs140113877	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:3939924G>A	ENST00000168977.2	+	6	640	c.350G>A	c.(349-351)cGg>cAg	p.R117Q	NMRK2_ENST00000599576.1_Intron|NMRK2_ENST00000593949.1_Missense_Mutation_p.R122Q	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	117					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										TACAGCCGCCGGTACTTCCTG	0.602																																																	0								ENSG00000077009	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	66.0	54.0	58.0		350	3.7	0.9	19	dbSNP_134	58	3,8595	3.0+/-9.4	0,3,4296	no	missense	ITGB1BP3	NM_170678.2	43	0,4,6498	AA,AG,GG		0.0349,0.0227,0.0308	probably-damaging	117/231	3939924	4,13000	2203	4299	6502	NMRK2	SO:0001583	missense	0			-	HGNC	AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.350G>A	19.37:g.3939924G>A	ENSP00000168977:p.Arg117Gln	Somatic	0	76	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	76	22.45	B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.R117Q	ENST00000168977.2	37	c.350	CCDS12115.1	19	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249914	0.59212	2.27E-4	3.49E-4	ENSG00000077009	ENST00000168977	T	0.42513	0.97	3.74	3.74	0.42951	.	0.202519	0.41500	D	0.000875	T	0.44052	0.1275	M	0.71871	2.18	0.21105	N	0.99979	P;P	0.46656	0.882;0.636	B;B	0.43386	0.418;0.182	T	0.45644	-0.9247	10	0.54805	T	0.06	-31.6968	10.8954	0.47019	0.0:0.0:1.0:0.0	.	122;117	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	Q	117	ENSP00000168977:R117Q	ENSP00000168977:R117Q	R	+	2	0	ITGB1BP3	3890924	0.809000	0.29036	0.950000	0.38849	0.966000	0.64601	4.728000	0.62000	1.916000	0.55485	0.491000	0.48974	CGG	-	superfamily_P-loop_NTPase		0.602	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NMRK2	protein_coding	OTTHUMT00000457492.1	G	NM_014446, NM_170678	rs140113877		3939924	+1	no_errors	ENST00000168977	ensembl	human	known	74_37	missense	SNP	0.594	A
CHRNA5	1138	genome.wustl.edu	37	15	78873234	78873234	+	Missense_Mutation	SNP	G	G	A	rs202057419		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr15:78873234G>A	ENST00000299565.5	+	2	388	c.188G>A	c.(187-189)cGt>cAt	p.R63H	CHRNA5_ENST00000559554.1_Missense_Mutation_p.R63H	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	63					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	AGATGGGTTCGTCCTGTGGAA	0.328																																																	0								ENSG00000169684						92.0	94.0	93.0					15																	78873234		2196	4293	6489	CHRNA5	SO:0001583	missense	0			-	HGNC		CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.188G>A	15.37:g.78873234G>A	ENSP00000299565:p.Arg63His	Somatic	0	100	0.00		0.7274002212195365	10	54.55	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	82	43.06	Q15824|Q99554	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R63H	ENST00000299565.5	37	c.188	CCDS10304.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.202410	0.94997	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	D	0.83250	-1.7	5.52	5.52	0.82312	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94228	0.8147	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95534	0.8606	10	0.87932	D	0	.	19.4388	0.94809	0.0:0.0:1.0:0.0	.	63	P30532	ACHA5_HUMAN	H	63;14	ENSP00000299565:R63H	ENSP00000299565:R63H	R	+	2	0	CHRNA5	76660289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.848000	0.99507	2.590000	0.87494	0.655000	0.94253	CGT	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.328	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA5	protein_coding	OTTHUMT00000290106.1	G		rs202057419		78873234	+1	no_errors	ENST00000299565	ensembl	human	known	74_37	missense	SNP	1.000	A
SH2D6	284948	genome.wustl.edu	37	2	85661741	85661741	+	5'Flank	DEL	A	A	-	rs536360058	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:85661741delA	ENST00000340326.2	+	0	0				SH2D6_ENST00000481426.2_Intron|SH2D6_ENST00000389938.2_Intron|Y_RNA_ENST00000384478.1_RNA	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6											central_nervous_system(1)|lung(2)	3						gactagacttAAAAAAAAAAA	0.478													|||unknown(HR)	686	0.136981	0.1354	0.0951	5008	,	,		15231	0.1706		0.1491	False		,,,				2504	0.1217																0								ENSG00000207207																																			Y_RNA	SO:0001631	upstream_gene_variant	0				RFAM	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176		2.37:g.85661741delA	Exception_encountered	Somatic	0	14	0.00		0.7274002212195365	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A6ND14|Q6R306	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340326.2	37	NULL	CCDS1976.1	2																																																																																			-	-		0.478	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000207207	protein_coding	OTTHUMT00000252493.2	A	NM_198482			85661741	+1	no_errors	ENST00000384478	ensembl	human	novel	74_37	rna	DEL	0.006	-
SLC25A44	9673	genome.wustl.edu	37	1	156180847	156180848	+	3'UTR	INS	-	-	TG	rs58631766|rs56120841		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:156180847_156180848insTG	ENST00000359511.4	+	0	1742_1743				PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000565805.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TACTTTTGTTTtgtgtgtgtgt	0.47																																																	0								ENSG00000160785																																			SLC25A44	SO:0001624	3_prime_UTR_variant	0				HGNC	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.*626->TG	1.37:g.156180856_156180857dupTG		Somatic	0	14	0.00		0.7274002212195365	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	O75034	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			-	-		0.470	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	protein_coding	OTTHUMT00000040856.1	-	NM_014655			156180848	+1	no_errors	ENST00000469537	ensembl	human	known	74_37	rna	INS	0.081:0.000	TG
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619768_201619769delTG		Somatic	0	11	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.406					AOX2P			TG				201619759	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
MYPOP	339344	genome.wustl.edu	37	19	46393942	46393942	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:46393942delG	ENST00000322217.5	-	3	1225	c.1139delC	c.(1138-1140)ccafs	p.P380fs		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	380	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						CCGCTTGTGTGGGGGGGAGTC	0.647																																																	0								ENSG00000176182						16.0	18.0	18.0					19																	46393942		2080	4203	6283	MYPOP	SO:0001589	frameshift_variant	0				HGNC	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1139delC	19.37:g.46393942delG	ENSP00000325402:p.Pro380fs	Somatic	0	15	0.00		0.7274002212195365	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.P380fs	ENST00000322217.5	37	c.1139	CCDS33055.1	19																																																																																			-	NULL		0.647	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYPOP	protein_coding	OTTHUMT00000461684.1	G	NM_001012643			46393942	-1	no_errors	ENST00000322217	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
POLN	353497	genome.wustl.edu	37	4	2074696	2074696	+	Splice_Site	SNP	T	T	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr4:2074696T>G	ENST00000511885.2	-	25	2869	c.2516A>C	c.(2515-2517)cAg>cCg	p.Q839P	POLN_ENST00000382865.1_Splice_Site_p.Q839P			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	839					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			TCCCCTCACCTGAAGCTGCAG	0.632								DNA polymerases (catalytic subunits)																																									0								ENSG00000130997						87.0	77.0	81.0					4																	2074696		2203	4300	6503	POLN	SO:0001630	splice_region_variant	0			-	HGNC	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.2517+1A>C	4.37:g.2074696T>G		Somatic	0	58	0.00		0.7274002212195365	1	80.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	55	45.00	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA_polymerase_A	p.Q839P	ENST00000511885.2	37	c.2516	CCDS3360.1	4	.	.	.	.	.	.	.	.	.	.	T	18.14	3.556691	0.65425	.	.	ENSG00000130997	ENST00000511885;ENST00000382865	T;T	0.21031	2.03;2.03	4.09	4.09	0.47781	DNA-directed DNA polymerase, family A, palm domain (1);	0.433964	0.20945	N	0.082844	T	0.18841	0.0452	N	0.20401	0.57	0.38611	D	0.950891	P	0.50369	0.934	P	0.50896	0.653	T	0.04268	-1.0964	10	0.31617	T	0.26	-11.375	9.6347	0.39800	0.0:0.0:0.0:1.0	.	839	Q7Z5Q5	DPOLN_HUMAN	P	839	ENSP00000435506:Q839P;ENSP00000372316:Q839P	ENSP00000372316:Q839P	Q	-	2	0	POLN	2044494	0.998000	0.40836	1.000000	0.80357	0.614000	0.37383	2.176000	0.42500	1.851000	0.53745	0.459000	0.35465	CAG	-	pfam_DNA-dir_DNA_pol_A_palm_dom		0.632	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLN	protein_coding	OTTHUMT00000205684.2	T	NM_181808	-	Missense_Mutation	2074696	-1	no_errors	ENST00000382865	ensembl	human	known	74_37	missense	SNP	1.000	G
DMKN	93099	genome.wustl.edu	37	19	36002412	36002412	+	Silent	SNP	G	G	A	rs56743379|rs111543270		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:36002412G>A	ENST00000339686.3	-	5	995	c.819C>T	c.(817-819)agC>agT	p.S273S	DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000440396.1_Silent_p.S273S|DMKN_ENST00000424570.2_Silent_p.S273S|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000418261.1_Silent_p.S273S|DMKN_ENST00000451297.2_Silent_p.S273S|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000447113.2_Silent_p.S273S|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000429837.1_Intron	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	273	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			tgctgccactgctgctgccac	0.657																																																	1	Deletion - In frame(1)	ovary(1)						ENSG00000161249						29.0	22.0	24.0					19																	36002412		2184	4248	6432	DMKN	SO:0001819	synonymous_variant	0			-	HGNC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819C>T	19.37:g.36002412G>A		Somatic	0	49	0.00		0.7274002212195365	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	53	14.52	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S273	ENST00000339686.3	37	c.819	CCDS12463.1	19																																																																																			-	NULL		0.657	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	protein_coding	OTTHUMT00000109461.2	G	NM_033317	rs140763085		36002412	-1	no_errors	ENST00000339686	ensembl	human	known	74_37	silent	SNP	0.000	A
TAF1B	9014	genome.wustl.edu	37	2	9989571	9989571	+	Frame_Shift_Del	DEL	A	A	-	rs528368939		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:9989571delA	ENST00000263663.5	+	3	375	c.187delA	c.(187-189)aaafs	p.K65fs	TAF1B_ENST00000396242.3_5'UTR|TAF1B_ENST00000402170.1_3'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	65	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGGGGGCTTAAAAAAAAAAA	0.333																																																	0								ENSG00000115750			139,495,3606		1,2,135,2,489,1491	20.0	22.0	21.0			1.7	0.9	2		23	207,946,7081		0,0,207,0,946,2964	no	codingComplex	TAF1B	NM_005680.2		1,2,342,2,1435,4455	A1A1,A1A2,A1R,A2A2,A2R,RR		14.0029,14.9528,14.3258			9989571	346,1441,10687	2194	4292	6486	TAF1B	SO:0001589	frameshift_variant	0				HGNC	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.187delA	2.37:g.9989571delA	ENSP00000263663:p.Lys65fs	Somatic	0	13	0.00		0.7274002212195365	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_Rrn7	p.N66fs	ENST00000263663.5	37	c.187	CCDS33143.1	2																																																																																			-	NULL		0.333	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	protein_coding	OTTHUMT00000323426.2	A	NM_005680			9989571	+1	no_errors	ENST00000263663	ensembl	human	known	74_37	frame_shift_del	DEL	0.991	-
GPR115	221393	genome.wustl.edu	37	6	47681828	47681828	+	Silent	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr6:47681828C>T	ENST00000283303.2	+	6	1105	c.847C>T	c.(847-849)Ctg>Ttg	p.L283L	GPR115_ENST00000327753.3_Silent_p.L283L|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Silent_p.L340L	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	283					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						GCTAAGGAAGCTGTGGCCAAA	0.463																																					GBM(22;431 510 9010 26644 32828)												0								ENSG00000153294						55.0	57.0	56.0					6																	47681828		2203	4300	6503	GPR115	SO:0001819	synonymous_variant	0			-	HGNC	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.847C>T	6.37:g.47681828C>T		Somatic	0	43	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.00	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.L340	ENST00000283303.2	37	c.1018	CCDS4922.2	6																																																																																			-	NULL		0.463	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR115	protein_coding	OTTHUMT00000040819.2	C	NM_153838	-		47681828	+1	no_errors	ENST00000371220	ensembl	human	known	74_37	silent	SNP	0.803	T
ATP13A4	84239	genome.wustl.edu	37	3	193174850	193174850	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr3:193174850G>T	ENST00000342695.4	-	16	2176	c.1854C>A	c.(1852-1854)gaC>gaA	p.D618E	ATP13A4_ENST00000392443.3_Missense_Mutation_p.D599E	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	618						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		ATGCCAGTCGGTCACCTCCCA	0.498																																																	0								ENSG00000127249						111.0	95.0	100.0					3																	193174850		2203	4300	6503	ATP13A4	SO:0001583	missense	0			-	HGNC	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1854C>A	3.37:g.193174850G>T	ENSP00000339182:p.Asp618Glu	Somatic	0	36	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	30	37.50	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.D618E	ENST00000342695.4	37	c.1854	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	G	8.107	0.777997	0.16120	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	T;T	0.69435	-0.4;-0.4	5.86	3.08	0.35506	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.224666	0.38381	N	0.001713	T	0.43122	0.1233	N	0.13327	0.33	0.21220	N	0.999757	B;B;B	0.12630	0.006;0.001;0.003	B;B;B	0.18263	0.021;0.012;0.021	T	0.16571	-1.0398	10	0.17369	T	0.5	-6.2904	7.4569	0.27272	0.1902:0.0:0.6849:0.1249	.	599;618;618	B7WPN9;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	E	599;618	ENSP00000376238:D599E;ENSP00000339182:D618E	ENSP00000339182:D618E	D	-	3	2	ATP13A4	194657544	0.000000	0.05858	0.998000	0.56505	0.810000	0.45777	-0.626000	0.05527	1.491000	0.48482	-0.140000	0.14226	GAC	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase		0.498	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	protein_coding	OTTHUMT00000157244.4	G	NM_032279	-		193174850	-1	no_errors	ENST00000342695	ensembl	human	known	74_37	missense	SNP	0.031	T
DIAPH2	1730	genome.wustl.edu	37	X	96354765	96354765	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chrX:96354765C>A	ENST00000324765.8	+	20	2667	c.2320C>A	c.(2320-2322)Ctc>Atc	p.L774I	DIAPH2_ENST00000373061.3_Missense_Mutation_p.L774I|DIAPH2_ENST00000373054.4_Missense_Mutation_p.L770I|DIAPH2_ENST00000355827.4_Missense_Mutation_p.L774I|DIAPH2_ENST00000373049.4_Missense_Mutation_p.L774I			O60879	DIAP2_HUMAN	diaphanous-related formin 2	774	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						ATATGATGACCTCTGTGAGCC	0.383																																																	0								ENSG00000147202						112.0	91.0	98.0					X																	96354765		2203	4300	6503	DIAPH2	SO:0001583	missense	0			-	HGNC	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2320C>A	X.37:g.96354765C>A	ENSP00000321348:p.Leu774Ile	Somatic	0	42	0.00		0.7274002212195365	3	90.00	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	11	67.65	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.L774I	ENST00000324765.8	37	c.2320	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568845	0.65765	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	5.21	5.21	0.72293	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000011	T	0.61899	0.2384	M	0.85630	2.765	0.42326	D	0.992271	D;D	0.59357	0.985;0.981	D;D	0.83275	0.996;0.993	T	0.67937	-0.5541	10	0.87932	D	0	.	10.2252	0.43220	0.0:0.9043:0.0:0.0957	.	774;774	O60879;O60879-2	DIAP2_HUMAN;.	I	774;770;774;774;774;781	ENSP00000362152:L774I;ENSP00000362145:L770I;ENSP00000348082:L774I;ENSP00000362140:L774I;ENSP00000321348:L774I	ENSP00000321348:L774I	L	+	1	0	DIAPH2	96241421	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.449000	0.44935	2.141000	0.66446	0.600000	0.82982	CTC	-	pfam_FH2_Formin,smart_FH2_Formin		0.383	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	C	NM_006729, NM_007309	-		96354765	+1	no_errors	ENST00000324765	ensembl	human	known	74_37	missense	SNP	1.000	A
YBEY	54059	genome.wustl.edu	37	21	47707039	47707040	+	Splice_Site	INS	-	-	AAAAA	rs71318058|rs202070025|rs530846715|rs58271568		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr21:47707039_47707040insAAAAA	ENST00000329319.3	+	2	608		c.e2+2		YBEY_ENST00000339195.6_Splice_Site|MCM3AP_ENST00000291688.1_5'Flank|YBEY_ENST00000397691.1_Splice_Site|YBEY_ENST00000397694.1_Intron|YBEY_ENST00000397701.4_Splice_Site|MCM3AP_ENST00000397708.1_5'Flank|YBEY_ENST00000397692.1_Intron	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)						rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.?(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						TTTCATGAGGTAAAAAAAAAAT	0.351																																																	1	Unknown(1)	lung(1)						ENSG00000182362		,	296,477,306,3167		23,37,41,172,36,26,342,11,217,1218					,	4.7	1.0		dbSNP_130	39	1148,1338,762,4946		152,182,160,502,133,122,768,49,382,1647	no	intron,intron	YBEY	NM_058181.1,NM_001006114.1	,	175,219,201,674,169,148,1110,60,599,2865	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		39.6388,25.4122,34.783	,	,		1444,1815,1068,8113				YBEY	SO:0001630	splice_region_variant	0				HGNC	AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.210+2->AAAAA	21.37:g.47707045_47707049dupAAAAA		Somatic	NA	NA	NA		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7WPA9|B7WPF7|D3DSN2	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e1+2	ENST00000329319.3	37	c.210+2_210+1	CCDS33591.1	21																																																																																			-	-		0.351	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBEY	protein_coding	OTTHUMT00000207265.1	-	NM_058181		Intron	47707040	+1	no_errors	ENST00000329319	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.124	AAAAA
GRIA4	2893	genome.wustl.edu	37	11	105483056	105483056	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr11:105483056A>G	ENST00000530497.1	+	2	142	c.142A>G	c.(142-144)Att>Gtt	p.I48V	GRIA4_ENST00000527669.1_Missense_Mutation_p.I48V|GRIA4_ENST00000428631.2_Missense_Mutation_p.I48V|GRIA4_ENST00000393127.2_Missense_Mutation_p.I48V|GRIA4_ENST00000525187.1_Missense_Mutation_p.I48V|GRIA4_ENST00000282499.5_Missense_Mutation_p.I48V|GRIA4_ENST00000393125.2_Missense_Mutation_p.I48V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	48					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TCGATTAGCAATTTTTCTTCA	0.408																																																	0								ENSG00000152578						147.0	126.0	133.0					11																	105483056		2202	4299	6501	GRIA4	SO:0001583	missense	0			-	HGNC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.142A>G	11.37:g.105483056A>G	ENSP00000435775:p.Ile48Val	Somatic	0	71	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	59	41.18	Q86XE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I48V	ENST00000530497.1	37	c.142	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	A	9.434	1.086385	0.20390	.	.	ENSG00000152578	ENST00000527177;ENST00000393125;ENST00000531986;ENST00000282499;ENST00000393127;ENST00000527669;ENST00000525921;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.91	5.91	0.95273	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000002	T	0.68787	0.3039	N	0.01109	-1.01	0.80722	D	1	B;B;B;B;P	0.38863	0.003;0.002;0.012;0.015;0.65	B;B;B;B;P	0.51079	0.035;0.012;0.035;0.027;0.658	T	0.71457	-0.4587	10	0.02654	T	1	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	48;48;78;48;48	P48058;G3V164;Q59GL7;Q86XE8;E9PQN1	GRIA4_HUMAN;.;.;.;.	V	48	ENSP00000376833:I48V;ENSP00000282499:I48V;ENSP00000376835:I48V;ENSP00000415551:I48V;ENSP00000432443:I48V;ENSP00000435775:I48V;ENSP00000432180:I48V	ENSP00000282499:I48V	I	+	1	0	GRIA4	104988266	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	9.339000	0.96797	2.254000	0.74563	0.533000	0.62120	ATT	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.408	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	protein_coding	OTTHUMT00000388593.1	A		-		105483056	+1	no_errors	ENST00000282499	ensembl	human	known	74_37	missense	SNP	1.000	G
COQ5	84274	genome.wustl.edu	37	12	120942762	120942762	+	Silent	SNP	G	G	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:120942762G>A	ENST00000288532.6	-	5	746	c.706C>T	c.(706-708)Ctg>Ttg	p.L236L	Y_RNA_ENST00000410669.1_RNA|COQ5_ENST00000445328.2_Silent_p.L162L	NM_032314.3	NP_115690.3	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase (S. cerevisiae)	236					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(3)	20	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTGGTTTCAGCACCCGATGA	0.473																																																	0								ENSG00000110871						111.0	90.0	97.0					12																	120942762		2203	4300	6503	COQ5	SO:0001819	synonymous_variant	0			-	HGNC	AK057777	CCDS31912.1	12q24.31	2011-09-16	2006-04-04		ENSG00000110871	ENSG00000110871	2.1.1.201		28722	protein-coding gene	gene with protein product	"""2-methoxy-6-polyprenyl-1,4-benzoquinol methylase"""		"""coenzyme Q5 homolog, methyltransferase (yeast)"""				Standard	NM_032314		Approved	MGC4767	uc001tyn.3	Q5HYK3	OTTHUMG00000169375	ENST00000288532.6:c.706C>T	12.37:g.120942762G>A		Somatic	0	63	0.00		0.7274002212195365	31	53.73	36	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	B4DEJ4|Q32Q28|Q53HH0|Q96LV1|Q9BSP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransf_11,pfam_Methyltransf_12,tigrfam_UbiE/COQ5_MeTrFase	p.L236	ENST00000288532.6	37	c.706	CCDS31912.1	12																																																																																			-	pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransf_11,pfam_Methyltransf_12,tigrfam_UbiE/COQ5_MeTrFase		0.473	COQ5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ5	protein_coding	OTTHUMT00000403767.2	G	NM_032314	-		120942762	-1	no_errors	ENST00000288532	ensembl	human	known	74_37	silent	SNP	1.000	A
IRAK2	3656	genome.wustl.edu	37	3	10261437	10261437	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr3:10261437T>C	ENST00000256458.4	+	8	1067	c.977T>C	c.(976-978)cTg>cCg	p.L326P	RNU6-814P_ENST00000410416.1_RNA	NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	326	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GTCGAGTACCTGCATGGTCTG	0.612																																																	0								ENSG00000134070						77.0	63.0	67.0					3																	10261437		2203	4300	6503	IRAK2	SO:0001583	missense	0			-	HGNC	AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.977T>C	3.37:g.10261437T>C	ENSP00000256458:p.Leu326Pro	Somatic	0	42	0.00		0.7274002212195365	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L326P	ENST00000256458.4	37	c.977	CCDS33697.1	3	.	.	.	.	.	.	.	.	.	.	T	14.11	2.437672	0.43224	.	.	ENSG00000134070	ENST00000256458	T	0.60548	0.18	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39687	N	0.001295	D	0.84737	0.5538	H	0.99130	4.44	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.89406	0.3699	10	0.87932	D	0	-13.9139	10.979	0.47483	0.0:0.0:0.0:1.0	.	326	O43187	IRAK2_HUMAN	P	326	ENSP00000256458:L326P	ENSP00000256458:L326P	L	+	2	0	IRAK2	10236437	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	4.206000	0.58473	1.839000	0.53478	0.459000	0.35465	CTG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.612	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	protein_coding	OTTHUMT00000339623.1	T		-		10261437	+1	no_errors	ENST00000256458	ensembl	human	known	74_37	missense	SNP	1.000	C
OR10Q1	219960	genome.wustl.edu	37	11	57996303	57996303	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr11:57996303C>A	ENST00000316770.2	-	1	87	c.45G>T	c.(43-45)gaG>gaT	p.E15D		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GGAACACAAACTCAGTGGGCT	0.488																																																	0								ENSG00000180475						126.0	132.0	130.0					11																	57996303		2165	4267	6432	OR10Q1	SO:0001583	missense	0			-	HGNC	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.45G>T	11.37:g.57996303C>A	ENSP00000314324:p.Glu15Asp	Somatic	0	41	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	32	41.82	Q6IFG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E15D	ENST00000316770.2	37	c.45	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317978	0.23994	.	.	ENSG00000180475	ENST00000316770	T	0.10860	2.83	4.71	0.242	0.15498	.	0.000000	0.42964	D	0.000631	T	0.10637	0.0260	L	0.50919	1.6	0.21064	N	0.999798	D	0.52996	0.957	P	0.46026	0.501	T	0.14980	-1.0453	10	0.54805	T	0.06	.	5.1394	0.14952	0.0:0.4448:0.3021:0.2531	.	15	Q8NGQ4	O10Q1_HUMAN	D	15	ENSP00000314324:E15D	ENSP00000314324:E15D	E	-	3	2	OR10Q1	57752879	0.439000	0.25610	0.068000	0.19968	0.008000	0.06430	0.075000	0.14686	0.173000	0.19788	-0.182000	0.12963	GAG	-	NULL		0.488	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	protein_coding	OTTHUMT00000394706.1	C	NM_001004471	-		57996303	-1	no_errors	ENST00000316770	ensembl	human	known	74_37	missense	SNP	0.807	A
GABRR1	2569	genome.wustl.edu	37	6	89895101	89895101	+	Missense_Mutation	SNP	G	G	A	rs200602822		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr6:89895101G>A	ENST00000454853.2	-	7	834	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	GABRR1_ENST00000369451.3_Missense_Mutation_p.R155W|GABRR1_ENST00000435811.1_Missense_Mutation_p.R225W	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	242					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AGTGAGATCCGTTCATCTGTC	0.483																																																	0								ENSG00000146276	G	TRP/ARG	0,4406		0,0,2203	261.0	233.0	243.0		724	1.9	1.0	6		243	1,8599	1.2+/-3.3	0,1,4299	no	missense	GABRR1	NM_002042.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	242/480	89895101	1,13005	2203	4300	6503	GABRR1	SO:0001583	missense	0			-	HGNC		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.724C>T	6.37:g.89895101G>A	ENSP00000412673:p.Arg242Trp	Somatic	0	55	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	42	38.24	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rho1_rcpt,prints_Neur_channel,prints_GABAAa_rho_rcpt,tigrfam_Neur_channel	p.R242W	ENST00000454853.2	37	c.724	CCDS5019.2	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968378	0.74131	0.0	1.16E-4	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	T;T;T	0.79749	-1.3;-1.3;-1.3	5.36	1.9	0.25705	Neurotransmitter-gated ion-channel ligand-binding (3);	0.042253	0.85682	D	0.000000	T	0.81955	0.4932	L	0.59436	1.845	0.53005	D	0.999969	D;D	0.89917	1.0;1.0	D;D	0.77004	0.982;0.989	T	0.81468	-0.0919	9	.	.	.	-27.4247	13.3176	0.60415	0.0:0.0:0.2914:0.7086	.	225;242	P24046-2;P24046	.;GBRR1_HUMAN	W	242;225;155;155	ENSP00000412673:R242W;ENSP00000394687:R225W;ENSP00000358463:R155W	.	R	-	1	2	GABRR1	89951820	0.988000	0.35896	1.000000	0.80357	0.890000	0.51754	0.393000	0.20817	0.672000	0.31204	0.561000	0.74099	CGG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.483	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRR1	protein_coding	OTTHUMT00000041479.2	G		rs200602822		89895101	-1	no_errors	ENST00000454853	ensembl	human	known	74_37	missense	SNP	1.000	A
PENK	5179	genome.wustl.edu	37	8	57353842	57353842	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr8:57353842T>C	ENST00000314922.3	-	2	869	c.793A>G	c.(793-795)Atg>Gtg	p.M265V	PENK_ENST00000451791.2_Missense_Mutation_p.M265V|PENK_ENST00000523274.1_5'Flank	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	265					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TAAAATCTCATAAATCCTCCG	0.478																																																	0								ENSG00000181195						77.0	87.0	84.0					8																	57353842		2203	4300	6503	PENK	SO:0001583	missense	0			-	HGNC		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.793A>G	8.37:g.57353842T>C	ENSP00000324248:p.Met265Val	Somatic	0	83	0.00		0.7274002212195365	175	57.18	235	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	42	38.57	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.M265V	ENST00000314922.3	37	c.793	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222564	0.79464	.	.	ENSG00000181195	ENST00000314922;ENST00000451791	T;T	0.76060	-0.99;-0.99	5.71	5.71	0.89125	.	0.035223	0.85682	D	0.000000	D	0.82421	0.5033	M	0.69523	2.12	0.80722	D	1	D	0.69078	0.997	P	0.56700	0.804	D	0.84873	0.0826	10	0.87932	D	0	-21.2085	15.1681	0.72846	0.0:0.0:0.0:1.0	.	265	P01210	PENK_HUMAN	V	265	ENSP00000324248:M265V;ENSP00000400894:M265V	ENSP00000324248:M265V	M	-	1	0	PENK	57516396	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.954000	0.76001	2.171000	0.68590	0.533000	0.62120	ATG	-	NULL		0.478	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	protein_coding	OTTHUMT00000378645.1	T		-		57353842	-1	no_errors	ENST00000314922	ensembl	human	known	74_37	missense	SNP	1.000	C
ADAM21P1	145241	genome.wustl.edu	37	14	70714300	70714300	+	RNA	SNP	A	A	G	rs112607032	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr14:70714300A>G	ENST00000530196.1	-	0	218					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GACAGTAGCCAGAAATAGACA	0.532																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714300A>G		Somatic	0	42	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.532	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	A	NG_002467	rs112607032		70714300	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.000	G
ANP32BP1	646791	genome.wustl.edu	37	15	75614886	75614886	+	RNA	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr15:75614886C>T	ENST00000564205.1	-	0	148									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		CTTAACTTTCCGCAGCGGGGG	0.637																																																	0								ENSG00000259790																																			ANP32BP1			0			-	HGNC			15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614886C>T		Somatic	0	74	0.00		0.7274002212195365	39	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	76	36.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			-	-		0.637	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	pseudogene	OTTHUMT00000419801.1	C		-		75614886	-1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	SNP	0.282	T
NEBL	10529	genome.wustl.edu	37	10	21129758	21129758	+	Silent	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr10:21129758C>T	ENST00000377122.4	-	13	1644	c.1248G>A	c.(1246-1248)ttG>ttA	p.L416L	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	416					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCTCATTTTCCAAATCTTTTT	0.343																																																	0								ENSG00000078114						95.0	90.0	92.0					10																	21129758		2203	4300	6503	NEBL	SO:0001819	synonymous_variant	0			-	HGNC	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1248G>A	10.37:g.21129758C>T		Somatic	0	22	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	3	82.35	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.L416	ENST00000377122.4	37	c.1248	CCDS7134.1	10																																																																																			-	smart_Nebulin_35r-motif		0.343	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	protein_coding	OTTHUMT00000047113.1	C	NM_006393	-		21129758	-1	no_errors	ENST00000377122	ensembl	human	known	74_37	silent	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179511230	179511230	+	Intron	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:179511230C>T	ENST00000591111.1	-	167	35599				TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.E13427K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|RP11-171I2.3_ENST00000605021.1_lincRNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTATTTCTTCAGGCTGTGGT	0.333																																																	0								ENSG00000155657																																			TTN	SO:0001627	intron_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35375-473G>A	2.37:g.179511230C>T		Somatic	0	43	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	35	45.45	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E13427K	ENST00000591111.1	37	c.40279		2	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052837	0.55218	.	.	ENSG00000155657	ENST00000429997;ENST00000446966	T	0.59638	0.25	5.93	5.93	0.95920	.	.	.	.	.	T	0.75072	0.3800	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.74368	-0.3688	8	0.45353	T	0.12	.	15.1099	0.72346	0.1415:0.8585:0.0:0.0	.	266	A2TKE4	.	K	266	ENSP00000408004:E266K	ENSP00000400616:E266K	E	-	1	0	TTN	179219475	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.530000	0.53539	2.808000	0.96608	0.655000	0.94253	GAA	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom		0.333	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179511230	-1	no_errors	ENST00000589042	ensembl	human	putative	74_37	missense	SNP	0.999	T
KIF25	3834	genome.wustl.edu	37	6	168443353	168443353	+	Silent	SNP	G	G	A	rs147561163		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr6:168443353G>A	ENST00000443060.2	+	9	1333	c.942G>A	c.(940-942)ccG>ccA	p.P314P	KIF25_ENST00000354419.2_Silent_p.P314P|KIF25_ENST00000351261.3_Intron			Q9UIL4	KIF25_HUMAN	kinesin family member 25	314	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P314P(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GCCATGCCCCGTACCGGAACA	0.652																																																	1	Substitution - coding silent(1)	cervix(1)						ENSG00000125337	G	,	0,4406		0,0,2203	112.0	107.0	109.0		,942	-8.2	0.0	6	dbSNP_134	109	3,8597	3.0+/-9.4	0,3,4297	no	intron,coding-synonymous	KIF25	NM_005355.3,NM_030615.2	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	,314/385	168443353	3,13003	2203	4300	6503	KIF25	SO:0001819	synonymous_variant	0			-	HGNC	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.942G>A	6.37:g.168443353G>A		Somatic	0	51	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	50	43.18	O94775|Q5SZU9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P314	ENST00000443060.2	37	c.942	CCDS5305.1	6																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom		0.652	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIF25	protein_coding	OTTHUMT00000362509.1	G		rs147561163		168443353	+1	no_errors	ENST00000354419	ensembl	human	known	74_37	silent	SNP	0.157	A
SYNPO	11346	genome.wustl.edu	37	5	150028887	150028887	+	Silent	SNP	G	G	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr5:150028887G>A	ENST00000394243.1	+	3	2156	c.1782G>A	c.(1780-1782)aaG>aaA	p.K594K	SYNPO_ENST00000522122.1_Silent_p.K594K|SYNPO_ENST00000519664.1_Silent_p.K350K|SYNPO_ENST00000307662.4_Silent_p.K350K	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	594					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGACCCCAAGTCTTCTCATC	0.602																																																	0								ENSG00000171992						69.0	73.0	71.0					5																	150028887		2203	4300	6503	SYNPO	SO:0001819	synonymous_variant	0			-	HGNC	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1782G>A	5.37:g.150028887G>A		Somatic	0	42	0.00		0.7274002212195365	127	24.85	42	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	34	38.18	A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K594	ENST00000394243.1	37	c.1782	CCDS54937.1	5																																																																																			-	NULL		0.602	SYNPO-002	KNOWN	basic|CCDS	protein_coding	SYNPO	protein_coding	OTTHUMT00000252371.1	G	NM_007286	-		150028887	+1	no_errors	ENST00000394243	ensembl	human	known	74_37	silent	SNP	0.235	A
LRRC16B	90668	genome.wustl.edu	37	14	24525877	24525877	+	Silent	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr14:24525877C>T	ENST00000342740.5	+	12	1066	c.912C>T	c.(910-912)ctC>ctT	p.L304L	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	304						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CCTCTGGCCTCACCAAACTGT	0.627																																																	0								ENSG00000186648						96.0	93.0	94.0					14																	24525877		2203	4300	6503	LRRC16B	SO:0001819	synonymous_variant	0			-	HGNC	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.912C>T	14.37:g.24525877C>T		Somatic	0	52	0.00		0.7274002212195365	0	100.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	40	41.18	Q8TEF7|Q96HS9	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L304	ENST00000342740.5	37	c.912	CCDS32054.1	14																																																																																			-	NULL		0.627	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	protein_coding	OTTHUMT00000416527.1	C	NM_138360	-		24525877	+1	no_errors	ENST00000342740	ensembl	human	known	74_37	silent	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76763007	76763007	+	3'UTR	SNP	G	G	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chrX:76763007G>A	ENST00000373344.5	-	0	8515				ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_3'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATGCAGTTAAGAGATGTGCTT	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0								ENSG00000085224																																			ATRX	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.*822C>T	X.37:g.76763007G>A		Somatic	0	50	0.00		0.7274002212195365	11	85.14	63	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	9	80.85	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			-	-		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489	-		76763007	-1	no_errors	ENST00000480283	ensembl	human	known	74_37	rna	SNP	0.075	A
TBX5	6910	genome.wustl.edu	37	12	114836461	114836461	+	Missense_Mutation	SNP	C	C	T	rs374906778		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:114836461C>T	ENST00000310346.4	-	5	1093	c.427G>A	c.(427-429)Gcc>Acc	p.A143T	TBX5_ENST00000405440.2_Missense_Mutation_p.A143T|TBX5_ENST00000349716.5_Missense_Mutation_p.A93T|TBX5_ENST00000526441.1_Missense_Mutation_p.A143T|TBX5_ENST00000552726.1_5'UTR	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	143					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCCCCGGTGGCGGGGGAGTCT	0.612																																					NSCLC(152;1358 1980 4050 23898 40356)												0			GRCh37	CI031925	TBX5	I		ENSG00000089225	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	59.0	49.0	52.0		427,277,427,427	4.6	0.8	12		52	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	TBX5	NM_000192.3,NM_080717.2,NM_080718.1,NM_181486.1	58,58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	143/519,93/469,143/350,143/519	114836461	1,13005	2203	4300	6503	TBX5	SO:0001583	missense	0			-	HGNC	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.427G>A	12.37:g.114836461C>T	ENSP00000309913:p.Ala143Thr	Somatic	0	42	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A143T	ENST00000310346.4	37	c.427	CCDS9173.1	12	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709930	0.68730	0.0	1.16E-4	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	4.56	4.56	0.56223	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94188	0.8135	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.80764	0.853;0.994	D	0.94057	0.7323	10	0.48119	T	0.1	.	17.8864	0.88856	0.0:1.0:0.0:0.0	.	143;143	Q99593-2;Q99593	.;TBX5_HUMAN	T	93;143;40;143;143	ENSP00000337723:A93T;ENSP00000309913:A143T;ENSP00000384152:A143T;ENSP00000433292:A143T	ENSP00000309913:A143T	A	-	1	0	TBX5	113320844	1.000000	0.71417	0.775000	0.31657	0.139000	0.21198	5.700000	0.68318	2.502000	0.84385	0.655000	0.94253	GCC	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box		0.612	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	protein_coding	OTTHUMT00000388297.1	C	NM_080717	-		114836461	-1	no_errors	ENST00000310346	ensembl	human	known	74_37	missense	SNP	0.998	T
POLE	5426	genome.wustl.edu	37	12	133220026	133220026	+	Missense_Mutation	SNP	G	G	A	rs528264567		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:133220026G>A	ENST00000320574.5	-	34	4454	c.4411C>T	c.(4411-4413)Cgc>Tgc	p.R1471C	POLE_ENST00000535270.1_Missense_Mutation_p.R1444C|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1471					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GCCAGAGAGCGCATCTCCAGG	0.587								DNA polymerases (catalytic subunits)					G|||	1	0.000199681	0.0	0.0	5008	,	,		19796	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000177084						138.0	132.0	134.0					12																	133220026		2203	4300	6503	POLE	SO:0001583	missense	0			-	HGNC		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4411C>T	12.37:g.133220026G>A	ENSP00000322570:p.Arg1471Cys	Somatic	0	44	0.00		0.7274002212195365	30	39.22	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	34	43.33	Q13533|Q86VH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.R1471C	ENST00000320574.5	37	c.4411	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059249	0.55325	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.02974	4.09;4.09;4.09	5.71	5.71	0.89125	.	0.042915	0.85682	D	0.000000	T	0.04952	0.0133	L	0.52126	1.63	0.80722	D	1	B;B	0.24721	0.085;0.11	B;B	0.20577	0.03;0.008	T	0.43015	-0.9417	10	0.38643	T	0.18	.	18.1027	0.89510	0.0:0.0:1.0:0.0	.	1444;1471	F5H1D6;Q07864	.;DPOE1_HUMAN	C	1471;1482;1444	ENSP00000322570:R1471C;ENSP00000406383:R1482C;ENSP00000445753:R1444C	ENSP00000322570:R1471C	R	-	1	0	POLE	131730099	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.972000	0.70448	2.716000	0.92895	0.650000	0.86243	CGC	-	NULL		0.587	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	protein_coding	OTTHUMT00000397689.2	G	NM_006231	-		133220026	-1	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	SNP	1.000	A
TSPYL6	388951	genome.wustl.edu	37	2	54483161	54483161	+	Missense_Mutation	SNP	C	C	A	rs537805712		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:54483161C>A	ENST00000317802.7	-	1	248	c.128G>T	c.(127-129)cGc>cTc	p.R43L	ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	43					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						TGGCTCCAAGCGGCCATCAAA	0.602																																																	0								ENSG00000178021						80.0	91.0	88.0					2																	54483161		1949	4134	6083	TSPYL6	SO:0001583	missense	0			-	HGNC	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.128G>T	2.37:g.54483161C>A	ENSP00000417919:p.Arg43Leu	Somatic	0	73	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	52	35.80	Q6NUJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.R43L	ENST00000317802.7	37	c.128	CCDS42682.1	2	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353295	0.24512	.	.	ENSG00000178021	ENST00000317802	T	0.25250	1.81	1.22	1.22	0.21188	.	.	.	.	.	T	0.13243	0.0321	N	0.22421	0.69	0.09310	N	1	P	0.35242	0.492	B	0.24701	0.055	T	0.16837	-1.0389	9	0.59425	D	0.04	.	5.8257	0.18552	0.0:1.0:0.0:0.0	.	43	Q8N831	TSYL6_HUMAN	L	43	ENSP00000417919:R43L	ENSP00000417919:R43L	R	-	2	0	TSPYL6	54336665	0.048000	0.20356	0.123000	0.21794	0.008000	0.06430	0.399000	0.20916	0.968000	0.38212	0.467000	0.42956	CGC	-	NULL		0.602	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL6	protein_coding	OTTHUMT00000324069.3	C	XM_371494	-		54483161	-1	no_errors	ENST00000317802	ensembl	human	known	74_37	missense	SNP	0.156	A
NEB	4703	genome.wustl.edu	37	2	152527713	152527713	+	Silent	SNP	A	A	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:152527713A>G	ENST00000172853.10	-	38	4477	c.4330T>C	c.(4330-4332)Ttg>Ctg	p.L1444L	NEB_ENST00000604864.1_Silent_p.L1444L|NEB_ENST00000427231.2_Silent_p.L1444L|NEB_ENST00000603639.1_Silent_p.L1444L|NEB_ENST00000397345.3_Silent_p.L1444L|NEB_ENST00000409198.1_Silent_p.L1444L			P20929	NEBU_HUMAN	nebulin	1444					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATGCCCTTCAAGAAGCTGTTA	0.443																																																	0								ENSG00000183091						96.0	90.0	92.0					2																	152527713		1901	4112	6013	NEB	SO:0001819	synonymous_variant	0			-	HGNC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4330T>C	2.37:g.152527713A>G		Somatic	0	100	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	135	12.34	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.L1444	ENST00000172853.10	37	c.4330		2																																																																																			-	pfscan_Nebulin_35r-motif		0.443	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		A	NM_004543	-		152527713	-1	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	SNP	0.984	G
SEC22B	9554	genome.wustl.edu	37	1	145116193	145116193	+	RNA	DEL	G	G	-	rs66989703|rs372891418	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:145116193delG	ENST00000453618.1	+	0	1279							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											AGCACTGGCTGGGGCATTCTC	0.428													GGGG|GGGG|GGG|deletion	1833	0.366014	0.3116	0.4294	5008	,	,		69780	0.3502		0.3847	False		,,,				2504	0.3916																0								ENSG00000223380																																			SEC22B			0				HGNC	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116193delG		Somatic	0	18	0.00		0.7274002212195365	156	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	A8K1G0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			-	-		0.428	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	processed_transcript	OTTHUMT00000038523.5	G	NM_004892			145116193	+1	no_errors	ENST00000453618	ensembl	human	known	74_37	rna	DEL	0.031	-
PLEKHO1	51177	genome.wustl.edu	37	1	150131553	150131553	+	Silent	SNP	G	G	T	rs372807467		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:150131553G>T	ENST00000369124.4	+	6	1343	c.1065G>T	c.(1063-1065)acG>acT	p.T355T	PLEKHO1_ENST00000025469.6_Silent_p.T321T|PLEKHO1_ENST00000369126.1_Silent_p.T172T	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	355	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCTGGAGACGGAACGGCTGC	0.607																																																	0								ENSG00000023902						46.0	50.0	49.0					1																	150131553		2203	4300	6503	PLEKHO1	SO:0001819	synonymous_variant	0			-	HGNC	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.1065G>T	1.37:g.150131553G>T		Somatic	0	43	0.00		0.7274002212195365	354	38.15	219	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	26	39.53	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T321	ENST00000369124.4	37	c.963	CCDS945.1	1																																																																																			-	NULL		0.607	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHO1	protein_coding	OTTHUMT00000034962.1	G	NM_016274	-		150131553	+1	no_errors	ENST00000025469	ensembl	human	known	74_37	silent	SNP	0.292	T
CACNA1H	8912	genome.wustl.edu	37	16	1270617	1270617	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr16:1270617A>T	ENST00000348261.5	+	35	6933	c.6685A>T	c.(6685-6687)Agg>Tgg	p.R2229W	CACNA1H_ENST00000565831.1_Missense_Mutation_p.R2223W|CACNA1H_ENST00000358590.4_Missense_Mutation_p.R2223W	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	2229					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CACGCCTCACAGGGACTCCCT	0.751																																																	0								ENSG00000196557						7.0	9.0	9.0					16																	1270617		1665	3778	5443	CACNA1H	SO:0001583	missense	0			-	HGNC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.6685A>T	16.37:g.1270617A>T	ENSP00000334198:p.Arg2229Trp	Somatic	0	10	0.00		0.7274002212195365	44	50.56	45	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	14	54.84	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.R2229W	ENST00000348261.5	37	c.6685	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	A	14.23	2.472847	0.43942	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	T;T	0.33865	1.39;1.39	4.39	4.39	0.52855	.	1.165150	0.06728	N	0.776053	T	0.42359	0.1199	N	0.22421	0.69	0.26550	N	0.973923	D;D;D;D;D	0.65815	0.992;0.988;0.995;0.973;0.975	P;P;P;P;P	0.57283	0.817;0.715;0.619;0.724;0.782	T	0.35251	-0.9796	10	0.87932	D	0	.	9.7802	0.40643	0.8124:0.1876:0.0:0.0	.	975;953;959;2223;2229	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	W	2229;2223	ENSP00000334198:R2229W;ENSP00000351401:R2223W	ENSP00000334198:R2229W	R	+	1	2	CACNA1H	1210618	1.000000	0.71417	0.997000	0.53966	0.609000	0.37215	1.800000	0.38833	1.835000	0.53391	0.477000	0.44152	AGG	-	NULL		0.751	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	protein_coding	OTTHUMT00000421601.1	A	NM_001005407	-		1270617	+1	no_errors	ENST00000348261	ensembl	human	known	74_37	missense	SNP	0.989	T
ZNF385B	151126	genome.wustl.edu	37	2	180348073	180348073	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:180348073G>T	ENST00000410066.1	-	6	1199	c.596C>A	c.(595-597)cCt>cAt	p.P199H	ZNF385B_ENST00000336917.5_Missense_Mutation_p.P97H|ZNF385B_ENST00000409343.1_Missense_Mutation_p.P123H|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.P97H	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	199	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTCCTTGGAAGGAACCATTTT	0.458																																					Colon(155;204 2491 32774 51842)												0								ENSG00000144331						371.0	299.0	323.0					2																	180348073		2203	4300	6503	ZNF385B	SO:0001583	missense	0			-	HGNC	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.596C>A	2.37:g.180348073G>T	ENSP00000386845:p.Pro199His	Somatic	0	101	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	145	12.12	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.P199H	ENST00000410066.1	37	c.596	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647063	0.47258	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692;ENST00000457304;ENST00000439340	T;T;T;T;T;T	0.43688	1.42;1.41;1.4;1.41;1.43;0.94	5.93	5.93	0.95920	.	0.407412	0.30151	N	0.010290	T	0.36248	0.0960	N	0.22421	0.69	0.29801	N	0.832407	B;B	0.20164	0.042;0.007	B;B	0.24541	0.054;0.003	T	0.24119	-1.0169	10	0.45353	T	0.12	-19.3667	20.328	0.98708	0.0:0.0:1.0:0.0	.	199;123	Q569K4;Q569K4-2	Z385B_HUMAN;.	H	199;97;123;97;97;130	ENSP00000386845:P199H;ENSP00000338225:P97H;ENSP00000386379:P123H;ENSP00000386507:P97H;ENSP00000394038:P97H;ENSP00000399198:P130H	ENSP00000338225:P97H	P	-	2	0	ZNF385B	180056318	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.593000	0.74100	2.802000	0.96397	0.561000	0.74099	CCT	-	NULL		0.458	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	protein_coding	OTTHUMT00000335972.1	G	NM_152520	-		180348073	-1	no_errors	ENST00000410066	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE7A	5150	genome.wustl.edu	37	8	66701116	66701116	+	Intron	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr8:66701116C>T	ENST00000401827.3	-	2	582				PDE7A_ENST00000379419.4_Splice_Site|PDE7A_ENST00000396642.3_Intron	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A						cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	AGATGGCCTACCTTAGAGGTG	0.378																																																	0								ENSG00000205268						111.0	101.0	104.0					8																	66701116		2203	4300	6503	PDE7A	SO:0001627	intron_variant	0			-	HGNC	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.139-6038G>A	8.37:g.66701116C>T		Somatic	0	47	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	26	49.02	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000401827.3	37	c.60+1	CCDS56538.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960456	0.74016	.	.	ENSG00000205268	ENST00000379419;ENST00000523253	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2998	0.94140	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE7A	66863670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.508000	0.67006	2.866000	0.98385	0.650000	0.86243	.	-	-		0.378	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7A	protein_coding	OTTHUMT00000378905.1	C		-		66701116	-1	no_errors	ENST00000379419	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ABCB4	5244	genome.wustl.edu	37	7	87069600	87069600	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr7:87069600T>C	ENST00000265723.4	-	13	1586	c.1475A>G	c.(1474-1476)tAt>tGt	p.Y492C	ABCB4_ENST00000359206.3_Missense_Mutation_p.Y492C|ABCB4_ENST00000453593.1_Missense_Mutation_p.Y492C|ABCB4_ENST00000545634.1_Missense_Mutation_p.Y492C|ABCB4_ENST00000358400.3_Missense_Mutation_p.Y492C	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	492	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TCCACGGCCATAACAAATATT	0.403																																																	0								ENSG00000005471						102.0	101.0	102.0					7																	87069600		2203	4300	6503	ABCB4	SO:0001583	missense	0			-	HGNC	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1475A>G	7.37:g.87069600T>C	ENSP00000265723:p.Tyr492Cys	Somatic	0	69	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	57	38.04	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.Y492C	ENST00000265723.4	37	c.1475	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	T	18.64	3.667532	0.67814	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78	5.73	5.73	0.89815	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.119656	0.64402	D	0.000016	D	0.94843	0.8334	M	0.71206	2.165	0.58432	D	0.999998	D;P;P	0.89917	1.0;0.749;0.789	D;P;P	0.83275	0.996;0.654;0.766	D	0.95326	0.8425	10	0.87932	D	0	-3.6682	16.0241	0.80528	0.0:0.0:0.0:1.0	.	492;492;492	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	C	492	ENSP00000352135:Y492C;ENSP00000351172:Y492C;ENSP00000265723:Y492C;ENSP00000392983:Y492C;ENSP00000437465:Y492C	ENSP00000265723:Y492C	Y	-	2	0	ABCB4	86907536	1.000000	0.71417	0.971000	0.41717	0.648000	0.38561	4.059000	0.57470	2.164000	0.68074	0.528000	0.53228	TAT	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.403	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	T	NM_000443	-		87069600	-1	no_errors	ENST00000265723	ensembl	human	known	74_37	missense	SNP	1.000	C
NPTX2	4885	genome.wustl.edu	37	7	98249052	98249052	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr7:98249052G>A	ENST00000265634.3	+	2	689	c.524G>A	c.(523-525)cGc>cAc	p.R175H		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	175					synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CAGCTTCTGCGCAAGGTGGCA	0.647																																																	0								ENSG00000106236						34.0	38.0	36.0					7																	98249052		2201	4296	6497	NPTX2	SO:0001583	missense	0			-	HGNC		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.524G>A	7.37:g.98249052G>A	ENSP00000265634:p.Arg175His	Somatic	0	45	0.00		0.7274002212195365	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	33	40.35	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.R175H	ENST00000265634.3	37	c.524	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	G	14.30	2.492955	0.44352	.	.	ENSG00000106236	ENST00000265634	T	0.10960	2.82	4.81	-0.597	0.11653	.	0.398779	0.28560	N	0.014903	T	0.06325	0.0163	L	0.29908	0.895	0.26713	N	0.970938	B	0.09022	0.002	B	0.04013	0.001	T	0.25082	-1.0142	10	0.39692	T	0.17	-2.283	4.9497	0.14008	0.3071:0.2653:0.4276:0.0	.	175	P47972	NPTX2_HUMAN	H	175	ENSP00000265634:R175H	ENSP00000265634:R175H	R	+	2	0	NPTX2	98086988	0.988000	0.35896	0.994000	0.49952	0.972000	0.66771	1.970000	0.40520	-0.119000	0.11830	-0.189000	0.12847	CGC	-	NULL		0.647	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	protein_coding	OTTHUMT00000334982.1	G	NM_002523	-		98249052	+1	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	SNP	0.689	A
PNMAL2	57469	genome.wustl.edu	37	19	46997016	46997017	+	Intron	INS	-	-	CGGCCT	rs147338403	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:46997016_46997017insCGGCCT	ENST00000377655.2	-	1	734				PNMAL2_ENST00000594749.1_Intron|AC011484.1_ENST00000377652.3_5'Flank|PNMAL2_ENST00000599531.1_In_Frame_Ins_p.569_569R>RGR			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GAGTGACGCCCCGGCCTCGGCC	0.777														399	0.0796725	0.0877	0.1311	5008	,	,		7999	0.0069		0.1541	False		,,,				2504	0.0307																0								ENSG00000204851		,	157,1431		64,29,701					,	-3.0	0.0		dbSNP_134	2	473,3237		187,99,1569	no	coding,intron	PNMAL2,LOC100506012	NM_020709.1,NM_001205281.1	,	251,128,2270	A1A1,A1R,RR		12.7493,9.8866,11.8913	,	,		630,4668				PNMAL2	SO:0001627	intron_variant	0				HGNC	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.734+971->AGGCCG	19.37:g.46997017_46997022dupCGGCCT		Somatic	NA	NA	NA		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.571in_frame_insRG	ENST00000377655.2	37	c.1707_1706		19																																																																																			-	NULL		0.777	PNMAL2-201	KNOWN	basic	protein_coding	PNMAL2	protein_coding		-	NM_020709			46997017	-1	no_errors	ENST00000599531	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	CGGCCT
ZNF570	148268	genome.wustl.edu	37	19	37975446	37975446	+	Silent	SNP	C	C	A	rs200846017		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:37975446C>A	ENST00000330173.1	+	5	1451	c.922C>A	c.(922-924)Cga>Aga	p.R308R	ZNF570_ENST00000388801.3_Silent_p.R105R|ZNF570_ENST00000586475.1_Silent_p.R364R	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAGGTATGTCGAAAAGCCTT	0.428																																																	0								ENSG00000171827						88.0	82.0	84.0					19																	37975446		2203	4300	6503	ZNF570	SO:0001819	synonymous_variant	0			-	HGNC	AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.922C>A	19.37:g.37975446C>A		Somatic	0	61	0.00		0.7274002212195365	7	22.22	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	53	42.39	A1L472|B4DMP1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R308	ENST00000330173.1	37	c.922	CCDS12504.1	19																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	protein_coding	OTTHUMT00000109600.1	C	NM_144694	-		37975446	+1	no_errors	ENST00000330173	ensembl	human	known	74_37	silent	SNP	1.000	A
HOXD8	3234	genome.wustl.edu	37	2	176995302	176995303	+	In_Frame_Ins	INS	-	-	CGCACC	rs557744341|rs544054860	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:176995302_176995303insCGCACC	ENST00000313173.4	+	1	835_836	c.208_209insCGCACC	c.(208-210)gcg>gCGCACCcg	p.74_75insHP	HOXD8_ENST00000544999.1_In_Frame_Ins_p.74_75insHP|HOXD8_ENST00000450510.2_In_Frame_Ins_p.74_75insHP|HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000429017.1_Intron|HOXD8_ENST00000548663.1_Intron	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	74					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GCAGGCGCACGCGCACCCGCAC	0.802														139	0.0277556	0.0287	0.0245	5008	,	,		8408	0.002		0.0398	False		,,,				2504	0.0429																0								ENSG00000175879		,,	38,1196		9,20,588					,,	-1.2	1.0			2	128,2934		36,56,1439	no	coding,intron,coding	HOXD8	NM_019558.3,NM_001199747.1,NM_001199746.1	,,	45,76,2027	A1A1,A1R,RR		4.1803,3.0794,3.8641	,,	,,		166,4130				HOXD8	SO:0001652	inframe_insertion	0				HGNC		CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.215_220dupCGCACC	2.37:g.176995303_176995308dupCGCACC	ENSP00000315949:p.His73_Pro74dup	Somatic	NA	NA	NA		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	F8WBG7|Q5BL00|Q8IXZ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.74in_frame_insPH	ENST00000313173.4	37	c.208_209	CCDS2268.1	2																																																																																			-	NULL		0.802	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HOXD8	protein_coding	OTTHUMT00000255694.1	-				176995303	+1	no_errors	ENST00000313173	ensembl	human	known	74_37	in_frame_ins	INS	0.993:1.000	CGCACC
COL6A3	1293	genome.wustl.edu	37	2	238253180	238253180	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:238253180A>G	ENST00000295550.4	-	36	7933	c.7481T>C	c.(7480-7482)gTg>gCg	p.V2494A	COL6A3_ENST00000346358.4_Missense_Mutation_p.V2294A|COL6A3_ENST00000353578.4_Missense_Mutation_p.V2288A|COL6A3_ENST00000409809.1_Missense_Mutation_p.V2288A|COL6A3_ENST00000472056.1_Missense_Mutation_p.V1887A|COL6A3_ENST00000347401.3_Missense_Mutation_p.V2293A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2494	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GTTCCTGGCCACAAACGACAT	0.507																																																	0								ENSG00000163359						110.0	100.0	103.0					2																	238253180		2203	4300	6503	COL6A3	SO:0001583	missense	0			-	HGNC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7481T>C	2.37:g.238253180A>G	ENSP00000295550:p.Val2494Ala	Somatic	0	49	0.00		0.7274002212195365	99	90.47	987	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	11	73.81	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.V2494A	ENST00000295550.4	37	c.7481	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335543	0.41398	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	4.87	4.87	0.63330	von Willebrand factor, type A (3);	0.000000	0.47852	D	0.000220	D	0.88526	0.6460	M	0.79693	2.465	0.58432	D	0.999999	D;D;D;D	0.76494	0.998;0.998;0.997;0.999	D;D;D;D	0.73380	0.965;0.953;0.941;0.98	D	0.86812	0.1999	10	0.20046	T	0.44	.	14.8002	0.69909	1.0:0.0:0.0:0.0	.	1887;1887;2288;2494	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	A	2494;2293;2288;1887;2288;2294	ENSP00000295550:V2494A;ENSP00000315609:V2293A;ENSP00000315873:V2288A;ENSP00000418285:V1887A;ENSP00000386844:V2288A;ENSP00000295546:V2294A	ENSP00000295550:V2494A	V	-	2	0	COL6A3	237917919	1.000000	0.71417	0.996000	0.52242	0.844000	0.47949	9.110000	0.94302	1.942000	0.56320	0.533000	0.62120	GTG	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.507	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	A	NM_004369	-		238253180	-1	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	SNP	1.000	G
ATP2A2	488	genome.wustl.edu	37	12	110770407	110770407	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:110770407C>A	ENST00000539276.2	+	9	1210	c.1101C>A	c.(1099-1101)ttC>ttA	p.F367L	ATP2A2_ENST00000308664.6_Missense_Mutation_p.F367L|ATP2A2_ENST00000395494.2_Missense_Mutation_p.F340L			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	367					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TACAGATGTTCATTCTGGACA	0.398																																																	0								ENSG00000174437						179.0	179.0	179.0					12																	110770407		2203	4300	6503	ATP2A2	SO:0001583	missense	0			-	HGNC		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1101C>A	12.37:g.110770407C>A	ENSP00000440045:p.Phe367Leu	Somatic	0	88	0.00		0.7274002212195365	304	38.18	189	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	48	36.84	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.F367L	ENST00000539276.2	37	c.1101	CCDS9144.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.87|14.87	2.665088|2.665088	0.47677|0.47677	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.82167|.	-1.58;-1.58;-1.58|.	5.31|5.31	1.93|1.93	0.25924|0.25924	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.139598|.	0.64402|.	D|.	0.000002|.	T|T	0.56514|0.56514	0.1990|0.1990	L|L	0.54908|0.54908	1.71|1.71	0.49213|0.49213	D|D	0.999769|0.999769	B;B;B|.	0.20261|.	0.011;0.014;0.043|.	B;B;B|.	0.20955|.	0.027;0.011;0.032|.	T|T	0.50684|0.50684	-0.8799|-0.8799	10|5	0.44086|.	T|.	0.13|.	.|.	7.292|7.292	0.26372|0.26372	0.1285:0.6425:0.0:0.229|0.1285:0.6425:0.0:0.229	.|.	340;367;367|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	L|N	367;340;367|258	ENSP00000311186:F367L;ENSP00000378872:F340L;ENSP00000440045:F367L|.	ENSP00000311186:F367L|.	F|H	+|+	3|1	2|0	ATP2A2|ATP2A2	109254790|109254790	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.906000|0.906000	0.53458|0.53458	1.024000|1.024000	0.30077|0.30077	0.708000|0.708000	0.31955|0.31955	0.460000|0.460000	0.39030|0.39030	TTC|CAT	-	superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase		0.398	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	protein_coding	OTTHUMT00000403539.1	C	NM_001681	-		110770407	+1	no_errors	ENST00000539276	ensembl	human	known	74_37	missense	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11515104	11515104	+	Intron	SNP	A	A	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr17:11515104A>G	ENST00000262442.4	+	4	972				DNAH9_ENST00000454412.2_Intron|DNAH9_ENST00000579828.1_Missense_Mutation_p.D304G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9						cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCAGGTGAGGACCAGCAAGTG	0.453																																																	0								ENSG00000007174						124.0	113.0	117.0					17																	11515104		2203	4300	6503	DNAH9	SO:0001627	intron_variant	0			-	HGNC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.904+7A>G	17.37:g.11515104A>G		Somatic	0	66	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	400	10.91	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom-1	p.D304G	ENST00000262442.4	37	c.911	CCDS11160.1	17																																																																																			-	NULL		0.453	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	A	NM_001372	-		11515104	+1	no_errors	ENST00000579828	ensembl	human	novel	74_37	missense	SNP	0.000	G
RAMP2	10266	genome.wustl.edu	37	17	40913022	40913022	+	5'Flank	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr17:40913022C>T	ENST00000253796.5	+	0	0				RAMP2_ENST00000588576.1_5'Flank|RAMP2_ENST00000591972.1_Intron|RAMP2_ENST00000587142.1_5'Flank|RAMP2_ENST00000589683.1_5'UTR|RAMP2-AS1_ENST00000592670.1_lincRNA	NM_005854.2	NP_005845.2	O60895	RAMP2_HUMAN	receptor (G protein-coupled) activity modifying protein 2						adherens junction assembly (GO:0034333)|angiogenesis (GO:0001525)|basement membrane assembly (GO:0070831)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to hormone stimulus (GO:0032870)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|heart development (GO:0007507)|intracellular protein transport (GO:0006886)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of vascular permeability (GO:0043116)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of gene expression (GO:0010628)|positive regulation of vasculogenesis (GO:2001214)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|sprouting angiogenesis (GO:0002040)|tight junction assembly (GO:0070830)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)			endometrium(2)|lung(1)|stomach(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)	AGCTGTCCAGCCTCGCGGGGT	0.731																																																	0								ENSG00000197291																																			RAMP2-AS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AJ001015	CCDS11437.1	17q12-q21.1	2012-08-17	2006-11-21		ENSG00000131477	ENSG00000131477		"""Receptor (G protein-coupled) activity modifying proteins"""	9844	protein-coding gene	gene with protein product		605154	"""receptor activity modifying protein 2"", ""receptor (calcitonin) activity modifying protein 2"""				Standard	NM_005854		Approved		uc002ibg.3	O60895			17.37:g.40913022C>T	Exception_encountered	Somatic	0	12	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	12	53.85	A7L9S6|K7EMD3|Q8N1F2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253796.5	37	NULL	CCDS11437.1	17																																																																																			-	-		0.731	RAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAMP2-AS1	protein_coding	OTTHUMT00000452380.1	C	NM_005854	-		40913022	-1	no_errors	ENST00000360166	ensembl	human	known	74_37	rna	SNP	0.992	T
PHKB	5257	genome.wustl.edu	37	16	47533690	47533690	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr16:47533690C>G	ENST00000323584.5	+	3	214	c.190C>G	c.(190-192)Caa>Gaa	p.Q64E	PHKB_ENST00000455779.1_Missense_Mutation_p.Q57E|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.Q57E|PHKB_ENST00000299167.8_Missense_Mutation_p.Q64E	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	64					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GCTGCTGTATCAAAGTCCAAC	0.473																																																	0								ENSG00000102893						164.0	158.0	160.0					16																	47533690		2201	4300	6501	PHKB	SO:0001583	missense	0			-	HGNC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.190C>G	16.37:g.47533690C>G	ENSP00000313504:p.Gln64Glu	Somatic	0	96	0.00		0.7274002212195365	19	38.71	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	65	35.00	Q8N4T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.Q64E	ENST00000323584.5	37	c.190	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.516089	0.96402	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92965	-3.14;-3.14	5.81	5.81	0.92471	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.052713	0.85682	N	0.000000	D	0.97365	0.9138	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.992	D;D;D	0.91635	0.987;0.999;0.986	D	0.97774	1.0228	10	0.87932	D	0	-18.7238	20.0758	0.97742	0.0:1.0:0.0:0.0	.	57;64;57	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	E	57;57;64	ENSP00000414345:Q57E;ENSP00000313504:Q64E	ENSP00000299167:Q57E	Q	+	1	0	PHKB	46091191	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.763000	0.85283	2.737000	0.93849	0.655000	0.94253	CAA	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.473	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	protein_coding	OTTHUMT00000430413.1	C		-		47533690	+1	no_errors	ENST00000299167	ensembl	human	known	74_37	missense	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179442292	179442292	+	Intron	SNP	T	T	A	rs148238009	byFrequency	TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr2:179442292T>A	ENST00000591111.1	-	273	64126				RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAATTTGCTTTAAAAAAAAAA	0.353																																																	0								ENSG00000271011						49.0	44.0	46.0					2																	179442292		1808	4064	5872	RP11-171I2.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63901+36A>T	2.37:g.179442292T>A		Somatic	0	36	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			-	-		0.353	TTN-019	PUTATIVE	basic	protein_coding	ENSG00000271011	protein_coding	OTTHUMT00000460310.1	T	NM_133378	-		179442292	+1	no_errors	ENST00000604215	ensembl	human	known	74_37	rna	SNP	0.663	A
CD209	30835	genome.wustl.edu	37	19	7810620	7810620	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr19:7810620C>A	ENST00000315599.7	-	4	554	c.532G>T	c.(532-534)Gct>Tct	p.A178S	CD209_ENST00000601256.1_Missense_Mutation_p.A154S|CD209_ENST00000394173.4_Intron|CD209_ENST00000593660.1_Missense_Mutation_p.A154S|CD209_ENST00000602261.1_Intron|CD209_ENST00000394161.5_Intron|CD209_ENST00000354397.6_Missense_Mutation_p.A178S|CD209_ENST00000593821.1_Intron|CD209_ENST00000315591.8_Missense_Mutation_p.A154S|CD209_ENST00000301357.8_Intron|CD209_ENST00000601951.1_Missense_Mutation_p.A154S|CD209_ENST00000204801.8_Missense_Mutation_p.A134S	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	178	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CCCACTGCAGCCTTCAGCCGA	0.547																																																	0								ENSG00000090659						104.0	102.0	103.0					19																	7810620		2191	4294	6485	CD209	SO:0001583	missense	0			-	HGNC	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.532G>T	19.37:g.7810620C>A	ENSP00000315477:p.Ala178Ser	Somatic	0	152	0.00		0.7274002212195365	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	117	39.38	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.A178S	ENST00000315599.7	37	c.532	CCDS12186.1	19	.	.	.	.	.	.	.	.	.	.	C	10.78	1.447174	0.25987	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000540789	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	0.461	-0.71	0.11234	.	.	.	.	.	T	0.37758	0.1015	M	0.74258	2.255	0.09310	N	1	D;D;P;D;P;B;P;D	0.67145	0.972;0.99;0.673;0.99;0.643;0.002;0.673;0.996	P;D;B;D;B;B;B;D	0.76071	0.866;0.98;0.193;0.971;0.364;0.029;0.148;0.987	T	0.22521	-1.0214	8	0.27785	T	0.31	.	.	.	.	.	178;154;134;154;178;154;154;178	Q9NNX6-2;Q9NNX6-12;Q9NNX6-7;Q9NNX6-6;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;CD209_HUMAN;.;.;.	S	178;178;154;134;162	ENSP00000315477:A178S;ENSP00000346373:A178S;ENSP00000315407:A154S;ENSP00000204801:A134S	ENSP00000204801:A134S	A	-	1	0	CD209	7716620	0.004000	0.15560	0.001000	0.08648	0.157000	0.22087	-0.286000	0.08399	-0.326000	0.08564	0.298000	0.19748	GCT	-	NULL		0.547	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD209	protein_coding	OTTHUMT00000462241.1	C	NM_021155	-		7810620	-1	no_errors	ENST00000315599	ensembl	human	known	74_37	missense	SNP	0.002	A
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.7274002212195365	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
BRD7	29117	genome.wustl.edu	37	16	50368678	50368679	+	Frame_Shift_Del	DEL	CT	CT	-	rs145896392		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr16:50368678_50368679delCT	ENST00000394688.3	-	7	989_990	c.830_831delAG	c.(829-831)gagfs	p.E277fs	BRD7_ENST00000394689.2_Frame_Shift_Del_p.E277fs			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	277					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTCCAGAGTCCTCTCTCTCTCT	0.47																																																	0								ENSG00000166164																																			BRD7	SO:0001589	frameshift_variant	0				HGNC	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.830_831delAG	16.37:g.50368688_50368689delCT	ENSP00000378180:p.Glu277fs	Somatic	0	37	0.00		0.7274002212195365	139	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E277fs	ENST00000394688.3	37	c.831_830	CCDS10742.1	16																																																																																			-	NULL		0.470	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	protein_coding	OTTHUMT00000256874.3	CT	NM_013263			50368679	-1	no_errors	ENST00000394689	ensembl	human	known	74_37	frame_shift_del	DEL	0.079:0.258	-
UBE2G2	7327	genome.wustl.edu	37	21	46193533	46193533	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr21:46193533C>T	ENST00000345496.2	-	5	584	c.314G>A	c.(313-315)aGc>aAc	p.S105N	UBE2G2_ENST00000477954.1_5'UTR|UBE2G2_ENST00000330942.5_Missense_Mutation_p.S77N	NM_003343.5	NP_003334.2	P60604	UB2G2_HUMAN	ubiquitin-conjugating enzyme E2G 2	105				MGYESSA -> HGLREQP (in Ref. 1; AAC32312). {ECO:0000305}.	ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K48-linked ubiquitination (GO:0070936)|protein N-linked glycosylation via asparagine (GO:0018279)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|central_nervous_system(1)|lung(1)	5				Colorectal(79;0.0638)		CTCCGCGCTGCTCTCGTAGCC	0.632																																																	0								ENSG00000184787						83.0	61.0	68.0					21																	46193533		2203	4300	6503	UBE2G2	SO:0001583	missense	0			-	HGNC	BC008351	CCDS13714.1, CCDS33586.1	21q22.3	2011-05-19	2011-05-19		ENSG00000184787	ENSG00000184787		"""Ubiquitin-conjugating enzymes E2"""	12483	protein-coding gene	gene with protein product		603124	"""ubiquitin-conjugating enzyme E2G 2 (homologous to yeast UBC7)"", ""ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)"""			9693041, 9925943	Standard	NM_003343		Approved	UBC7	uc002zfy.3	P60604	OTTHUMG00000089179	ENST00000345496.2:c.314G>A	21.37:g.46193533C>T	ENSP00000338348:p.Ser105Asn	Somatic	0	40	0.00		0.7274002212195365	103	50.24	104	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	23	58.18	A6NMQ7|A8K3L4|D3DSL7|P56554	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S105N	ENST00000345496.2	37	c.314	CCDS13714.1	21	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947301	0.53186	.	.	ENSG00000184787	ENST00000345496;ENST00000330942	T;T	0.58506	0.33;1.92	5.51	5.51	0.81932	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64394	0.2594	M	0.84326	2.69	0.80722	D	1	B	0.19706	0.038	B	0.28784	0.094	T	0.62053	-0.6935	10	0.17832	T	0.49	-11.4971	19.0088	0.92863	0.0:1.0:0.0:0.0	.	105	P60604	UB2G2_HUMAN	N	105;77	ENSP00000338348:S105N;ENSP00000331384:S77N	ENSP00000331384:S77N	S	-	2	0	UBE2G2	45017961	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.463000	0.80869	2.579000	0.87056	0.591000	0.81541	AGC	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.632	UBE2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2G2	protein_coding	OTTHUMT00000202647.2	C	NM_182688	-		46193533	-1	no_errors	ENST00000345496	ensembl	human	known	74_37	missense	SNP	1.000	T
MFSD2A	84879	genome.wustl.edu	37	1	40433245	40433245	+	Intron	SNP	G	G	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:40433245G>T	ENST00000372809.5	+	10	1193				MFSD2A_ENST00000372811.5_Intron|MFSD2A_ENST00000420632.2_Intron|MFSD2A_ENST00000480630.1_Intron	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A						establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GGAAGGGCAGGAGGGGCTCTG	0.577																																																	0								ENSG00000168389						56.0	46.0	49.0					1																	40433245		692	1591	2283	MFSD2A	SO:0001627	intron_variant	0			-	HGNC	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.1051-55G>T	1.37:g.40433245G>T		Somatic	0	24	0.00		0.7274002212195365	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A8K675|Q6UWU5|Q96F59|Q9BRC8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372809.5	37	NULL	CCDS44118.1	1																																																																																			-	-		0.577	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2A	protein_coding	OTTHUMT00000025756.1	G	NM_032793	-		40433245	+1	no_errors	ENST00000459917	ensembl	human	known	74_37	rna	SNP	0.000	T
SSH1	54434	genome.wustl.edu	37	12	109182324	109182324	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:109182324C>T	ENST00000326495.5	-	15	2683	c.2590G>A	c.(2590-2592)Gcg>Acg	p.A864T	SSH1_ENST00000360239.3_Missense_Mutation_p.A552T	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	864					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCGTGGAGCGCGGCTGGATCC	0.677																																																	0								ENSG00000084112						21.0	25.0	24.0					12																	109182324		2203	4298	6501	SSH1	SO:0001583	missense	0			-	HGNC	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2590G>A	12.37:g.109182324C>T	ENSP00000315713:p.Ala864Thr	Somatic	0	28	0.00		0.7274002212195365	16	60.00	24	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	8	55.56	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A864T	ENST00000326495.5	37	c.2590	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	C	0.845	-0.740559	0.03088	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.11495	2.96;2.77	2.91	-0.476	0.12100	.	46.390500	0.00166	N	0.000000	T	0.06142	0.0159	N	0.08118	0	0.09310	N	1	B;B	0.29862	0.102;0.259	B;B	0.25759	0.008;0.063	T	0.33445	-0.9868	10	0.18276	T	0.48	-0.0657	9.5786	0.39472	0.1139:0.5358:0.3504:0.0	.	864;552	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	T	552;864	ENSP00000353374:A552T;ENSP00000315713:A864T	ENSP00000315713:A864T	A	-	1	0	SSH1	107706453	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.025000	0.12413	0.085000	0.17107	0.655000	0.94253	GCG	-	NULL		0.677	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	protein_coding	OTTHUMT00000403724.1	C	NM_018984	-		109182324	-1	no_errors	ENST00000326495	ensembl	human	known	74_37	missense	SNP	0.000	T
GFI1B	8328	genome.wustl.edu	37	9	135863692	135863692	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr9:135863692G>T	ENST00000339463.3	+	8	1166	c.347G>T	c.(346-348)gGc>gTc	p.G116V	GFI1B_ENST00000372122.1_Missense_Mutation_p.G116V|GFI1B_ENST00000450530.1_Missense_Mutation_p.G116V|GFI1B_ENST00000534944.1_Missense_Mutation_p.G116V|GFI1B_ENST00000372123.1_Missense_Mutation_p.G116V|GFI1B_ENST00000372124.1_Missense_Mutation_p.G116V			Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription repressor	116	Interaction with ARIH2.				cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K9 methylation (GO:0051574)|regulation of erythrocyte differentiation (GO:0045646)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II transcription factor binding (GO:0001085)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		ACAACCTATGGCCACAGCTAC	0.627																																																	0								ENSG00000165702						104.0	86.0	92.0					9																	135863692		2203	4300	6503	GFI1B	SO:0001583	missense	0			-	HGNC	AF081946	CCDS6957.1, CCDS48049.1	9q34.13	2014-09-17	2007-10-04		ENSG00000165702	ENSG00000165702		"""Zinc fingers, C2H2-type"""	4238	protein-coding gene	gene with protein product		604383	"""growth factor independent 1B (potential regulator of CDKN1A, translocated in CML)"""			9878267	Standard	NM_001135031		Approved		uc004ccg.3	Q5VTD9	OTTHUMG00000020848	ENST00000339463.3:c.347G>T	9.37:g.135863692G>T	ENSP00000344782:p.Gly116Val	Somatic	0	81	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	86	30.40	O95270|Q5VTD8|Q6FHZ2|Q6T888	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G116V	ENST00000339463.3	37	c.347	CCDS6957.1	9	.	.	.	.	.	.	.	.	.	.	G	7.929	0.740297	0.15642	.	.	ENSG00000165702	ENST00000372124;ENST00000339463;ENST00000450530;ENST00000534944;ENST00000372123;ENST00000372122	T;T;T;T;T;T	0.08984	3.15;3.03;3.03;3.15;3.15;3.03	4.35	4.35	0.52113	.	0.498085	0.21951	N	0.066730	T	0.11836	0.0288	M	0.62723	1.935	0.32025	N	0.60027	B;B	0.21309	0.054;0.037	B;B	0.23574	0.047;0.015	T	0.02064	-1.1220	10	0.59425	D	0.04	-17.3413	12.2344	0.54508	0.0:0.0:1.0:0.0	.	116;116	Q5VTD9-2;Q5VTD9	.;GFI1B_HUMAN	V	116	ENSP00000361197:G116V;ENSP00000344782:G116V;ENSP00000409546:G116V;ENSP00000446134:G116V;ENSP00000361196:G116V;ENSP00000361195:G116V	ENSP00000344782:G116V	G	+	2	0	GFI1B	134853513	0.965000	0.33210	0.471000	0.27229	0.309000	0.27889	2.584000	0.46102	2.218000	0.71995	0.563000	0.77884	GGC	-	NULL		0.627	GFI1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GFI1B	protein_coding	OTTHUMT00000393840.1	G	NM_004188	-		135863692	+1	no_errors	ENST00000339463	ensembl	human	known	74_37	missense	SNP	0.417	T
MTG2	26164	genome.wustl.edu	37	20	60772864	60772864	+	Intron	SNP	G	G	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr20:60772864G>C	ENST00000370823.3	+	4	370				MTG2_ENST00000536470.1_Intron|MTG2_ENST00000436421.2_Intron|MTG2_ENST00000461411.1_3'UTR	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2						GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										ATAGGCCATGGTTGTCGTAAC	0.473																																																	0								ENSG00000101181						84.0	64.0	71.0					20																	60772864		2203	4300	6503	MTG2	SO:0001627	intron_variant	0			-	HGNC	AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.353-44G>C	20.37:g.60772864G>C		Somatic	0	44	0.00		0.7274002212195365	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370823.3	37	NULL	CCDS13492.1	20																																																																																			-	-		0.473	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	MTG2	protein_coding	OTTHUMT00000079989.1	G	NM_015666	-		60772864	+1	no_errors	ENST00000461411	ensembl	human	known	74_37	rna	SNP	0.001	C
SYT8	90019	genome.wustl.edu	37	11	1856623	1856623	+	Silent	SNP	G	G	A	rs540038185		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr11:1856623G>A	ENST00000381968.3	+	3	362	c.234G>A	c.(232-234)agG>agA	p.R78R	SYT8_ENST00000535046.1_Silent_p.R216R|SYT8_ENST00000436964.2_Silent_p.R64R|SYT8_ENST00000341958.3_Silent_p.R64R	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	78					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCGCCACAGGAAGAAGCCCA	0.701																																																	0								ENSG00000149043						16.0	18.0	17.0					11																	1856623		2190	4284	6474	SYT8	SO:0001819	synonymous_variant	0			-	HGNC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.234G>A	11.37:g.1856623G>A		Somatic	0	36	0.00		0.7274002212195365	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	37	39.34	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G70E	ENST00000381968.3	37	c.209	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	g	4.688	0.127884	0.08981	.	.	ENSG00000149043	ENST00000381978	.	.	.	3.34	2.4	0.29515	.	.	.	.	.	T	0.33000	0.0848	.	.	.	0.27866	N	0.940201	.	.	.	.	.	.	T	0.22068	-1.0227	4	.	.	.	.	6.94	0.24488	0.0:0.2081:0.6044:0.1875	.	.	.	.	K	77	.	.	E	+	1	0	SYT8	1813199	0.261000	0.24063	0.059000	0.19551	0.333000	0.28666	0.298000	0.19120	0.741000	0.32674	0.305000	0.20034	GAA	-	NULL		0.701	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	protein_coding	OTTHUMT00000025013.4	G		-		1856623	+1	no_errors	ENST00000424556	ensembl	human	known	74_37	missense	SNP	0.140	A
FAM230B	642633	genome.wustl.edu	37	22	21537782	21537782	+	RNA	SNP	G	G	A	rs12172393		TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr22:21537782G>A	ENST00000451257.1	+	0	768									family with sequence similarity 230, member B (non-protein coding)																		GGCATCGCCAGCGAGGACGCC	0.736																																																	0								ENSG00000215498																																			FAM230B			0			-	HGNC	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21537782G>A		Somatic	0	30	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			-	-		0.736	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	processed_transcript	OTTHUMT00000320063.1	G	NR_108107	rs12172393		21537782	+1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	SNP	0.002	A
GNPTAB	79158	genome.wustl.edu	37	12	102161854	102161856	+	In_Frame_Del	DEL	TAC	TAC	-			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	TAC	TAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr12:102161854_102161856delTAC	ENST00000299314.7	-	11	1629_1631	c.1367_1369delGTA	c.(1366-1371)tgtaat>tat	p.456_457CN>Y	GNPTAB_ENST00000549940.1_In_Frame_Del_p.456_457CN>Y|RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	456					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GCTGAATTATTACAAGCCTTGTC	0.414																																																	0								ENSG00000111670																																			GNPTAB	SO:0001651	inframe_deletion	0				HGNC	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1367_1369delGTA	12.37:g.102161854_102161856delTAC	ENSP00000299314:p.Cys456_Asn457delinsTyr	Somatic	0	73	0.00		0.7274002212195365	38	30.91	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	63	31.52	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.CN456in_frame_delY	ENST00000299314.7	37	c.1369_1367	CCDS9088.1	12																																																																																			-	pfam_Notch_dom,superfamily_Notch_dom,smart_Notch_dom,pfscan_Notch_dom		0.414	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	TAC				102161856	-1	no_errors	ENST00000299314	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
MTF2	22823	genome.wustl.edu	37	1	93585109	93585109	+	Intron	SNP	T	T	C			TCGA-X6-A7WD-01A-21D-A351-09	TCGA-X6-A7WD-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6a327d8b-23f5-46e7-91a9-33e4fd0bf8d4	91308f69-8b3e-4ceb-9754-926945ab8da8	g.chr1:93585109T>C	ENST00000370298.4	+	8	1086				MTF2_ENST00000370303.4_Intron|MTF2_ENST00000471953.1_Intron|MTF2_ENST00000540243.1_Intron|MTF2_ENST00000545708.1_Intron	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2						chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		CCTGATGTCATCTTCACTAAG	0.289																																																	0								ENSG00000143033																																			MTF2	SO:0001627	intron_variant	0			-	HGNC	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.797+151T>C	1.37:g.93585109T>C		Somatic	0	18	0.00		0.7274002212195365	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	22	33.33	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370298.4	37	NULL	CCDS742.1	1																																																																																			-	-		0.289	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF2	protein_coding	OTTHUMT00000028075.3	T	NM_007358	-		93585109	+1	no_errors	ENST00000468457	ensembl	human	known	74_37	rna	SNP	0.071	C
