#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SREBF1	6720	genome.wustl.edu	37	17	17719281	17719281	+	Missense_Mutation	SNP	G	G	T	rs529689353		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:17719281G>T	ENST00000261646.5	-	12	2460	c.2276C>A	c.(2275-2277)gCc>gAc	p.A759D	MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000338854.5_Missense_Mutation_p.A759D|SREBF1_ENST00000395757.1_Missense_Mutation_p.A505D|SREBF1_ENST00000355815.4_Missense_Mutation_p.A789D	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	759					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCACTGCATGGCAGGAGGCAC	0.652																																																	0								ENSG00000072310						55.0	52.0	53.0					17																	17719281		2203	4300	6503	SREBF1	SO:0001583	missense	0			-	HGNC	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2276C>A	17.37:g.17719281G>T	ENSP00000261646:p.Ala759Asp	Somatic	0	59	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.A789D	ENST00000261646.5	37	c.2366	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.808490|2.808490	0.50421|0.50421	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161;ENST00000447641|ENST00000395751	T;T;T;T|.	0.13196|.	2.61;2.61;2.61;2.61|.	5.2|5.2	4.11|4.11	0.48088|0.48088	.|.	0.063428|.	0.64402|.	D|.	0.000008|.	T|.	0.60183|.	0.2249|.	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	P;D;P|.	0.59357|.	0.954;0.985;0.948|.	P;P;P|.	0.61533|.	0.779;0.89;0.802|.	T|.	0.57236|.	-0.7846|.	10|.	0.36615|.	T|.	0.2|.	-13.4023|-13.4023	13.5083|13.5083	0.61497|0.61497	0.0831:0.0:0.9169:0.0|0.0831:0.0:0.9169:0.0	.|.	759;789;378|.	P36956;P36956-4;A8MTU8|.	SRBP1_HUMAN;.;.|.	D|X	759;789;759;505;378;596;685;84|766	ENSP00000345822:A759D;ENSP00000348069:A789D;ENSP00000261646:A759D;ENSP00000379106:A505D|.	ENSP00000261646:A759D|.	A|C	-|-	2|3	0|2	SREBF1|SREBF1	17660006|17660006	1.000000|1.000000	0.71417|0.71417	0.946000|0.946000	0.38457|0.38457	0.965000|0.965000	0.64279|0.64279	6.514000|6.514000	0.73746|0.73746	1.150000|1.150000	0.42419|0.42419	0.561000|0.561000	0.74099|0.74099	GCC|TGC	-	NULL		0.652	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	protein_coding	OTTHUMT00000131771.1	G	NM_004176	-		17719281	-1	no_errors	ENST00000355815	ensembl	human	known	74_37	missense	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81777917	81777917	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:81777917C>A	ENST00000549396.1	-	9	1029	c.869G>T	c.(868-870)cGt>cTt	p.R290L	PPFIA2_ENST00000550359.2_Missense_Mutation_p.R137L|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R272L|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R272L|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R290L|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R216L|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R191L|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R290L|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R290L	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	290	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GGCTGCTAAACGTTCTTTCAT	0.403																																																	0								ENSG00000139220						125.0	121.0	122.0					12																	81777917		1880	4110	5990	PPFIA2	SO:0001583	missense	0			-	HGNC	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.869G>T	12.37:g.81777917C>A	ENSP00000450337:p.Arg290Leu	Somatic	0	51	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R290L	ENST00000549396.1	37	c.869	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.531909|5.531909	0.96446|0.96446	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000548790	T;T;T;T;T;T;T|.	0.79352|.	1.17;1.17;1.17;-1.26;1.17;1.17;1.17|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77678|0.77678	0.4166|0.4166	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.996;0.987|.	D;D|.	0.79108|.	0.992;0.953|.	T|T	0.75852|0.75852	-0.3171|-0.3171	10|5	0.62326|.	D|.	0.03|.	-11.9479|-11.9479	19.9576|19.9576	0.97228|0.97228	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	190;290|.	B7Z4H8;O75334|.	.;LIPA2_HUMAN|.	L|F	290;272;216;301;272;290;191;290|108	ENSP00000450337:R290L;ENSP00000450298:R272L;ENSP00000385093:R216L;ENSP00000327416:R272L;ENSP00000449338:R290L;ENSP00000388373:R191L;ENSP00000447868:R290L|.	ENSP00000327416:R272L|.	R|V	-|-	2|1	0|0	PPFIA2|PPFIA2	80302048|80302048	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	7.776000|7.776000	0.85560|0.85560	2.720000|2.720000	0.93068|0.93068	0.557000|0.557000	0.71058|0.71058	CGT|GTT	-	NULL		0.403	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	protein_coding	OTTHUMT00000408030.1	C		-		81777917	-1	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF195	7748	genome.wustl.edu	37	11	3392908	3392908	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:3392908G>A	ENST00000399602.4	-	2	155	c.29C>T	c.(28-30)gCc>gTc	p.A10V	ZNF195_ENST00000354599.6_Missense_Mutation_p.A10V|ZNF195_ENST00000429541.2_Missense_Mutation_p.A14V|ZNF195_ENST00000005082.9_Missense_Mutation_p.A10V|ZNF195_ENST00000343338.7_Missense_Mutation_p.A14V|ZNF195_ENST00000526601.1_Missense_Mutation_p.A14V|ZNF195_ENST00000527386.1_5'UTR|AC123788.1_ENST00000581561.1_RNA|ZNF195_ENST00000528796.1_Missense_Mutation_p.A10V|ZNF195_ENST00000438262.2_Missense_Mutation_p.A14V	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	10	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		GAATTCTATGGCCACATCCCT	0.448																																																	0								ENSG00000005801						73.0	78.0	76.0					11																	3392908		2195	4298	6493	ZNF195	SO:0001583	missense	0			-	HGNC		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.29C>T	11.37:g.3392908G>A	ENSP00000382511:p.Ala10Val	Somatic	0	66	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A10V	ENST00000399602.4	37	c.29	CCDS44522.1	11	.	.	.	.	.	.	.	.	.	.	g	17.81	3.481831	0.63849	.	.	ENSG00000005801	ENST00000528796;ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601;ENST00000438262;ENST00000528410;ENST00000533036;ENST00000529678;ENST00000427810;ENST00000534569;ENST00000525502;ENST00000532539	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.03301	3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98;3.98	1.19	1.19	0.21007	Krueppel-associated box (4);	.	.	.	.	T	0.13415	0.0325	M	0.79926	2.475	0.09310	N	1	P;P;D;P;D	0.60575	0.877;0.512;0.988;0.899;0.988	D;B;D;P;D	0.65010	0.916;0.11;0.931;0.787;0.931	T	0.06807	-1.0806	9	0.56958	D	0.05	.	5.6377	0.17546	0.0:0.0:1.0:0.0	.	14;10;14;10;10	O14628-6;O14628-5;O14628-7;O14628;O14628-4	.;.;.;ZN195_HUMAN;.	V	10;10;10;14;14;10;14;14;14;10;14;25;14;10;14	ENSP00000432720:A10V;ENSP00000346613:A10V;ENSP00000382511:A10V;ENSP00000344483:A14V;ENSP00000387998:A14V;ENSP00000005082:A10V;ENSP00000435828:A14V;ENSP00000414353:A14V;ENSP00000431937:A14V;ENSP00000433911:A10V;ENSP00000434715:A14V;ENSP00000390663:A25V;ENSP00000437265:A14V;ENSP00000434006:A10V;ENSP00000435153:A14V	ENSP00000005082:A10V	A	-	2	0	ZNF195	3349484	1.000000	0.71417	0.014000	0.15608	0.899000	0.52679	2.642000	0.46596	0.590000	0.29694	0.313000	0.20887	GCC	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.448	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF195	protein_coding	OTTHUMT00000032321.2	G		-		3392908	-1	no_errors	ENST00000399602	ensembl	human	known	74_37	missense	SNP	0.133	A
CKAP2	26586	genome.wustl.edu	37	13	53048039	53048039	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:53048039T>C	ENST00000378037.5	+	8	1715	c.1625T>C	c.(1624-1626)gTa>gCa	p.V542A	CKAP2_ENST00000258607.5_Missense_Mutation_p.V541A|CKAP2_ENST00000490903.1_Missense_Mutation_p.V493A	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GGTGTTGATGTAGATCCAGAA	0.328																																																	0								ENSG00000136108						93.0	101.0	98.0					13																	53048039		2203	4300	6503	CKAP2	SO:0001583	missense	0			-	HGNC	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1625T>C	13.37:g.53048039T>C	ENSP00000367276:p.Val542Ala	Somatic	0	113	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	54	23.94		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V542A	ENST00000378037.5	37	c.1625	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	0.329	-0.957110	0.02267	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.21361	2.01;2.01;2.01	5.91	-1.1	0.09872	.	1.446920	0.04408	N	0.365504	T	0.16938	0.0407	L	0.53249	1.67	0.09310	N	1	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.21546	0.035;0.035;0.035	T	0.23368	-1.0190	10	0.13108	T	0.6	-0.6036	1.8007	0.03071	0.1261:0.2838:0.1302:0.4599	.	493;542;541	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	A	541;542;493	ENSP00000258607:V541A;ENSP00000367276:V542A;ENSP00000417830:V493A	ENSP00000258607:V541A	V	+	2	0	CKAP2	51946040	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	-0.110000	0.10824	-0.100000	0.12241	-0.256000	0.11100	GTA	-	NULL		0.328	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	protein_coding	OTTHUMT00000355010.2	T		-		53048039	+1	no_errors	ENST00000378037	ensembl	human	known	74_37	missense	SNP	0.000	C
GLG1	2734	genome.wustl.edu	37	16	74487194	74487194	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:74487194delT	ENST00000422840.2	-	26	3410	c.3411delA	c.(3409-3411)caafs	p.Q1137fs	GLG1_ENST00000447066.2_Frame_Shift_Del_p.Q1126fs|GLG1_ENST00000205061.5_Frame_Shift_Del_p.Q1137fs	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	1137					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						ACGTCATTACTTGCATGGCAA	0.498																																																	0								ENSG00000090863						142.0	119.0	127.0					16																	74487194		2198	4300	6498	GLG1	SO:0001589	frameshift_variant	0				HGNC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.3411delA	16.37:g.74487194delT	ENSP00000405984:p.Gln1137fs	Somatic	0	44	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cys-rich_GLG1_repeat	p.V1138fs	ENST00000422840.2	37	c.3411	CCDS45527.1	16																																																																																			-	NULL		0.498	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	protein_coding	OTTHUMT00000435750.1	T	NM_012201			74487194	-1	no_errors	ENST00000205061	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CD84	8832	genome.wustl.edu	37	1	160549203	160549203	+	Silent	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:160549203A>G	ENST00000311224.4	-	1	91	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD84_ENST00000368051.3_Silent_p.L9L|CD84_ENST00000368048.3_Silent_p.L9L|CD84_ENST00000368054.3_Silent_p.L9L|CD84_ENST00000534968.1_Silent_p.L9L|CD84_ENST00000368047.3_5'UTR	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	9					blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CAAAGGAGCAAGATCCATAGG	0.453																																																	0								ENSG00000066294						152.0	136.0	141.0					1																	160549203		2203	4300	6503	CD84	SO:0001819	synonymous_variant	0			-	HGNC	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.25T>C	1.37:g.160549203A>G		Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	18	28.00	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfscan_Ig-like_dom	p.L9	ENST00000311224.4	37	c.25	CCDS53396.1	1																																																																																			-	NULL		0.453	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	protein_coding	OTTHUMT00000059092.1	A	NM_003874	-		160549203	-1	no_errors	ENST00000534968	ensembl	human	known	74_37	silent	SNP	0.999	G
NUF2	83540	genome.wustl.edu	37	1	163313591	163313591	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:163313591T>G	ENST00000271452.3	+	10	1017	c.738T>G	c.(736-738)gaT>gaG	p.D246E	NUF2_ENST00000524800.1_Missense_Mutation_p.D246E|NUF2_ENST00000367900.3_Missense_Mutation_p.D246E	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	246	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AAATTGTGGATTCTCCAGAGA	0.274																																																	0								ENSG00000143228						24.0	29.0	27.0					1																	163313591		2149	4249	6398	NUF2	SO:0001583	missense	0			-	HGNC	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.738T>G	1.37:g.163313591T>G	ENSP00000271452:p.Asp246Glu	Somatic	0	281	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	129	9.15	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinetochore_Nuf2	p.D246E	ENST00000271452.3	37	c.738	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	T	4.698	0.129875	0.08981	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.28454	1.64;1.61;1.61	4.83	-2.34	0.06704	.	0.101007	0.64402	N	0.000002	T	0.02342	0.0072	N	0.11427	0.14	0.28485	N	0.914772	B;B	0.17268	0.021;0.021	B;B	0.14023	0.01;0.01	T	0.32481	-0.9905	9	0.02654	T	1	-18.4689	2.4131	0.04430	0.1461:0.4114:0.1502:0.2923	.	246;246	E9PQC4;Q9BZD4	.;NUF2_HUMAN	E	246	ENSP00000436888:D246E;ENSP00000356875:D246E;ENSP00000271452:D246E	ENSP00000271452:D246E	D	+	3	2	NUF2	161580215	0.992000	0.36948	0.995000	0.50966	0.992000	0.81027	-0.038000	0.12144	-0.247000	0.09597	0.477000	0.44152	GAT	-	NULL		0.274	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	protein_coding	OTTHUMT00000082812.1	T	NM_145697	-		163313591	+1	no_errors	ENST00000271452	ensembl	human	known	74_37	missense	SNP	0.980	G
UBE2J1	51465	genome.wustl.edu	37	6	90045027	90045027	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:90045027G>T	ENST00000435041.2	-	6	830	c.552C>A	c.(550-552)agC>agA	p.S184R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	184					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GTACCTTAAAGCTTATTTGCC	0.398																																																	0								ENSG00000198833						91.0	93.0	92.0					6																	90045027		2203	4300	6503	UBE2J1	SO:0001583	missense	0			-	HGNC	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.552C>A	6.37:g.90045027G>T	ENSP00000451261:p.Ser184Arg	Somatic	0	53	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	20.83	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S184R	ENST00000435041.2	37	c.552	CCDS5021.1	6	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139528	0.37728	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.64803	-0.12	6.03	3.64	0.41730	Ubiquitin-conjugating enzyme/RWD-like (1);	0.119583	0.85682	D	0.000000	T	0.39600	0.1084	M	0.68952	2.095	0.48288	D	0.999622	B	0.14805	0.011	B	0.14578	0.011	T	0.27123	-1.0083	10	0.29301	T	0.29	-8.979	9.2316	0.37441	0.7802:0.0:0.2198:0.0	.	184	Q9Y385	UB2J1_HUMAN	R	184;169	ENSP00000451261:S184R	ENSP00000354684:S184R	S	-	3	2	UBE2J1	90101746	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	0.971000	0.29396	0.532000	0.28657	-0.351000	0.07748	AGC	-	NULL		0.398	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2J1	protein_coding	OTTHUMT00000043742.2	G	NM_016021	-		90045027	-1	no_errors	ENST00000435041	ensembl	human	known	74_37	missense	SNP	1.000	T
OR2V2	285659	genome.wustl.edu	37	5	180582647	180582647	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:180582647G>A	ENST00000328275.1	+	1	705	c.705G>A	c.(703-705)tgG>tgA	p.W235*		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCAGGCCTGGAAAAAGGCCC	0.567																																																	0								ENSG00000182613						145.0	140.0	142.0					5																	180582647		2203	4300	6503	OR2V2	SO:0001587	stop_gained	0			-	HGNC	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.705G>A	5.37:g.180582647G>A	ENSP00000332185:p.Trp235*	Somatic	0	73	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	19	45.71	Q6IFL6|Q8NGV1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W235*	ENST00000328275.1	37	c.705	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	4.556	0.103235	0.08731	.	.	ENSG00000182613	ENST00000328275	.	.	.	3.48	-6.95	0.01628	.	2.265590	0.02537	N	0.094241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	6.4091	0.21680	0.1086:0.0964:0.6352:0.1597	.	.	.	.	X	235	.	ENSP00000332185:W235X	W	+	3	0	OR2V2	180515253	0.000000	0.05858	0.004000	0.12327	0.079000	0.17450	-1.623000	0.02040	-1.089000	0.03073	0.305000	0.20034	TGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.567	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	protein_coding	OTTHUMT00000253529.1	G		-		180582647	+1	no_errors	ENST00000328275	ensembl	human	known	74_37	nonsense	SNP	0.005	A
IFNA1	3439	genome.wustl.edu	37	9	21440957	21440957	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:21440957A>T	ENST00000276927.1	+	1	518	c.451A>T	c.(451-453)Act>Tct	p.T151S		NM_024013.2	NP_076918.1	P01562	IFNA1_HUMAN	interferon, alpha 1	151					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)	7				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CCGAAGAATCACTCTCTATCT	0.473																																																	0								ENSG00000197919						39.0	47.0	44.0					9																	21440957		2166	4251	6417	IFNA1	SO:0001583	missense	0			-	HGNC		CCDS6508.1	9p22	2010-12-10			ENSG00000197919	ENSG00000197919		"""Interferons"""	5417	protein-coding gene	gene with protein product	"""IFN-alpha 1b"", ""interferon alpha 1b"""	147660				1385305	Standard	NM_024013		Approved	IFNA@, IFL, IFN, IFN-ALPHA, IFNA13, IFN-alphaD	uc003zpd.2	P01562	OTTHUMG00000019673	ENST00000276927.1:c.451A>T	9.37:g.21440957A>T	ENSP00000276927:p.Thr151Ser	Somatic	0	42	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.T151S	ENST00000276927.1	37	c.451	CCDS6508.1	9	.	.	.	.	.	.	.	.	.	.	A	10.95	1.497007	0.26861	.	.	ENSG00000197919	ENST00000276927	T	0.03272	3.99	3.21	-6.43	0.01926	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.100060	0.06754	N	0.780602	T	0.02807	0.0084	L	0.39633	1.23	0.09310	N	1	B	0.06786	0.001	B	0.17433	0.018	T	0.43861	-0.9365	10	0.23302	T	0.38	.	2.8643	0.05596	0.2434:0.445:0.0878:0.2238	.	151	P01562	IFNA1_HUMAN	S	151	ENSP00000276927:T151S	ENSP00000276927:T151S	T	+	1	0	IFNA1	21430957	0.000000	0.05858	0.000000	0.03702	0.918000	0.54935	-3.705000	0.00388	-2.343000	0.00623	0.491000	0.48974	ACT	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta		0.473	IFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA1	protein_coding	OTTHUMT00000051902.1	A	NM_024013	-		21440957	+1	no_errors	ENST00000276927	ensembl	human	known	74_37	missense	SNP	0.000	T
STX7	8417	genome.wustl.edu	37	6	132781974	132781974	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:132781974delT	ENST00000367941.2	-	10	822	c.709delA	c.(709-711)accfs	p.T237fs		NM_003569.2	NP_003560.2	O15400	STX7_HUMAN	syntaxin 7	237					intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(1)|lung(5)	19	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		ATGCACAGGGTTTTTCTGGAT	0.378																																																	0								ENSG00000079950						128.0	116.0	120.0					6																	132781974		2203	4300	6503	STX7	SO:0001589	frameshift_variant	0				HGNC	U77942	CCDS5153.1	6q23.1	2008-02-05			ENSG00000079950	ENSG00000079950			11442	protein-coding gene	gene with protein product		603217				9358037	Standard	NM_003569		Approved		uc003qdg.2	O15400	OTTHUMG00000015577	ENST00000367941.2:c.709delA	6.37:g.132781974delT	ENSP00000356918:p.Thr237fs	Somatic	0	43	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	E1P579|Q5SZW2|Q96ES9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.T237fs	ENST00000367941.2	37	c.709	CCDS5153.1	6																																																																																			-	NULL		0.378	STX7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STX7	protein_coding	OTTHUMT00000042252.2	T				132781974	-1	no_errors	ENST00000367941	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ADCY4	196883	genome.wustl.edu	37	14	24800488	24800489	+	Frame_Shift_Ins	INS	-	-	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr14:24800488_24800489insA	ENST00000310677.4	-	6	856_857	c.743_744insT	c.(742-744)cagfs	p.Q248fs	ADCY4_ENST00000554068.2_Frame_Shift_Ins_p.Q248fs|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000418030.2_Frame_Shift_Ins_p.Q248fs|ADCY4_ENST00000396747.3_De_novo_Start_OutOfFrame	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	248					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CCTGTCCTGCCTGCAGCCGTGC	0.559																																																	0								ENSG00000129467																																			ADCY4	SO:0001589	frameshift_variant	0				HGNC	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.743_744insT	14.37:g.24800488_24800489insA	ENSP00000312126:p.Gln248fs	Somatic	0	51	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.Q248fs	ENST00000310677.4	37	c.744_743	CCDS9627.1	14																																																																																			-	smart_A/G_cyclase		0.559	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY4	protein_coding	OTTHUMT00000073200.4	-				24800489	-1	no_errors	ENST00000310677	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
HOOK1	51361	genome.wustl.edu	37	1	60330673	60330673	+	Intron	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:60330673T>A	ENST00000371208.3	+	18	1918				HOOK1_ENST00000395561.2_Intron|HOOK1_ENST00000465876.1_Intron	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1						early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TTTTGGCACCTGCCGTGTGCC	0.403																																																	0								ENSG00000134709																																			HOOK1	SO:0001627	intron_variant	0			-	HGNC	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1662-162T>A	1.37:g.60330673T>A		Somatic	0	22	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371208.3	37	NULL	CCDS612.1	1																																																																																			-	-		0.403	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	protein_coding	OTTHUMT00000024934.1	T	NM_015888	-		60330673	+1	no_errors	ENST00000466803	ensembl	human	known	74_37	rna	SNP	0.000	A
APOB	338	genome.wustl.edu	37	2	21247913	21247913	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:21247913G>T	ENST00000233242.1	-	16	2455	c.2328C>A	c.(2326-2328)taC>taA	p.Y776*	APOB_ENST00000399256.4_Nonsense_Mutation_p.Y776*	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	776					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGATGCGGAGGTAGGCTCTGG	0.493																																																	0								ENSG00000084674						94.0	96.0	95.0					2																	21247913		2203	4300	6503	APOB	SO:0001587	stop_gained	0			-	HGNC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2328C>A	2.37:g.21247913G>T	ENSP00000233242:p.Tyr776*	Somatic	0	84	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	47	32.86	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.Y776*	ENST00000233242.1	37	c.2328	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.228076	0.98717	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	.	.	.	5.7	4.58	0.56647	.	0.121727	0.37261	N	0.002175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1262	0.42652	0.2056:0.0:0.7944:0.0	.	.	.	.	X	776	.	ENSP00000233242:Y776X	Y	-	3	2	APOB	21101418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.977000	0.49297	1.196000	0.43129	0.655000	0.94253	TAC	-	pfam_Vitellinogen_open_b-sht,superfamily_Lipid_transp_b-sht_shell		0.493	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	G		-		21247913	-1	no_errors	ENST00000233242	ensembl	human	known	74_37	nonsense	SNP	1.000	T
REV3L	5980	genome.wustl.edu	37	6	111636558	111636558	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:111636558G>T	ENST00000358835.3	-	28	8832	c.8378C>A	c.(8377-8379)aCt>aAt	p.T2793N	REV3L_ENST00000368805.1_Missense_Mutation_p.T2793N|REV3L_ENST00000368802.3_Missense_Mutation_p.T2793N|REV3L_ENST00000462119.1_5'UTR|REV3L_ENST00000435970.1_Missense_Mutation_p.T2715N|RP5-1112D6.8_ENST00000607434.1_RNA			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2793					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTGCTCCTTAGTGGCTCCTTT	0.353								DNA polymerases (catalytic subunits)																																									0								ENSG00000009413						71.0	64.0	66.0					6																	111636558		2203	4300	6503	REV3L	SO:0001583	missense	0			-	HGNC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.8378C>A	6.37:g.111636558G>T	ENSP00000351697:p.Thr2793Asn	Somatic	0	39	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	O43214|Q5TC33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.T2793N	ENST00000358835.3	37	c.8378	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939637	0.92526	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	5.51	5.51	0.81932	DNA polymerase, palm domain (1);DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.127436	0.52532	D	0.000075	T	0.22475	0.0542	M	0.64404	1.975	0.53688	D	0.999976	P	0.42123	0.771	P	0.51516	0.672	T	0.00719	-1.1595	10	0.25106	T	0.35	-6.9829	19.415	0.94690	0.0:0.0:1.0:0.0	.	2793	O60673	DPOLZ_HUMAN	N	2793;2793;2793;2715	ENSP00000357792:T2793N;ENSP00000357795:T2793N;ENSP00000351697:T2793N;ENSP00000402003:T2715N	ENSP00000351697:T2793N	T	-	2	0	REV3L	111743251	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.872000	0.87187	2.600000	0.87896	0.650000	0.86243	ACT	-	pfam_DNA-dir_DNA_pol_B_multi_dom		0.353	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	protein_coding	OTTHUMT00000043695.1	G	NM_002912	-		111636558	-1	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	SNP	1.000	T
LGALS7B	653499	genome.wustl.edu	37	19	39281369	39281369	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:39281369G>A	ENST00000314980.4	+	3	152	c.136G>A	c.(136-138)Gat>Aat	p.D46N		NM_001042507.3	NP_001035972.1	P47929	LEG7_HUMAN	lectin, galactoside-binding, soluble, 7B	46	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|heterophilic cell-cell adhesion (GO:0007157)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carbohydrate binding (GO:0030246)										GCAGGGCTCCGATGCCGCCCT	0.642																																																	0								ENSG00000178934						35.0	38.0	37.0					19																	39281369		2201	4298	6499	LGALS7B	SO:0001583	missense	0			-	HGNC		CCDS42565.1	19q13.2	2011-08-04			ENSG00000178934	ENSG00000178934		"""Lectins, galactoside-binding"""	34447	protein-coding gene	gene with protein product	"""galectin 7B"""						Standard	NM_001042507		Approved	GAL7	uc002ojf.4	P47929		ENST00000314980.4:c.136G>A	19.37:g.39281369G>A	ENSP00000313571:p.Asp46Asn	Somatic	0	265	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	192	11.11	Q6IB87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.D46N	ENST00000314980.4	37	c.136	CCDS42565.1	19	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632873	0.67015	.	.	ENSG00000178934	ENST00000314980	T	0.20881	2.04	4.31	4.31	0.51392	.	0.336624	0.25419	N	0.030807	T	0.31327	0.0793	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.10086	-1.0645	7	0.59425	D	0.04	-50.8757	13.8728	0.63629	0.0:0.0:1.0:0.0	.	.	.	.	N	46	ENSP00000313571:D46N	ENSP00000313571:D46N	D	+	1	0	LGALS7B	43973209	0.032000	0.19561	0.010000	0.14722	0.001000	0.01503	1.553000	0.36255	2.241000	0.73720	0.650000	0.86243	GAT	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD		0.642	LGALS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS7B	protein_coding	OTTHUMT00000462638.1	G		-		39281369	+1	no_errors	ENST00000314980	ensembl	human	known	74_37	missense	SNP	0.022	A
CHM	1121	genome.wustl.edu	37	X	85213903	85213904	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:85213903_85213904delGT	ENST00000357749.2	-	6	810_811	c.781_782delAC	c.(781-783)accfs	p.T261fs	CHM_ENST00000537751.1_Frame_Shift_Del_p.T113fs|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	261					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AAGAATCCTGGTAATATTTTTA	0.347																																																	0								ENSG00000188419																																			CHM	SO:0001589	frameshift_variant	0				HGNC	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.781_782delAC	X.37:g.85213903_85213904delGT	ENSP00000350386:p.Thr261fs	Somatic	0	73	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	A1L4D2|O43732	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.T261fs	ENST00000357749.2	37	c.782_781	CCDS14454.1	X																																																																																			-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk		0.347	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	protein_coding	OTTHUMT00000057396.3	GT	NM_000390			85213904	-1	no_errors	ENST00000357749	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
FRMD4B	23150	genome.wustl.edu	37	3	69230187	69230187	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:69230187C>A	ENST00000398540.3	-	21	2797	c.2714G>T	c.(2713-2715)cGg>cTg	p.R905L	FRMD4B_ENST00000542259.1_Missense_Mutation_p.R851L|FRMD4B_ENST00000478263.1_Missense_Mutation_p.R557L	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	905					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CCCAGAGGCCCGCTGGTACCA	0.587																																																	0								ENSG00000114541						75.0	72.0	73.0					3																	69230187		1987	4185	6172	FRMD4B	SO:0001583	missense	0			-	HGNC	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2714G>T	3.37:g.69230187C>A	ENSP00000381549:p.Arg905Leu	Somatic	0	40	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	29	32.56	Q8TAI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3338,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.R905L	ENST00000398540.3	37	c.2714	CCDS46863.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898813	0.91962	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.94184	-3.37;-3.32	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.96617	0.8896	M	0.71036	2.16	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96565	0.9418	10	0.87932	D	0	-16.9233	20.1141	0.97919	0.0:1.0:0.0:0.0	.	749;905	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	L	905;851;557	ENSP00000381549:R905L;ENSP00000437658:R851L	ENSP00000381549:R905L	R	-	2	0	FRMD4B	69312877	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	7.487000	0.81328	2.757000	0.94681	0.591000	0.81541	CGG	-	NULL		0.587	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD4B	protein_coding	OTTHUMT00000352111.1	C		-		69230187	-1	no_errors	ENST00000398540	ensembl	human	known	74_37	missense	SNP	1.000	A
HMBOX1	79618	genome.wustl.edu	37	8	28906830	28906832	+	Intron	DEL	GGA	GGA	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:28906830_28906832delGGA	ENST00000397358.3	+	10	1829				HMBOX1_ENST00000444075.1_In_Frame_Del_p.E386del|HMBOX1_ENST00000558662.1_In_Frame_Del_p.E386del|HMBOX1_ENST00000355231.5_Intron|HMBOX1_ENST00000519047.1_Intron|RNA5SP260_ENST00000363849.1_RNA|HMBOX1_ENST00000524238.1_In_Frame_Del_p.E386del|HMBOX1_ENST00000523613.1_3'UTR|HMBOX1_ENST00000517386.1_Intron|HMBOX1_ENST00000287701.10_Intron	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		TACGCAATggggaggaggaggag	0.453																																																	0								ENSG00000147421																																			HMBOX1	SO:0001627	intron_variant	0				HGNC	AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.1125+265GGA>-	8.37:g.28906839_28906841delGGA		Somatic	0	37	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.E386in_frame_del	ENST00000397358.3	37	c.1146_1148	CCDS6071.1	8																																																																																			-	NULL		0.453	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	protein_coding	OTTHUMT00000255267.4	GGA	NM_024567			28906832	+1	no_errors	ENST00000444075	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
NRG3	10718	genome.wustl.edu	37	10	84745311	84745311	+	Missense_Mutation	SNP	C	C	A	rs201882406		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:84745311C>A	ENST00000404547.1	+	10	2113	c.2113C>A	c.(2113-2115)Caa>Aaa	p.Q705K	NRG3_ENST00000372142.2_Missense_Mutation_p.Q484K|NRG3_ENST00000556918.1_Missense_Mutation_p.Q511K|NRG3_ENST00000537893.1_Missense_Mutation_p.Q331K|NRG3_ENST00000372141.2_Missense_Mutation_p.Q681K|NRG3_ENST00000545131.1_Missense_Mutation_p.Q331K|NRG3_ENST00000404576.2_Missense_Mutation_p.Q485K			P56975	NRG3_HUMAN	neuregulin 3	705					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ACGAGAGGCGCAATTTGTCTT	0.463																																																	0								ENSG00000185737						76.0	73.0	74.0					10																	84745311		2203	4300	6503	NRG3	SO:0001583	missense	0			-	HGNC	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.2113C>A	10.37:g.84745311C>A	ENSP00000384796:p.Gln705Lys	Somatic	0	63	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_EG-like_dom	p.Q705K	ENST00000404547.1	37	c.2113	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358138	0.24598	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.52295	1.3;1.29;1.31;0.67;1.24;0.78;0.78	5.15	5.15	0.70609	.	0.088628	0.48767	D	0.000161	T	0.34193	0.0889	N	0.21448	0.665	0.38282	D	0.94245	B;B;B;B	0.20887	0.049;0.049;0.02;0.049	B;B;B;B	0.22152	0.008;0.038;0.026;0.008	T	0.24225	-1.0166	10	0.44086	T	0.13	-33.2025	11.5654	0.50802	0.1784:0.8216:0.0:0.0	.	680;705;484;681	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	K	681;705;680;484;485;511;331;331	ENSP00000361214:Q681K;ENSP00000384796:Q705K;ENSP00000361215:Q484K;ENSP00000385804:Q485K;ENSP00000451376:Q511K;ENSP00000441201:Q331K;ENSP00000440377:Q331K	ENSP00000361214:Q681K	Q	+	1	0	NRG3	84735291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.612000	0.46343	2.567000	0.86603	0.591000	0.81541	CAA	-	NULL		0.463	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	protein_coding	OTTHUMT00000412262.1	C	XM_166086	-		84745311	+1	no_errors	ENST00000404547	ensembl	human	known	74_37	missense	SNP	1.000	A
NUP214	8021	genome.wustl.edu	37	9	134073008	134073008	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:134073008delC	ENST00000359428.5	+	29	4271	c.4127delC	c.(4126-4128)gccfs	p.A1376fs	NUP214_ENST00000411637.2_Frame_Shift_Del_p.A1366fs|NUP214_ENST00000483497.2_Frame_Shift_Del_p.A202fs|NUP214_ENST00000451030.1_Frame_Shift_Del_p.A1377fs|NUP214_ENST00000465486.2_3'UTR			P35658	NU214_HUMAN	nucleoporin 214kDa	1376	11 X 5 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AATTTTACTGCCCCCCCGGTG	0.547			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0								ENSG00000126883						106.0	107.0	106.0					9																	134073008		2203	4300	6503	NUP214	SO:0001589	frameshift_variant	0				HGNC	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4127delC	9.37:g.134073008delC	ENSP00000352400:p.Ala1376fs	Somatic	0	27	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_WD40_repeat	p.P1379fs	ENST00000359428.5	37	c.4130	CCDS6940.1	9																																																																																			-	NULL		0.547	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	protein_coding	OTTHUMT00000054694.2	C	NM_005085			134073008	+1	no_errors	ENST00000451030	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
TP53	7157	genome.wustl.edu	37	17	7577134	7577134	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577134delG	ENST00000269305.4	-	8	993	c.804delC	c.(802-804)aacfs	p.N268fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.N268fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.N268fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.N268fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.N268fs|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	268	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.N268N(2)|p.?(2)|p.G262_S269delGNLLGRNS(2)|p.L265_K305del41(1)|p.E258fs*71(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTCAAAGCTGTTCCGTCCCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	22	Deletion - In frame(8)|Whole gene deletion(8)|Unknown(2)|Substitution - coding silent(2)|Deletion - Frameshift(2)	lung(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|urinary_tract(1)|oesophagus(1)|breast(1)|eye(1)|ovary(1)						ENSG00000141510						56.0	50.0	52.0					17																	7577134		2203	4300	6503	TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.804delC	17.37:g.7577134delG	ENSP00000269305:p.Asn268fs	Somatic	0	28	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	3	84.21	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N268fs	ENST00000269305.4	37	c.804	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546			7577134	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	0.425	-
PLCL1	5334	genome.wustl.edu	37	2	198948489	198948489	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:198948489C>G	ENST00000428675.1	+	2	646	c.248C>G	c.(247-249)tCa>tGa	p.S83*	PLCL1_ENST00000437704.2_5'Flank	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	83	Interaction with PPP1C.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CAGGATCCTTCAAACCAAAAA	0.348																																																	0								ENSG00000115896						43.0	44.0	44.0					2																	198948489		2200	4300	6500	PLCL1	SO:0001587	stop_gained	0			-	HGNC	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.248C>G	2.37:g.198948489C>G	ENSP00000402861:p.Ser83*	Somatic	0	63	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	Q3MJ90|Q53SD3|Q7Z3S3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.S83*	ENST00000428675.1	37	c.248	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	37	6.628777	0.97718	.	.	ENSG00000115896	ENST00000428675	.	.	.	5.67	5.67	0.87782	.	0.619946	0.12011	U	0.507868	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1421	0.98061	0.0:1.0:0.0:0.0	.	.	.	.	X	83	.	.	S	+	2	0	PLCL1	198656734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.238000	0.78173	2.836000	0.97738	0.655000	0.94253	TCA	-	NULL		0.348	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	protein_coding	OTTHUMT00000340210.1	C	NM_006226	-		198948489	+1	no_errors	ENST00000428675	ensembl	human	known	74_37	nonsense	SNP	1.000	G
MIA2	117153	genome.wustl.edu	37	14	39722117	39722117	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr14:39722117A>G	ENST00000280082.3	+	5	1932	c.1733A>G	c.(1732-1734)cAg>cGg	p.Q578R	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		CTAAATAGTCAGATGGTTTCA	0.358																																																	0								ENSG00000150526						83.0	88.0	86.0					14																	39722117		2203	4300	6503	MIA2	SO:0001583	missense	0			-	HGNC	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1733A>G	14.37:g.39722117A>G	ENSP00000280082:p.Gln578Arg	Somatic	1	138	0.72		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A1L4H0|Q9H6C1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,superfamily_SH3_domain	p.Q578R	ENST00000280082.3	37	c.1733	CCDS9672.1	14	.	.	.	.	.	.	.	.	.	.	A	12.12	1.843132	0.32606	.	.	ENSG00000150526	ENST00000280082	T	0.56941	0.43	4.49	0.514	0.17007	.	1.177780	0.06654	N	0.763283	T	0.32010	0.0815	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.17776	-1.0358	8	.	.	.	.	2.2234	0.03978	0.5936:0.1617:0.0893:0.1554	.	578	Q96PC5-2	.	R	578	ENSP00000280082:Q578R	.	Q	+	2	0	MIA2	38791868	0.001000	0.12720	0.000000	0.03702	0.239000	0.25481	1.010000	0.29898	-0.011000	0.14247	0.477000	0.44152	CAG	-	NULL		0.358	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	protein_coding	OTTHUMT00000276768.3	A	NM_054024	-		39722117	+1	no_errors	ENST00000280082	ensembl	human	novel	74_37	missense	SNP	0.001	G
FASN	2194	genome.wustl.edu	37	17	80042811	80042811	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:80042811G>C	ENST00000306749.2	-	26	4646	c.4428C>G	c.(4426-4428)aaC>aaG	p.N1476K	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1476					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGCTGCTGAGGTTGGAGAGCA	0.677																																					Colon(59;314 1043 11189 28578 32273)												0								ENSG00000169710						14.0	12.0	13.0					17																	80042811		2059	4082	6141	FASN	SO:0001583	missense	0			-	HGNC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4428C>G	17.37:g.80042811G>C	ENSP00000304592:p.Asn1476Lys	Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	90	16.67	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.N1476K	ENST00000306749.2	37	c.4428	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	G	7.660	0.684781	0.14973	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.25414	1.8	3.54	3.54	0.40534	.	0.175826	0.48286	D	0.000196	T	0.22085	0.0532	L	0.49126	1.545	0.46478	D	0.999065	P	0.37423	0.594	B	0.30316	0.114	T	0.15263	-1.0443	10	0.66056	D	0.02	-35.9713	13.4136	0.60956	0.0:0.0:1.0:0.0	.	1476	P49327	FAS_HUMAN	K	1476;441	ENSP00000304592:N1476K	ENSP00000304592:N1476K	N	-	3	2	FASN	77636100	1.000000	0.71417	1.000000	0.80357	0.095000	0.18619	1.414000	0.34736	1.772000	0.52199	0.313000	0.20887	AAC	-	NULL		0.677	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	protein_coding	OTTHUMT00000442369.1	G	NM_004104	-		80042811	-1	no_errors	ENST00000306749	ensembl	human	known	74_37	missense	SNP	1.000	C
SCNN1G	6340	genome.wustl.edu	37	16	23197815	23197815	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:23197815G>A	ENST00000300061.2	+	2	366	c.223G>A	c.(223-225)Gtc>Atc	p.V75I		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	75					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)	p.V75I(1)		NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CGCCCTCCTCGTCTTCTCCTT	0.577																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000166828						65.0	60.0	62.0					16																	23197815		2197	4300	6497	SCNN1G	SO:0001583	missense	0			-	HGNC	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.223G>A	16.37:g.23197815G>A	ENSP00000300061:p.Val75Ile	Somatic	0	29	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V75I	ENST00000300061.2	37	c.223	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	2.750	-0.260215	0.05791	.	.	ENSG00000166828	ENST00000300061	T	0.61040	0.14	5.34	1.13	0.20643	.	0.827160	0.10918	N	0.619769	T	0.23926	0.0579	N	0.02721	-0.515	0.22728	N	0.99881	B	0.14012	0.009	B	0.12156	0.007	T	0.28839	-1.0031	10	0.02654	T	1	-35.0795	4.6443	0.12565	0.3562:0.2467:0.3971:0.0	.	75	P51170	SCNNG_HUMAN	I	75	ENSP00000300061:V75I	ENSP00000300061:V75I	V	+	1	0	SCNN1G	23105316	0.012000	0.17670	0.482000	0.27366	0.934000	0.57294	-0.027000	0.12371	0.220000	0.20860	0.563000	0.77884	GTC	-	pfam_Na+channel_ASC,tigrfam_EnaC		0.577	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	protein_coding	OTTHUMT00000254496.1	G	NM_001039	-		23197815	+1	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	SNP	0.713	A
PAPOLG	64895	genome.wustl.edu	37	2	60997608	60997608	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:60997608T>A	ENST00000238714.3	+	6	703	c.454T>A	c.(454-456)Ttt>Att	p.F152I		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	152		Interaction with RNA. {ECO:0000250}.			mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGAAGATGCCTTTGTACCTGT	0.284																																					GBM(183;1497 2932 21839 46797)												0								ENSG00000115421						176.0	168.0	171.0					2																	60997608		2202	4298	6500	PAPOLG	SO:0001583	missense	0			-	HGNC	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.454T>A	2.37:g.60997608T>A	ENSP00000238714:p.Phe152Ile	Somatic	0	101	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.F152I	ENST00000238714.3	37	c.454	CCDS1863.1	2	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517330	0.85495	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.73	5.73	0.89815	Nucleotidyl transferase domain (1);Poly(A) polymerase, central domain (1);	0.097735	0.64402	D	0.000001	T	0.76814	0.4040	M	0.88906	2.99	0.80722	D	1	P	0.35242	0.492	B	0.40982	0.345	T	0.80591	-0.1314	9	0.87932	D	0	-15.3485	15.9756	0.80060	0.0:0.0:0.0:1.0	.	152	Q9BWT3	PAPOG_HUMAN	I	152	.	ENSP00000238714:F152I	F	+	1	0	PAPOLG	60851112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.653000	0.83643	2.313000	0.78055	0.454000	0.30748	TTT	-	pfam_PolA_pol_cen_dom,pfam_Nucleotidyltransferase,pirsf_PolyA_polymerase		0.284	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLG	protein_coding	OTTHUMT00000251577.3	T	NM_022894	-		60997608	+1	no_errors	ENST00000238714	ensembl	human	known	74_37	missense	SNP	1.000	A
SNX29	92017	genome.wustl.edu	37	16	12497352	12497352	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:12497352G>A	ENST00000566228.1	+	18	2072	c.2003G>A	c.(2002-2004)cGg>cAg	p.R668Q	SNX29_ENST00000306030.3_Missense_Mutation_p.R283Q|SNX29_ENST00000323433.4_Missense_Mutation_p.R283Q	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	668	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GTGTTTCTCCGGGGCAAAGCA	0.478																																																	0								ENSG00000048471																																			SNX29	SO:0001583	missense	0			-	HGNC	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2003G>A	16.37:g.12497352G>A	ENSP00000456480:p.Arg668Gln	Somatic	0	78	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R283Q	ENST00000566228.1	37	c.848	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146214	0.77888	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.30714	1.52;1.52	5.24	5.24	0.73138	.	0.069170	0.64402	D	0.000011	T	0.35653	0.0939	L	0.41906	1.305	0.29358	N	0.864899	.	.	.	.	.	.	T	0.17531	-1.0366	8	0.29301	T	0.29	-18.0607	16.3313	0.83015	0.0:0.0:1.0:0.0	.	.	.	.	Q	283	ENSP00000306940:R283Q;ENSP00000322226:R283Q	ENSP00000306940:R283Q	R	+	2	0	SNX29	12404853	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.229000	0.65316	2.440000	0.82611	0.561000	0.74099	CGG	-	superfamily_Phox,smart_Phox,pfscan_Phox		0.478	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	protein_coding	OTTHUMT00000422622.1	G		-		12497352	+1	no_errors	ENST00000306030	ensembl	human	known	74_37	missense	SNP	1.000	A
CDCP2	200008	genome.wustl.edu	37	1	54610408	54610408	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:54610408T>G	ENST00000371330.1	-	2	1005	c.158A>C	c.(157-159)aAc>aCc	p.N53T	RP11-446E24.4_ENST00000311841.7_3'UTR|RP11-446E24.4_ENST00000525949.1_5'UTR	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	53	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)				kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						GCACTCTGTGTTGTAGGGGTA	0.567																																																	0								ENSG00000157211						81.0	65.0	70.0					1																	54610408		2203	4300	6503	CDCP2	SO:0001583	missense	0			-	HGNC		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.158A>C	1.37:g.54610408T>G	ENSP00000360381:p.Asn53Thr	Somatic	0	68	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92	Q6ZWJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	p.N53T	ENST00000371330.1	37	c.158	CCDS588.2	1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138756	0.77775	.	.	ENSG00000157211	ENST00000371330	T	0.34472	1.36	5.51	5.51	0.81932	CUB (5);	0.307475	0.35646	N	0.003065	T	0.54515	0.1863	M	0.87547	2.89	0.40672	D	0.982224	D	0.53151	0.958	P	0.49140	0.601	T	0.66396	-0.5934	10	0.66056	D	0.02	-29.0875	15.6251	0.76848	0.0:0.0:0.0:1.0	.	53	Q5VXM1	CDCP2_HUMAN	T	53	ENSP00000360381:N53T	ENSP00000360381:N53T	N	-	2	0	CDCP2	54382996	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.136000	0.71703	2.093000	0.63338	0.482000	0.46254	AAC	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.567	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CDCP2	protein_coding	OTTHUMT00000022209.2	T	NM_201546	-		54610408	-1	no_errors	ENST00000371330	ensembl	human	novel	74_37	missense	SNP	1.000	G
ZFP37	7539	genome.wustl.edu	37	9	115806243	115806243	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:115806243T>C	ENST00000374227.3	-	4	682	c.655A>G	c.(655-657)Aca>Gca	p.T219A	ZFP37_ENST00000553380.1_Missense_Mutation_p.T234A|ZFP37_ENST00000555206.1_Missense_Mutation_p.T220A	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CCTTTCCTTGTATCAGATAAG	0.343																																																	0								ENSG00000136866						240.0	235.0	237.0					9																	115806243		2203	4299	6502	ZFP37	SO:0001583	missense	0			-	HGNC	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.655A>G	9.37:g.115806243T>C	ENSP00000363344:p.Thr219Ala	Somatic	0	37	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T234A	ENST00000374227.3	37	c.700	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.489607	0.01018	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.05319	3.53;3.46;3.53	4.28	3.15	0.36227	.	0.726173	0.11897	N	0.519050	T	0.05227	0.0139	L	0.31845	0.965	0.09310	N	1	B;B;B	0.28291	0.206;0.206;0.131	B;B;B	0.28305	0.088;0.088;0.04	T	0.42498	-0.9448	10	0.23891	T	0.37	-0.3295	5.9026	0.18976	0.0:0.1189:0.0:0.8811	.	220;234;219	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	A	219;220;234	ENSP00000363344:T219A;ENSP00000451310:T220A;ENSP00000452552:T234A	ENSP00000363344:T219A	T	-	1	0	ZFP37	114846064	0.006000	0.16342	0.262000	0.24481	0.036000	0.12997	1.306000	0.33505	0.995000	0.38917	0.533000	0.62120	ACA	-	NULL		0.343	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	protein_coding	OTTHUMT00000055439.1	T	NM_003408	-		115806243	-1	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	SNP	0.150	C
PSMB9	5698	genome.wustl.edu	37	6	32825819	32825819	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:32825819G>T	ENST00000374859.2	+	4	367	c.298G>T	c.(298-300)Gca>Tca	p.A100S	PSMB9_ENST00000395330.1_Missense_Mutation_p.A77S|PSMB9_ENST00000453265.2_Missense_Mutation_p.A56S	NM_002800.4	NP_002791.1	P28065	PSB9_HUMAN	proteasome (prosome, macropain) subunit, beta type, 9	100					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			large_intestine(4)|lung(4)|skin(1)	9					Carfilzomib(DB08889)	TTTGGCTGCTGCAAATGTGGT	0.423																																																	0								ENSG00000240065						109.0	111.0	111.0					6																	32825819		1510	2709	4219	PSMB9	SO:0001583	missense	0			-	HGNC		CCDS4759.1	6p21.3	2013-03-27	2013-03-27		ENSG00000240065	ENSG00000240065		"""Proteasome (prosome, macropain) subunits"""	9546	protein-coding gene	gene with protein product		177045	"""proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2)"", ""large multifunctional peptidase 2"""	LMP2		1922385, 1529427	Standard	NM_002800		Approved	RING12, beta1i, PSMB6i	uc003sga.3	P28065	OTTHUMG00000031287	ENST00000374859.2:c.298G>T	6.37:g.32825819G>T	ENSP00000363993:p.Ala100Ser	Somatic	0	46	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B0V0T1|Q16523|Q5JNW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.A100S	ENST00000374859.2	37	c.298	CCDS4759.1	6	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809455	0.90707	.	.	ENSG00000240065	ENST00000395330;ENST00000414474;ENST00000374859;ENST00000453265;ENST00000395333	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.49457	0.1558	L	0.43701	1.375	0.58432	D	0.999998	D;D	0.89917	1.0;0.99	D;D	0.91635	0.999;0.991	T	0.49908	-0.8889	10	0.62326	D	0.03	-14.8072	15.8988	0.79356	0.0:0.0:1.0:0.0	.	56;100	B4DZW2;P28065	.;PSB9_HUMAN	S	77;77;100;56;56	ENSP00000378739:A77S;ENSP00000394363:A77S;ENSP00000363993:A100S;ENSP00000394773:A56S	ENSP00000363993:A100S	A	+	1	0	PSMB9	32933797	1.000000	0.71417	0.992000	0.48379	0.977000	0.68977	8.379000	0.90146	2.619000	0.88677	0.638000	0.83543	GCA	-	pfam_Proteasome_sua/b		0.423	PSMB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB9	protein_coding	OTTHUMT00000076624.5	G	NM_002800	-		32825819	+1	no_errors	ENST00000374859	ensembl	human	known	74_37	missense	SNP	1.000	T
CD300LG	146894	genome.wustl.edu	37	17	41930355	41930355	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:41930355C>A	ENST00000317310.4	+	3	496	c.455C>A	c.(454-456)gCt>gAt	p.A152D	CD300LG_ENST00000377203.4_Intron|CD300LG_ENST00000293396.8_Intron|CD300LG_ENST00000539718.1_Missense_Mutation_p.A152D|CD300LG_ENST00000586233.1_Intron	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	152					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AAGGCAAAAGCTCAGCAAACC	0.587																																																	0								ENSG00000161649						138.0	129.0	132.0					17																	41930355		2203	4300	6503	CD300LG	SO:0001583	missense	0			-	HGNC	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.455C>A	17.37:g.41930355C>A	ENSP00000321005:p.Ala152Asp	Somatic	0	70	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	39	37.10	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A152D	ENST00000317310.4	37	c.455	CCDS11470.1	17	.	.	.	.	.	.	.	.	.	.	C	3.556	-0.090617	0.07053	.	.	ENSG00000161649	ENST00000317310;ENST00000539718	T;T	0.07688	3.19;3.17	3.04	2.07	0.26955	.	0.616946	0.13478	N	0.384908	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	P;P	0.39250	0.665;0.535	B;B	0.43728	0.429;0.247	T	0.34104	-0.9842	10	0.36615	T	0.2	.	6.1104	0.20097	0.0:0.8568:0.0:0.1432	.	152;152	F5H7P9;Q6UXG3	.;CLM9_HUMAN	D	152	ENSP00000321005:A152D;ENSP00000442368:A152D	ENSP00000321005:A152D	A	+	2	0	CD300LG	39285881	0.040000	0.19996	0.024000	0.17045	0.018000	0.09664	0.505000	0.22642	0.857000	0.35407	0.462000	0.41574	GCT	-	NULL		0.587	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	protein_coding	OTTHUMT00000457646.1	C	NM_145273	-		41930355	+1	no_errors	ENST00000317310	ensembl	human	known	74_37	missense	SNP	0.029	A
GLYAT	10249	genome.wustl.edu	37	11	58478144	58478144	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:58478144G>A	ENST00000344743.3	-	5	548	c.407C>T	c.(406-408)gCa>gTa	p.A136V	GLYAT_ENST00000529732.1_Missense_Mutation_p.A136V|GLYAT_ENST00000278400.3_Missense_Mutation_p.A136V	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	136					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	TGTTTCAGCTGCCATATAGAG	0.428																																																	0								ENSG00000149124						160.0	148.0	152.0					11																	58478144		2201	4295	6496	GLYAT	SO:0001583	missense	0			-	HGNC	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.407C>T	11.37:g.58478144G>A	ENSP00000340200:p.Ala136Val	Somatic	0	64	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	O14833|Q96QK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.A136V	ENST00000344743.3	37	c.407	CCDS7970.1	11	.	.	.	.	.	.	.	.	.	.	G	9.162	1.018888	0.19355	.	.	ENSG00000149124	ENST00000344743;ENST00000529732;ENST00000278400	T;T;T	0.14893	2.53;2.53;2.47	5.77	-6.65	0.01795	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	4.412020	0.00166	N	0.000005	T	0.04363	0.0120	N	0.01668	-0.77	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.27905	-1.0060	10	0.14252	T	0.57	11.7786	1.4405	0.02353	0.4331:0.1024:0.2123:0.2522	.	136;136	Q6IB77-2;Q6IB77	.;GLYAT_HUMAN	V	136	ENSP00000340200:A136V;ENSP00000431688:A136V;ENSP00000278400:A136V	ENSP00000278400:A136V	A	-	2	0	GLYAT	58234720	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.638000	0.02013	-0.905000	0.03871	0.655000	0.94253	GCA	-	pfam_Glycine_N-acyltransferase_N,superfamily_Acyl_CoA_acyltransferase		0.428	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYAT	protein_coding	OTTHUMT00000394593.1	G		-		58478144	-1	no_errors	ENST00000344743	ensembl	human	known	74_37	missense	SNP	0.000	A
MICAL3	57553	genome.wustl.edu	37	22	18314825	18314827	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:18314825_18314827delCTC	ENST00000441493.2	-	21	3200_3202	c.2848_2850delGAG	c.(2848-2850)gagdel	p.E950del		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	950	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GCAGGCGAGGctcctcctcctcc	0.557																																																	0								ENSG00000243156			113,3533		2,109,1712						1.8	0.5			25	286,7086		1,284,3401	no	coding	MICAL3	NM_015241.2		3,393,5113	A1A1,A1R,RR		3.8795,3.0993,3.6213				399,10619				MICAL3	SO:0001651	inframe_deletion	0				HGNC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2848_2850delGAG	22.37:g.18314834_18314836delCTC	ENSP00000416015:p.Glu950del	Somatic	0	44	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.E950in_frame_del	ENST00000441493.2	37	c.2850_2848	CCDS46659.1	22																																																																																			-	NULL		0.557	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	protein_coding	OTTHUMT00000447351.1	CTC				18314827	-1	no_errors	ENST00000441493	ensembl	human	known	74_37	in_frame_del	DEL	0.639:0.995:1.000	-
MRPL55	128308	genome.wustl.edu	37	1	228294568	228294568	+	Missense_Mutation	SNP	G	G	A	rs200018997		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:228294568G>A	ENST00000411464.2	-	5	1073	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W	MRPL55_ENST00000366741.1_Missense_Mutation_p.R94W|MRPL55_ENST00000366739.1_Missense_Mutation_p.R94W|MRPL55_ENST00000366736.1_Missense_Mutation_p.R94W|MRPL55_ENST00000366747.3_Missense_Mutation_p.R94W|MRPL55_ENST00000366732.1_Missense_Mutation_p.R91W|MRPL55_ENST00000366744.1_Missense_Mutation_p.R94W|MRPL55_ENST00000430433.1_Missense_Mutation_p.R130W|MRPL55_ENST00000336520.3_Missense_Mutation_p.R94W|MRPL55_ENST00000295008.4_Missense_Mutation_p.R94W|MRPL55_ENST00000348259.5_Missense_Mutation_p.R94W|MRPL55_ENST00000366733.1_Missense_Mutation_p.R94W|MRPL55_ENST00000391867.3_Missense_Mutation_p.R94W|MRPL55_ENST00000336300.5_Missense_Mutation_p.R94W|MRPL55_ENST00000366740.1_Missense_Mutation_p.R94W|MRPL55_ENST00000366746.3_Missense_Mutation_p.R94W|MRPL55_ENST00000366734.1_Missense_Mutation_p.R94W|MRPL55_ENST00000366738.1_Missense_Mutation_p.R130W|MRPL55_ENST00000366731.5_Missense_Mutation_p.R130W|C1orf35_ENST00000472617.1_5'Flank|MRPL55_ENST00000366742.1_Missense_Mutation_p.R94W|MRPL55_ENST00000465397.1_5'UTR|MRPL55_ENST00000366735.1_Missense_Mutation_p.R94W			Q7Z7F7	RM55_HUMAN	mitochondrial ribosomal protein L55	94					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|lung(4)	5		Prostate(94;0.0405)				TCACGCTTCCGCAGCCTGGCC	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18059	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000162910						92.0	77.0	82.0					1																	228294568		2203	4300	6503	MRPL55	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK056987	CCDS1567.1, CCDS44325.1	1q42.13	2012-09-13			ENSG00000162910	ENSG00000162910		"""Mitochondrial ribosomal proteins / large subunits"""	16686	protein-coding gene	gene with protein product		611859					Standard	NM_181463		Approved		uc001hrz.4	Q7Z7F7	OTTHUMG00000037965	ENST00000411464.2:c.280C>T	1.37:g.228294568G>A	ENSP00000401737:p.Arg94Trp	Somatic	0	36	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q5TBY3|Q5TBY6|Q6UWI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L55_mit	p.R130W	ENST00000411464.2	37	c.388	CCDS1567.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	12.34	1.908709	0.33721	.	.	ENSG00000162910	ENST00000366732;ENST00000366733;ENST00000366734;ENST00000366735;ENST00000366736;ENST00000366738;ENST00000366741;ENST00000366740;ENST00000366739;ENST00000366742;ENST00000366744;ENST00000348259;ENST00000366747;ENST00000366746;ENST00000295008;ENST00000336520;ENST00000336300;ENST00000430433;ENST00000391867;ENST00000366731;ENST00000411464	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	4.64	2.72	0.32119	.	0.181349	0.33792	N	0.004554	T	0.30510	0.0767	M	0.78637	2.42	0.09310	N	0.999992	B;B	0.33919	0.432;0.274	B;B	0.28465	0.051;0.09	T	0.28650	-1.0037	10	0.87932	D	0	-12.0528	8.0116	0.30357	0.0876:0.0:0.7554:0.157	.	130;94	Q7Z7F7-2;Q7Z7F7	.;RM55_HUMAN	W	91;94;94;94;94;130;94;94;94;94;94;94;94;94;94;94;94;130;94;130;94	ENSP00000355693:R91W;ENSP00000355694:R94W;ENSP00000355695:R94W;ENSP00000355696:R94W;ENSP00000355697:R94W;ENSP00000355699:R130W;ENSP00000355702:R94W;ENSP00000355701:R94W;ENSP00000355700:R94W;ENSP00000355703:R94W;ENSP00000355705:R94W;ENSP00000338189:R94W;ENSP00000355708:R94W;ENSP00000355707:R94W;ENSP00000295008:R94W;ENSP00000337342:R94W;ENSP00000337361:R94W;ENSP00000403614:R130W;ENSP00000375740:R94W;ENSP00000355692:R130W;ENSP00000401737:R94W	ENSP00000295008:R94W	R	-	1	2	MRPL55	226361191	0.910000	0.30920	0.005000	0.12908	0.028000	0.11728	2.245000	0.43133	0.471000	0.27319	0.491000	0.48974	CGG	-	pfam_Ribosomal_L55_mit		0.597	MRPL55-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL55	protein_coding	OTTHUMT00000092808.1	G	XM_059233	rs200018997		228294568	-1	no_errors	ENST00000366731	ensembl	human	known	74_37	missense	SNP	0.062	A
TERT	7015	genome.wustl.edu	37	5	1293552	1293552	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:1293552G>A	ENST00000310581.5	-	2	1506	c.1449C>T	c.(1447-1449)aaC>aaT	p.N483N	TERT_ENST00000296820.5_Silent_p.N483N|TERT_ENST00000508104.2_Silent_p.N483N|TERT_ENST00000334602.6_Silent_p.N483N|TERT_ENST00000522877.1_5'Flank	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	483	QFP motif.|RNA-interacting domain 2.|Required for oligomerization.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	AGCGGCGTTCGTTGTGCCTGG	0.662									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																								0								ENSG00000164362						33.0	33.0	33.0					5																	1293552		2193	4300	6493	TERT	SO:0001819	synonymous_variant	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	-	HGNC	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.1449C>T	5.37:g.1293552G>A		Somatic	0	29	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.N483	ENST00000310581.5	37	c.1449	CCDS3861.2	5																																																																																			-	pfam_Telomerase_RBD,smart_Telomerase_RBD		0.662	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	protein_coding	OTTHUMT00000206729.2	G		-		1293552	-1	no_errors	ENST00000310581	ensembl	human	known	74_37	silent	SNP	0.984	A
CDH6	1004	genome.wustl.edu	37	5	31317976	31317976	+	Silent	SNP	G	G	T	rs145080455		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:31317976G>T	ENST00000265071.2	+	11	2092	c.1827G>T	c.(1825-1827)acG>acT	p.T609T	CDH6_ENST00000514738.1_Silent_p.T554T	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	609					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCCACCCCACGGGACTGAGCA	0.592																																																	0								ENSG00000113361						66.0	64.0	65.0					5																	31317976		2203	4300	6503	CDH6	SO:0001819	synonymous_variant	0			-	HGNC	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1827G>T	5.37:g.31317976G>T		Somatic	0	48	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.11	A8K5H5|Q9BWS0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T609	ENST00000265071.2	37	c.1827	CCDS3894.1	5																																																																																			-	pfscan_Cadherin		0.592	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	protein_coding	OTTHUMT00000207355.2	G	NM_004932	-		31317976	+1	no_errors	ENST00000265071	ensembl	human	known	74_37	silent	SNP	0.996	T
CFAP46	54777	genome.wustl.edu	37	10	134664648	134664648	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:134664648G>T	ENST00000368586.5	-	40	5836	c.5736C>A	c.(5734-5736)aaC>aaA	p.N1912K	TTC40_ENST00000263170.5_Missense_Mutation_p.N73K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						AGTCACTGGTGTTCTGCAGAT	0.617																																																	0								ENSG00000171811						82.0	80.0	81.0					10																	134664648		2203	4300	6503	TTC40	SO:0001583	missense	0			-	HGNC																												ENST00000368586.5:c.5736C>A	10.37:g.134664648G>T	ENSP00000357575:p.Asn1912Lys	Somatic	0	93	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N73K	ENST00000368586.5	37	c.219	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707951	0.30322	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.11495	2.98;2.77	4.79	2.63	0.31362	.	0.912433	0.09148	N	0.842004	T	0.07954	0.0199	L	0.36672	1.1	0.09310	N	0.999995	B	0.32160	0.358	B	0.27500	0.08	T	0.34204	-0.9838	10	0.37606	T	0.19	.	4.1644	0.10300	0.4149:0.0:0.5851:0.0	.	73	Q8IYW2	CJ092_HUMAN	K	1912;73	ENSP00000357575:N1912K;ENSP00000263170:N73K	ENSP00000263170:N73K	N	-	3	2	C10orf93	134514638	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.558000	0.23469	1.009000	0.39289	0.655000	0.94253	AAC	-	NULL		0.617	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	protein_coding	OTTHUMT00000051095.3	G		-		134664648	-1	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	SNP	0.001	T
SACS	26278	genome.wustl.edu	37	13	23907175	23907175	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:23907175C>G	ENST00000382292.3	-	9	11113	c.10840G>C	c.(10840-10842)Gaa>Caa	p.E3614Q	SACS_ENST00000382298.3_Missense_Mutation_p.E3614Q|SACS_ENST00000402364.1_Missense_Mutation_p.E2864Q			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3614					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GACCAGTTTTCTGTATTAGCC	0.348																																																	0								ENSG00000151835						62.0	65.0	64.0					13																	23907175		2202	4299	6501	SACS	SO:0001583	missense	0			-	HGNC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10840G>C	13.37:g.23907175C>G	ENSP00000371729:p.Glu3614Gln	Somatic	0	80	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.E3614Q	ENST00000382292.3	37	c.10840	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581728	0.65992	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88354	-2.22;-2.37;-2.22	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.91341	0.7269	L	0.29908	0.895	0.49483	D	0.999796	D	0.76494	0.999	D	0.80764	0.994	D	0.89151	0.3523	10	0.29301	T	0.29	.	20.2946	0.98546	0.0:1.0:0.0:0.0	.	3614	Q9NZJ4	SACS_HUMAN	Q	3614;2864;3614	ENSP00000371729:E3614Q;ENSP00000385844:E2864Q;ENSP00000371735:E3614Q	ENSP00000371729:E3614Q	E	-	1	0	SACS	22805175	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.818000	0.86416	2.804000	0.96469	0.462000	0.41574	GAA	-	NULL		0.348	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	C	NM_014363	-		23907175	-1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	SNP	1.000	G
USH2A	7399	genome.wustl.edu	37	1	216062047	216062047	+	Silent	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:216062047G>T	ENST00000307340.3	-	41	8330	c.7944C>A	c.(7942-7944)acC>acA	p.T2648T	USH2A_ENST00000366943.2_Silent_p.T2648T|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2648	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATTGGGGTGGGTAGGGGGTT	0.498										HNSCC(13;0.011)																																							0								ENSG00000042781						71.0	79.0	76.0					1																	216062047		2203	4300	6503	USH2A	SO:0001819	synonymous_variant	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7944C>A	1.37:g.216062047G>T		Somatic	0	40	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.T2648	ENST00000307340.3	37	c.7944	CCDS31025.1	1																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.498	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	G	NM_007123	-		216062047	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	silent	SNP	0.000	T
UBE3C	9690	genome.wustl.edu	37	7	156994425	156994425	+	Missense_Mutation	SNP	A	A	T	rs376738509		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:156994425A>T	ENST00000348165.5	+	11	1702	c.1342A>T	c.(1342-1344)Agt>Tgt	p.S448C		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	448					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCTTCTCTACAGTTTAGCCTT	0.308																																																	0								ENSG00000009335						149.0	134.0	139.0					7																	156994425		2203	4300	6503	UBE3C	SO:0001583	missense	0			-	HGNC	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1342A>T	7.37:g.156994425A>T	ENSP00000309198:p.Ser448Cys	Somatic	0	48	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.S448C	ENST00000348165.5	37	c.1342	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542095	0.85917	.	.	ENSG00000009335	ENST00000348165	T	0.46819	0.86	5.74	5.74	0.90152	.	0.082328	0.85682	D	0.000000	T	0.64929	0.2643	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.64144	0.922;0.904	T	0.64271	-0.6447	10	0.39692	T	0.17	-24.5531	16.0456	0.80720	1.0:0.0:0.0:0.0	.	448;448	Q15386;Q15386-2	UBE3C_HUMAN;.	C	448	ENSP00000309198:S448C	ENSP00000309198:S448C	S	+	1	0	UBE3C	156687186	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.437000	0.90302	2.193000	0.70182	0.482000	0.46254	AGT	-	NULL		0.308	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	protein_coding	OTTHUMT00000348108.1	A	NM_014671	-		156994425	+1	no_errors	ENST00000348165	ensembl	human	known	74_37	missense	SNP	1.000	T
AMZ2	51321	genome.wustl.edu	37	17	66246341	66246341	+	Missense_Mutation	SNP	C	C	T	rs532820909		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:66246341C>T	ENST00000359904.3	+	2	1145	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	AMZ2_ENST00000577866.1_Missense_Mutation_p.R5W|AMZ2_ENST00000577985.1_Missense_Mutation_p.R5W|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577273.1_Missense_Mutation_p.R5W|AMZ2_ENST00000392720.2_Missense_Mutation_p.R5W|AMZ2_ENST00000359783.4_Missense_Mutation_p.R5W|AMZ2_ENST00000580753.1_Missense_Mutation_p.R5W	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	5							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAAATAATACGGCACTCCGA	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		20400	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000196704						75.0	79.0	78.0					17																	66246341		2203	4300	6503	AMZ2	SO:0001583	missense	0			-	HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.13C>T	17.37:g.66246341C>T	ENSP00000352976:p.Arg5Trp	Somatic	0	85	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M54_archaemetzincn	p.R5W	ENST00000359904.3	37	c.13	CCDS11674.1	17	.	.	.	.	.	.	.	.	.	.	C	0.090	-1.168251	0.01660	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.19938	2.11;2.11;2.11	3.71	1.58	0.23477	.	0.721746	0.11673	N	0.540610	T	0.21718	0.0523	L	0.57536	1.79	0.09310	N	1	D;D	0.61697	0.978;0.99	B;B	0.43623	0.425;0.425	T	0.14090	-1.0485	10	0.87932	D	0	-32.5953	7.065	0.25147	0.1861:0.451:0.3629:0.0	.	5;5	A6NLD9;Q86W34	.;AMZ2_HUMAN	W	5	ENSP00000352976:R5W;ENSP00000352831:R5W;ENSP00000376481:R5W	ENSP00000352831:R5W	R	+	1	2	AMZ2	63757936	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.302000	0.19192	0.320000	0.23234	0.456000	0.33151	CGG	-	NULL		0.343	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	C	NM_016627	-		66246341	+1	no_errors	ENST00000359904	ensembl	human	known	74_37	missense	SNP	0.000	T
ACTR5	79913	genome.wustl.edu	37	20	37380900	37380900	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr20:37380900G>C	ENST00000243903.4	+	3	769	c.732G>C	c.(730-732)gaG>gaC	p.E244D		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	244					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GCATGGAGGAGATTCTGCATG	0.527																																																	0								ENSG00000101442						107.0	87.0	94.0					20																	37380900		2203	4300	6503	ACTR5	SO:0001583	missense	0			-	HGNC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.732G>C	20.37:g.37380900G>C	ENSP00000243903:p.Glu244Asp	Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related	p.E244D	ENST00000243903.4	37	c.732	CCDS13308.1	20	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812981	0.70912	.	.	ENSG00000101442	ENST00000243903	T	0.06687	3.27	5.62	3.29	0.37713	.	0.000000	0.85682	D	0.000000	T	0.12518	0.0304	N	0.17082	0.46	0.48185	D	0.999607	D	0.76494	0.999	D	0.80764	0.994	T	0.12734	-1.0536	10	0.38643	T	0.18	-32.7063	9.48	0.38895	0.2766:0.0:0.7234:0.0	.	244	Q9H9F9	ARP5_HUMAN	D	244	ENSP00000243903:E244D	ENSP00000243903:E244D	E	+	3	2	ACTR5	36814314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.166000	0.42406	1.505000	0.48720	0.561000	0.74099	GAG	-	pfam_Actin-related,smart_Actin-related		0.527	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR5	protein_coding	OTTHUMT00000079205.2	G	NM_024855	-		37380900	+1	no_errors	ENST00000243903	ensembl	human	known	74_37	missense	SNP	1.000	C
MX1	4599	genome.wustl.edu	37	21	42830644	42830644	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr21:42830644C>G	ENST00000398600.2	+	19	2973	c.1948C>G	c.(1948-1950)Ctg>Gtg	p.L650V	MX1_ENST00000398598.3_Missense_Mutation_p.L650V|MX1_ENST00000455164.2_Missense_Mutation_p.L650V|MX1_ENST00000288383.6_Missense_Mutation_p.L627V	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	650	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GCTTGCACGGCTGACGCAGGC	0.652																																																	0								ENSG00000157601						42.0	46.0	44.0					21																	42830644		2203	4300	6503	MX1	SO:0001583	missense	0			-	HGNC		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1948C>G	21.37:g.42830644C>G	ENSP00000381601:p.Leu650Val	Somatic	0	56	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.L650V	ENST00000398600.2	37	c.1948	CCDS13673.1	21	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957716	0.53400	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.7	4.7	0.59300	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.000000	0.85682	D	0.000000	D	0.83589	0.5287	M	0.88704	2.975	0.54753	D	0.999981	D	0.89917	1.0	D	0.87578	0.998	D	0.86567	0.1845	10	0.87932	D	0	-31.8418	13.8894	0.63729	0.0:1.0:0.0:0.0	.	650	P20591	MX1_HUMAN	V	650;650;650;627	ENSP00000381601:L650V;ENSP00000381599:L650V;ENSP00000410523:L650V;ENSP00000288383:L627V	ENSP00000288383:L627V	L	+	1	2	MX1	41752514	1.000000	0.71417	0.974000	0.42286	0.015000	0.08874	3.642000	0.54367	2.547000	0.85894	0.655000	0.94253	CTG	-	pfam_GED,superfamily_P-loop_NTPase,smart_GED		0.652	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	protein_coding	OTTHUMT00000195161.2	C		-		42830644	+1	no_errors	ENST00000398598	ensembl	human	known	74_37	missense	SNP	1.000	G
SYT9	143425	genome.wustl.edu	37	11	7334914	7334914	+	Silent	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:7334914C>A	ENST00000318881.6	+	3	1023	c.786C>A	c.(784-786)atC>atA	p.I262I	SYT9_ENST00000396716.2_Silent_p.I230I	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	262	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.I262I(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ATGTCAAGATCTATTTGCTTC	0.413																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000170743						136.0	135.0	136.0					11																	7334914		2201	4296	6497	SYT9	SO:0001819	synonymous_variant	0			-	HGNC	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.786C>A	11.37:g.7334914C>A		Somatic	0	48	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.95		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.I262	ENST00000318881.6	37	c.786	CCDS7778.1	11																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_C2_dom		0.413	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	protein_coding	OTTHUMT00000384483.1	C	NM_175733	-		7334914	+1	no_errors	ENST00000318881	ensembl	human	known	74_37	silent	SNP	1.000	A
MAN2A2	4122	genome.wustl.edu	37	15	91456916	91456916	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:91456916A>G	ENST00000559717.1	+	19	3250	c.2791A>G	c.(2791-2793)Atc>Gtc	p.I931V	MAN2A2_ENST00000431652.2_Missense_Mutation_p.I439V|MAN2A2_ENST00000430376.2_Missense_Mutation_p.I121V|MAN2A2_ENST00000360468.3_Missense_Mutation_p.I931V			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	931					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CATGGCCTATATCCAGGACGC	0.612																																																	0								ENSG00000196547						45.0	38.0	40.0					15																	91456916		2198	4298	6496	MAN2A2	SO:0001583	missense	0			-	HGNC	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2791A>G	15.37:g.91456916A>G	ENSP00000452948:p.Ile931Val	Somatic	0	27	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.I931V	ENST00000559717.1	37	c.2791	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983811	0.53827	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	D;D;D	0.87650	-2.28;-2.28;-2.28	4.98	3.85	0.44370	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.275088	0.40908	D	0.000991	D	0.90971	0.7161	M	0.79123	2.44	0.80722	D	1	P;B;B	0.39352	0.669;0.107;0.215	P;B;B	0.52554	0.702;0.391;0.384	D	0.90428	0.4422	10	0.56958	D	0.05	-31.2907	11.6398	0.51227	0.8432:0.1568:0.0:0.0	.	439;559;931	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	V	931;439;121	ENSP00000353655:I931V;ENSP00000388221:I439V;ENSP00000394372:I121V	ENSP00000353655:I931V	I	+	1	0	MAN2A2	89257920	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.134000	0.71689	0.934000	0.37316	0.397000	0.26171	ATC	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom		0.612	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	protein_coding	OTTHUMT00000418246.5	A	NM_006122	-		91456916	+1	no_errors	ENST00000360468	ensembl	human	known	74_37	missense	SNP	1.000	G
MTMR3	8897	genome.wustl.edu	37	22	30415667	30415667	+	Frame_Shift_Del	DEL	G	G	-	rs148069934		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:30415667delG	ENST00000401950.2	+	17	2361	c.2019delG	c.(2017-2019)ccgfs	p.P673fs	MTMR3_ENST00000351488.3_Frame_Shift_Del_p.P673fs|MTMR3_ENST00000406629.1_Frame_Shift_Del_p.P673fs|CTA-85E5.10_ENST00000429350.1_RNA|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000323630.5_Frame_Shift_Del_p.P537fs|MTMR3_ENST00000333027.3_Frame_Shift_Del_p.P673fs	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	673					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCAGAGTGCCGGGGGGTGCCG	0.627																																																	0								ENSG00000100330						52.0	62.0	59.0					22																	30415667		2203	4300	6503	MTMR3	SO:0001589	frameshift_variant	0				HGNC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2019delG	22.37:g.30415667delG	ENSP00000384651:p.Pro673fs	Somatic	0	67	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.G675fs	ENST00000401950.2	37	c.2019	CCDS13870.1	22																																																																																			-	NULL		0.627	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	protein_coding	OTTHUMT00000322066.1	G	NM_021090			30415667	+1	no_errors	ENST00000401950	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ZBED9	114821	genome.wustl.edu	37	6	28554200	28554200	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:28554200G>T	ENST00000452236.2	-	1	912	c.295C>A	c.(295-297)Cag>Aag	p.Q99K	SCAND3_ENST00000530247.1_Intron|RP5-1186N24.3_ENST00000499525.1_RNA	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						GTCAGGAACTGCTCCAGCACC	0.552																																																	0								ENSG00000232040						108.0	108.0	108.0					6																	28554200		2203	4300	6503	SCAND3	SO:0001583	missense	0			-	HGNC																												ENST00000452236.2:c.295C>A	6.37:g.28554200G>T	ENSP00000395259:p.Gln99Lys	Somatic	0	67	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.Q99K	ENST00000452236.2	37	c.295	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100950	0.76983	.	.	ENSG00000232040	ENST00000452236	T	0.16324	2.35	3.46	3.46	0.39613	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.37945	0.1022	M	0.91459	3.21	0.30929	N	0.727151	P	0.51537	0.946	D	0.69307	0.963	T	0.32851	-0.9891	9	0.87932	D	0	.	12.8515	0.57860	0.0:0.0:1.0:0.0	.	99	Q6R2W3	SCND3_HUMAN	K	99	ENSP00000395259:Q99K	ENSP00000395259:Q99K	Q	-	1	0	SCAND3	28662179	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.615000	0.67702	1.938000	0.56188	0.655000	0.94253	CAG	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.552	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	G		-		28554200	-1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	SNP	1.000	T
BCR	613	genome.wustl.edu	37	22	23658274	23658275	+	3'UTR	INS	-	-	TTC	rs199982774|rs202178919		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:23658274_23658275insTTC	ENST00000305877.8	+	0	5132_5133				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CATTCTTGGCTTTCTTTTTCTT	0.47			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0								ENSG00000186716																																			BCR	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*566->TTC	22.37:g.23658275_23658277dupTTC		Somatic	0	8	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	P78501|Q12842|Q4LE80|Q6NZI3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			-	-		0.470	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	-	NM_004327			23658275	+1	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	INS	0.000:0.000	TTC
PLEKHA2	59339	genome.wustl.edu	37	8	38793524	38793524	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:38793524G>C	ENST00000521746.1	+	3	388	c.154G>C	c.(154-156)Ggg>Cgg	p.G52R	PLEKHA2_ENST00000388745.4_3'UTR|PLEKHA2_ENST00000420274.1_Missense_Mutation_p.G52R			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	52	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TCTGGCAATGGGGGCAGGAGC	0.453																																																	0								ENSG00000169499						138.0	136.0	136.0					8																	38793524		1916	4135	6051	PLEKHA2	SO:0001583	missense	0			-	HGNC	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.154G>C	8.37:g.38793524G>C	ENSP00000430938:p.Gly52Arg	Somatic	0	86	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	5	73.68		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G52R	ENST00000521746.1	37	c.154		8	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059180	0.76074	.	.	ENSG00000169499	ENST00000521746;ENST00000420274;ENST00000535929;ENST00000519640	T;T;T	0.74526	-0.85;-0.85;-0.85	5.78	5.78	0.91487	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85090	0.0951	10	0.87932	D	0	.	15.8585	0.79005	0.0:0.0:1.0:0.0	.	52;52	Q9HB19;A8K727	PKHA2_HUMAN;.	R	52;52;2;52	ENSP00000430938:G52R;ENSP00000393860:G52R;ENSP00000429956:G52R	ENSP00000393860:G52R	G	+	1	0	PLEKHA2	38912681	0.999000	0.42202	0.963000	0.40424	0.819000	0.46315	3.458000	0.53014	2.890000	0.99128	0.655000	0.94253	GGG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.453	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	protein_coding	OTTHUMT00000377068.1	G	NM_021623	-		38793524	+1	no_errors	ENST00000420274	ensembl	human	known	74_37	missense	SNP	0.986	C
CDH12	1010	genome.wustl.edu	37	5	21751881	21751881	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:21751881C>T	ENST00000382254.1	-	15	3436	c.2350G>A	c.(2350-2352)Gaa>Aaa	p.E784K	CDH12_ENST00000504376.2_Missense_Mutation_p.E784K|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.E744K	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	784					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CTCTCTTCTTCGCCAAACATG	0.443										HNSCC(59;0.17)																																							0								ENSG00000154162						81.0	82.0	82.0					5																	21751881		2203	4300	6503	CDH12	SO:0001583	missense	0			-	HGNC	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2350G>A	5.37:g.21751881C>T	ENSP00000371689:p.Glu784Lys	Somatic	0	49	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	12	75.00	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E784K	ENST00000382254.1	37	c.2350	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940972	0.34283	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.75938	-0.98;-0.98;-0.98	5.34	5.34	0.76211	Cadherin, cytoplasmic domain (1);	0.052208	0.85682	D	0.000000	T	0.65471	0.2694	L	0.40543	1.245	0.52501	D	0.999957	B;B	0.21452	0.01;0.056	B;B	0.18263	0.021;0.011	T	0.61959	-0.6955	10	0.39692	T	0.17	.	12.4075	0.55449	0.0:0.9228:0.0:0.0772	.	744;784	B7Z2U6;P55289	.;CAD12_HUMAN	K	784;784;744	ENSP00000423577:E784K;ENSP00000371689:E784K;ENSP00000428786:E744K	ENSP00000371689:E784K	E	-	1	0	CDH12	21787638	1.000000	0.71417	0.935000	0.37517	0.930000	0.56654	5.355000	0.66046	2.496000	0.84212	0.467000	0.42956	GAA	-	pfam_Cadherin_cytoplasmic-dom		0.443	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	protein_coding	OTTHUMT00000207139.1	C	NM_004061	-		21751881	-1	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	SNP	0.998	T
RTN4IP1	84816	genome.wustl.edu	37	6	107050756	107050756	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:107050756G>T	ENST00000369063.3	-	5	1127	c.662C>A	c.(661-663)gCt>gAt	p.A221D	RTN4IP1_ENST00000539449.1_Intron	NM_032730.4	NP_116119.2	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1	221						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		TACCTGTATAGCAAAAGTACC	0.328																																																	0								ENSG00000130347						74.0	77.0	76.0					6																	107050756		2203	4300	6503	RTN4IP1	SO:0001583	missense	0			-	HGNC	AF336861	CCDS5056.1	6q21	2008-02-05			ENSG00000130347	ENSG00000130347			18647	protein-coding gene	gene with protein product		610502					Standard	NM_032730		Approved	NIMP	uc003prj.3	Q8WWV3	OTTHUMG00000015304	ENST00000369063.3:c.662C>A	6.37:g.107050756G>T	ENSP00000358059:p.Ala221Asp	Somatic	0	49	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q8N9B3|Q8WZ66|Q9BRA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.A221D	ENST00000369063.3	37	c.662	CCDS5056.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071848	0.76301	.	.	ENSG00000130347	ENST00000369063	T	0.57595	0.39	4.91	4.91	0.64330	Alcohol dehydrogenase, C-terminal (1);Quinone oxidoreductase/zeta-crystallin, conserved site (1);NAD(P)-binding domain (1);	0.049845	0.85682	D	0.000000	T	0.81197	0.4772	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.88224	0.2899	10	0.87932	D	0	-22.4183	14.9401	0.70986	0.0:0.0:1.0:0.0	.	221	Q8WWV3	RT4I1_HUMAN	D	221	ENSP00000358059:A221D	ENSP00000358059:A221D	A	-	2	0	RTN4IP1	107157449	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.135000	0.64777	2.557000	0.86248	0.585000	0.79938	GCT	-	pfam_ADH_C,smart_PKS_ER		0.328	RTN4IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4IP1	protein_coding	OTTHUMT00000041673.1	G		-		107050756	-1	no_errors	ENST00000369063	ensembl	human	known	74_37	missense	SNP	1.000	T
TPK1	27010	genome.wustl.edu	37	7	144345963	144345963	+	Silent	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:144345963A>G	ENST00000360057.3	-	5	297	c.195T>C	c.(193-195)ccT>ccC	p.P65P	TPK1_ENST00000538212.2_Silent_p.P60P|TPK1_ENST00000378099.3_Silent_p.P65P|TPK1_ENST00000547966.1_5'UTR|TPK1_ENST00000549981.1_5'UTR	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	65					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	TGATGAATTCAGGCAAAAAGC	0.318																																					Ovarian(45;88 1034 2073 5829 28455)												0								ENSG00000196511						96.0	108.0	104.0					7																	144345963		2203	4300	6503	TPK1	SO:0001819	synonymous_variant	0			-	HGNC	AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.195T>C	7.37:g.144345963A>G		Somatic	0	83	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L20P	ENST00000360057.3	37	c.59	CCDS5888.1	7																																																																																			-	NULL		0.318	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPK1	protein_coding	OTTHUMT00000327777.1	A	NM_022445	-		144345963	-1	no_errors	ENST00000489798	ensembl	human	known	74_37	missense	SNP	0.998	G
ANAPC4	29945	genome.wustl.edu	37	4	25415313	25415313	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr4:25415313T>A	ENST00000315368.3	+	22	1714	c.1572T>A	c.(1570-1572)ttT>ttA	p.F524L	ANAPC4_ENST00000510092.1_Missense_Mutation_p.F525L	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	524					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				CATTGCATTTTGTGAAAAGGC	0.338																																																	0								ENSG00000053900						120.0	118.0	119.0					4																	25415313		2203	4300	6503	ANAPC4	SO:0001583	missense	0			-	HGNC	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.1572T>A	4.37:g.25415313T>A	ENSP00000318775:p.Phe524Leu	Somatic	0	87	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,pirsf_APC4_metazoa	p.F525L	ENST00000315368.3	37	c.1575	CCDS3434.1	4	.	.	.	.	.	.	.	.	.	.	T	15.19	2.759782	0.49468	.	.	ENSG00000053900	ENST00000315368;ENST00000510092	T;T	0.29397	1.57;1.57	6.07	3.63	0.41609	.	0.046134	0.85682	D	0.000000	T	0.27629	0.0679	M	0.62723	1.935	0.51482	D	0.999921	B	0.20887	0.049	B	0.19666	0.026	T	0.05801	-1.0863	10	0.11485	T	0.65	-33.653	10.7682	0.46305	0.0:0.1299:0.0:0.8701	.	524	Q9UJX5	APC4_HUMAN	L	524;525	ENSP00000318775:F524L;ENSP00000426654:F525L	ENSP00000318775:F524L	F	+	3	2	ANAPC4	25024411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.797000	0.47877	1.129000	0.42072	0.477000	0.44152	TTT	-	pirsf_APC4_metazoa		0.338	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANAPC4	protein_coding	OTTHUMT00000214986.1	T	NM_013367	-		25415313	+1	no_errors	ENST00000510092	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO1H	283446	genome.wustl.edu	37	12	109845713	109845713	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:109845713A>G	ENST00000431443.2	+	9	1102	c.1102A>G	c.(1102-1104)Aac>Gac	p.N368D	MYO1H_ENST00000310903.5_Missense_Mutation_p.N368D	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	368	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CTCCTTAGTTAACAAGGTTGG	0.418																																																	0								ENSG00000174527						170.0	162.0	165.0					12																	109845713		1980	4140	6120	MYO1H	SO:0001583	missense	0			-	HGNC		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1102A>G	12.37:g.109845713A>G	ENSP00000444076:p.Asn368Asp	Somatic	0	119	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	49	31.94	F5H3C6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.N368D	ENST00000431443.2	37	c.1102		12	.	.	.	.	.	.	.	.	.	.	A	15.62	2.887033	0.52014	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87103	-2.21;-2.21	5.06	5.06	0.68205	.	.	.	.	.	D	0.91209	0.7230	L	0.53561	1.675	0.44619	D	0.99759	D	0.89917	1.0	D	0.91635	0.999	D	0.90656	0.4586	9	0.40728	T	0.16	.	14.3179	0.66465	1.0:0.0:0.0:0.0	.	368	F5H3C6	.	D	368	ENSP00000439182:N368D;ENSP00000444076:N368D	ENSP00000439182:N368D	N	+	1	0	MYO1H	108330096	1.000000	0.71417	0.988000	0.46212	0.118000	0.20060	7.287000	0.78681	2.051000	0.60960	0.397000	0.26171	AAC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.418	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	protein_coding		A	NM_173597	-		109845713	+1	no_errors	ENST00000431443	ensembl	human	known	74_37	missense	SNP	1.000	G
ZEB2	9839	genome.wustl.edu	37	2	145157714	145157715	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:145157714_145157715delTT	ENST00000558170.2	-	8	2223_2224	c.1039_1040delAA	c.(1039-1041)aatfs	p.N347fs	ZEB2_ENST00000409487.3_Frame_Shift_Del_p.N347fs|ZEB2_ENST00000303660.4_Frame_Shift_Del_p.N347fs|ZEB2_ENST00000539609.3_Frame_Shift_Del_p.N323fs	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	347					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CGTCTTGATATTGTTTCTCATT	0.396																																					Melanoma(33;1235 1264 5755 16332)												0								ENSG00000169554																																			ZEB2	SO:0001589	frameshift_variant	0				HGNC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1039_1040delAA	2.37:g.145157714_145157715delTT	ENSP00000454157:p.Asn347fs	Somatic	0	104	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	51	20.31	A0JP09|B7Z2P2|F5H814|Q9UED1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.N347fs	ENST00000558170.2	37	c.1040_1039	CCDS2186.1	2																																																																																			-	NULL		0.396	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	protein_coding	OTTHUMT00000254778.5	TT	NM_014795			145157715	-1	no_errors	ENST00000303660	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
FNDC3B	64778	genome.wustl.edu	37	3	172003714	172003714	+	Splice_Site	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:172003714A>G	ENST00000336824.4	+	7	889		c.e7-1		FNDC3B_ENST00000415807.2_Splice_Site|FNDC3B_ENST00000416957.1_Splice_Site	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B						cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TTCGCAATGCAGAATATGAGT	0.373																																																	0								ENSG00000075420						82.0	83.0	83.0					3																	172003714		2203	4300	6503	FNDC3B	SO:0001630	splice_region_variant	0			-	HGNC	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.791-1A>G	3.37:g.172003714A>G		Somatic	0	40	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-2	ENST00000336824.4	37	c.791-2	CCDS3217.1	3	.	.	.	.	.	.	.	.	.	.	A	22.0	4.224841	0.79576	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FNDC3B	173486408	1.000000	0.71417	0.999000	0.59377	0.785000	0.44390	7.927000	0.87577	2.308000	0.77769	0.533000	0.62120	.	-	-		0.373	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3B	protein_coding	OTTHUMT00000345618.2	A	NM_022763	-	Intron	172003714	+1	no_errors	ENST00000336824	ensembl	human	known	74_37	splice_site	SNP	1.000	G
ACSM4	341392	genome.wustl.edu	37	12	7480905	7480905	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:7480905C>A	ENST00000399422.4	+	13	1727	c.1679C>A	c.(1678-1680)cCa>cAa	p.P560Q		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	560					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						CAAGAACTCCCAAAGACAATC	0.398																																																	0								ENSG00000215009						70.0	63.0	65.0					12																	7480905		1840	4095	5935	ACSM4	SO:0001583	missense	0			-	HGNC		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1679C>A	12.37:g.7480905C>A	ENSP00000382349:p.Pro560Gln	Somatic	0	84	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	43	27.12	A8MTI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.P560Q	ENST00000399422.4	37	c.1679	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367989	0.61513	.	.	ENSG00000215009	ENST00000399422	T	0.72725	-0.68	2.64	2.64	0.31445	.	0.000000	0.38959	U	0.001514	D	0.87819	0.6273	H	0.97103	3.94	0.52099	D	0.999944	D	0.89917	1.0	D	0.97110	1.0	D	0.90529	0.4494	10	0.87932	D	0	0.1466	11.4235	0.49996	0.0:1.0:0.0:0.0	.	560	P0C7M7	ACSM4_HUMAN	Q	560	ENSP00000382349:P560Q	ENSP00000382349:P560Q	P	+	2	0	ACSM4	7372172	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.029000	0.70895	1.789000	0.52484	0.591000	0.81541	CCA	-	NULL		0.398	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	protein_coding	OTTHUMT00000337866.2	C	NM_001080454	-		7480905	+1	no_errors	ENST00000399422	ensembl	human	novel	74_37	missense	SNP	1.000	A
SLC8A3	6547	genome.wustl.edu	37	14	70634157	70634157	+	Frame_Shift_Del	DEL	G	G	-	rs144107599		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr14:70634157delG	ENST00000381269.2	-	2	1736	c.983delC	c.(982-984)ccafs	p.P328fs	SLC8A3_ENST00000356921.2_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000528359.1_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000534137.1_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000357887.3_Frame_Shift_Del_p.P328fs	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	328					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GTCCTTCTCTGGGTGTTTTTG	0.507																																																	0								ENSG00000100678						93.0	97.0	96.0					14																	70634157		2203	4300	6503	SLC8A3	SO:0001589	frameshift_variant	0				HGNC	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.983delC	14.37:g.70634157delG	ENSP00000370669:p.Pro328fs	Somatic	0	52	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.P328fs	ENST00000381269.2	37	c.983	CCDS35498.1	14																																																																																			-	tigrfam_Na_Ca_Ex		0.507	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	G				70634157	-1	no_errors	ENST00000381269	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CREB3L1	90993	genome.wustl.edu	37	11	46321563	46321563	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:46321563T>A	ENST00000529193.1	+	2	631	c.180T>A	c.(178-180)gaT>gaA	p.D60E	CREB3L1_ENST00000288400.3_Missense_Mutation_p.D60E			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	60	Required for transcriptional activation.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GCTTCTTTGATGACCCTGTGC	0.562			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)			Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	0								ENSG00000157613						109.0	106.0	107.0					11																	46321563		2070	4222	6292	CREB3L1	SO:0001583	missense	0			-	HGNC		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.180T>A	11.37:g.46321563T>A	ENSP00000434939:p.Asp60Glu	Somatic	0	55	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q8N2D5|Q96CP0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	p.D60E	ENST00000529193.1	37	c.180	CCDS53620.1	11	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403642	0.83230	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415;ENST00000534787	T;T;T	0.47177	2.59;2.59;0.85	5.56	4.42	0.53409	.	0.138818	0.46442	D	0.000295	T	0.57213	0.2038	L	0.42245	1.32	0.39210	D	0.963302	D	0.64830	0.994	D	0.72625	0.978	T	0.55205	-0.8177	10	0.30854	T	0.27	-23.4852	11.503	0.50448	0.0:0.0705:0.0:0.9295	.	60	Q96BA8	CR3L1_HUMAN	E	60;60;60;14	ENSP00000434939:D60E;ENSP00000288400:D60E;ENSP00000431677:D14E	ENSP00000288400:D60E	D	+	3	2	CREB3L1	46278139	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.763000	0.38461	0.930000	0.37217	0.533000	0.62120	GAT	-	NULL		0.562	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	protein_coding	OTTHUMT00000389702.1	T	NM_052854	-		46321563	+1	no_errors	ENST00000288400	ensembl	human	known	74_37	missense	SNP	1.000	A
CABP1	9478	genome.wustl.edu	37	12	121098629	121098629	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:121098629G>T	ENST00000316803.3	+	4	1059	c.925G>T	c.(925-927)Gat>Tat	p.D309Y	CABP1_ENST00000453000.1_Missense_Mutation_p.D245Y|CABP1_ENST00000351200.2_Missense_Mutation_p.D106Y|CABP1_ENST00000288616.3_Missense_Mutation_p.D166Y	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1	309	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGAACTGCGAGATGCTTTCCG	0.498																																																	0								ENSG00000157782						147.0	142.0	144.0					12																	121098629		2203	4300	6503	CABP1	SO:0001583	missense	0			-	HGNC	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.925G>T	12.37:g.121098629G>T	ENSP00000317310:p.Asp309Tyr	Somatic	0	42	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	O95663|Q8N6H5|Q9NZU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D309Y	ENST00000316803.3	37	c.925	CCDS31913.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172014	0.78452	.	.	ENSG00000157782	ENST00000316803;ENST00000288616;ENST00000351200;ENST00000453000	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.25	5.25	0.73442	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87489	0.6190	M	0.90705	3.14	0.80722	D	1	D;D;D;D	0.89917	1.0;0.992;1.0;0.999	D;D;D;D	0.83275	0.996;0.915;0.995;0.978	D	0.90055	0.4152	10	0.87932	D	0	-21.7273	18.4685	0.90765	0.0:0.0:1.0:0.0	.	245;106;166;309	C9J8G2;Q9NZU7-2;Q9NZU7-1;Q9NZU7	.;.;.;CABP1_HUMAN	Y	309;166;106;245	ENSP00000317310:D309Y;ENSP00000288616:D166Y;ENSP00000288615:D106Y;ENSP00000398959:D245Y	ENSP00000288616:D166Y	D	+	1	0	CABP1	119583012	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.957000	0.87870	2.450000	0.82876	0.650000	0.86243	GAT	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom		0.498	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	protein_coding	OTTHUMT00000345822.1	G	NM_001033677	-		121098629	+1	no_errors	ENST00000316803	ensembl	human	known	74_37	missense	SNP	1.000	T
YTHDC2	64848	genome.wustl.edu	37	5	112871433	112871433	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:112871433C>A	ENST00000161863.4	+	7	1253	c.1040C>A	c.(1039-1041)tCt>tAt	p.S347Y	YTHDC2_ENST00000515883.1_Missense_Mutation_p.S347Y	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	347	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CTAATTCTTTCTAGTGCTGCC	0.303																																																	0								ENSG00000047188						62.0	68.0	66.0					5																	112871433		2201	4298	6499	YTHDC2	SO:0001583	missense	0			-	HGNC	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.1040C>A	5.37:g.112871433C>A	ENSP00000161863:p.Ser347Tyr	Somatic	0	81	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	32	34.69	B2RP66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S347Y	ENST00000161863.4	37	c.1040	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796856	0.70567	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.09350	2.99;2.99	5.61	5.61	0.85477	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.054046	0.85682	D	0.000000	T	0.37598	0.1009	M	0.77103	2.36	0.53688	D	0.999971	D	0.89917	1.0	D	0.79108	0.992	T	0.11591	-1.0581	10	0.87932	D	0	.	19.6493	0.95794	0.0:1.0:0.0:0.0	.	347	Q9H6S0	YTDC2_HUMAN	Y	347;347;257	ENSP00000161863:S347Y;ENSP00000423101:S347Y	ENSP00000161863:S347Y	S	+	2	0	YTHDC2	112899332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.663000	0.68038	2.638000	0.89438	0.650000	0.86243	TCT	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.303	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	protein_coding	OTTHUMT00000250776.2	C	NM_022828	-		112871433	+1	no_errors	ENST00000161863	ensembl	human	known	74_37	missense	SNP	1.000	A
MYZAP	100820829	genome.wustl.edu	37	15	57918073	57918073	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:57918073G>C	ENST00000267853.5	+	5	602	c.508G>C	c.(508-510)Gat>Cat	p.D170H	GCOM1_ENST00000380568.3_Missense_Mutation_p.D170H|GCOM1_ENST00000587652.1_Missense_Mutation_p.D170H|GCOM1_ENST00000572390.1_Missense_Mutation_p.D170H|GCOM1_ENST00000380561.2_Missense_Mutation_p.D139H|GCOM1_ENST00000380560.2_Intron|GCOM1_ENST00000396180.1_Missense_Mutation_p.D139H|GCOM1_ENST00000380569.2_Missense_Mutation_p.D170H|POLR2M_ENST00000380563.2_5'UTR|MYZAP_ENST00000380565.4_Missense_Mutation_p.D170H|GCOM1_ENST00000574161.1_Missense_Mutation_p.D170H			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	170					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											CTTGGCATCAGATTCCATTGG	0.488																																																	0								ENSG00000137878						125.0	107.0	113.0					15																	57918073		2192	4292	6484	GCOM1	SO:0001583	missense	0			-	HGNC	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.508G>C	15.37:g.57918073G>C	ENSP00000267853:p.Asp170His	Somatic	0	33	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D170H	ENST00000267853.5	37	c.508	CCDS10162.1	15	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098124	0.56183	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37	5.81	5.81	0.92471	.	0.094116	0.64402	D	0.000001	T	0.57080	0.2029	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71870	0.957;0.957;0.975;0.975	T	0.53899	-0.8373	10	0.54805	T	0.06	-30.9752	18.851	0.92230	0.0:0.0:1.0:0.0	.	170;170;170;170	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	H	170;139;139;170;170;170	ENSP00000369943:D170H;ENSP00000369935:D139H;ENSP00000379483:D139H;ENSP00000267853:D170H;ENSP00000369939:D170H;ENSP00000369942:D170H	ENSP00000267853:D170H	D	+	1	0	GCOM1	55705365	1.000000	0.71417	0.932000	0.37286	0.243000	0.25628	6.707000	0.74654	2.747000	0.94245	0.650000	0.86243	GAT	-	NULL		0.488	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCOM1	protein_coding	OTTHUMT00000255716.2	G	NM_001018100	-		57918073	+1	no_errors	ENST00000380569	ensembl	human	known	74_37	missense	SNP	0.994	C
ATP2C1	27032	genome.wustl.edu	37	3	130683797	130683797	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:130683797T>A	ENST00000510168.1	+	14	1580	c.1030T>A	c.(1030-1032)Tgt>Agt	p.C344S	ATP2C1_ENST00000533801.2_Missense_Mutation_p.C339S|ATP2C1_ENST00000359644.3_Missense_Mutation_p.C344S|ATP2C1_ENST00000328560.8_Missense_Mutation_p.C344S|ATP2C1_ENST00000507488.2_Missense_Mutation_p.C328S|ATP2C1_ENST00000422190.2_Missense_Mutation_p.C344S|ATP2C1_ENST00000508532.1_Missense_Mutation_p.C344S|ATP2C1_ENST00000504948.1_Missense_Mutation_p.C328S|ATP2C1_ENST00000513801.1_Missense_Mutation_p.C328S|ATP2C1_ENST00000393221.4_Missense_Mutation_p.C378S|ATP2C1_ENST00000504381.1_Missense_Mutation_p.C289S|ATP2C1_ENST00000428331.2_Missense_Mutation_p.C344S|ATP2C1_ENST00000505330.1_Missense_Mutation_p.C328S			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	344			C -> Y (in HHD; unstable protein). {ECO:0000269|PubMed:10767338}.		actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TTTAGGCTGCTGTAATGTGAT	0.343									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)												0								ENSG00000017260						134.0	123.0	127.0					3																	130683797		2203	4300	6503	ATP2C1	SO:0001583	missense	0	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	-	HGNC	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.1030T>A	3.37:g.130683797T>A	ENSP00000427461:p.Cys344Ser	Somatic	0	66	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.C378S	ENST00000510168.1	37	c.1132	CCDS46914.1	3	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543737	0.65198	.	.	ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421;ENST00000515854	D;D;D;D;D;D;D;D;D;D;D;D;D;T	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-1.4	5.26	5.26	0.73747	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.92971	0.7763	L	0.43598	1.365	0.80722	D	1	B;B;B;B;B;B;B	0.29341	0.203;0.242;0.132;0.081;0.082;0.03;0.099	B;B;B;B;B;B;B	0.29663	0.099;0.101;0.105;0.061;0.105;0.036;0.06	D	0.91897	0.5528	10	0.56958	D	0.05	.	15.4681	0.75419	0.0:0.0:0.0:1.0	.	378;339;378;344;378;344;344	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.;.;.;.;.;.;AT2C1_HUMAN	S	328;289;328;378;339;344;344;328;328;344;344;344;344;343;83	ENSP00000423774:C328S;ENSP00000425320:C289S;ENSP00000421326:C328S;ENSP00000376914:C378S;ENSP00000432956:C339S;ENSP00000427461:C344S;ENSP00000424783:C344S;ENSP00000423330:C328S;ENSP00000422872:C328S;ENSP00000329664:C344S;ENSP00000395809:C344S;ENSP00000352665:C344S;ENSP00000402677:C344S;ENSP00000422890:C83S	ENSP00000329664:C344S	C	+	1	0	ATP2C1	132166487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.099000	0.63709	0.459000	0.35465	TGT	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase		0.343	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATP2C1	protein_coding	OTTHUMT00000356648.2	T	NM_001001486	-		130683797	+1	no_errors	ENST00000393221	ensembl	human	known	74_37	missense	SNP	1.000	A
ESPL1	9700	genome.wustl.edu	37	12	53683300	53683300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:53683300delT	ENST00000257934.4	+	22	5126	c.5035delT	c.(5035-5037)ttcfs	p.F1679fs	ESPL1_ENST00000552462.1_Frame_Shift_Del_p.F1679fs	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1679					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CCTCTTTTCCTTCAGGGCTTT	0.607																																					Colon(53;1069 1201 2587 5382)												0								ENSG00000135476						48.0	52.0	50.0					12																	53683300		2203	4300	6503	ESPL1	SO:0001589	frameshift_variant	0				HGNC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5035delT	12.37:g.53683300delT	ENSP00000257934:p.Phe1679fs	Somatic	0	68	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.F1679fs	ENST00000257934.4	37	c.5035	CCDS8852.1	12																																																																																			-	NULL		0.607	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	protein_coding	OTTHUMT00000406899.2	T	NM_012291			53683300	+1	no_errors	ENST00000257934	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KIF11	3832	genome.wustl.edu	37	10	94390005	94390005	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:94390005G>T	ENST00000260731.3	+	12	1468	c.1378G>T	c.(1378-1380)Gaa>Taa	p.E460*		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	460					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAAAACACAAGAACTTGAAAC	0.299																																					Colon(47;212 1003 2764 4062 8431)												0								ENSG00000138160						60.0	60.0	60.0					10																	94390005		2203	4300	6503	KIF11	SO:0001587	stop_gained	0			-	HGNC	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.1378G>T	10.37:g.94390005G>T	ENSP00000260731:p.Glu460*	Somatic	0	50	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A0AV49|B2RMV3|Q15716|Q5VWX0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E460*	ENST00000260731.3	37	c.1378	CCDS7422.1	10	.	.	.	.	.	.	.	.	.	.	g	38	6.977382	0.97975	.	.	ENSG00000138160	ENST00000260731	.	.	.	5.82	5.82	0.92795	.	0.170353	0.51477	D	0.000096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	19.6917	0.96005	0.0:0.0:1.0:0.0	.	.	.	.	X	460	.	ENSP00000260731:E460X	E	+	1	0	KIF11	94379985	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.318000	0.51975	2.751000	0.94390	0.650000	0.86243	GAA	-	NULL		0.299	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF11	protein_coding	OTTHUMT00000049401.1	G	NM_004523	-		94390005	+1	no_errors	ENST00000260731	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577136	7577136	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577136T>A	ENST00000269305.4	-	8	991	c.802A>T	c.(802-804)Aac>Tac	p.N268Y	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.N268Y|TP53_ENST00000455263.2_Missense_Mutation_p.N268Y|TP53_ENST00000420246.2_Missense_Mutation_p.N268Y|TP53_ENST00000359597.4_Missense_Mutation_p.N268Y|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	268	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.N268H(3)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.N268fs*77(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.N268fs*8(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)|p.N268F(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAAAGCTGTTCCGTCCCAGT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Deletion - In frame(8)|Whole gene deletion(8)|Substitution - Missense(4)|Unknown(3)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|lung(3)|large_intestine(2)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|breast(2)|thyroid(1)|stomach(1)|eye(1)|ovary(1)						ENSG00000141510						55.0	49.0	51.0					17																	7577136		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.802A>T	17.37:g.7577136T>A	ENSP00000269305:p.Asn268Tyr	Somatic	0	27	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N268Y	ENST00000269305.4	37	c.802	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193991	0.58017	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99762	-6.67;-6.67;-6.67;-6.67;-6.67;-6.67	5.13	-4.52	0.03472	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.596147	0.17821	N	0.160851	D	0.99184	0.9717	L	0.45581	1.43	0.09310	N	0.999999	D;B;D;D	0.67145	0.995;0.138;0.992;0.996	D;B;D;D	0.74348	0.956;0.117;0.962;0.983	D	0.96648	0.9479	10	0.87932	D	0	-6.849	2.6577	0.05017	0.1106:0.3308:0.3293:0.2293	.	268;268;268;268	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	268;268;268;268;268;257;136	ENSP00000352610:N268Y;ENSP00000269305:N268Y;ENSP00000398846:N268Y;ENSP00000391127:N268Y;ENSP00000391478:N268Y;ENSP00000425104:N136Y	ENSP00000269305:N268Y	N	-	1	0	TP53	7517861	0.001000	0.12720	0.074000	0.20217	0.886000	0.51366	-0.220000	0.09215	-0.688000	0.05155	0.379000	0.24179	AAC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7577136	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.001	A
COL6A6	131873	genome.wustl.edu	37	3	130282278	130282278	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:130282278A>T	ENST00000358511.6	+	2	462	c.431A>T	c.(430-432)gAg>gTg	p.E144V	COL6A6_ENST00000453409.2_Missense_Mutation_p.E144V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	144	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCTGAGTCTGAGGATAATGTG	0.498																																																	0								ENSG00000206384						48.0	48.0	48.0					3																	130282278		1901	4122	6023	COL6A6	SO:0001583	missense	0			-	HGNC	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.431A>T	3.37:g.130282278A>T	ENSP00000351310:p.Glu144Val	Somatic	0	57	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E144V	ENST00000358511.6	37	c.431	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	A	17.43	3.386518	0.61956	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78364	-1.17;-1.17	5.21	5.21	0.72293	von Willebrand factor, type A (3);	0.101584	0.43260	D	0.000596	D	0.84942	0.5584	M	0.69185	2.1	0.28192	N	0.927723	D	0.64830	0.994	P	0.61658	0.892	T	0.80410	-0.1394	10	0.49607	T	0.09	.	15.0383	0.71767	1.0:0.0:0.0:0.0	.	144	A6NMZ7	CO6A6_HUMAN	V	144	ENSP00000351310:E144V;ENSP00000399236:E144V	ENSP00000351310:E144V	E	+	2	0	COL6A6	131764968	0.976000	0.34144	0.995000	0.50966	0.769000	0.43574	2.462000	0.45049	2.090000	0.63153	0.459000	0.35465	GAG	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	protein_coding	OTTHUMT00000356705.5	A	NM_001102608	-		130282278	+1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	SNP	0.895	T
KCNA6	3742	genome.wustl.edu	37	12	4919890	4919890	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:4919890A>T	ENST00000280684.3	+	1	1549	c.683A>T	c.(682-684)gAa>gTa	p.E228V	KCNA6_ENST00000433855.1_Missense_Mutation_p.E228V|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	228					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GAGGAGGATGAAGACGATTCC	0.552										HNSCC(72;0.22)																																							0								ENSG00000151079						88.0	88.0	88.0					12																	4919890		2203	4300	6503	KCNA6	SO:0001583	missense	0			-	HGNC	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.683A>T	12.37:g.4919890A>T	ENSP00000280684:p.Glu228Val	Somatic	0	67	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	52	14.75		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E228V	ENST00000280684.3	37	c.683	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	A	0.244	-1.011687	0.02095	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97209	-4.29;-4.29	5.64	5.64	0.86602	.	2.916220	0.01570	N	0.020525	D	0.92433	0.7598	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.82977	-0.0189	10	0.26408	T	0.33	.	7.0966	0.25313	0.7752:0.1486:0.0763:0.0	.	228	P17658	KCNA6_HUMAN	V	228	ENSP00000408321:E228V;ENSP00000280684:E228V	ENSP00000280684:E228V	E	+	2	0	KCNA6	4790151	0.054000	0.20591	0.109000	0.21407	0.057000	0.15508	0.804000	0.27098	2.152000	0.67230	0.533000	0.62120	GAA	-	prints_K_chnl_volt-dep_Kv1.6		0.552	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	protein_coding	OTTHUMT00000398909.1	A	NM_002235	-		4919890	+1	no_errors	ENST00000280684	ensembl	human	known	74_37	missense	SNP	0.070	T
CEP192	55125	genome.wustl.edu	37	18	13068181	13068181	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:13068181delG	ENST00000325971.8	+	21	4508	c.2915delG	c.(2914-2916)cggfs	p.R972fs	CEP192_ENST00000506447.1_Frame_Shift_Del_p.R1568fs|CEP192_ENST00000430049.2_Frame_Shift_Del_p.R1093fs			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	972					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GTGGTCACTCGGCTAGCAGGC	0.493																																																	0								ENSG00000101639						78.0	79.0	79.0					18																	13068181		2203	4300	6503	CEP192	SO:0001589	frameshift_variant	0				HGNC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2915delG	18.37:g.13068181delG	ENSP00000317156:p.Arg972fs	Somatic	0	50	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.L1569fs	ENST00000325971.8	37	c.4703		18																																																																																			-	NULL		0.493	CEP192-201	KNOWN	basic	protein_coding	CEP192	protein_coding		G	NM_032142			13068181	+1	no_errors	ENST00000506447	ensembl	human	known	74_37	frame_shift_del	DEL	0.008	-
ZNF169	169841	genome.wustl.edu	37	9	97062505	97062505	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:97062505G>T	ENST00000395395.2	+	5	755	c.665G>T	c.(664-666)aGc>aTc	p.S222I	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				CTGGGACTTAGCAAAAAGTCA	0.502																																																	0								ENSG00000175787						61.0	55.0	57.0					9																	97062505		2203	4300	6503	ZNF169	SO:0001583	missense	0			-	HGNC	U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.665G>T	9.37:g.97062505G>T	ENSP00000378792:p.Ser222Ile	Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S222I	ENST00000395395.2	37	c.665	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	7.906	0.735353	0.15574	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.07114	3.22	2.59	0.671	0.17929	.	.	.	.	.	T	0.04815	0.0130	L	0.28115	0.83	0.09310	N	1	B	0.15930	0.015	B	0.22152	0.038	T	0.46857	-0.9161	9	0.15499	T	0.54	.	2.1547	0.03809	0.3128:0.0:0.4358:0.2513	.	222	Q14929	ZN169_HUMAN	I	222;31	ENSP00000378792:S222I	ENSP00000340711:S31I	S	+	2	0	ZNF169	96102326	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-1.716000	0.01878	0.176000	0.19873	-0.362000	0.07510	AGC	-	NULL		0.502	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	protein_coding	OTTHUMT00000253714.1	G	NM_194320	-		97062505	+1	no_errors	ENST00000395395	ensembl	human	known	74_37	missense	SNP	0.000	T
PCDHB18	54660	genome.wustl.edu	37	5	140614224	140614224	+	RNA	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:140614224C>T	ENST00000526308.1	+	0	287					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GGAGCTATTCCATAGCAGAGG	0.537																																																	0								ENSG00000146001																																			PCDHB18			0			-	HGNC	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140614224C>T		Somatic	0	32	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B3KTF8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			-	-		0.537	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	pseudogene	OTTHUMT00000394776.1	C		-		140614224	+1	no_errors	ENST00000526308	ensembl	human	known	74_37	rna	SNP	0.174	T
LOC100631378	100631378	genome.wustl.edu	37	19	38322104	38322104	+	lincRNA	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:38322104G>A	ENST00000443870.1	+	0	1914				AC016582.2_ENST00000592640.1_lincRNA																							TGACCCCGGTGAATGAAGACC	0.522																																																	0								ENSG00000229481																																			CTD-2554C21.3			0			-	Clone_based_vega_gene																													19.37:g.38322104G>A		Somatic	0	77	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	-		0.522	CTD-2554C21.3-001	KNOWN	basic	lincRNA	ENSG00000229481	lincRNA	OTTHUMT00000459795.1	G		-		38322104	+1	no_errors	ENST00000443870	ensembl	human	known	74_37	rna	SNP	0.167	A
TMEM200A	114801	genome.wustl.edu	37	6	130762280	130762280	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:130762280G>C	ENST00000296978.3	+	3	1584	c.713G>C	c.(712-714)aGt>aCt	p.S238T	TMEM200A_ENST00000545622.1_Missense_Mutation_p.S238T|TMEM200A_ENST00000392429.1_Missense_Mutation_p.S238T	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	238						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GAAGGTAAGAGTTCTGGGCAT	0.493																																																	0								ENSG00000164484						67.0	64.0	65.0					6																	130762280		2203	4300	6503	TMEM200A	SO:0001583	missense	0			-	HGNC	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.713G>C	6.37:g.130762280G>C	ENSP00000296978:p.Ser238Thr	Somatic	0	39	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	Q96PX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2371_TMEM200	p.S238T	ENST00000296978.3	37	c.713	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	G	0.426	-0.905837	0.02453	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.93	3.1	0.35709	.	0.574086	0.20413	N	0.092840	T	0.10637	0.0260	L	0.31664	0.95	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.25950	-1.0117	9	0.21540	T	0.41	-23.7235	7.0026	0.24817	0.2048:0.3516:0.4436:0.0	.	238	Q86VY9	T200A_HUMAN	T	238	.	ENSP00000296978:S238T	S	+	2	0	TMEM200A	130803973	0.950000	0.32346	0.858000	0.33744	0.217000	0.24651	1.534000	0.36051	0.800000	0.34041	0.655000	0.94253	AGT	-	NULL		0.493	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	protein_coding	OTTHUMT00000042201.1	G	NM_052913	-		130762280	+1	no_errors	ENST00000296978	ensembl	human	known	74_37	missense	SNP	0.372	C
ABCA8	10351	genome.wustl.edu	37	17	66865867	66865867	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:66865867G>T	ENST00000269080.2	-	36	4702	c.4565C>A	c.(4564-4566)gCc>gAc	p.A1522D	ABCA8_ENST00000586539.1_Missense_Mutation_p.A1562D|ABCA8_ENST00000430352.2_Missense_Mutation_p.A1562D	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1522					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GAAAGCTTGGGCTAAAGGTTG	0.388																																																	0								ENSG00000141338						137.0	137.0	137.0					17																	66865867		2203	4300	6503	ABCA8	SO:0001583	missense	0			-	HGNC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4565C>A	17.37:g.66865867G>T	ENSP00000269080:p.Ala1522Asp	Somatic	0	72	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A1562D	ENST00000269080.2	37	c.4685	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391707	0.83011	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.88046	-2.33;-2.33	4.83	3.84	0.44239	.	0.669254	0.13032	N	0.419270	D	0.90466	0.7014	M	0.79343	2.45	0.09310	N	0.999999	P;P;P	0.43973	0.616;0.823;0.616	B;P;B	0.48677	0.15;0.586;0.272	D	0.83724	0.0194	10	0.87932	D	0	.	14.3926	0.66989	0.0:0.1489:0.8511:0.0	.	1562;1562;1522	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	D	1522;1562	ENSP00000269080:A1522D;ENSP00000402814:A1562D	ENSP00000269080:A1522D	A	-	2	0	ABCA8	64377462	0.955000	0.32602	0.007000	0.13788	0.947000	0.59692	5.722000	0.68485	1.357000	0.45904	0.561000	0.74099	GCC	-	NULL		0.388	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	protein_coding	OTTHUMT00000450172.1	G	NM_007168	-		66865867	-1	no_errors	ENST00000430352	ensembl	human	known	74_37	missense	SNP	0.255	T
NCOA1	8648	genome.wustl.edu	37	2	24952593	24952593	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:24952593G>A	ENST00000406961.1	+	17	3762	c.3110G>A	c.(3109-3111)gGc>gAc	p.G1037D	NCOA1_ENST00000405141.1_Missense_Mutation_p.G1037D|NCOA1_ENST00000348332.3_Missense_Mutation_p.G1037D|NCOA1_ENST00000407230.1_Missense_Mutation_p.G886D|NCOA1_ENST00000288599.5_Missense_Mutation_p.G1037D|NCOA1_ENST00000395856.3_Missense_Mutation_p.G1037D|NCOA1_ENST00000538539.1_Missense_Mutation_p.G1037D			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1037					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGCATGGGCATGCAGCCC	0.542			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0								ENSG00000084676						114.0	114.0	114.0					2																	24952593		2203	4300	6503	NCOA1	SO:0001583	missense	0			-	HGNC	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3110G>A	2.37:g.24952593G>A	ENSP00000385216:p.Gly1037Asp	Somatic	0	88	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.64	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.G1037D	ENST00000406961.1	37	c.3110	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203685	0.58234	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.51	5.51	0.81932	.	0.172578	0.49916	D	0.000122	T	0.45094	0.1325	L	0.49778	1.585	0.48511	D	0.999663	B;B;B;B	0.34290	0.447;0.319;0.241;0.155	B;B;B;B	0.34180	0.177;0.086;0.177;0.086	T	0.39563	-0.9608	10	0.44086	T	0.13	.	16.0087	0.80380	0.0:0.1346:0.8654:0.0	.	1037;1037;1037;886	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	D	1037;1037;886;1037;1037;1037;1037	ENSP00000385216:G1037D;ENSP00000385097:G1037D;ENSP00000385195:G886D;ENSP00000444039:G1037D;ENSP00000320940:G1037D;ENSP00000288599:G1037D;ENSP00000379197:G1037D	ENSP00000288599:G1037D	G	+	2	0	NCOA1	24806097	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.297000	0.51810	2.775000	0.95449	0.585000	0.79938	GGC	-	pirsf_Nuclear_rcpt_coactivator		0.542	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	protein_coding	OTTHUMT00000246852.3	G	NM_147223	-		24952593	+1	no_errors	ENST00000348332	ensembl	human	known	74_37	missense	SNP	1.000	A
ASPDH	554235	genome.wustl.edu	37	19	51015485	51015485	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:51015485C>T	ENST00000389208.4	-	6	777	c.716G>A	c.(715-717)aGc>aAc	p.S239N	JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000597030.1_5'UTR|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.S134N	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	239					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CACAGCAAAGCTTCGGCCCGT	0.692																																																	0								ENSG00000204653						23.0	29.0	27.0					19																	51015485		2201	4300	6501	ASPDH	SO:0001583	missense	0			-	HGNC		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.716G>A	19.37:g.51015485C>T	ENSP00000373860:p.Ser239Asn	Somatic	0	54	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	Q6NZ37	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp_DH,pfam_Asp/hSer_DH_NAD-bd	p.S239N	ENST00000389208.4	37	c.716	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528809	0.27387	.	.	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.45668	0.89;0.89	3.47	1.04	0.20106	Aspartate dehydrogenase (1);	1.248550	0.06032	N	0.653346	T	0.30166	0.0756	L	0.36672	1.1	0.22620	N	0.998922	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.22208	-1.0223	10	0.25751	T	0.34	-5.5901	4.2875	0.10862	0.0:0.6233:0.238:0.1387	.	239;134	A6ND91;A6ND91-2	ASPD_HUMAN;.	N	134;239	ENSP00000366114:S134N;ENSP00000373860:S239N	ENSP00000366114:S134N	S	-	2	0	ASPDH	55707297	0.001000	0.12720	0.650000	0.29550	0.916000	0.54674	-0.180000	0.09754	0.591000	0.29711	0.462000	0.41574	AGC	-	pfam_Asp_DH		0.692	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	protein_coding	OTTHUMT00000464861.1	C	NM_001024656	-		51015485	-1	no_errors	ENST00000389208	ensembl	human	known	74_37	missense	SNP	0.613	T
MYO6	4646	genome.wustl.edu	37	6	76568652	76568652	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:76568652G>T	ENST00000369977.3	+	14	1554	c.1415G>T	c.(1414-1416)tGc>tTc	p.C472F	MYO6_ENST00000369985.4_Missense_Mutation_p.C472F|MYO6_ENST00000369975.1_Missense_Mutation_p.C472F|MYO6_ENST00000369981.3_Missense_Mutation_p.C472F	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	472	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GAACAATTTTGCATCAACTAT	0.279																																																	0								ENSG00000196586						48.0	48.0	48.0					6																	76568652		2201	4286	6487	MYO6	SO:0001583	missense	0			-	HGNC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.1415G>T	6.37:g.76568652G>T	ENSP00000358994:p.Cys472Phe	Somatic	0	43	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.C472F	ENST00000369977.3	37	c.1415	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792955	0.90453	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	6.08	6.08	0.98989	.	0.040549	0.85682	D	0.000000	D	0.89491	0.6730	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90456	0.4442	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	472;472	Q9UM54-2;Q9UM54-1	.;.	F	472	ENSP00000358998:C472F;ENSP00000359002:C472F;ENSP00000358994:C472F;ENSP00000358992:C472F	ENSP00000358992:C472F	C	+	2	0	MYO6	76625372	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.444000	0.97578	2.894000	0.99253	0.655000	0.94253	TGC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.279	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	protein_coding	OTTHUMT00000041279.2	G	NM_004999	-		76568652	+1	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC36A1	206358	genome.wustl.edu	37	5	150844123	150844124	+	Frame_Shift_Ins	INS	-	-	T	rs143136105		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:150844123_150844124insT	ENST00000243389.3	+	4	506_507	c.283_284insT	c.(283-285)atgfs	p.M95fs	SLC36A1_ENST00000520701.1_Frame_Shift_Ins_p.M95fs|SLC36A1_ENST00000521351.1_3'UTR|SLC36A1_ENST00000521925.1_Frame_Shift_Ins_p.M95fs|SLC36A1_ENST00000429484.2_Frame_Shift_Ins_p.M95fs	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	95					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CGTGCACTGCATGGGTATCCTG	0.51																																					Melanoma(151;1534 1860 12947 32979 37872)												0								ENSG00000123643																																			SLC36A1	SO:0001589	frameshift_variant	0				HGNC	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.284dupT	5.37:g.150844124_150844124dupT	ENSP00000243389:p.Met95fs	Somatic	0	32	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.M95fs	ENST00000243389.3	37	c.283_284	CCDS4316.1	5																																																																																			-	pfam_AA_transpt_TM		0.510	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A1	protein_coding	OTTHUMT00000252433.1	-	NM_078483			150844124	+1	no_errors	ENST00000243389	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113377481	113377482	+	Frame_Shift_Ins	INS	-	-	T	rs78597857		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:113377481_113377482insT	ENST00000478658.1	-	5	3064_3065	c.3047_3048insA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Frame_Shift_Ins_p.N1016fs			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ATTTCTGAGGGTTTTTTTTTTT	0.366																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)						ENSG00000176542																																			KIAA2018	SO:0001589	frameshift_variant	0				HGNC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3048dupA	3.37:g.113377492_113377492dupT	ENSP00000420721:p.Asn1016fs	Somatic	0	38	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3048_3047	CCDS43133.1	3																																																																																			-	NULL		0.366	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	protein_coding	OTTHUMT00000354591.1	-	NM_001009899			113377482	-1	no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_ins	INS	0.174:0.827	T
ARHGEF4	50649	genome.wustl.edu	37	2	131803760	131803760	+	Nonstop_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:131803760T>C	ENST00000326016.5	+	14	2590	c.2071T>C	c.(2071-2073)Tga>Cga	p.*691R	ARHGEF4_ENST00000428230.2_Nonstop_Mutation_p.*193R|ARHGEF4_ENST00000525839.1_3'UTR|ARHGEF4_ENST00000409303.1_Nonstop_Mutation_p.*631R|ARHGEF4_ENST00000355771.3_Nonstop_Mutation_p.*620R|ARHGEF4_ENST00000392953.3_3'UTR	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	0					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CTTCCGCAAGTGAACTGGTCC	0.667																																																	0								ENSG00000136002						26.0	29.0	28.0					2																	131803760		2201	4299	6500	ARHGEF4	SO:0001578	stop_lost	0			-	HGNC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.2071T>C	2.37:g.131803760T>C	ENSP00000316845:p.*691Argext*91	Somatic	0	84	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	36	33.33	Q9HDC6|Q9UPP0	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.*691R	ENST00000326016.5	37	c.2071	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526615	0.85706	.	.	ENSG00000136002	ENST00000326016;ENST00000438985;ENST00000428230;ENST00000409303;ENST00000355771	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4949	0.61419	0.0:0.0:0.0:1.0	.	.	.	.	R	691;373;193;631;620	.	.	X	+	1	0	ARHGEF4	131520230	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.654000	0.61469	2.089000	0.63090	0.379000	0.24179	TGA	-	NULL		0.667	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	protein_coding	OTTHUMT00000254554.4	T		-		131803760	+1	no_errors	ENST00000326016	ensembl	human	known	74_37	nonstop	SNP	1.000	C
RAB4B	53916	genome.wustl.edu	37	19	41289870	41289870	+	Missense_Mutation	SNP	G	G	A	rs556443632		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:41289870G>A	ENST00000594800.1	+	5	480	c.320G>A	c.(319-321)cGc>cAc	p.R107H	RAB4B_ENST00000357052.2_Missense_Mutation_p.R107H|MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000594136.1_Missense_Mutation_p.R107H|RAB4B_ENST00000602069.1_3'UTR|RAB4B-EGLN2_ENST00000601949.1_Intron			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	107					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACGGATGCCCGCACCCTGGCC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		14248	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000167578						43.0	40.0	41.0					19																	41289870		2203	4300	6503	RAB4B	SO:0001583	missense	0			-	HGNC	AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.320G>A	19.37:g.41289870G>A	ENSP00000470246:p.Arg107His	Somatic	0	102	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	P22750|Q7Z514|Q9HBR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R107H	ENST00000594800.1	37	c.320	CCDS33030.1	19	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041244	0.75732	.	.	ENSG00000167578	ENST00000357052	T	0.80480	-1.38	4.88	3.85	0.44370	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000001	D	0.83128	0.5187	L	0.42686	1.345	0.80722	D	1	D;D	0.76494	0.999;0.977	P;P	0.61477	0.889;0.472	D	0.84038	0.0363	10	0.87932	D	0	.	11.6392	0.51222	0.0886:0.0:0.9114:0.0	.	142;107	P61018-2;P61018	.;RAB4B_HUMAN	H	107	ENSP00000349560:R107H	ENSP00000349560:R107H	R	+	2	0	RAB4B	45981710	1.000000	0.71417	0.678000	0.29963	0.803000	0.45373	9.720000	0.98763	1.045000	0.40225	0.478000	0.44815	CGC	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.632	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4B	protein_coding	OTTHUMT00000463168.1	G	NM_016154	-		41289870	+1	no_errors	ENST00000357052	ensembl	human	known	74_37	missense	SNP	1.000	A
AGAP3	116988	genome.wustl.edu	37	7	150814543	150814543	+	Splice_Site	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:150814543G>T	ENST00000397238.2	+	4	564	c.564G>T	c.(562-564)caG>caT	p.Q188H	AGAP3_ENST00000463381.1_5'UTR|AGAP3_ENST00000479901.1_Splice_Site_p.Q188H|AGAP3_ENST00000473312.1_Splice_Site_p.Q188H|AGAP3_ENST00000476375.1_3'UTR|AGAP3_ENST00000335367.3_Splice_Site_p.Q368H	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	152	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CTGAGCTCCAGGTGATGCTCC	0.617																																																	0								ENSG00000133612						75.0	83.0	81.0					7																	150814543		2036	4207	6243	AGAP3	SO:0001630	splice_region_variant	0			-	HGNC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.564+1G>T	7.37:g.150814543G>T		Somatic	0	52	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.Q188H	ENST00000397238.2	37	c.564	CCDS43681.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.502210|4.502210	0.85176|0.85176	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355;ENST00000335367|ENST00000469901	T;T;T;T|.	0.66638|.	-0.22;-0.22;-0.22;-0.22|.	3.37|3.37	3.37|3.37	0.38596|0.38596	.|.	0.363225|.	0.26341|.	N|.	0.024938|.	T|T	0.75810|0.75810	0.3900|0.3900	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	D;P;D;D|.	0.71674|.	0.998;0.476;0.997;0.997|.	D;P;D;D|.	0.68039|.	0.955;0.63;0.928;0.929|.	T|T	0.78583|0.78583	-0.2148|-0.2148	10|5	0.87932|.	D|.	0|.	.|.	13.144|13.144	0.59450|0.59450	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	188;368;188;188|.	C9J975;E7ESL9;Q96P47-4;E9PAL8|.	.;.;.;.|.	H|I	188;188;188;152;368|124	ENSP00000418921:Q188H;ENSP00000418125:Q188H;ENSP00000380413:Q188H;ENSP00000335589:Q368H|.	ENSP00000334157:Q152H|.	Q|S	+|+	3|2	2|0	AGAP3|AGAP3	150445476|150445476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.832000|7.832000	0.86757|0.86757	2.227000|2.227000	0.72691|0.72691	0.400000|0.400000	0.26472|0.26472	CAG|AGT	-	pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase		0.617	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP3	protein_coding	OTTHUMT00000351908.3	G	NM_031946	-	Missense_Mutation	150814543	+1	no_errors	ENST00000397238	ensembl	human	known	74_37	missense	SNP	1.000	T
CEACAM1	634	genome.wustl.edu	37	19	43025657	43025657	+	Silent	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:43025657G>T	ENST00000161559.6	-	4	854	c.720C>A	c.(718-720)ccC>ccA	p.P240P	CEACAM1_ENST00000403444.3_Silent_p.P240P|CEACAM1_ENST00000352591.5_Silent_p.P240P|CEACAM1_ENST00000599389.1_Silent_p.P240P|CEACAM1_ENST00000403461.1_Silent_p.P240P|CEACAM1_ENST00000358394.3_Silent_p.P240P|CEACAM1_ENST00000351134.3_Intron|LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000308072.4_Silent_p.P200P	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	240	Ig-like C2-type 2.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	GGGAAATGGTGGGGGTGTCCG	0.557																																																	0								ENSG00000079385						102.0	107.0	105.0					19																	43025657		2203	4300	6503	CEACAM1	SO:0001819	synonymous_variant	0			-	HGNC	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.720C>A	19.37:g.43025657G>T		Somatic	0	101	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P240	ENST00000161559.6	37	c.720	CCDS12609.1	19																																																																																			-	pfscan_Ig-like_dom		0.557	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM1	protein_coding	OTTHUMT00000321190.2	G	NM_001712	-		43025657	-1	no_errors	ENST00000161559	ensembl	human	known	74_37	silent	SNP	0.974	T
PLCG2	5336	genome.wustl.edu	37	16	81990389	81990389	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:81990389C>A	ENST00000359376.3	+	32	3874	c.3660C>A	c.(3658-3660)caC>caA	p.H1220Q		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	1220					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ATGACACACACCAGAACTTGC	0.517																																																	0								ENSG00000197943						108.0	111.0	110.0					16																	81990389		2000	4166	6166	PLCG2	SO:0001583	missense	0			-	HGNC		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.3660C>A	16.37:g.81990389C>A	ENSP00000352336:p.His1220Gln	Somatic	0	66	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_dom,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.H1220Q	ENST00000359376.3	37	c.3660	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957253	0.34565	.	.	ENSG00000197943	ENST00000359376	T	0.65364	-0.15	5.56	0.788	0.18601	.	0.085587	0.85682	N	0.000000	T	0.38612	0.1047	L	0.29908	0.895	0.40250	D	0.978067	B	0.19706	0.038	B	0.17979	0.02	T	0.06197	-1.0840	10	0.13853	T	0.58	.	2.8631	0.05593	0.128:0.5028:0.1255:0.2438	.	1220	P16885	PLCG2_HUMAN	Q	1220	ENSP00000352336:H1220Q	ENSP00000352336:H1220Q	H	+	3	2	PLCG2	80547890	0.722000	0.28017	1.000000	0.80357	0.997000	0.91878	-0.333000	0.07894	0.287000	0.22375	0.555000	0.69702	CAC	-	pirsf_PLC-gamma		0.517	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	protein_coding	OTTHUMT00000432429.1	C		-		81990389	+1	no_errors	ENST00000359376	ensembl	human	known	74_37	missense	SNP	0.991	A
KIAA1468	57614	genome.wustl.edu	37	18	59947038	59947038	+	Intron	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:59947038T>C	ENST00000398130.2	+	23	3199				KIAA1468_ENST00000256858.6_Missense_Mutation_p.V1034A	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468											autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GAAACTCTGGTAGCTCAGAGG	0.498																																																	0								ENSG00000134444																																			KIAA1468	SO:0001627	intron_variant	0			-	HGNC	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2968-555T>C	18.37:g.59947038T>C		Somatic	0	70	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.V1034A	ENST00000398130.2	37	c.3101	CCDS11979.2	18	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563725	0.45694	.	.	ENSG00000134444	ENST00000256858	T	0.03951	3.75	5.72	5.72	0.89469	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.56434	0.798	T	0.00430	-1.1744	7	.	.	.	-15.6187	16.2988	0.82793	0.0:0.0:0.0:1.0	.	1034	Q9P260-2	.	A	1034	ENSP00000256858:V1034A	.	V	+	2	0	KIAA1468	58098018	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.965000	0.87945	2.311000	0.77944	0.533000	0.62120	GTA	-	superfamily_ARM-type_fold		0.498	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	protein_coding	OTTHUMT00000256187.1	T	NM_020854	-		59947038	+1	no_errors	ENST00000256858	ensembl	human	known	74_37	missense	SNP	1.000	C
AMOT	154796	genome.wustl.edu	37	X	112058737	112058737	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:112058737T>C	ENST00000524145.1	-	3	1315	c.1241A>G	c.(1240-1242)cAg>cGg	p.Q414R	AMOT_ENST00000304758.1_Missense_Mutation_p.Q5R|AMOT_ENST00000371959.3_Missense_Mutation_p.Q414R|AMOT_ENST00000371958.1_Missense_Mutation_p.Q182R|AMOT_ENST00000371962.1_Missense_Mutation_p.Q182R			Q4VCS5	AMOT_HUMAN	angiomotin	414					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						AGAGGATGGCTGAGCCCGAGG	0.562																																																	0								ENSG00000126016						103.0	90.0	95.0					X																	112058737		2203	4300	6503	AMOT	SO:0001583	missense	0			-	HGNC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1241A>G	X.37:g.112058737T>C	ENSP00000429013:p.Gln414Arg	Somatic	0	29	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.Q414R	ENST00000524145.1	37	c.1241	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	T	12.44	1.937804	0.34189	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.18960	2.18;2.59;2.59;2.59;2.59	5.45	5.45	0.79879	.	0.331472	0.33253	N	0.005116	T	0.19087	0.0458	L	0.43152	1.355	0.30394	N	0.780733	B	0.15473	0.013	B	0.12837	0.008	T	0.08868	-1.0701	10	0.62326	D	0.03	-14.1089	9.8875	0.41270	0.0:0.0:0.1687:0.8313	.	414	Q4VCS5	AMOT_HUMAN	R	5;414;182;414;182	ENSP00000305557:Q5R;ENSP00000361027:Q414R;ENSP00000361030:Q182R;ENSP00000429013:Q414R;ENSP00000361026:Q182R	ENSP00000305557:Q5R	Q	-	2	0	AMOT	111945393	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.474000	0.45154	2.018000	0.59344	0.486000	0.48141	CAG	-	NULL		0.562	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	protein_coding	OTTHUMT00000378570.1	T	NM_133265	-		112058737	-1	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	SNP	1.000	C
UTP14A	10813	genome.wustl.edu	37	X	129054466	129054466	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:129054466G>T	ENST00000394422.3	+	9	814	c.786G>T	c.(784-786)aaG>aaT	p.K262N	UTP14A_ENST00000425117.2_Missense_Mutation_p.K210N|UTP14A_ENST00000371051.5_Missense_Mutation_p.K208N|UTP14A_ENST00000371042.3_Missense_Mutation_p.K94N|RP4-537K23.4_ENST00000432062.1_RNA	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	262					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GAAAGGCCAAGAAAGCCCTAA	0.463																																																	0								ENSG00000156697						126.0	123.0	124.0					X																	129054466		2203	4300	6503	UTP14A	SO:0001583	missense	0			-	HGNC	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.786G>T	X.37:g.129054466G>T	ENSP00000377944:p.Lys262Asn	Somatic	0	66	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSU_processome_Utp14	p.K262N	ENST00000394422.3	37	c.786	CCDS14615.1	X	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682861	0.47991	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000427972;ENST00000371042	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	6.17	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.52208	0.1720	M	0.88310	2.945	0.53005	D	0.999969	P;P;P	0.51240	0.943;0.909;0.89	P;P;P	0.56751	0.629;0.805;0.745	T	0.58544	-0.7618	10	0.72032	D	0.01	-19.3386	6.5764	0.22569	0.1642:0.2018:0.634:0.0	.	208;210;262	F8WD00;E9PEL7;Q9BVJ6	.;.;UT14A_HUMAN	N	210;262;208;94;94	ENSP00000388669:K210N;ENSP00000377944:K262N;ENSP00000360090:K208N;ENSP00000413187:K94N;ENSP00000360081:K94N	ENSP00000360081:K94N	K	+	3	2	UTP14A	128882147	1.000000	0.71417	1.000000	0.80357	0.143000	0.21401	1.348000	0.33987	1.356000	0.45884	0.600000	0.82982	AAG	-	pfam_SSU_processome_Utp14		0.463	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	protein_coding	OTTHUMT00000058221.1	G	NM_006649	-		129054466	+1	no_errors	ENST00000394422	ensembl	human	known	74_37	missense	SNP	1.000	T
INPP5B	3633	genome.wustl.edu	37	1	38411475	38411476	+	Frame_Shift_Ins	INS	-	-	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:38411475_38411476insA	ENST00000373026.1	-	2	104_105	c.104_105insT	c.(103-105)ctcfs	p.L35fs	INPP5B_ENST00000373024.3_Frame_Shift_Ins_p.L35fs|INPP5B_ENST00000373023.2_Frame_Shift_Ins_p.L35fs|INPP5B_ENST00000373021.1_Frame_Shift_Ins_p.L35fs			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	35	PH.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CGAGTCCCAGGAGGCGGCTCTG	0.668																																																	0								ENSG00000204084																																			INPP5B	SO:0001589	frameshift_variant	0				HGNC	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.105dupT	1.37:g.38411476_38411476dupA	ENSP00000362117:p.Leu35fs	Somatic	0	49	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L36fs	ENST00000373026.1	37	c.105_104		1																																																																																			-	NULL		0.668	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	protein_coding	OTTHUMT00000012968.1	-	NM_005540			38411476	-1	no_errors	ENST00000373023	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
TP53	7157	genome.wustl.edu	37	17	7577137	7577137	+	Silent	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577137C>T	ENST00000269305.4	-	8	990	c.801G>A	c.(799-801)cgG>cgA	p.R267R	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Silent_p.R267R|TP53_ENST00000455263.2_Silent_p.R267R|TP53_ENST00000420246.2_Silent_p.R267R|TP53_ENST00000359597.4_Silent_p.R267R|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	267	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation; dbSNP:rs55832599). {ECO:0000269|PubMed:16959974}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R267R(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.N268fs*77(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.N268fs*8(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)|p.R267fs*78(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAGCTGTTCCGTCCCAGTA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - coding silent(4)|Unknown(3)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|breast(3)|lung(3)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|urinary_tract(2)|stomach(1)|eye(1)|ovary(1)|pancreas(1)						ENSG00000141510						54.0	48.0	50.0					17																	7577137		2203	4300	6503	TP53	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.801G>A	17.37:g.7577137C>T		Somatic	0	27	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R267	ENST00000269305.4	37	c.801	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577137	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	silent	SNP	0.001	T
ZNF804A	91752	genome.wustl.edu	37	2	185801275	185801275	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:185801275G>T	ENST00000302277.6	+	4	1746	c.1152G>T	c.(1150-1152)gaG>gaT	p.E384D		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	384							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGCATAACGAGGCATCCACAA	0.363																																																	0								ENSG00000170396						61.0	62.0	62.0					2																	185801275		2203	4300	6503	ZNF804A	SO:0001583	missense	0			-	HGNC	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1152G>T	2.37:g.185801275G>T	ENSP00000303252:p.Glu384Asp	Somatic	0	33	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A7E253|Q6ZN26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz	p.E384D	ENST00000302277.6	37	c.1152	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.478855	0.00165	.	.	ENSG00000170396	ENST00000302277	T	0.04654	3.58	5.39	-10.8	0.00216	.	1.323370	0.05021	N	0.472771	T	0.00784	0.0026	N	0.00368	-1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35475	-0.9787	10	0.02654	T	1	0.2196	1.4564	0.02386	0.3401:0.1558:0.3426:0.1614	.	384	Q7Z570	Z804A_HUMAN	D	384	ENSP00000303252:E384D	ENSP00000303252:E384D	E	+	3	2	ZNF804A	185509520	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.782000	0.00772	-2.865000	0.00325	-1.211000	0.01629	GAG	-	NULL		0.363	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	G	NM_194250	-		185801275	+1	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	SNP	0.000	T
COL22A1	169044	genome.wustl.edu	37	8	139611094	139611094	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:139611094G>A	ENST00000303045.6	-	61	4679	c.4233C>T	c.(4231-4233)ggC>ggT	p.G1411G	COL22A1_ENST00000435777.1_Silent_p.G1391G|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1411	Collagen-like 14.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCCAGGCTGGCCTTTTCCAC	0.587										HNSCC(7;0.00092)																																							0								ENSG00000169436						59.0	57.0	58.0					8																	139611094		2203	4300	6503	COL22A1	SO:0001819	synonymous_variant	0			-	HGNC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4233C>T	8.37:g.139611094G>A		Somatic	0	85	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G1411	ENST00000303045.6	37	c.4233	CCDS6376.1	8																																																																																			-	pfam_Collagen		0.587	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	protein_coding	OTTHUMT00000315905.2	G	XM_291257	-		139611094	-1	no_errors	ENST00000303045	ensembl	human	known	74_37	silent	SNP	0.964	A
AKAP11	11215	genome.wustl.edu	37	13	42875991	42875991	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:42875991delA	ENST00000025301.2	+	8	3284	c.3109delA	c.(3109-3111)aagfs	p.K1037fs		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1037					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATCTGACTTGAAGGAATCTGC	0.423																																																	0								ENSG00000023516						106.0	102.0	103.0					13																	42875991		2203	4300	6503	AKAP11	SO:0001589	frameshift_variant	0				HGNC	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3109delA	13.37:g.42875991delA	ENSP00000025301:p.Lys1037fs	Somatic	0	75	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	O75124|Q9NUK7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K1037fs	ENST00000025301.2	37	c.3109	CCDS9383.1	13																																																																																			-	NULL		0.423	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	protein_coding	OTTHUMT00000044700.2	A	NM_016248			42875991	+1	no_errors	ENST00000025301	ensembl	human	known	74_37	frame_shift_del	DEL	0.393	-
CAD	790	genome.wustl.edu	37	2	27459278	27459278	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:27459278delG	ENST00000403525.1	+	25	4156	c.4012delG	c.(4012-4014)gggfs	p.G1339fs	CAD_ENST00000264705.4_Frame_Shift_Del_p.G1402fs			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGTGGAGCTGGGGGCCGGCG	0.577																																																	0								ENSG00000084774						83.0	80.0	81.0					2																	27459278		2203	4300	6503	CAD	SO:0001589	frameshift_variant	0				HGNC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4012delG	2.37:g.27459278delG	ENSP00000384510:p.Gly1339fs	Somatic	0	37	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.G1402fs	ENST00000403525.1	37	c.4201		2																																																																																			-	pfam_MGS-like_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu		0.577	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	protein_coding	OTTHUMT00000324970.1	G				27459278	+1	no_errors	ENST00000264705	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
SPTA1	6708	genome.wustl.edu	37	1	158590098	158590098	+	Silent	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:158590098A>G	ENST00000368147.4	-	44	6459	c.6279T>C	c.(6277-6279)gcT>gcC	p.A2093A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2093					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTGAGCCCTAGCCAGGGAGG	0.498																																																	0								ENSG00000163554						77.0	73.0	74.0					1																	158590098		1923	4126	6049	SPTA1	SO:0001819	synonymous_variant	0			-	HGNC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6279T>C	1.37:g.158590098A>G		Somatic	0	44	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.A2093	ENST00000368147.4	37	c.6279	CCDS41423.1	1																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.498	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	A	NM_003126	-		158590098	-1	no_errors	ENST00000368147	ensembl	human	known	74_37	silent	SNP	0.003	G
MAPK6	5597	genome.wustl.edu	37	15	52338058	52338058	+	5'UTR	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:52338058G>C	ENST00000261845.5	+	0	208				MAPK6_ENST00000558841.1_3'UTR	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6						cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CGGTAGCTTTGATTGTGATTG	0.418																																																	0								ENSG00000069956																																			MAPK6	SO:0001623	5_prime_UTR_variant	0			-	HGNC	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.-600G>C	15.37:g.52338058G>C		Somatic	0	80	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	24	27.27	B2R945|B5BU65|Q68DH4|Q8IYN8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261845.5	37	NULL	CCDS10147.1	15																																																																																			-	-		0.418	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	protein_coding	OTTHUMT00000254841.2	G	NM_002748	-		52338058	+1	no_errors	ENST00000558063	ensembl	human	putative	74_37	rna	SNP	1.000	C
NBPF22P	285622	genome.wustl.edu	37	5	85578685	85578685	+	RNA	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:85578685G>C	ENST00000590707.1	+	0	408					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		GCAATCAGCAGTTCCGAGACC	0.478																																																	0								ENSG00000205449																																			NBPF22P			0			-	HGNC	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85578685G>C		Somatic	0	156	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	87	23.01		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			-	-		0.478	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	pseudogene	OTTHUMT00000453100.1	G	XM_208333	-		85578685	+1	no_errors	ENST00000590707	ensembl	human	known	74_37	rna	SNP	0.004	C
SEC63	11231	genome.wustl.edu	37	6	108243017	108243017	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:108243017C>T	ENST00000369002.4	-	4	615	c.436G>A	c.(436-438)Gca>Aca	p.A146T		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	146	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TAAGCTTTTGCTATCCTCATG	0.393																																																	0								ENSG00000025796						203.0	183.0	190.0					6																	108243017		2203	4300	6503	SEC63	SO:0001583	missense	0			-	HGNC	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.436G>A	6.37:g.108243017C>T	ENSP00000357998:p.Ala146Thr	Somatic	0	54	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec63-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_ARM-type_fold,smart_DnaJ_domain,smart_Sec63-dom,prints_DnaJ_domain,pfscan_DnaJ_domain	p.A146T	ENST00000369002.4	37	c.436	CCDS5061.1	6	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056366	0.55325	.	.	ENSG00000025796	ENST00000369002;ENST00000423697;ENST00000429168	T;T	0.30714	1.52;1.52	5.46	5.46	0.80206	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.16428	0.0395	N	0.03881	-0.34	0.80722	D	1	P;D	0.69078	0.623;0.997	P;D	0.83275	0.456;0.996	T	0.06267	-1.0836	10	0.02654	T	1	-15.3812	17.4917	0.87705	0.0:1.0:0.0:0.0	.	146;146	Q9UGP8;B3KQF0	SEC63_HUMAN;.	T	146;6;90	ENSP00000357998:A146T;ENSP00000403144:A90T	ENSP00000357998:A146T	A	-	1	0	SEC63	108349710	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.152000	0.77419	2.556000	0.86216	0.650000	0.86243	GCA	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain		0.393	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	protein_coding	OTTHUMT00000041705.4	C	NM_007214	-		108243017	-1	no_errors	ENST00000369002	ensembl	human	known	74_37	missense	SNP	1.000	T
GBP7	388646	genome.wustl.edu	37	1	89618012	89618012	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:89618012C>A	ENST00000294671.2	-	5	702	c.564G>T	c.(562-564)aaG>aaT	p.K188N		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	188	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		GTCCATCTAACTTCAGCTCCA	0.473																																																	0								ENSG00000213512						145.0	143.0	144.0					1																	89618012		2203	4300	6503	GBP7	SO:0001583	missense	0			-	HGNC	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.564G>T	1.37:g.89618012C>A	ENSP00000294671:p.Lys188Asn	Somatic	0	64	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.K188N	ENST00000294671.2	37	c.564	CCDS720.1	1	.	.	.	.	.	.	.	.	.	.	C	3.530	-0.096028	0.07010	.	.	ENSG00000213512	ENST00000294671	T	0.75704	-0.96	3.37	1.39	0.22231	Guanylate-binding protein, N-terminal (1);	0.619511	0.16790	N	0.199422	T	0.53610	0.1807	M	0.75150	2.29	0.26019	N	0.981892	B	0.15473	0.013	B	0.20577	0.03	T	0.54275	-0.8318	10	0.51188	T	0.08	.	7.2319	0.26046	0.1939:0.6183:0.1878:0.0	.	188	Q8N8V2	GBP7_HUMAN	N	188	ENSP00000294671:K188N	ENSP00000294671:K188N	K	-	3	2	GBP7	89390600	0.000000	0.05858	0.194000	0.23346	0.063000	0.16089	-0.189000	0.09629	0.145000	0.18977	-1.036000	0.02392	AAG	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.473	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	protein_coding	OTTHUMT00000029401.1	C	NM_207398	-		89618012	-1	no_errors	ENST00000294671	ensembl	human	known	74_37	missense	SNP	0.981	A
ARPP19	10776	genome.wustl.edu	37	15	52844135	52844135	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:52844135C>T	ENST00000566423.1	-	4	468	c.335G>A	c.(334-336)gGc>gAc	p.G112D	ARPP19_ENST00000564163.1_Missense_Mutation_p.G131D|ARPP19_ENST00000567669.1_Missense_Mutation_p.G112D|ARPP19_ENST00000563566.1_Missense_Mutation_p.G96D|ARPP19_ENST00000569281.2_Missense_Mutation_p.G112D|ARPP19_ENST00000249822.4_Missense_Mutation_p.G112D|ARPP19_ENST00000565288.1_5'UTR|ARPP19_ENST00000561971.1_Missense_Mutation_p.G131D|ARPP19_ENST00000569723.1_Missense_Mutation_p.G71D|ARPP19_ENST00000568196.1_Missense_Mutation_p.G96D|ARPP19_ENST00000561650.1_Missense_Mutation_p.G96D|ARPP19_ENST00000563277.1_Missense_Mutation_p.G96D			P56211	ARP19_HUMAN	cAMP-regulated phosphoprotein, 19kDa	112					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of glucose import (GO:0046326)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	phosphatase inhibitor activity (GO:0019212)|potassium channel regulator activity (GO:0015459)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						TCTTAATCAGCCAGCCAGCTT	0.443																																																	0								ENSG00000128989						135.0	130.0	132.0					15																	52844135		2194	4293	6487	ARPP19	SO:0001583	missense	0			-	HGNC	AF084555	CCDS32242.1	15q11.2	2009-04-20	2009-04-20		ENSG00000128989	ENSG00000128989			16967	protein-coding gene	gene with protein product	"""endosulfine alpha-like"""	605487				11279279, 8687439	Standard	NM_006628		Approved	ARPP-19, ARPP-16, ARPP16, ENSAL	uc002acd.1	P56211		ENST00000566423.1:c.335G>A	15.37:g.52844135C>T	ENSP00000455625:p.Gly112Asp	Somatic	0	56	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	B2R497|Q6IAM2|Q86TA6|Q9UD70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endosulphine	p.G112D	ENST00000566423.1	37	c.335	CCDS32242.1	15	.	.	.	.	.	.	.	.	.	.	.	25.0	4.590995	0.86851	.	.	ENSG00000128989	ENST00000249822	.	.	.	5.88	5.88	0.94601	.	0.045192	0.85682	N	0.000000	T	0.74261	0.3693	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.56823	0.807	T	0.75396	-0.3332	9	0.87932	D	0	.	20.3148	0.98648	0.0:1.0:0.0:0.0	.	112	P56211	ARP19_HUMAN	D	112	.	ENSP00000249822:G112D	G	-	2	0	ARPP19	50631427	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.951000	0.70273	2.818000	0.97014	0.644000	0.83932	GGC	-	NULL		0.443	ARPP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP19	protein_coding	OTTHUMT00000419834.1	C	NM_006628	-		52844135	-1	no_errors	ENST00000249822	ensembl	human	known	74_37	missense	SNP	1.000	T
ATP6V1E1	529	genome.wustl.edu	37	22	18095543	18095543	+	Intron	DEL	A	A	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:18095543delA	ENST00000253413.5	-	4	459				ATP6V1E1_ENST00000399796.2_Intron|ATP6V1E1_ENST00000478963.1_5'UTR|ATP6V1E1_ENST00000399798.2_Intron	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		ATAAACATGTAATAATTTTAT	0.299																																																	0								ENSG00000131100						47.0	52.0	50.0					22																	18095543		2202	4300	6502	ATP6V1E1	SO:0001627	intron_variant	0				HGNC	X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.276+34T>-	22.37:g.18095543delA		Somatic	0	62	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	A8MUE4|A8MUN4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253413.5	37	NULL	CCDS13745.1	22																																																																																			-	-		0.299	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1E1	protein_coding	OTTHUMT00000131790.3	A	NM_001696			18095543	-1	no_errors	ENST00000478963	ensembl	human	putative	74_37	rna	DEL	0.000	-
CRISP3	10321	genome.wustl.edu	37	6	49705150	49705150	+	5'Flank	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:49705150A>T	ENST00000393666.1	-	0	0				CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000371159.4_Missense_Mutation_p.F18Y|CRISP3_ENST00000433368.2_Intron|CRISP3_ENST00000263045.4_Intron			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3						defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATCTGCATTAAAATGATTGGT	0.433																																																	0								ENSG00000096006						55.0	54.0	54.0					6																	49705150		2203	4300	6503	CRISP3	SO:0001631	upstream_gene_variant	0			-	HGNC	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823		6.37:g.49705150A>T	Exception_encountered	Somatic	0	60	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP_domain,pfam_Cysteine_rich_secretory,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.F18Y	ENST00000393666.1	37	c.53		6	.	.	.	.	.	.	.	.	.	.	A	8.048	0.765320	0.15914	.	.	ENSG00000096006	ENST00000371159	T	0.08193	3.12	4.35	-6.62	0.01813	.	.	.	.	.	T	0.01029	0.0034	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46596	-0.9180	5	.	.	.	.	1.4161	0.02302	0.1612:0.1999:0.3814:0.2574	.	.	.	.	Y	18	ENSP00000360201:F18Y	.	F	-	2	0	CRISP3	49813109	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.229000	0.09098	-1.277000	0.02411	-0.385000	0.06624	TTT	-	NULL		0.433	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	CRISP3	protein_coding		A	NM_006061	-		49705150	-1	no_errors	ENST00000371159	ensembl	human	novel	74_37	missense	SNP	0.000	T
ZNF75A	7627	genome.wustl.edu	37	16	3367660	3367660	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:3367660C>A	ENST00000574298.1	+	6	1155	c.682C>A	c.(682-684)Caa>Aaa	p.Q228K	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	228			Q -> E (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q228E(1)		breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						AAGCTTCAGTCAAAATACAAA	0.353																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000162086						63.0	59.0	60.0					16																	3367660		2197	4300	6497	ZNF75A	SO:0001583	missense	0			-	HGNC	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.682C>A	16.37:g.3367660C>A	ENSP00000459566:p.Gln228Lys	Somatic	0	35	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	Q0VDI8|Q92669	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q228K	ENST00000574298.1	37	c.682	CCDS10501.1	16	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035201	0.35893	.	.	ENSG00000162086	ENST00000293995	.	.	.	4.57	4.57	0.56435	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.164390	0.29348	N	0.012415	T	0.22781	0.0550	L	0.28458	0.855	0.24248	N	0.995334	P	0.50443	0.935	B	0.33960	0.173	T	0.21552	-1.0242	9	0.30854	T	0.27	.	15.2186	0.73292	0.0:1.0:0.0:0.0	.	228	Q96N20	ZN75A_HUMAN	K	228	.	ENSP00000293995:Q228K	Q	+	1	0	ZNF75A	3307661	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.247000	0.18179	2.530000	0.85305	0.557000	0.71058	CAA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.353	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF75A	protein_coding	OTTHUMT00000251506.2	C	NM_153028	-		3367660	+1	no_errors	ENST00000574298	ensembl	human	known	74_37	missense	SNP	0.930	A
SLC12A9	56996	genome.wustl.edu	37	7	100459181	100459192	+	In_Frame_Del	DEL	TCAGCCAGGCCT	TCAGCCAGGCCT	-	rs548604660	byFrequency	TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	TCAGCCAGGCCT	TCAGCCAGGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:100459181_100459192delTCAGCCAGGCCT	ENST00000354161.3	+	11	1636_1647	c.1511_1522delTCAGCCAGGCCT	c.(1510-1524)gtcagccaggccttg>gtg	p.SQAL505del	SLC12A9_ENST00000415287.1_In_Frame_Del_p.SQAL416del|SLC12A9_ENST00000428758.1_In_Frame_Del_p.SQAL505del|SLC12A9_ENST00000540482.1_In_Frame_Del_p.SQAL505del|SLC12A9_ENST00000275729.3_In_Frame_Del_p.SQAL416del	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	505					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGGGGCTATGTCAGCCAGGCCTTGCTTTTCCA	0.642																																																	0								ENSG00000146828																																			SLC12A9	SO:0001651	inframe_deletion	0				HGNC	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1511_1522delTCAGCCAGGCCT	7.37:g.100459181_100459192delTCAGCCAGGCCT	ENSP00000275730:p.Ser505_Leu508del	Somatic	NA	NA	NA		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom	p.SQAL505in_frame_del	ENST00000354161.3	37	c.1511_1522	CCDS5707.1	7																																																																																			-	pfam_AA-permease/SLC12A_dom		0.642	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A9	protein_coding	OTTHUMT00000342837.1	TCAGCCAGGCCT	NM_020246			100459192	+1	no_errors	ENST00000354161	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.992:0.999	-
NUDT21	11051	genome.wustl.edu	37	16	56468673	56468673	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:56468673delT	ENST00000300291.5	-	5	712	c.540delA	c.(538-540)caafs	p.Q180fs		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	180	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						TACCTTTTTCTTGAAGCTGAA	0.299																																																	0								ENSG00000167005						105.0	109.0	107.0					16																	56468673		2197	4292	6489	NUDT21	SO:0001589	frameshift_variant	0				HGNC	AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.540delA	16.37:g.56468673delT	ENSP00000300291:p.Gln180fs	Somatic	0	64	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q6IB85|Q6NE84	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	p.E181fs	ENST00000300291.5	37	c.540	CCDS10760.1	16																																																																																			-	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5		0.299	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT21	protein_coding	OTTHUMT00000256980.3	T	NM_007006			56468673	-1	no_errors	ENST00000300291	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TPT1-AS1	100190939	genome.wustl.edu	37	13	45957935	45957935	+	RNA	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:45957935C>A	ENST00000517509.1	+	0	988				TPT1-AS1_ENST00000523445.1_RNA|TPT1-AS1_ENST00000519454.1_RNA|TPT1-AS1_ENST00000522673.1_RNA|TPT1-AS1_ENST00000520585.1_RNA	NR_024458.1				TPT1 antisense RNA 1																		tttctgttcccgggctgcgtt	0.522																																																	0								ENSG00000170919																																			TPT1-AS1			0			-	HGNC	AF318337		13q14.13	2012-10-12	2012-08-15		ENSG00000170919	ENSG00000170919		"""Long non-coding RNAs"""	43686	non-coding RNA	RNA, long non-coding			"""TPT1 antisense RNA 1 (non-protein coding)"""				Standard	NR_024458		Approved		uc021rjh.1		OTTHUMG00000016851		13.37:g.45957935C>A		Somatic	0	35	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000517509.1	37	NULL		13																																																																																			-	-		0.522	TPT1-AS1-003	KNOWN	basic	antisense	TPT1-AS1	antisense	OTTHUMT00000374919.1	C	NR_024458	-		45957935	+1	no_errors	ENST00000519454	ensembl	human	known	74_37	rna	SNP	0.052	A
CP	1356	genome.wustl.edu	37	3	148928119	148928119	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:148928119T>A	ENST00000264613.6	-	3	704	c.442A>T	c.(442-444)Aaa>Taa	p.K148*		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	148	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGATATACTTTGTCATCTGCT	0.423																																																	0								ENSG00000047457						161.0	149.0	153.0					3																	148928119		2203	4300	6503	CP	SO:0001587	stop_gained	0			-	HGNC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.442A>T	3.37:g.148928119T>A	ENSP00000264613:p.Lys148*	Somatic	0	87	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	40	33.33	Q14063|Q2PP18|Q9UKS4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.K148*	ENST00000264613.6	37	c.442	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019956	0.75275	.	.	ENSG00000047457	ENST00000264613	.	.	.	5.8	4.57	0.56435	.	0.336726	0.35378	N	0.003258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-24.3738	5.1079	0.14794	0.0:0.148:0.1645:0.6876	.	.	.	.	X	148	.	ENSP00000264613:K148X	K	-	1	0	CP	150410809	1.000000	0.71417	0.987000	0.45799	0.053000	0.15095	0.828000	0.27435	2.207000	0.71202	0.455000	0.32223	AAA	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin		0.423	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	protein_coding	OTTHUMT00000317498.1	T	NM_000096	-		148928119	-1	no_errors	ENST00000264613	ensembl	human	known	74_37	nonsense	SNP	1.000	A
IFT74	80173	genome.wustl.edu	37	9	27062724	27062724	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:27062724G>A	ENST00000443698.1	+	20	1964	c.1793G>A	c.(1792-1794)aGc>aAc	p.S598N	IFT74_ENST00000433700.1_Missense_Mutation_p.S598N|IFT74_ENST00000380062.5_Missense_Mutation_p.S598N	NM_001099222.1	NP_001092692.1	Q96LB3	IFT74_HUMAN	intraflagellar transport 74	598					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|keratinocyte development (GO:0003334)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|nucleus (GO:0005634)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		CATAGCACCAGCGGAAACTGA	0.383																																																	0								ENSG00000096872						94.0	86.0	88.0					9																	27062724		1862	4093	5955	IFT74	SO:0001583	missense	0			-	HGNC	AK023707	CCDS43793.1, CCDS47955.1	9p21.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000096872	ENSG00000096872		"""Intraflagellar transport homologs"""	21424	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 1"""	608040	"""coiled-coil domain containing 2"", ""intraflagellar transport 74 homolog (Chlamydomonas)"""	CCDC2		11683410	Standard	NM_001099223		Approved	CMG1, CMG-1, FLJ22621	uc003zqg.4	Q96LB3	OTTHUMG00000021028	ENST00000443698.1:c.1793G>A	9.37:g.27062724G>A	ENSP00000404122:p.Ser598Asn	Somatic	0	70	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q3B789|Q5VY34|Q6PGQ8|Q9H643|Q9H8G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S598N	ENST00000443698.1	37	c.1793	CCDS43793.1	9	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906544	0.33628	.	.	ENSG00000096872	ENST00000433700;ENST00000443698;ENST00000380062	T;T;T	0.12672	2.66;2.66;2.66	6.05	4.17	0.49024	.	0.496219	0.23041	N	0.052614	T	0.06645	0.0170	N	0.08118	0	0.21445	N	0.999689	B	0.13594	0.008	B	0.12156	0.007	T	0.21177	-1.0253	10	0.52906	T	0.07	-0.4281	5.8692	0.18795	0.1946:0.1524:0.653:0.0	.	598	Q96LB3	IFT74_HUMAN	N	598	ENSP00000389224:S598N;ENSP00000404122:S598N;ENSP00000369402:S598N	ENSP00000369402:S598N	S	+	2	0	IFT74	27052724	0.886000	0.30341	0.955000	0.39395	0.679000	0.39708	0.755000	0.26405	1.580000	0.49851	0.650000	0.86243	AGC	-	NULL		0.383	IFT74-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT74	protein_coding	OTTHUMT00000055476.2	G	NM_025103	-		27062724	+1	no_errors	ENST00000380062	ensembl	human	known	74_37	missense	SNP	0.614	A
WDR5	11091	genome.wustl.edu	37	9	137020864	137020864	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:137020864C>T	ENST00000358625.3	+	12	962	c.791C>T	c.(790-792)gCc>gTc	p.A264V	WDR5_ENST00000425041.1_Missense_Mutation_p.A264V	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	264					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		TGCATATTTGCCAATTTCTCT	0.493																																																	0								ENSG00000196363						190.0	175.0	180.0					9																	137020864		2203	4300	6503	WDR5	SO:0001583	missense	0			-	HGNC	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.791C>T	9.37:g.137020864C>T	ENSP00000351446:p.Ala264Val	Somatic	0	78	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q91VA5|Q9NWX7|Q9UGP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A264V	ENST00000358625.3	37	c.791	CCDS6981.1	9	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748909	0.69533	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	T;T	0.58940	0.3;0.3	4.28	4.28	0.50868	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	N	0.11724	0.165	0.80722	D	1	P	0.52692	0.955	B	0.38327	0.271	T	0.23190	-1.0195	10	0.15499	T	0.54	.	16.0667	0.80887	0.0:1.0:0.0:0.0	.	264	P61964	WDR5_HUMAN	V	264	ENSP00000351446:A264V;ENSP00000401889:A264V	ENSP00000351446:A264V	A	+	2	0	WDR5	136010685	1.000000	0.71417	0.937000	0.37676	0.947000	0.59692	6.950000	0.75977	2.100000	0.63781	0.561000	0.74099	GCC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.493	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5	protein_coding	OTTHUMT00000254621.1	C	NM_052821	-		137020864	+1	no_errors	ENST00000358625	ensembl	human	known	74_37	missense	SNP	0.999	T
SFMBT2	57713	genome.wustl.edu	37	10	7262457	7262457	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:7262457C>A	ENST00000361972.4	-	11	1336	c.1246G>T	c.(1246-1248)Gct>Tct	p.A416S	SFMBT2_ENST00000397167.1_Missense_Mutation_p.A416S	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	416					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GGGTTCACAGCTTCAAGTTTC	0.532																																																	0								ENSG00000198879						210.0	187.0	195.0					10																	7262457		2203	4300	6503	SFMBT2	SO:0001583	missense	0			-	HGNC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1246G>T	10.37:g.7262457C>A	ENSP00000355109:p.Ala416Ser	Somatic	0	94	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	86	13.13	A7MD09|Q9HCF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.A416S	ENST00000361972.4	37	c.1246	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822159	0.90873	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.45276	0.9;0.9	5.4	5.4	0.78164	.	0.047328	0.85682	D	0.000000	T	0.63271	0.2497	M	0.88775	2.98	0.80722	D	1	P	0.45283	0.855	P	0.49502	0.613	T	0.71731	-0.4504	10	0.87932	D	0	.	18.7763	0.91912	0.0:1.0:0.0:0.0	.	416	Q5VUG0	SMBT2_HUMAN	S	416	ENSP00000355109:A416S;ENSP00000380353:A416S	ENSP00000355109:A416S	A	-	1	0	SFMBT2	7302463	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.037000	0.70956	2.530000	0.85305	0.563000	0.77884	GCT	-	pfam_Mbt,smart_Mbt,pfscan_Mbt		0.532	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	protein_coding	OTTHUMT00000046673.1	C	NM_001029880	-		7262457	-1	no_errors	ENST00000361972	ensembl	human	known	74_37	missense	SNP	1.000	A
INPP5B	3633	genome.wustl.edu	37	1	38329987	38329987	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:38329987G>T	ENST00000373026.1	-	22	2863	c.2863C>A	c.(2863-2865)Cta>Ata	p.L955I	INPP5B_ENST00000373027.1_Missense_Mutation_p.L711I|INPP5B_ENST00000373024.3_Missense_Mutation_p.L875I|INPP5B_ENST00000373023.2_Missense_Mutation_p.L955I|RP11-109P14.10_ENST00000419993.1_RNA			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	955	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGCTTACCTAGAATATTCTCA	0.413																																																	0								ENSG00000204084						66.0	57.0	60.0					1																	38329987		1825	4087	5912	INPP5B	SO:0001583	missense	0			-	HGNC	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.2863C>A	1.37:g.38329987G>T	ENSP00000362117:p.Leu955Ile	Somatic	0	36	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L955I	ENST00000373026.1	37	c.2863		1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027567	0.54683	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373026;ENST00000373024	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.49	2.53	0.30540	.	0.233607	0.37437	N	0.002086	T	0.71264	0.3319	M	0.67569	2.06	0.80722	D	1	D	0.58970	0.984	P	0.54140	0.743	T	0.69610	-0.5099	10	0.32370	T	0.25	.	12.0224	0.53350	0.2009:0.0:0.7991:0.0	.	875	P32019-2	.	I	711;955;955;875	ENSP00000362118:L711I;ENSP00000362114:L955I;ENSP00000362117:L955I;ENSP00000362115:L875I	ENSP00000362114:L955I	L	-	1	2	INPP5B	38102574	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.483000	0.45233	0.779000	0.33543	-0.150000	0.13652	CTA	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.413	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	protein_coding	OTTHUMT00000012968.1	G	NM_005540	-		38329987	-1	no_errors	ENST00000373023	ensembl	human	known	74_37	missense	SNP	1.000	T
FOXD3	27022	genome.wustl.edu	37	1	63789443	63789443	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:63789443G>C	ENST00000371116.2	+	1	714	c.714G>C	c.(712-714)aaG>aaC	p.K238N	RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	238					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						AACGCTTCAAGCGCCACCAGC	0.697																																					Pancreas(68;276 1750 11966 31252)												0								ENSG00000187140						30.0	37.0	35.0					1																	63789443		2203	4298	6501	FOXD3	SO:0001583	missense	0			-	HGNC	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.714G>C	1.37:g.63789443G>C	ENSP00000360157:p.Lys238Asn	Somatic	0	66	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	29	44.23	Q9BYM2|Q9UDD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.K238N	ENST00000371116.2	37	c.714	CCDS624.1	1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545991	0.65198	.	.	ENSG00000187140	ENST00000371116	D	0.95656	-3.77	2.39	2.39	0.29439	.	0.065901	0.56097	U	0.000030	D	0.93789	0.8014	L	0.27053	0.805	0.58432	D	0.999992	D	0.71674	0.998	D	0.65684	0.937	D	0.94449	0.7665	10	0.87932	D	0	.	13.457	0.61204	0.0:0.0:1.0:0.0	.	238	Q9UJU5	FOXD3_HUMAN	N	238	ENSP00000360157:K238N	ENSP00000360157:K238N	K	+	3	2	FOXD3	63562031	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.310000	0.65780	1.641000	0.50575	0.460000	0.39030	AAG	-	NULL		0.697	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD3	protein_coding	OTTHUMT00000025331.1	G		-		63789443	+1	no_errors	ENST00000371116	ensembl	human	known	74_37	missense	SNP	1.000	C
NFIX	4784	genome.wustl.edu	37	19	13136278	13136278	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:13136278G>A	ENST00000592199.1	+	2	471	c.471G>A	c.(469-471)tcG>tcA	p.S157S	NFIX_ENST00000360105.4_Silent_p.S160S|NFIX_ENST00000588228.1_Silent_p.S110S|NFIX_ENST00000585575.1_Silent_p.S149S|NFIX_ENST00000358552.3_Silent_p.S156S|NFIX_ENST00000587260.1_Silent_p.S156S|NFIX_ENST00000587760.1_Silent_p.S149S|NFIX_ENST00000397661.2_Silent_p.S157S			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)	157					astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CTCAGTGCTCGAACCCCGGCC	0.537																																																	0								ENSG00000008441						40.0	42.0	41.0					19																	13136278		2137	4263	6400	NFIX	SO:0001819	synonymous_variant	0			-	HGNC	U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.471G>A	19.37:g.13136278G>A		Somatic	0	70	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.S149	ENST00000592199.1	37	c.447		19																																																																																			-	pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom		0.537	NFIX-013	NOVEL	basic	protein_coding	NFIX	protein_coding	OTTHUMT00000452763.1	G	NM_002501	-		13136278	+1	no_errors	ENST00000585575	ensembl	human	known	74_37	silent	SNP	1.000	A
WDR7	23335	genome.wustl.edu	37	18	54687985	54687985	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:54687985G>T	ENST00000254442.3	+	27	4385	c.4174G>T	c.(4174-4176)Gga>Tga	p.G1392*	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Nonsense_Mutation_p.G1359*	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1392					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GACAATCCATGGACACAAGGG	0.388																																																	0								ENSG00000091157						142.0	124.0	130.0					18																	54687985		2203	4300	6503	WDR7	SO:0001587	stop_gained	0			-	HGNC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.4174G>T	18.37:g.54687985G>T	ENSP00000254442:p.Gly1392*	Somatic	0	43	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1392*	ENST00000254442.3	37	c.4174	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	46	12.242592	0.99649	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	.	.	.	X	1392;1359;717;1359	.	ENSP00000254442:G1392X	G	+	1	0	WDR7	52838983	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.693000	0.98684	2.941000	0.99782	0.655000	0.94253	GGA	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.388	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	protein_coding	OTTHUMT00000256062.1	G		-		54687985	+1	no_errors	ENST00000254442	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PPRC1	23082	genome.wustl.edu	37	10	103901296	103901296	+	Missense_Mutation	SNP	G	G	T	rs201069737		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:103901296G>T	ENST00000278070.2	+	5	3070	c.3031G>T	c.(3031-3033)Gtt>Ttt	p.V1011F	PPRC1_ENST00000413464.2_Missense_Mutation_p.V1011F|PPRC1_ENST00000370012.1_5'UTR	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1011	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TGGGAGAGCTGTTCCCCAACC	0.582																																																	0								ENSG00000148840						48.0	50.0	49.0					10																	103901296		2203	4300	6503	PPRC1	SO:0001583	missense	0			-	HGNC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3031G>T	10.37:g.103901296G>T	ENSP00000278070:p.Val1011Phe	Somatic	0	37	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V1011F	ENST00000278070.2	37	c.3031	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603924	0.28534	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.26810	1.74;1.71	5.79	1.62	0.23740	.	0.839629	0.10485	N	0.669114	T	0.20455	0.0492	L	0.29908	0.895	0.09310	N	1	P;P;P	0.42409	0.779;0.773;0.664	B;B;B	0.43155	0.233;0.41;0.233	T	0.14200	-1.0481	10	0.62326	D	0.03	.	6.6553	0.22984	0.0693:0.2326:0.5787:0.1194	.	1011;891;1011	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	F	1011	ENSP00000278070:V1011F;ENSP00000399743:V1011F	ENSP00000278070:V1011F	V	+	1	0	PPRC1	103891286	0.001000	0.12720	0.984000	0.44739	0.335000	0.28730	0.391000	0.20784	0.783000	0.33636	0.462000	0.41574	GTT	-	NULL		0.582	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	protein_coding	OTTHUMT00000050021.1	G	NM_015062	-		103901296	+1	no_errors	ENST00000278070	ensembl	human	known	74_37	missense	SNP	0.000	T
REPS1	85021	genome.wustl.edu	37	6	139308791	139308791	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:139308791T>C	ENST00000450536.2	-	1	603	c.29A>G	c.(28-30)gAg>gGg	p.E10G	REPS1_ENST00000258062.5_Missense_Mutation_p.E10G|REPS1_ENST00000531675.1_5'UTR|REPS1_ENST00000415951.2_Missense_Mutation_p.E10G|REPS1_ENST00000409812.2_Missense_Mutation_p.E10G|REPS1_ENST00000367663.4_Missense_Mutation_p.E10G			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	10	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GTATTTCTGCTCCGCATCGCT	0.647																																																	0								ENSG00000135597						65.0	69.0	67.0					6																	139308791		692	1591	2283	REPS1	SO:0001583	missense	0			-	HGNC		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.29A>G	6.37:g.139308791T>C	ENSP00000392065:p.Glu10Gly	Somatic	0	36	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.E10G	ENST00000450536.2	37	c.29		6	.	.	.	.	.	.	.	.	.	.	t	24.7	4.555605	0.86231	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000409812;ENST00000258062;ENST00000415951	T;T;T;T;T	0.47869	0.85;0.84;0.85;0.83;0.84	3.87	3.87	0.44632	EPS15 homology (EH) (2);EF-hand-like domain (1);	.	.	.	.	T	0.58323	0.2114	M	0.77103	2.36	0.52501	D	0.999958	D;D;D;D	0.76494	0.999;0.999;0.982;0.998	D;D;P;D	0.75484	0.986;0.986;0.624;0.968	T	0.63857	-0.6542	9	0.59425	D	0.04	.	11.0647	0.47968	0.0:0.0:0.0:1.0	.	10;10;10;10	Q96D71-3;Q96D71-2;Q96D71;E9PMG1	.;.;REPS1_HUMAN;.	G	10	ENSP00000392065:E10G;ENSP00000356635:E10G;ENSP00000386699:E10G;ENSP00000258062:E10G;ENSP00000397941:E10G	ENSP00000258062:E10G	E	-	2	0	REPS1	139350484	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.099000	0.71466	1.617000	0.50277	0.338000	0.21704	GAG	-	smart_EPS15_homology,pfscan_EPS15_homology		0.647	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	REPS1	protein_coding	OTTHUMT00000042447.3	T		-		139308791	-1	no_errors	ENST00000450536	ensembl	human	known	74_37	missense	SNP	1.000	C
TSHZ2	128553	genome.wustl.edu	37	20	51872532	51872539	+	Frame_Shift_Del	DEL	GTCCAACT	GTCCAACT	-	rs377415955		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	GTCCAACT	GTCCAACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr20:51872532_51872539delGTCCAACT	ENST00000371497.5	+	2	3422_3429	c.2535_2542delGTCCAACT	c.(2533-2544)cagtccaactggfs	p.SNW846fs	TSHZ2_ENST00000603338.2_Frame_Shift_Del_p.SNW843fs|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Frame_Shift_Del_p.SNW843fs	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	846					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAGGCCGGCAGTCCAACTGGAATCCTCA	0.524																																																	0								ENSG00000182463																																			TSHZ2	SO:0001589	frameshift_variant	0				HGNC	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2535_2542delGTCCAACT	20.37:g.51872532_51872539delGTCCAACT	ENSP00000360552:p.Ser846fs	Somatic	NA	NA	NA		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.S846fs	ENST00000371497.5	37	c.2535_2542	CCDS33490.1	20																																																																																			-	superfamily_Homeodomain-like,smart_Homeobox_dom		0.524	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	protein_coding	OTTHUMT00000080398.6	GTCCAACT	NM_173485			51872539	+1	no_errors	ENST00000371497	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
ZNF521	25925	genome.wustl.edu	37	18	22806657	22806657	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:22806657A>T	ENST00000361524.3	-	4	1373	c.1225T>A	c.(1225-1227)Tac>Aac	p.Y409N	ZNF521_ENST00000538137.2_Missense_Mutation_p.Y409N|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.Y189N	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	409					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTGTTGCAGTAAATACAGCTG	0.443			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0								ENSG00000198795						95.0	92.0	93.0					18																	22806657		2203	4300	6503	ZNF521	SO:0001583	missense	0			-	HGNC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1225T>A	18.37:g.22806657A>T	ENSP00000354794:p.Tyr409Asn	Somatic	0	60	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y409N	ENST00000361524.3	37	c.1225	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	A	10.97	1.501063	0.26861	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.10382	2.88;2.92	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);	0.059313	0.64402	D	0.000001	T	0.22666	0.0547	L	0.29908	0.895	0.47276	D	0.999378	D	0.76494	0.999	D	0.68943	0.961	T	0.00712	-1.1598	10	0.49607	T	0.09	-43.2009	16.8061	0.85666	1.0:0.0:0.0:0.0	.	409	Q96K83	ZN521_HUMAN	N	409;443;409	ENSP00000354794:Y409N;ENSP00000382352:Y409N	ENSP00000354794:Y409N	Y	-	1	0	ZNF521	21060655	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.367000	0.80283	0.528000	0.53228	TAC	-	smart_Znf_C2H2-like		0.443	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	protein_coding	OTTHUMT00000446781.2	A	NM_015461	-		22806657	-1	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	SNP	1.000	T
MGA	23269	genome.wustl.edu	37	15	41989072	41989072	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:41989072C>G	ENST00000570161.1	+	2	1864	c.1864C>G	c.(1864-1866)Ctc>Gtc	p.L622V	MGA_ENST00000545763.1_Missense_Mutation_p.L622V|MGA_ENST00000389936.4_Missense_Mutation_p.L622V|MGA_ENST00000566586.1_Missense_Mutation_p.L622V|MGA_ENST00000219905.7_Missense_Mutation_p.L622V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAAATTGAAACTCTGTAAGGC	0.438																																																	0								ENSG00000174197						24.0	22.0	23.0					15																	41989072		1866	4100	5966	MGA	SO:0001583	missense	0			-	HGNC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1864C>G	15.37:g.41989072C>G	ENSP00000457035:p.Leu622Val	Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	26	33.33	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.L622V	ENST00000570161.1	37	c.1864	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630510	0.28978	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.43294	0.95;0.95;0.95	5.21	2.25	0.28309	.	5.602340	0.00166	N	0.000002	T	0.35219	0.0924	N	0.24115	0.695	0.23238	N	0.998063	P;B	0.44090	0.826;0.062	B;B	0.42522	0.39;0.014	T	0.25572	-1.0128	10	0.66056	D	0.02	.	6.4956	0.22140	0.1343:0.6494:0.0:0.2162	.	622;622	F5H7K2;E7ENI0	.;.	V	622	ENSP00000219905:L622V;ENSP00000374586:L622V;ENSP00000442467:L622V	ENSP00000219905:L622V	L	+	1	0	MGA	39776364	0.893000	0.30496	0.997000	0.53966	0.814000	0.46013	0.199000	0.17237	0.197000	0.20387	0.462000	0.41574	CTC	-	NULL		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	protein_coding	OTTHUMT00000420229.1	C	NM_001164273.1	-		41989072	+1	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	SNP	0.983	G
TACC2	10579	genome.wustl.edu	37	10	123970428	123970428	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:123970428T>A	ENST00000369005.1	+	9	6828	c.6488T>A	c.(6487-6489)gTc>gAc	p.V2163D	TACC2_ENST00000515603.1_Missense_Mutation_p.V2118D|TACC2_ENST00000260733.3_Missense_Mutation_p.V241D|TACC2_ENST00000513429.1_Missense_Mutation_p.V309D|TACC2_ENST00000369004.3_Missense_Mutation_p.V241D|TACC2_ENST00000515273.1_Missense_Mutation_p.V2167D|TACC2_ENST00000334433.3_Missense_Mutation_p.V2163D|TACC2_ENST00000360561.3_Missense_Mutation_p.V241D|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000358010.1_Missense_Mutation_p.V309D|TACC2_ENST00000453444.2_Missense_Mutation_p.V2167D|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000368999.1_Missense_Mutation_p.V241D	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2163					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GAGAGCCTTGTCCCCAGTGGG	0.562																																																	0								ENSG00000138162						97.0	110.0	105.0					10																	123970428		2203	4300	6503	TACC2	SO:0001583	missense	0			-	HGNC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6488T>A	10.37:g.123970428T>A	ENSP00000358001:p.Val2163Asp	Somatic	0	111	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TACC	p.V2163D	ENST00000369005.1	37	c.6488	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	T	2.612	-0.290609	0.05568	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539;ENST00000505639	T;T;T;T;T;T;T;T;T;T;T;T;T	0.22539	4.04;3.62;4.06;4.05;4.04;3.62;4.06;3.52;3.42;3.42;3.5;3.11;1.95	5.54	-3.65	0.04502	.	0.545295	0.13873	N	0.356862	T	0.06962	0.0177	N	0.13043	0.29	0.19775	N	0.999952	B;B;B;B;B;B;B;B;B	0.09022	0.002;0.0;0.0;0.0;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B;B;B;B	0.06405	0.001;0.0;0.001;0.002;0.0;0.001;0.001;0.002;0.002	T	0.35351	-0.9792	10	0.10902	T	0.67	-0.3564	1.1047	0.01691	0.4415:0.1748:0.2252:0.1584	.	258;2167;241;2118;2167;241;241;309;2163	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	D	2163;309;2167;2118;2163;309;2167;2153;241;241;241;241;258;4	ENSP00000358001:V2163D;ENSP00000425062:V309D;ENSP00000424467:V2167D;ENSP00000427618:V2118D;ENSP00000334280:V2163D;ENSP00000350701:V309D;ENSP00000395048:V2167D;ENSP00000353763:V241D;ENSP00000357995:V241D;ENSP00000422815:V241D;ENSP00000260733:V241D;ENSP00000420967:V258D;ENSP00000426303:V4D	ENSP00000260733:V241D	V	+	2	0	TACC2	123960418	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.932000	0.03963	-0.482000	0.06782	0.533000	0.62120	GTC	-	NULL		0.562	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	protein_coding	OTTHUMT00000090004.1	T		-		123970428	+1	no_errors	ENST00000334433	ensembl	human	known	74_37	missense	SNP	0.000	A
SLC2A7	155184	genome.wustl.edu	37	1	9070297	9070297	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:9070297delG	ENST00000400906.1	-	9	1020	c.1021delC	c.(1021-1023)cttfs	p.L341fs		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	341					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CGCTCCACAAGGACAGCCTGG	0.672																																																	0								ENSG00000197241						11.0	10.0	10.0					1																	9070297		2028	3970	5998	SLC2A7	SO:0001589	frameshift_variant	0				HGNC	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1021delC	1.37:g.9070297delG	ENSP00000383698:p.Leu341fs	Somatic	0	76	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	82	20.39	A2A333	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.V342fs	ENST00000400906.1	37	c.1021	CCDS98.2	1																																																																																			-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.672	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	protein_coding	OTTHUMT00000127768.3	G	NM_207420			9070297	-1	no_errors	ENST00000400906	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
NOTCH3	4854	genome.wustl.edu	37	19	15271540	15271540	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:15271540A>T	ENST00000263388.2	-	33	6974	c.6899T>A	c.(6898-6900)cTt>cAt	p.L2300H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2300					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGCCTGAGCAAGGGAGCTGGG	0.642																																																	0								ENSG00000074181						53.0	62.0	59.0					19																	15271540		2203	4300	6503	NOTCH3	SO:0001583	missense	0			-	HGNC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6899T>A	19.37:g.15271540A>T	ENSP00000263388:p.Leu2300His	Somatic	0	76	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.L2300H	ENST00000263388.2	37	c.6899	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	A	13.31	2.197781	0.38806	.	.	ENSG00000074181	ENST00000263388	D	0.82526	-1.62	3.77	2.65	0.31530	.	.	.	.	.	T	0.71298	0.3323	N	0.08118	0	0.09310	N	1	D	0.56746	0.977	P	0.49708	0.62	T	0.61019	-0.7147	9	0.42905	T	0.14	.	7.5307	0.27681	0.8084:0.0:0.0:0.1916	.	2300	Q9UM47	NOTC3_HUMAN	H	2300	ENSP00000263388:L2300H	ENSP00000263388:L2300H	L	-	2	0	NOTCH3	15132540	0.066000	0.20996	0.012000	0.15200	0.935000	0.57460	0.031000	0.13710	1.720000	0.51447	0.482000	0.46254	CTT	-	pirsf_Notch		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	A	NM_000435	-		15271540	-1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	SNP	0.024	T
ATP4B	496	genome.wustl.edu	37	13	114307737	114307737	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:114307737C>A	ENST00000335288.4	-	3	295	c.254G>T	c.(253-255)aGg>aTg	p.R85M		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	85					cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			AACATCCGGCCTTAAGGTTAC	0.512																																																	0								ENSG00000186009						183.0	158.0	166.0					13																	114307737		2203	4300	6503	ATP4B	SO:0001583	missense	0			-	HGNC		CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.254G>T	13.37:g.114307737C>A	ENSP00000334216:p.Arg85Met	Somatic	0	51	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B1B0N8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta	p.R85M	ENST00000335288.4	37	c.254	CCDS9539.1	13	.	.	.	.	.	.	.	.	.	.	C	16.89	3.247791	0.59103	.	.	ENSG00000186009	ENST00000335288	T	0.33216	1.42	5.02	5.02	0.67125	.	0.061993	0.64402	D	0.000006	T	0.62539	0.2436	M	0.89715	3.055	0.53688	D	0.99997	D	0.89917	1.0	D	0.79108	0.992	T	0.70506	-0.4853	10	0.59425	D	0.04	-6.4734	15.2657	0.73660	0.0:1.0:0.0:0.0	.	85	P51164	ATP4B_HUMAN	M	85	ENSP00000334216:R85M	ENSP00000334216:R85M	R	-	2	0	ATP4B	113355738	1.000000	0.71417	0.999000	0.59377	0.339000	0.28857	5.686000	0.68211	2.327000	0.79052	0.491000	0.48974	AGG	-	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta		0.512	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	protein_coding	OTTHUMT00000276703.2	C	NM_000705	-		114307737	-1	no_errors	ENST00000335288	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNA6	3742	genome.wustl.edu	37	12	4919850	4919850	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:4919850T>A	ENST00000280684.3	+	1	1509	c.643T>A	c.(643-645)Tcc>Acc	p.S215T	KCNA6_ENST00000433855.1_Missense_Mutation_p.S215T|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	215					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GAGTCGAGTCTCCCCAGTTTC	0.537										HNSCC(72;0.22)																																							0								ENSG00000151079						75.0	71.0	72.0					12																	4919850		2203	4300	6503	KCNA6	SO:0001583	missense	0			-	HGNC	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.643T>A	12.37:g.4919850T>A	ENSP00000280684:p.Ser215Thr	Somatic	0	39	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S215T	ENST00000280684.3	37	c.643	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.840936	0.00573	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97161	-4.27;-4.27	5.43	3.09	0.35607	.	.	.	.	.	D	0.92463	0.7607	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.81300	-0.0995	9	0.10377	T	0.69	.	7.0734	0.25191	0.0:0.0861:0.3444:0.5695	.	215	P17658	KCNA6_HUMAN	T	215	ENSP00000408321:S215T;ENSP00000280684:S215T	ENSP00000280684:S215T	S	+	1	0	KCNA6	4790111	0.067000	0.21026	0.022000	0.16811	0.051000	0.14879	1.567000	0.36407	0.869000	0.35703	0.533000	0.62120	TCC	-	NULL		0.537	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	protein_coding	OTTHUMT00000398909.1	T	NM_002235	-		4919850	+1	no_errors	ENST00000280684	ensembl	human	known	74_37	missense	SNP	0.000	A
PPIL2	23759	genome.wustl.edu	37	22	22035663	22035663	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:22035663A>T	ENST00000335025.8	+	7	462	c.371A>T	c.(370-372)aAc>aTc	p.N124I	PPIL2_ENST00000406385.1_Missense_Mutation_p.N124I|PPIL2_ENST00000492445.2_Missense_Mutation_p.N124I|PPIL2_ENST00000456792.2_Missense_Mutation_p.N103I|PPIL2_ENST00000398831.3_Missense_Mutation_p.N124I|PPIL2_ENST00000412327.1_Missense_Mutation_p.N124I					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					ACGACCGGCAACGTCTACGCC	0.587																																																	0								ENSG00000100023						143.0	103.0	116.0					22																	22035663		2203	4300	6503	PPIL2	SO:0001583	missense	0			-	HGNC		CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.371A>T	22.37:g.22035663A>T	ENSP00000334553:p.Asn124Ile	Somatic	0	23	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,pfam_Rtf2_RING-finger,superfamily_Cyclophilin-like_PPIase_dom,smart_Ubox_domain,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.N124I	ENST00000335025.8	37	c.371	CCDS13793.1	22	.	.	.	.	.	.	.	.	.	.	A	32	5.125276	0.94429	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000458567;ENST00000406385;ENST00000456792	T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	M	0.91612	3.225	0.80722	D	1	D;D;D	0.89917	0.997;0.982;1.0	D;D;D	0.91635	0.967;0.933;0.999	T	0.73062	-0.4101	10	0.66056	D	0.02	.	15.0889	0.72177	1.0:0.0:0.0:0.0	.	103;124;124	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	I	124;124;124;124;155;124;103	ENSP00000390427:N124I;ENSP00000334553:N124I;ENSP00000381812:N124I;ENSP00000445312:N124I;ENSP00000384299:N124I;ENSP00000396228:N103I	ENSP00000334553:N124I	N	+	2	0	PPIL2	20365663	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	8.809000	0.91944	2.116000	0.64780	0.459000	0.35465	AAC	-	pfam_Rtf2_RING-finger		0.587	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	protein_coding	OTTHUMT00000075028.4	A		-		22035663	+1	no_errors	ENST00000412327	ensembl	human	known	74_37	missense	SNP	1.000	T
UTP14A	10813	genome.wustl.edu	37	X	129060008	129060008	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:129060008delA	ENST00000394422.3	+	13	1891	c.1863delA	c.(1861-1863)ccafs	p.P621fs	UTP14A_ENST00000425117.2_Frame_Shift_Del_p.P569fs|UTP14A_ENST00000371051.5_Frame_Shift_Del_p.P567fs|UTP14A_ENST00000371042.3_Frame_Shift_Del_p.P453fs|RP4-537K23.4_ENST00000432062.1_RNA	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	621					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						CGAGTAAGCCAAAGGACGTGG	0.517											OREG0019920	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000156697						56.0	56.0	56.0					X																	129060008		2202	4280	6482	UTP14A	SO:0001589	frameshift_variant	0				HGNC	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1863delA	X.37:g.129060008delA	ENSP00000377944:p.Pro621fs	Somatic	0	62	0.00	1569	0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SSU_processome_Utp14	p.K622fs	ENST00000394422.3	37	c.1863	CCDS14615.1	X																																																																																			-	pfam_SSU_processome_Utp14		0.517	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	protein_coding	OTTHUMT00000058221.1	A	NM_006649			129060008	+1	no_errors	ENST00000394422	ensembl	human	known	74_37	frame_shift_del	DEL	0.105	-
IGFN1	91156	genome.wustl.edu	37	1	201190739	201190739	+	Missense_Mutation	SNP	G	G	A	rs375687736		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:201190739G>A	ENST00000335211.4	+	19	10196	c.10066G>A	c.(10066-10068)Gtg>Atg	p.V3356M	IGFN1_ENST00000295591.8_Missense_Mutation_p.V516M|RP11-567E21.3_ENST00000453155.1_RNA	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	899						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGTGGGCACCGTGCCAGTCAC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		18431	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000163395	G	MET/VAL	0,4406		0,0,2203	53.0	45.0	48.0		10066	2.7	0.1	1		48	1,8599	1.2+/-3.3	0,1,4299	no	missense	IGFN1	NM_001164586.1	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	3356/3709	201190739	1,13005	2203	4300	6503	IGFN1	SO:0001583	missense	0			-	HGNC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10066G>A	1.37:g.201190739G>A	ENSP00000334714:p.Val3356Met	Somatic	0	52	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	8	76.92	F8WAI1|Q9NT72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V3356M	ENST00000335211.4	37	c.10066	CCDS53455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.44|11.44	1.639433|1.639433	0.29157|0.29157	0.0|0.0	1.16E-4|1.16E-4	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000335211;ENST00000295591	.|T;T	.|0.61392	.|0.11;0.11	4.64|4.64	2.71|2.71	0.32032|0.32032	.|.	.|0.645104	.|0.13642	.|N	.|0.372870	T|T	0.68366|0.68366	0.2993|0.2993	M|M	0.87456|0.87456	2.885|2.885	0.09310|0.09310	N|N	1|1	.|D	.|0.54964	.|0.969	.|P	.|0.54060	.|0.741	T|T	0.58070|0.58070	-0.7701|-0.7701	5|10	.|0.45353	.|T	.|0.12	.|.	5.2243|5.2243	0.15385|0.15385	0.1763:0.0:0.66:0.1637|0.1763:0.0:0.66:0.1637	.|.	.|3356	.|F8WAI1	.|.	H|M	773|3356;516	.|ENSP00000334714:V3356M;ENSP00000295591:V516M	.|ENSP00000295591:V516M	R|V	+|+	2|1	0|0	IGFN1|IGFN1	199457362|199457362	0.000000|0.000000	0.05858|0.05858	0.105000|0.105000	0.21289|0.21289	0.074000|0.074000	0.17049|0.17049	-0.069000|-0.069000	0.11542|0.11542	0.367000|0.367000	0.24454|0.24454	-0.704000|-0.704000	0.03662|0.03662	CGT|GTG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	protein_coding		G	NM_178275	-		201190739	+1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	SNP	0.000	A
INSIG2	51141	genome.wustl.edu	37	2	118864318	118864318	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:118864318delG	ENST00000245787.4	+	4	581	c.375delG	c.(373-375)gtgfs	p.V125fs	INSIG2_ENST00000485520.1_3'UTR	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2	125					cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						CTCAGAAAGTGGATTTCGATA	0.383																																																	0								ENSG00000125629						158.0	145.0	149.0					2																	118864318		2203	4300	6503	INSIG2	SO:0001589	frameshift_variant	0				HGNC	AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.375delG	2.37:g.118864318delG	ENSP00000245787:p.Val125fs	Somatic	0	57	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A8K5W8|Q8TBI8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_INSIG_fam	p.D126fs	ENST00000245787.4	37	c.375	CCDS2122.1	2																																																																																			-	pfam_INSIG_fam		0.383	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSIG2	protein_coding	OTTHUMT00000129624.1	G	NM_016133			118864318	+1	no_errors	ENST00000245787	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PKNOX2	63876	genome.wustl.edu	37	11	125280690	125280690	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:125280690delA	ENST00000298282.9	+	9	1005	c.734delA	c.(733-735)caafs	p.Q245fs	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Frame_Shift_Del_p.Q181fs	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	245					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		GCCTTATACCAACCGGTTACC	0.572																																																	0								ENSG00000165495						93.0	90.0	91.0					11																	125280690		1946	4141	6087	PKNOX2	SO:0001589	frameshift_variant	0				HGNC	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.734delA	11.37:g.125280690delA	ENSP00000298282:p.Gln245fs	Somatic	0	57	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Q245fs	ENST00000298282.9	37	c.734	CCDS41730.1	11																																																																																			-	NULL		0.572	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	protein_coding	OTTHUMT00000386866.3	A				125280690	+1	no_errors	ENST00000298282	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
C21orf58	54058	genome.wustl.edu	37	21	47734706	47734706	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr21:47734706A>G	ENST00000291691.7	-	5	1669	c.533T>C	c.(532-534)cTg>cCg	p.L178P	C21orf58_ENST00000397680.1_Missense_Mutation_p.L72P|C21orf58_ENST00000397679.1_Missense_Mutation_p.L72P|C21orf58_ENST00000397682.3_Missense_Mutation_p.L72P|C21orf58_ENST00000397683.1_Missense_Mutation_p.L72P	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	178										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		CGTGGGGGGCAGCTCTGGGGG	0.687																																																	0								ENSG00000160298						11.0	12.0	11.0					21																	47734706		2059	4074	6133	C21orf58	SO:0001583	missense	0			-	HGNC		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.533T>C	21.37:g.47734706A>G	ENSP00000291691:p.Leu178Pro	Somatic	0	60	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B3KPI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L178P	ENST00000291691.7	37	c.533	CCDS13735.1	21	.	.	.	.	.	.	.	.	.	.	A	15.38	2.816328	0.50527	.	.	ENSG00000160298	ENST00000397683;ENST00000417060;ENST00000397682;ENST00000291691;ENST00000397679;ENST00000397680	T;T;T;T;T;T	0.48836	0.8;2.0;0.8;2.0;0.8;0.8	4.89	1.17	0.20885	.	0.925683	0.08839	N	0.886189	T	0.47284	0.1437	L	0.40543	1.245	0.09310	N	1	D;D;P	0.60160	0.972;0.987;0.799	P;P;B	0.52217	0.6;0.693;0.366	T	0.35301	-0.9794	10	0.72032	D	0.01	-6.8364	6.7925	0.23707	0.7125:0.0:0.2875:0.0	.	178;72;178	P58505;Q8N7N9;P58505-2	CU058_HUMAN;.;.	P	72;140;72;178;72;72	ENSP00000380799:L72P;ENSP00000402356:L140P;ENSP00000380798:L72P;ENSP00000291691:L178P;ENSP00000380796:L72P;ENSP00000380797:L72P	ENSP00000291691:L178P	L	-	2	0	C21orf58	46559134	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.155000	0.10115	0.023000	0.15187	0.460000	0.39030	CTG	-	NULL		0.687	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf58	protein_coding	OTTHUMT00000207283.1	A	NM_058180	-		47734706	-1	no_errors	ENST00000291691	ensembl	human	known	74_37	missense	SNP	0.000	G
AGFG1	3267	genome.wustl.edu	37	2	228418418	228418418	+	Splice_Site	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:228418418A>T	ENST00000310078.8	+	12	1797		c.e12-1		AGFG1_ENST00000409979.2_Intron|AGFG1_ENST00000373671.3_Splice_Site|AGFG1_ENST00000409171.1_Intron|AGFG1_ENST00000409315.1_Splice_Site	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1						cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						TATTTTAACAAGGTGCAGGTT	0.398																																																	0								ENSG00000173744						92.0	97.0	95.0					2																	228418418		2203	4300	6503	AGFG1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1538-1A>T	2.37:g.228418418A>T		Somatic	0	109	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	10.81	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e12-2	ENST00000310078.8	37	c.1538-2	CCDS2467.1	2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408677	0.83340	.	.	ENSG00000173744	ENST00000310078;ENST00000409315;ENST00000373671;ENST00000458212	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0564	0.80809	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGFG1	228126662	1.000000	0.71417	0.983000	0.44433	0.978000	0.69477	7.849000	0.86908	2.197000	0.70478	0.482000	0.46254	.	-	-		0.398	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGFG1	protein_coding	OTTHUMT00000256895.2	A	NM_004504	-	Intron	228418418	+1	no_errors	ENST00000310078	ensembl	human	known	74_37	splice_site	SNP	1.000	T
PCSK5	5125	genome.wustl.edu	37	9	78710840	78710840	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:78710840C>T	ENST00000545128.1	+	8	1467	c.929C>T	c.(928-930)gCa>gTa	p.A310V	PCSK5_ENST00000376767.3_Missense_Mutation_p.A310V|PCSK5_ENST00000376752.4_Missense_Mutation_p.A310V	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	310	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TTTGTTTGGGCATCTGGAAAT	0.493																																																	0								ENSG00000099139						166.0	148.0	154.0					9																	78710840		2203	4300	6503	PCSK5	SO:0001583	missense	0			-	HGNC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.929C>T	9.37:g.78710840C>T	ENSP00000446280:p.Ala310Val	Somatic	0	48	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.00	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.A310V	ENST00000545128.1	37	c.929	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.360161	0.95877	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752	D;D;D	0.90620	-2.7;-2.7;-2.7	5.69	5.69	0.88448	.	0.050288	0.85682	D	0.000000	D	0.97854	0.9295	H	0.99415	4.555	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.926	D	0.98953	1.0795	10	0.66056	D	0.02	-17.6705	19.8169	0.96573	0.0:1.0:0.0:0.0	.	310;310	Q92824-2;B1AMG5	.;.	V	310;13;310;310;310	ENSP00000446280:A310V;ENSP00000365958:A310V;ENSP00000365943:A310V	ENSP00000365943:A310V	A	+	2	0	PCSK5	77900660	1.000000	0.71417	0.968000	0.41197	0.990000	0.78478	7.487000	0.81328	2.689000	0.91719	0.460000	0.39030	GCA	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom		0.493	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	protein_coding		C		-		78710840	+1	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	SNP	1.000	T
NUF2	83540	genome.wustl.edu	37	1	163313586	163313586	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:163313586G>A	ENST00000271452.3	+	10	1012	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	NUF2_ENST00000524800.1_Missense_Mutation_p.V245M|NUF2_ENST00000367900.3_Missense_Mutation_p.V245M	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	245	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AACAAAAATTGTGGATTCTCC	0.269																																																	0								ENSG00000143228						24.0	28.0	27.0					1																	163313586		2147	4252	6399	NUF2	SO:0001583	missense	0			-	HGNC	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.733G>A	1.37:g.163313586G>A	ENSP00000271452:p.Val245Met	Somatic	0	279	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	125	11.35	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinetochore_Nuf2	p.V245M	ENST00000271452.3	37	c.733	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076618	0.76415	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.60171	0.7;0.21;0.21	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.66607	0.2806	M	0.61703	1.905	0.43430	D	0.995591	D;D	0.89917	1.0;1.0	D;D	0.73380	0.972;0.98	T	0.67397	-0.5681	9	0.49607	T	0.09	-19.7177	15.3094	0.74019	0.0:0.0:1.0:0.0	.	245;245	E9PQC4;Q9BZD4	.;NUF2_HUMAN	M	245	ENSP00000436888:V245M;ENSP00000356875:V245M;ENSP00000271452:V245M	ENSP00000271452:V245M	V	+	1	0	NUF2	161580210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.171000	0.64996	2.680000	0.91292	0.585000	0.79938	GTG	-	NULL		0.269	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	protein_coding	OTTHUMT00000082812.1	G	NM_145697	-		163313586	+1	no_errors	ENST00000271452	ensembl	human	known	74_37	missense	SNP	1.000	A
OR6V1	346517	genome.wustl.edu	37	7	142749718	142749718	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:142749718G>A	ENST00000418316.1	+	1	302	c.281G>A	c.(280-282)gGc>gAc	p.G94D		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					ACCTTCACTGGCTGCATGGTC	0.542																																																	0								ENSG00000225781						184.0	187.0	186.0					7																	142749718		2122	4251	6373	OR6V1	SO:0001583	missense	0			-	HGNC		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.281G>A	7.37:g.142749718G>A	ENSP00000396085:p.Gly94Asp	Somatic	0	78	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G94D	ENST00000418316.1	37	c.281	CCDS47728.1	7	.	.	.	.	.	.	.	.	.	.	G	11.23	1.576708	0.28092	.	.	ENSG00000225781	ENST00000418316	T	0.09723	2.95	4.53	0.154	0.14901	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.11495	0.0280	M	0.74389	2.26	0.09310	N	1	B	0.31054	0.306	B	0.30646	0.118	T	0.30149	-0.9988	9	0.44086	T	0.13	.	2.1068	0.03693	0.1955:0.15:0.5007:0.1538	.	94	Q8N148	OR6V1_HUMAN	D	94	ENSP00000396085:G94D	ENSP00000396085:G94D	G	+	2	0	OR6V1	142459840	0.321000	0.24625	0.055000	0.19348	0.994000	0.84299	1.629000	0.37071	0.115000	0.18071	0.655000	0.94253	GGC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.542	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6V1	protein_coding	OTTHUMT00000350860.1	G		-		142749718	+1	no_errors	ENST00000418316	ensembl	human	known	74_37	missense	SNP	0.071	A
ITFG2	55846	genome.wustl.edu	37	12	2927497	2927497	+	Intron	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:2927497A>G	ENST00000228799.2	+	4	545				ITFG2_ENST00000419778.2_Intron|ITFG2_ENST00000542548.1_Silent_p.L16L	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2						germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			AGTGGATACTAGAGCATATCC	0.527																																																	0								ENSG00000111203																																			ITFG2	SO:0001627	intron_variant	0			-	HGNC	AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.406+54A>G	12.37:g.2927497A>G		Somatic	0	27	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L16	ENST00000228799.2	37	c.48	CCDS8513.1	12																																																																																			-	NULL		0.527	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG2	protein_coding	OTTHUMT00000253091.1	A	NM_018463	-		2927497	+1	no_errors	ENST00000542548	ensembl	human	known	74_37	silent	SNP	0.000	G
SCML2	10389	genome.wustl.edu	37	X	18259309	18259309	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:18259309T>C	ENST00000251900.4	-	0	2324				SCML2_ENST00000491988.1_5'UTR|SCML2_ENST00000398048.3_3'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					GAGAAATACTTTTAAATTAAA	0.269																																					Esophageal Squamous(100;1252 1965 19021 35517)												0								ENSG00000102098																																			SCML2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*62A>G	X.37:g.18259309T>C		Somatic	0	49	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	28	37.78	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	-		0.269	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	protein_coding	OTTHUMT00000055941.1	T	NM_006089	-		18259309	-1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	SNP	0.043	C
TMPRSS5	80975	genome.wustl.edu	37	11	113565336	113565336	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:113565336delG	ENST00000299882.5	-	8	797	c.649delC	c.(649-651)cggfs	p.R217fs	TMPRSS5_ENST00000540540.1_5'UTR|TMPRSS5_ENST00000536856.1_5'UTR|TMPRSS5_ENST00000545265.1_5'Flank|TMPRSS5_ENST00000538955.1_Frame_Shift_Del_p.R173fs|TMPRSS5_ENST00000544476.1_Intron|TMPRSS5_ENST00000545579.1_Frame_Shift_Del_p.R208fs|TMPRSS5_ENST00000544634.1_Intron	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	217		Cleavage. {ECO:0000255}.			proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		CCAACTATCCGGGAAGCCAGG	0.637																																																	0								ENSG00000166682						11.0	16.0	14.0					11																	113565336		1933	4037	5970	TMPRSS5	SO:0001589	frameshift_variant	0				HGNC	AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.649delC	11.37:g.113565336delG	ENSP00000299882:p.Arg217fs	Somatic	0	60	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R217fs	ENST00000299882.5	37	c.649	CCDS44735.1	11																																																																																			-	superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1		0.637	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	protein_coding	OTTHUMT00000398652.1	G	NM_030770			113565336	-1	no_errors	ENST00000299882	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
CDCA2	157313	genome.wustl.edu	37	8	25337454	25337454	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:25337454G>A	ENST00000330560.3	+	8	1323	c.846G>A	c.(844-846)gtG>gtA	p.V282V	CDCA2_ENST00000380665.3_Silent_p.V267V|CDCA2_ENST00000521098.2_3'UTR	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	282					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ACTGTGTAGTGGGCAAAGGAT	0.453																																																	0								ENSG00000184661						127.0	106.0	113.0					8																	25337454		2203	4300	6503	CDCA2	SO:0001819	synonymous_variant	0			-	HGNC	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.846G>A	8.37:g.25337454G>A		Somatic	0	57	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V282	ENST00000330560.3	37	c.846	CCDS6049.1	8																																																																																			-	NULL		0.453	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	protein_coding	OTTHUMT00000216891.3	G	NM_152562	-		25337454	+1	no_errors	ENST00000330560	ensembl	human	known	74_37	silent	SNP	0.002	A
UNKL	64718	genome.wustl.edu	37	16	1464016	1464016	+	Missense_Mutation	SNP	A	A	G	rs202202852		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:1464016A>G	ENST00000389221.4	-	2	117	c.118T>C	c.(118-120)Tca>Cca	p.S40P	UNKL_ENST00000508903.2_Missense_Mutation_p.S40P|UNKL_ENST00000301712.5_Missense_Mutation_p.S40P|LA16c-312E8.2_ENST00000568554.1_RNA|UNKL_ENST00000503648.1_5'UTR|UNKL_ENST00000397462.1_Missense_Mutation_p.S40P	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	40					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TTGTGCTGTGAAAACAGGGGG	0.662											OREG0023546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	1	0.000199681	0.0	0.0014	5008	,	,		13997	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000059145						23.0	20.0	21.0					16																	1464016		2072	4062	6134	UNKL	SO:0001583	missense	0			GMAF=0.0005	HGNC	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.118T>C	16.37:g.1464016A>G	ENSP00000373873:p.Ser40Pro	Somatic	0	61	0.00	596	0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	14	50.00	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.S40P	ENST00000389221.4	37	c.118	CCDS53981.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	14.71	2.616339	0.46736	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462;ENST00000301712	T	0.64438	-0.1	3.98	-6.64	0.01801	.	0.449133	0.19472	N	0.113432	T	0.24736	0.0600	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.01961	-1.1239	10	0.30078	T	0.28	.	7.3858	0.26882	0.502:0.2035:0.2945:0.0	.	40	Q9H9P5-5	.	P	40	ENSP00000373873:S40P	ENSP00000301712:S40P	S	-	1	0	UNKL	1404017	0.019000	0.18553	0.817000	0.32601	0.969000	0.65631	-0.721000	0.04963	-0.901000	0.03891	0.460000	0.39030	TCA	-	NULL		0.662	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	protein_coding		A	NM_001037125	rs202202852		1464016	-1	no_errors	ENST00000397462	ensembl	human	known	74_37	missense	SNP	0.942	G
SLURP1	57152	genome.wustl.edu	37	8	143823300	143823300	+	Silent	SNP	G	G	T	rs187775640		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:143823300G>T	ENST00000246515.1	-	2	124	c.99C>A	c.(97-99)acC>acA	p.T33T		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	33	UPAR/Ly6.				cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AGGAAGCACTGGTCATGGGCT	0.637																																																	0								ENSG00000126233						102.0	95.0	97.0					8																	143823300		2202	4299	6501	SLURP1	SO:0001819	synonymous_variant	0			-	HGNC	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.99C>A	8.37:g.143823300G>T		Somatic	0	62	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	Q53YJ6|Q6PUA6|Q92483	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LY6_UPAR	p.T33	ENST00000246515.1	37	c.99	CCDS6387.1	8																																																																																			-	pfam_LY6_UPAR		0.637	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLURP1	protein_coding	OTTHUMT00000379741.1	G	NM_020427	-		143823300	-1	no_errors	ENST00000246515	ensembl	human	known	74_37	silent	SNP	0.000	T
TCOF1	6949	genome.wustl.edu	37	5	149771625	149771625	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:149771625C>T	ENST00000504761.2	+	21	3403	c.3403C>T	c.(3403-3405)Cag>Tag	p.Q1135*	TCOF1_ENST00000323668.7_Nonsense_Mutation_p.Q1058*|TCOF1_ENST00000513346.1_Nonsense_Mutation_p.Q1134*|TCOF1_ENST00000451292.1_Nonsense_Mutation_p.Q1172*|TCOF1_ENST00000377797.3_Nonsense_Mutation_p.Q1135*|TCOF1_ENST00000439160.2_Nonsense_Mutation_p.Q1097*|TCOF1_ENST00000445265.2_Nonsense_Mutation_p.Q1058*			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1135					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGGTCCAGCAGGCCACCAA	0.587																																																	0								ENSG00000070814						74.0	72.0	73.0					5																	149771625		2203	4300	6503	TCOF1	SO:0001587	stop_gained	0			-	HGNC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3403C>T	5.37:g.149771625C>T	ENSP00000421655:p.Gln1135*	Somatic	0	50	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.Q1172*	ENST00000504761.2	37	c.3514	CCDS54936.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.092547	0.97276	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	.	.	.	5.18	4.31	0.51392	.	0.454593	0.16575	N	0.208440	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-1.3333	11.4908	0.50379	0.1793:0.8207:0.0:0.0	.	.	.	.	X	1172;1135;1058;1058;1097;1097;1135;1134	.	ENSP00000325223:Q1058X	Q	+	1	0	TCOF1	149751818	0.096000	0.21769	0.156000	0.22583	0.276000	0.26787	1.944000	0.40263	1.304000	0.44892	0.655000	0.94253	CAG	-	NULL		0.587	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	protein_coding	OTTHUMT00000380552.1	C	NM_001008656	-		149771625	+1	no_errors	ENST00000451292	ensembl	human	known	74_37	nonsense	SNP	0.072	T
CSMD2	114784	genome.wustl.edu	37	1	34209082	34209082	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:34209082G>T	ENST00000373381.4	-	14	2148	c.1972C>A	c.(1972-1974)Ctg>Atg	p.L658M		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	618	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTGAAGGCCAGGTGGATGCGG	0.607																																																	0								ENSG00000121904						83.0	84.0	83.0					1																	34209082		2203	4300	6503	CSMD2	SO:0001583	missense	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1972C>A	1.37:g.34209082G>T	ENSP00000362479:p.Leu658Met	Somatic	0	90	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.L658M	ENST00000373381.4	37	c.1972		1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937139	0.73557	.	.	ENSG00000121904	ENST00000373381	T	0.34072	1.38	5.58	3.69	0.42338	CUB (5);	0.000000	0.64402	D	0.000004	T	0.65933	0.2739	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73122	-0.4082	10	0.54805	T	0.06	.	11.7503	0.51845	0.203:0.0:0.797:0.0	.	618;658	Q7Z408;E7EUA6	CSMD2_HUMAN;.	M	658	ENSP00000362479:L658M	ENSP00000241312:L618M	L	-	1	2	CSMD2	33981669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.644000	0.46613	1.494000	0.48533	0.655000	0.94253	CTG	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		G	NM_052896	-		34209082	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	SNP	1.000	T
HRNR	388697	genome.wustl.edu	37	1	152188769	152188769	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:152188769C>T	ENST00000368801.2	-	3	5411	c.5336G>A	c.(5335-5337)aGc>aAc	p.S1779N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1779					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCCTTGGCTACAGAAGTG	0.537																																																	0								ENSG00000197915						1.0	2.0	2.0					1																	152188769		537	1680	2217	HRNR	SO:0001583	missense	0			-	HGNC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5336G>A	1.37:g.152188769C>T	ENSP00000357791:p.Ser1779Asn	Somatic	0	41	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	Q5DT20|Q5U1F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S1779N	ENST00000368801.2	37	c.5336	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	0.726	-0.781889	0.02929	.	.	ENSG00000197915	ENST00000368801	T	0.02763	4.17	1.88	-1.56	0.08532	.	.	.	.	.	T	0.00637	0.0021	L	0.29908	0.895	0.09310	N	1	B	0.28026	0.198	B	0.20955	0.032	T	0.44050	-0.9353	9	0.20519	T	0.43	.	7.033	0.24977	0.1817:0.2799:0.5384:0.0	.	1779	Q86YZ3	HORN_HUMAN	N	1779	ENSP00000357791:S1779N	ENSP00000357791:S1779N	S	-	2	0	HRNR	150455393	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.492000	0.06467	-0.388000	0.07797	-2.357000	0.00240	AGC	-	NULL		0.537	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	C	XM_373868	-		152188769	-1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	SNP	0.000	T
CFAP54	144535	genome.wustl.edu	37	12	96883406	96883406	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:96883406C>A	ENST00000524981.4	+	1	42	c.19C>A	c.(19-21)Ccc>Acc	p.P7T	C12orf55_ENST00000298953.3_Missense_Mutation_p.P7T			Q96N23	CL055_HUMAN		7																	GCAGGGCTCCCCCTCGAGCTC	0.697											OREG0022044	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000188596																																			C12orf55	SO:0001583	missense	0			-	HGNC																												ENST00000524981.4:c.19C>A	12.37:g.96883406C>A	ENSP00000431759:p.Pro7Thr	Somatic	0	82	0.00	1324	0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	23.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3	p.P7T	ENST00000524981.4	37	c.19		12	.	.	.	.	.	.	.	.	.	.	C	9.159	1.018240	0.19355	.	.	ENSG00000188596	ENST00000553778;ENST00000524981;ENST00000298953	T;T	0.20332	2.09;2.08	4.03	-8.07	0.01098	.	3.477460	0.00832	N	0.001661	T	0.08133	0.0203	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.20405	-1.0276	10	0.25751	T	0.34	16.2101	1.8571	0.03181	0.4388:0.2956:0.1038:0.1619	.	7	G3V4Y4	.	T	7	ENSP00000452066:P7T;ENSP00000298953:P7T	ENSP00000298953:P7T	P	+	1	0	C12orf63	95407537	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-2.247000	0.01190	-2.807000	0.00349	-0.397000	0.06425	CCC	-	NULL		0.697	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	protein_coding	OTTHUMT00000395046.4	C		-		96883406	+1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	SNP	0.000	A
MYBPC2	4606	genome.wustl.edu	37	19	50949209	50949209	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:50949209G>A	ENST00000357701.5	+	12	1257	c.1206G>A	c.(1204-1206)aaG>aaA	p.K402K		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	402	Ig-like C2-type 3.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGGACGGGAAGCGCCACATCC	0.567																																																	0								ENSG00000086967						67.0	71.0	70.0					19																	50949209		2066	4200	6266	MYBPC2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1206G>A	19.37:g.50949209G>A		Somatic	0	63	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67	A1L4G9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K402	ENST00000357701.5	37	c.1206	CCDS46152.1	19																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.567	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	protein_coding	OTTHUMT00000464751.1	G	NM_004533	-		50949209	+1	no_errors	ENST00000357701	ensembl	human	known	74_37	silent	SNP	1.000	A
PARP10	84875	genome.wustl.edu	37	8	145059071	145059071	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:145059071G>T	ENST00000313028.7	-	5	1193	c.1099C>A	c.(1099-1101)Cct>Act	p.P367T	PARP10_ENST00000524918.1_Missense_Mutation_p.P367T|PARP10_ENST00000533665.1_5'Flank|PARP10_ENST00000525773.1_Missense_Mutation_p.P379T	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	367					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AACCCCACAGGCCTCAGGCTT	0.647																																																	0								ENSG00000178685						75.0	82.0	79.0					8																	145059071		2203	4300	6503	PARP10	SO:0001583	missense	0			-	HGNC	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1099C>A	8.37:g.145059071G>T	ENSP00000325618:p.Pro367Thr	Somatic	0	71	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.P367T	ENST00000313028.7	37	c.1099	CCDS34960.1	8	.	.	.	.	.	.	.	.	.	.	G	3.149	-0.174578	0.06421	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.32272	2.9;2.94;2.93;1.46	3.72	-7.44	0.01379	.	1.372090	0.05428	N	0.545359	T	0.13243	0.0321	N	0.19112	0.55	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.08055	0.001;0.003;0.001	T	0.25047	-1.0143	10	0.10111	T	0.7	.	4.392	0.11344	0.267:0.0:0.2631:0.4698	.	379;367;367	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	T	367;73;367;379;282	ENSP00000431620:P367T;ENSP00000325618:P367T;ENSP00000434776:P379T;ENSP00000314320:P282T	ENSP00000325618:P367T	P	-	1	0	PARP10	145131059	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-4.769000	0.00188	-1.293000	0.02362	-0.327000	0.08410	CCT	-	NULL		0.647	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP10	protein_coding	OTTHUMT00000383866.1	G	NM_032789	-		145059071	-1	no_errors	ENST00000313028	ensembl	human	known	74_37	missense	SNP	0.000	T
GPR83	10888	genome.wustl.edu	37	11	94134288	94134288	+	Missense_Mutation	SNP	G	G	T	rs374506287		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:94134288G>T	ENST00000243673.2	-	1	297	c.126C>A	c.(124-126)ttC>ttA	p.F42L	GPR83_ENST00000539203.2_Missense_Mutation_p.F42L	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	42					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGTTCCAAGAGAAGAAGTGCG	0.657																																																	0								ENSG00000123901						60.0	63.0	62.0					11																	94134288		2201	4298	6499	GPR83	SO:0001583	missense	0			-	HGNC	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.126C>A	11.37:g.94134288G>T	ENSP00000243673:p.Phe42Leu	Somatic	0	35	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.F42L	ENST00000243673.2	37	c.126	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002403	0.54254	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.61040	0.2;0.14	4.43	3.5	0.40072	.	0.065126	0.64402	D	0.000009	T	0.47857	0.1468	L	0.56769	1.78	0.40131	D	0.97671	B	0.26081	0.141	B	0.27887	0.084	T	0.35674	-0.9779	10	0.10636	T	0.68	.	9.4904	0.38955	0.1722:0.0:0.8278:0.0	.	42	Q9NYM4	GPR83_HUMAN	L	42	ENSP00000243673:F42L;ENSP00000441550:F42L	ENSP00000243673:F42L	F	-	3	2	GPR83	93773936	0.914000	0.31030	0.922000	0.36590	0.873000	0.50193	-0.086000	0.11233	2.022000	0.59522	0.407000	0.27541	TTC	-	NULL		0.657	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	protein_coding	OTTHUMT00000396232.1	G	NM_016540	-		94134288	-1	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	SNP	0.968	T
BFAR	51283	genome.wustl.edu	37	16	14761590	14761590	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:14761590A>G	ENST00000261658.2	+	8	1536	c.1259A>G	c.(1258-1260)aAc>aGc	p.N420S	BFAR_ENST00000563082.1_3'UTR|BFAR_ENST00000426842.2_Missense_Mutation_p.N292S|BFAR_ENST00000563971.1_Missense_Mutation_p.N295S	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	420					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						TTTGTTTGCAACTGTTTGTTT	0.498																																																	0								ENSG00000103429						145.0	139.0	141.0					16																	14761590		2197	4300	6497	BFAR	SO:0001583	missense	0			-	HGNC	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.1259A>G	16.37:g.14761590A>G	ENSP00000261658:p.Asn420Ser	Somatic	0	76	0.00		0.5964348528521314	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	29	36.96	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.N420S	ENST00000261658.2	37	c.1259	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615018	0.87359	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.52295	3.02;0.67	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	L	0.27053	0.805	0.58432	D	0.999998	P;D;D	0.67145	0.941;0.996;0.996	P;P;P	0.58266	0.504;0.836;0.76	T	0.57015	-0.7883	10	0.87932	D	0	.	14.938	0.70973	1.0:0.0:0.0:0.0	.	292;420;420	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	S	420;292	ENSP00000261658:N420S;ENSP00000400634:N292S	ENSP00000261658:N420S	N	+	2	0	BFAR	14669091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.280000	0.78610	2.121000	0.65114	0.460000	0.39030	AAC	-	NULL		0.498	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	protein_coding	OTTHUMT00000252088.1	A	NM_016561	-		14761590	+1	no_errors	ENST00000261658	ensembl	human	known	74_37	missense	SNP	1.000	G
