#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACBD6	84320	genome.wustl.edu	37	1	180471380	180471380	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:180471380C>T	ENST00000367595.3	-	1	709	c.22G>A	c.(22-24)Gcg>Acg	p.A8T		NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	8						cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						ATGGCCCCCGCGGGCAGGAAT	0.647																																																	0								ENSG00000135847						29.0	33.0	31.0					1																	180471380		2203	4300	6503	ACBD6	SO:0001583	missense	0			-	HGNC	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.22G>A	1.37:g.180471380C>T	ENSP00000356567:p.Ala8Thr	Somatic	0	42	0.00		0.521819055958222	53	26.39	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl-CoA-binding_protein,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Acyl-CoA-binding_protein,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Acyl-CoA-binding_protein,prints_Ankyrin_rpt	p.A8T	ENST00000367595.3	37	c.22	CCDS1339.1	1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.757146	0.31137	.	.	ENSG00000135847	ENST00000367595	T	0.48836	0.8	4.79	-7.3	0.01446	.	0.501140	0.21459	N	0.074185	T	0.18045	0.0433	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06267	-1.0836	10	0.26408	T	0.33	1.2834	3.0108	0.06044	0.3694:0.3812:0.0854:0.164	.	8	Q9BR61	ACBD6_HUMAN	T	8	ENSP00000356567:A8T	ENSP00000356567:A8T	A	-	1	0	ACBD6	178738003	0.006000	0.16342	0.275000	0.24674	0.759000	0.43091	-0.766000	0.04725	-0.904000	0.03876	0.313000	0.20887	GCG	-	NULL		0.647	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD6	protein_coding	OTTHUMT00000084998.1	C	NM_032360	-		180471380	-1	no_errors	ENST00000367595	ensembl	human	known	74_37	missense	SNP	0.002	T
PATL1	219988	genome.wustl.edu	37	11	59419077	59419077	+	Silent	SNP	A	A	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:59419077A>T	ENST00000300146.9	-	12	1548	c.1464T>A	c.(1462-1464)tcT>tcA	p.S488S		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	488	Involved in nuclear spleckles localization.|Region C.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						TATTCACACTAGAAACGGTAA	0.383																																																	0								ENSG00000166889						94.0	79.0	84.0					11																	59419077		1875	4101	5976	PATL1	SO:0001819	synonymous_variant	0			-	HGNC	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.1464T>A	11.37:g.59419077A>T		Somatic	0	40	0.00		0.521819055958222	81	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Topo_II-assoc_PAT1	p.S488	ENST00000300146.9	37	c.1464	CCDS44613.1	11																																																																																			-	pfam_Topo_II-assoc_PAT1		0.383	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	protein_coding	OTTHUMT00000394559.1	A	NM_152716	-		59419077	-1	no_errors	ENST00000300146	ensembl	human	known	74_37	silent	SNP	1.000	T
SLC52A2	79581	genome.wustl.edu	37	8	145583332	145583332	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr8:145583332delG	ENST00000532887.1	+	3	763	c.180delG	c.(178-180)ctgfs	p.L60fs	FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000530047.1_Frame_Shift_Del_p.L60fs|SLC52A2_ENST00000527078.1_Frame_Shift_Del_p.L60fs|SLC52A2_ENST00000526891.1_3'UTR|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000329994.2_Frame_Shift_Del_p.L60fs|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000540505.1_5'UTR|SLC52A2_ENST00000402965.1_Frame_Shift_Del_p.L60fs|FBXL6_ENST00000455319.2_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	60					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TGGGGAACCTGGGTCTGCTGG	0.647																																																	0								ENSG00000185803						151.0	140.0	144.0					8																	145583332		2203	4300	6503	SLC52A2	SO:0001589	frameshift_variant	0				HGNC	AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.180delG	8.37:g.145583332delG	ENSP00000436768:p.Leu60fs	Somatic	0	57	0.00		0.521819055958222	188	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	54	15.62	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Endogenous_retrovirus_rcpt	p.G61fs	ENST00000532887.1	37	c.180	CCDS6423.1	8																																																																																			-	NULL		0.647	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC52A2	protein_coding	OTTHUMT00000382405.1	G	NM_024531			145583332	+1	no_errors	ENST00000329994	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
LRRK2	120892	genome.wustl.edu	37	12	40692941	40692941	+	Silent	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:40692941G>A	ENST00000298910.7	+	25	3436	c.3378G>A	c.(3376-3378)ttG>ttA	p.L1126L	LRRK2_ENST00000343742.2_Silent_p.L1126L	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1126					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCTCCCCCTTGAGACTGAAGG	0.333																																																	0								ENSG00000188906						116.0	125.0	122.0					12																	40692941		2203	4300	6503	LRRK2	SO:0001819	synonymous_variant	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3378G>A	12.37:g.40692941G>A		Somatic	0	83	0.00		0.521819055958222	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	116	14.71	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.L1126	ENST00000298910.7	37	c.3378	CCDS31774.1	12																																																																																			-	NULL		0.333	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513	-		40692941	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	silent	SNP	0.879	A
DMD	1756	genome.wustl.edu	37	X	31200986	31200986	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chrX:31200986G>T	ENST00000357033.4	-	68	10049	c.9843C>A	c.(9841-9843)ttC>ttA	p.F3281L	DMD_ENST00000378677.2_Missense_Mutation_p.F3277L|DMD_ENST00000378707.3_Missense_Mutation_p.F821L|DMD_ENST00000378680.2_Missense_Mutation_p.F213L|DMD_ENST00000361471.4_Missense_Mutation_p.F213L|DMD_ENST00000343523.2_Missense_Mutation_p.F821L|DMD_ENST00000541735.1_Missense_Mutation_p.F821L|DMD_ENST00000474231.1_Missense_Mutation_p.F821L|DMD_ENST00000359836.1_Missense_Mutation_p.F821L|DMD_ENST00000378723.3_Missense_Mutation_p.F213L|DMD_ENST00000378702.4_Missense_Mutation_p.F213L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3281	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCAGTCTAGGAAGAGGGCCG	0.527																																																	0								ENSG00000198947						88.0	66.0	74.0					X																	31200986		2202	4300	6502	DMD	SO:0001583	missense	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9843C>A	X.37:g.31200986G>T	ENSP00000354923:p.Phe3281Leu	Somatic	0	71	0.00		0.521819055958222	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	54	38.64	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.F3281L	ENST00000357033.4	37	c.9843	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.257089|4.257089	0.80246|0.80246	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680;ENST00000378705|ENST00000465285	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.81247|.	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47|.	5.41|5.41	3.64|3.64	0.41730|0.41730	EF-hand domain, type 2 (1);|.	0.000000|.	0.39020|.	U|.	0.001495|.	T|T	0.78432|0.78432	0.4282|0.4282	M|M	0.92880|0.92880	3.355|3.355	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	0.989;0.983;0.998;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999;0.999;0.987;1.0;1.0;0.998|.	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.97110|.	0.975;0.94;0.994;0.996;0.996;0.996;0.999;0.999;0.999;0.997;0.995;0.996;0.971;1.0;0.999;0.994|.	T|T	0.78823|0.78823	-0.2052|-0.2052	10|5	0.87932|.	D|.	0|.	.|.	7.6949|7.6949	0.28590|0.28590	0.3273:0.0:0.6727:0.0|0.3273:0.0:0.6727:0.0	.|.	213;3273;3281;3277;1940;1937;821;821;821;821;821;3158;213;213;213;213|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	L|T	3273;1940;1937;213;977;3277;3281;821;821;3281;3158;821;821;213;821;213;213;71|1010	ENSP00000367997:F213L;ENSP00000350765:F977L;ENSP00000367948:F3277L;ENSP00000354923:F3281L;ENSP00000352894:F821L;ENSP00000340057:F821L;ENSP00000367979:F821L;ENSP00000444119:F821L;ENSP00000367974:F213L;ENSP00000417123:F821L;ENSP00000354464:F213L;ENSP00000367951:F213L;ENSP00000367977:F71L|.	ENSP00000340057:F821L|.	F|P	-|-	3|1	2|0	DMD|DMD	31110907|31110907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.009000|2.009000	0.40903|0.40903	0.639000|0.639000	0.30564|0.30564	0.600000|0.600000	0.82982|0.82982	TTC|CCT	-	pfam_EF-hand_dom_typ2,pirsf_Dystrophin/utrophin		0.527	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	G	NM_004006	-		31200986	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	SNP	1.000	T
COLEC12	81035	genome.wustl.edu	37	18	346619	346619	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr18:346619G>A	ENST00000400256.3	-	5	1210	c.1003C>T	c.(1003-1005)Cgc>Tgc	p.R335C		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	335					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				AGCTGGAAGCGTTCCTCCAGT	0.468																																																	0								ENSG00000158270						165.0	133.0	144.0					18																	346619		2203	4300	6503	COLEC12	SO:0001583	missense	0			-	HGNC	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1003C>T	18.37:g.346619G>A	ENSP00000383115:p.Arg335Cys	Somatic	0	108	0.00		0.521819055958222	85	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	195	10.55	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.R335C	ENST00000400256.3	37	c.1003	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580056	0.46006	.	.	ENSG00000158270	ENST00000400256	T	0.80994	-1.44	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.83852	0.5344	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	P	0.61275	0.886	D	0.85102	0.0958	10	0.87932	D	0	-9.732	15.8302	0.78743	0.0:0.0:0.8561:0.1439	.	335	Q5KU26	COL12_HUMAN	C	335	ENSP00000383115:R335C	ENSP00000383115:R335C	R	-	1	0	COLEC12	336619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.113000	0.71553	2.778000	0.95560	0.655000	0.94253	CGC	-	NULL		0.468	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	protein_coding	OTTHUMT00000440746.1	G		-		346619	-1	no_errors	ENST00000400256	ensembl	human	known	74_37	missense	SNP	1.000	A
PRDM7	11105	genome.wustl.edu	37	16	90161117	90161117	+	5'Flank	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:90161117G>A	ENST00000569206.1	-	0	0				TUBB8P7_ENST00000567960.1_RNA|TUBB8P7_ENST00000564451.1_RNA			Q9NQW5	PRDM7_HUMAN	PR domain containing 7						regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		AACGCTCCAAGGTCATCCTGT	0.607																																																	0								ENSG00000261812																																			TUBB8P7	SO:0001631	upstream_gene_variant	0			-	HGNC	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990		16.37:g.90161117G>A	Exception_encountered	Somatic	0	135	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	77	25.24	A4Q9G8|Q08EM4|Q9NQW4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000569206.1	37	NULL		16																																																																																			-	-		0.607	PRDM7-009	KNOWN	basic	processed_transcript	TUBB8P7	protein_coding	OTTHUMT00000420855.1	G		-		90161117	+1	no_errors	ENST00000563927	ensembl	human	known	74_37	rna	SNP	0.849	A
COL4A5	1287	genome.wustl.edu	37	X	107924118	107924118	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chrX:107924118T>A	ENST00000361603.2	+	44	4245	c.4001T>A	c.(4000-4002)aTg>aAg	p.M1334K	COL4A5_ENST00000328300.6_Missense_Mutation_p.M1340K	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1334	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TGTGCAGGCATGAAAGGACCC	0.478									Alport syndrome with Diffuse Leiomyomatosis																																								0								ENSG00000188153						141.0	128.0	132.0					X																	107924118		2203	4299	6502	COL4A5	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4001T>A	X.37:g.107924118T>A	ENSP00000354505:p.Met1334Lys	Somatic	0	156	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	108	33.74	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.M1340K	ENST00000361603.2	37	c.4019	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	T	2.787	-0.252200	0.05829	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94000	-3.33;-3.21	5.19	5.19	0.71726	.	0.153282	0.64402	D	0.000012	D	0.85457	0.5701	N	0.11313	0.125	0.38896	D	0.957223	B;B	0.30889	0.299;0.165	B;B	0.35859	0.212;0.064	T	0.82694	-0.0330	10	0.07030	T	0.85	.	14.1569	0.65424	0.0:0.0:0.0:1.0	.	1337;1334	E7EVY4;P29400	.;CO4A5_HUMAN	K	1340;1334;1340	ENSP00000331902:M1340K;ENSP00000354505:M1334K	ENSP00000331902:M1340K	M	+	2	0	COL4A5	107810774	1.000000	0.71417	0.997000	0.53966	0.586000	0.36452	3.408000	0.52651	1.721000	0.51461	0.350000	0.21858	ATG	-	pfam_Collagen		0.478	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	T		-		107924118	+1	no_errors	ENST00000328300	ensembl	human	known	74_37	missense	SNP	0.999	A
NOL4	8715	genome.wustl.edu	37	18	31538220	31538220	+	Missense_Mutation	SNP	G	G	A	rs141080481	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr18:31538220G>A	ENST00000261592.5	-	7	1516	c.1219C>T	c.(1219-1221)Cgg>Tgg	p.R407W	NOL4_ENST00000269185.4_Missense_Mutation_p.R293W|NOL4_ENST00000589544.1_Missense_Mutation_p.R407W|NOL4_ENST00000535384.1_Missense_Mutation_p.R122W|NOL4_ENST00000538587.1_Missense_Mutation_p.R333W|NOL4_ENST00000535475.1_Missense_Mutation_p.R252W	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	407						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.R407W(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GCTTTCAGCCGCTCGGCTTCA	0.453																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000101746						151.0	131.0	138.0					18																	31538220		2203	4300	6503	NOL4	SO:0001583	missense	0			-	HGNC	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1219C>T	18.37:g.31538220G>A	ENSP00000261592:p.Arg407Trp	Somatic	0	49	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R407W	ENST00000261592.5	37	c.1219	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821091	0.50633	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	T;T	0.80123	-1.34;-1.34	5.5	1.22	0.21188	.	0.000000	0.64402	D	0.000007	D	0.87791	0.6266	M	0.70595	2.14	0.46203	D	0.998926	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.997;0.997;0.999;0.998;0.997;0.983;0.997	D	0.88114	0.2827	10	0.87932	D	0	-15.2256	14.6743	0.68967	0.0:0.0:0.5085:0.4915	.	293;156;122;333;407;122;407;252	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	W	407;293;156;122;252;333	ENSP00000445733:R122W;ENSP00000443472:R333W	ENSP00000261592:R407W	R	-	1	2	NOL4	29792218	1.000000	0.71417	0.989000	0.46669	0.939000	0.58152	2.498000	0.45363	0.214000	0.20742	0.557000	0.71058	CGG	-	NULL		0.453	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	protein_coding	OTTHUMT00000255386.1	G	NM_003787	-		31538220	-1	no_errors	ENST00000261592	ensembl	human	known	74_37	missense	SNP	1.000	A
METTL13	51603	genome.wustl.edu	37	1	171753532	171753532	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:171753532C>T	ENST00000361735.3	+	2	1072	c.806C>T	c.(805-807)tCt>tTt	p.S269F	METTL13_ENST00000362019.3_Missense_Mutation_p.S183F|METTL13_ENST00000367737.5_Intron|METTL13_ENST00000458517.1_Missense_Mutation_p.S268F	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	269							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GGGAGTGTGTCTCTGGACTTG	0.647																																																	0								ENSG00000010165						22.0	21.0	21.0					1																	171753532		2199	4298	6497	METTL13	SO:0001583	missense	0			-	HGNC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.806C>T	1.37:g.171753532C>T	ENSP00000354920:p.Ser269Phe	Somatic	0	51	0.00		0.521819055958222	40	20.00	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.S269F	ENST00000361735.3	37	c.806	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439719	0.83885	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T	0.35236	2.08;1.32;2.08;2.95	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	M	0.62209	1.925	0.80722	D	1	D;D	0.69078	0.994;0.997	P;D	0.63597	0.864;0.916	T	0.23226	-1.0194	10	0.29301	T	0.29	-46.9349	18.6211	0.91321	0.0:1.0:0.0:0.0	.	268;269	B4E2X3;Q8N6R0	.;MTL13_HUMAN	F	268;183;269;186;183	ENSP00000401955:S268F;ENSP00000355393:S183F;ENSP00000354920:S269F;ENSP00000356710:S186F	ENSP00000341732:S183F	S	+	2	0	METTL13	170020155	0.999000	0.42202	0.998000	0.56505	0.996000	0.88848	4.260000	0.58835	2.465000	0.83290	0.655000	0.94253	TCT	-	NULL		0.647	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	protein_coding	OTTHUMT00000084528.5	C	NM_014955	-		171753532	+1	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	SNP	1.000	T
CNOT1	23019	genome.wustl.edu	37	16	58568140	58568140	+	Silent	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:58568140G>A	ENST00000317147.5	-	40	6138	c.5806C>T	c.(5806-5808)Ctg>Ttg	p.L1936L	CNOT1_ENST00000245138.4_Silent_p.L787L|CNOT1_ENST00000569240.1_Silent_p.L1931L	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1936				L -> P (in Ref. 1; CAH18093). {ECO:0000305}.	gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AAGGCATCCAGGTTGTGATAG	0.493																																																	0								ENSG00000125107						185.0	137.0	153.0					16																	58568140		2198	4300	6498	CNOT1	SO:0001819	synonymous_variant	0			-	HGNC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.5806C>T	16.37:g.58568140G>A		Somatic	0	95	0.00		0.521819055958222	132	12.00	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	70	9.09	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.L1936	ENST00000317147.5	37	c.5806	CCDS10799.1	16																																																																																			-	NULL		0.493	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	protein_coding	OTTHUMT00000257385.3	G	NM_016284	-		58568140	-1	no_errors	ENST00000317147	ensembl	human	known	74_37	silent	SNP	1.000	A
XKR6	286046	genome.wustl.edu	37	8	10986462	10986462	+	Intron	SNP	A	A	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr8:10986462A>C	ENST00000416569.2	-	1	791				AF131215.5_ENST00000400102.3_Missense_Mutation_p.L31R|AF131215.3_ENST00000500944.2_RNA	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		gcagccagaaagtctttttTT	0.383																																																	0								ENSG00000215346																																			AF131215.5	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.764+71622T>G	8.37:g.10986462A>C		Somatic	0	49	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	Q8TBA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L31R	ENST00000416569.2	37	c.92	CCDS5978.2	8	.	.	.	.	.	.	.	.	.	.	A	6.031	0.374165	0.11409	.	.	ENSG00000215346	ENST00000400102	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	T	0.39655	0.1086	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39143	-0.9628	4	0.87932	D	0	.	.	.	.	.	.	.	.	R	31	.	ENSP00000382973:L31R	L	-	2	0	AF131215.1	11023872	0.044000	0.20184	0.029000	0.17559	0.099000	0.18886	0.539000	0.23175	0.263000	0.21812	0.260000	0.18958	CTT	-	NULL		0.383	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215346	protein_coding	OTTHUMT00000383958.1	A	NM_173683	-		10986462	-1	no_errors	ENST00000400102	ensembl	human	novel	74_37	missense	SNP	0.036	C
PHB2	11331	genome.wustl.edu	37	12	7077684	7077684	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:7077684G>A	ENST00000535923.1	-	4	648	c.367C>T	c.(367-369)Cgc>Tgc	p.R123C	PHB2_ENST00000399433.2_Missense_Mutation_p.R123C|PHB2_ENST00000546111.1_Intron|EMG1_ENST00000261406.6_5'Flank|PHB2_ENST00000544134.1_5'UTR|PHB2_ENST00000440277.1_Missense_Mutation_p.R123C|SCARNA12_ENST00000459155.1_RNA|PHB2_ENST00000542912.1_Missense_Mutation_p.R123C	NM_001144831.1	NP_001138303.1			prohibitin 2											ovary(2)|pancreas(1)	3						AGCCCTAGGCGCTGGTACATG	0.547																																																	0								ENSG00000215021						83.0	82.0	83.0					12																	7077684		2079	4210	6289	PHB2	SO:0001583	missense	0			-	HGNC	AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.367C>T	12.37:g.7077684G>A	ENSP00000441875:p.Arg123Cys	Somatic	0	61	0.00		0.521819055958222	457	21.88	128	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	75	17.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Band_7,smart_Band_7,prints_Prohibitin	p.R123C	ENST00000535923.1	37	c.367	CCDS53741.1	12	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587386	0.86851	.	.	ENSG00000215021	ENST00000535923;ENST00000542912;ENST00000399433;ENST00000440277;ENST00000545167;ENST00000536316	D;D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57;-3.57	5.31	4.42	0.53409	.	0.074322	0.56097	U	0.000028	D	0.94483	0.8224	L	0.31926	0.97	0.80722	D	1	P;D;D	0.76494	0.944;0.998;0.999	P;P;P	0.61658	0.86;0.892;0.892	D	0.94974	0.8119	10	0.72032	D	0.01	-7.2573	14.2285	0.65875	0.0721:0.0:0.9279:0.0	.	123;123;123	B4DW05;B4DP75;Q99623	.;.;PHB2_HUMAN	C	123;123;123;123;159;134	ENSP00000441875:R123C;ENSP00000440317:R123C;ENSP00000382362:R123C;ENSP00000412856:R123C;ENSP00000441662:R159C;ENSP00000439029:R134C	ENSP00000382362:R123C	R	-	1	0	PHB2	6947945	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.813000	0.99286	1.378000	0.46305	-0.136000	0.14681	CGC	-	pfam_Band_7,smart_Band_7		0.547	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHB2	protein_coding	OTTHUMT00000400040.3	G	NM_007273	-		7077684	-1	no_errors	ENST00000399433	ensembl	human	known	74_37	missense	SNP	1.000	A
CYP2E1	1571	genome.wustl.edu	37	10	135345227	135345227	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:135345227G>T	ENST00000463117.2	+	5	748	c.476G>T	c.(475-477)aGg>aTg	p.R159M	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Missense_Mutation_p.R159M|AL161645.2_ENST00000599428.1_5'Flank|CYP2E1_ENST00000480558.1_3'UTR			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	159					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	GAAGCACTCAGGAAGACCCAA	0.617									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																																								0								ENSG00000130649						58.0	54.0	56.0					10																	135345227		2203	4300	6503	CYP2E1	SO:0001583	missense	0	Familial Cancer Database	incl.: Familial Head and Neck Cancer	-	HGNC	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.476G>T	10.37:g.135345227G>T	ENSP00000440689:p.Arg159Met	Somatic	0	42	0.00		0.521819055958222	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2E-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R159M	ENST00000463117.2	37	c.476	CCDS7686.1	10	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995932	0.54147	.	.	ENSG00000130649	ENST00000463117;ENST00000252945;ENST00000421586	T;T;T	0.71103	-0.54;-0.54;-0.54	5.01	4.09	0.47781	.	0.294347	0.42294	D	0.000727	T	0.71307	0.3324	L	0.43646	1.37	0.22737	N	0.998799	D	0.67145	0.996	P	0.54499	0.754	T	0.64681	-0.6350	10	0.87932	D	0	.	10.6492	0.45638	0.0954:0.0:0.9046:0.0	.	159	P05181	CP2E1_HUMAN	M	159;159;72	ENSP00000440689:R159M;ENSP00000252945:R159M;ENSP00000412754:R72M	ENSP00000252945:R159M	R	+	2	0	CYP2E1	135195217	0.002000	0.14202	0.829000	0.32907	0.457000	0.32468	0.874000	0.28065	1.448000	0.47680	0.655000	0.94253	AGG	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.617	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2E1	protein_coding	OTTHUMT00000051161.2	G	NM_000773	-		135345227	+1	no_errors	ENST00000252945	ensembl	human	known	74_37	missense	SNP	0.701	T
BDH2	56898	genome.wustl.edu	37	4	104003299	104003299	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:104003299G>T	ENST00000296424.4	-	9	743	c.623C>A	c.(622-624)aCg>aAg	p.T208K		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	208					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.T208M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		GAATCTTCCCGTCTTTTGTCT	0.453																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000164039						137.0	120.0	126.0					4																	104003299		2203	4300	6503	BDH2	SO:0001583	missense	0			-	HGNC	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.623C>A	4.37:g.104003299G>T	ENSP00000296424:p.Thr208Lys	Somatic	0	61	0.00		0.521819055958222	42	45.45	35	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	31	51.56	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.T208K	ENST00000296424.4	37	c.623	CCDS3663.1	4	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777518	0.49786	.	.	ENSG00000164039	ENST00000296424	T	0.42513	0.97	5.03	3.31	0.37934	NAD(P)-binding domain (1);	0.093880	0.64402	D	0.000001	T	0.31575	0.0801	L	0.38733	1.17	0.46586	D	0.999118	B	0.28783	0.222	B	0.22152	0.038	T	0.13202	-1.0518	10	0.87932	D	0	.	10.9321	0.47224	0.1567:0.0:0.8433:0.0	.	208	Q9BUT1	BDH2_HUMAN	K	208	ENSP00000296424:T208K	ENSP00000296424:T208K	T	-	2	0	BDH2	104222748	0.995000	0.38212	0.787000	0.31911	0.842000	0.47809	2.227000	0.42972	0.635000	0.30488	-0.137000	0.14449	ACG	-	prints_Glc/ribitol_DH		0.453	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDH2	protein_coding	OTTHUMT00000157159.2	G	NM_020139	-		104003299	-1	no_errors	ENST00000296424	ensembl	human	known	74_37	missense	SNP	0.949	T
VAX1	11023	genome.wustl.edu	37	10	118897354	118897354	+	Missense_Mutation	SNP	C	C	A	rs143954756	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:118897354C>A	ENST00000369206.5	-	1	213	c.214G>T	c.(214-216)Gat>Tat	p.D72Y	VAX1_ENST00000277905.2_Missense_Mutation_p.D72Y	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	72					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		CGGCAGTAATCCGGGTCCGCT	0.667																																																	0								ENSG00000148704						25.0	31.0	29.0					10																	118897354		2203	4299	6502	VAX1	SO:0001583	missense	0			-	HGNC	AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.214G>T	10.37:g.118897354C>A	ENSP00000358207:p.Asp72Tyr	Somatic	0	47	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	32	41.82	B1AVW5|Q6ZSX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.D72Y	ENST00000369206.5	37	c.214	CCDS44483.1	10	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098892	0.37048	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.92495	-2.33;-3.05	3.87	3.87	0.44632	.	0.118101	0.56097	D	0.000033	D	0.94404	0.8200	L	0.57536	1.79	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.87578	0.993;0.998	D	0.93590	0.6920	10	0.37606	T	0.19	-9.0901	13.9936	0.64382	0.0:1.0:0.0:0.0	.	72;72	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	Y	72	ENSP00000277905:D72Y;ENSP00000358207:D72Y	ENSP00000277905:D72Y	D	-	1	0	VAX1	118887344	1.000000	0.71417	0.996000	0.52242	0.831000	0.47069	6.595000	0.74109	1.696000	0.51158	0.305000	0.20034	GAT	-	NULL		0.667	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	protein_coding	OTTHUMT00000050559.3	C	XM_301242	-		118897354	-1	no_errors	ENST00000369206	ensembl	human	known	74_37	missense	SNP	1.000	A
ADCY7	113	genome.wustl.edu	37	16	50342240	50342240	+	Missense_Mutation	SNP	C	C	T	rs148155774	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:50342240C>T	ENST00000394697.2	+	16	2193	c.1853C>T	c.(1852-1854)aCg>aTg	p.T618M	ADCY7_ENST00000537579.1_3'UTR|ADCY7_ENST00000566433.2_Missense_Mutation_p.T618M|ADCY7_ENST00000538642.1_Missense_Mutation_p.T618M|ADCY7_ENST00000254235.3_Missense_Mutation_p.T618M			P51828	ADCY7_HUMAN	adenylate cyclase 7	618					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.T618M(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CTCTCCAGGACGGCGGCACTG	0.647																																																	1	Substitution - Missense(1)	stomach(1)						ENSG00000121281	C	MET/THR	2,4394	4.2+/-10.8	0,2,2196	107.0	97.0	101.0		1853	-8.7	0.0	16	dbSNP_134	101	0,8600		0,0,4300	yes	missense	ADCY7	NM_001114.3	81	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	benign	618/1081	50342240	2,12994	2198	4300	6498	ADCY7	SO:0001583	missense	0			-	HGNC	D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.1853C>T	16.37:g.50342240C>T	ENSP00000378187:p.Thr618Met	Somatic	0	60	0.00		0.521819055958222	41	31.67	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	59	15.71	A0AVA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.T618M	ENST00000394697.2	37	c.1853	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	C	9.766	1.171413	0.21621	4.55E-4	0.0	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000254235	T;D;D	0.82255	0.96;-1.59;-1.59	4.66	-8.7	0.00851	.	0.304362	0.22680	N	0.056946	T	0.55449	0.1921	N	0.11427	0.14	0.26445	N	0.975709	B;B	0.22541	0.071;0.055	B;B	0.23018	0.028;0.043	T	0.47114	-0.9142	10	0.27785	T	0.31	.	5.4786	0.16710	0.0938:0.5624:0.0944:0.2495	.	618;618	P51828;F5H4D1	ADCY7_HUMAN;.	M	618	ENSP00000445046:T618M;ENSP00000378187:T618M;ENSP00000254235:T618M	ENSP00000254235:T618M	T	+	2	0	ADCY7	48899741	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.317000	0.02707	-1.611000	0.01581	-0.266000	0.10368	ACG	-	NULL		0.647	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	protein_coding	OTTHUMT00000256877.3	C		rs148155774		50342240	+1	no_errors	ENST00000254235	ensembl	human	known	74_37	missense	SNP	0.000	T
CLSTN3	9746	genome.wustl.edu	37	12	7308935	7308936	+	Intron	DEL	TG	TG	-	rs141591357		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:7308935_7308936delTG	ENST00000266546.6	+	17	2977				CLSTN3_ENST00000537408.1_Intron|CLSTN3_ENST00000331148.5_3'UTR	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTTCGAGAGCTGTGTGTGTGTG	0.634																																																	0								ENSG00000139182																																			CLSTN3	SO:0001627	intron_variant	0				HGNC	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2528-1149TG>-	12.37:g.7308945_7308946delTG		Somatic	0	42	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000266546.6	37	NULL	CCDS8575.1	12																																																																																			-	-		0.634	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	protein_coding	OTTHUMT00000398560.2	TG	NM_014718			7308936	+1	no_errors	ENST00000331148	ensembl	human	known	74_37	rna	DEL	0.062:0.004	-
ZNF534	147658	genome.wustl.edu	37	19	52941698	52941698	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:52941698A>G	ENST00000332323.6	+	4	1085	c.1024A>G	c.(1024-1026)Aag>Gag	p.K342E	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.K329E	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						TTATGATTGTAAGGAATGTGG	0.418																																																	0								ENSG00000198633						59.0	53.0	55.0					19																	52941698		1568	3582	5150	ZNF534	SO:0001583	missense	0			-	HGNC	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1024A>G	19.37:g.52941698A>G	ENSP00000327538:p.Lys342Glu	Somatic	0	66	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	95	9.43	Q76KX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K342E	ENST00000332323.6	37	c.1024	CCDS46165.1	19	.	.	.	.	.	.	.	.	.	.	A	9.279	1.047720	0.19827	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.08370	3.1;3.1	1.82	-0.687	0.11320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03136	0.0092	N	0.04355	-0.22	0.09310	N	1	B;B	0.18461	0.009;0.028	B;B	0.18263	0.015;0.021	T	0.45279	-0.9272	9	0.25751	T	0.34	.	3.4954	0.07653	0.5098:0.2026:0.2876:0.0	.	329;342	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	E	342;329;341	ENSP00000327538:K342E;ENSP00000391358:K329E	ENSP00000327538:K342E	K	+	1	0	ZNF534	57633510	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-5.268000	0.00136	-0.483000	0.06772	-0.456000	0.05471	AAG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	protein_coding	OTTHUMT00000460877.1	A	NM_182512	-		52941698	+1	no_errors	ENST00000332323	ensembl	human	known	74_37	missense	SNP	0.001	G
TMEM117	84216	genome.wustl.edu	37	12	44783026	44783026	+	3'UTR	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:44783026A>G	ENST00000266534.3	+	0	2243				TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000546978.1_3'UTR	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		AAATATAAATACAGATGCAAA	0.383																																																	0								ENSG00000139173																																			TMEM117	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.*571A>G	12.37:g.44783026A>G		Somatic	0	35	0.00		0.521819055958222	21	54.35	25	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	31	31.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000266534.3	37	NULL	CCDS8745.1	12																																																																																			-	-		0.383	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM117	protein_coding	OTTHUMT00000403969.1	A	NM_032256	-		44783026	+1	no_errors	ENST00000546978	ensembl	human	known	74_37	rna	SNP	0.874	G
RASGRF1	5923	genome.wustl.edu	37	15	79277345	79277345	+	Intron	SNP	G	G	A	rs202089658		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr15:79277345G>A	ENST00000419573.3	-	24	3737				RASGRF1_ENST00000558480.2_Intron|RASGRF1_ENST00000560334.1_Intron|RASGRF1_ENST00000394745.3_Intron|RP11-16K12.1_ENST00000316148.4_RNA	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1						activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCTCCTGCCCGCACCTGCTTA	0.597																																																	0								ENSG00000177699	G	,,	1,4391	2.1+/-5.4	0,1,2195	66.0	52.0	57.0		,,	0.2	0.4	15		57	2,8584	2.2+/-6.3	0,2,4291	no	intron,intron,intron	RASGRF1	NM_001145648.1,NM_002891.4,NM_153815.2	,,	0,3,6486	AA,AG,GG		0.0233,0.0228,0.0231	,,	,,	79277345	3,12975	2196	4293	6489	RP11-16K12.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3462+3C>T	15.37:g.79277345G>A		Somatic	0	44	0.00		0.521819055958222	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00	F8VPA5|H0YKF2|J3KQP9|Q16027	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000419573.3	37	NULL	CCDS10309.1	15																																																																																			-	-		0.597	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000177699	protein_coding	OTTHUMT00000291371.3	G	NM_002891	rs202089658		79277345	+1	no_errors	ENST00000316148	ensembl	human	known	74_37	rna	SNP	0.073	A
FAM65C	140876	genome.wustl.edu	37	20	49208924	49208924	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr20:49208924G>T	ENST00000327979.2	-	19	2933	c.2522C>A	c.(2521-2523)gCt>gAt	p.A841D	FAM65C_ENST00000462842.1_5'Flank|FAM65C_ENST00000045083.2_Missense_Mutation_p.A841D|FAM65C_ENST00000535356.1_Missense_Mutation_p.A845D			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	841										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGCCAGGCGAGCGCTGGCCGC	0.657																																																	0								ENSG00000042062						38.0	42.0	41.0					20																	49208924		2018	4153	6171	FAM65C	SO:0001583	missense	0			-	HGNC	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2522C>A	20.37:g.49208924G>T	ENSP00000332663:p.Ala841Asp	Somatic	0	27	0.00		0.521819055958222	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.A845D	ENST00000327979.2	37	c.2534	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	G	1.224	-0.625949	0.03610	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.78595	-1.19;-1.19;-1.19	4.81	2.8	0.32819	.	0.987152	0.08223	U	0.978795	T	0.63438	0.2511	L	0.39633	1.23	0.09310	N	1	B;B	0.30973	0.013;0.302	B;B	0.24541	0.042;0.054	T	0.46148	-0.9212	10	0.12103	T	0.63	0.6653	4.9454	0.13987	0.238:0.0:0.615:0.147	.	845;841	F5H0X2;Q96MK2	.;FA65C_HUMAN	D	841;841;845	ENSP00000332663:A841D;ENSP00000045083:A841D;ENSP00000439802:A845D	ENSP00000045083:A841D	A	-	2	0	FAM65C	48642331	0.001000	0.12720	0.001000	0.08648	0.082000	0.17680	1.109000	0.31135	0.422000	0.26005	0.462000	0.41574	GCT	-	superfamily_ARM-type_fold		0.657	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	protein_coding	OTTHUMT00000257962.1	G		-		49208924	-1	no_errors	ENST00000535356	ensembl	human	known	74_37	missense	SNP	0.000	T
TENM3	55714	genome.wustl.edu	37	4	183714357	183714357	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:183714357C>T	ENST00000511685.1	+	26	6655	c.6532C>T	c.(6532-6534)Cga>Tga	p.R2178*	TENM3_ENST00000406950.2_Nonsense_Mutation_p.R2178*			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2178					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CTATGACCTGCGAGACAGAAT	0.468																																																	0								ENSG00000218336						113.0	111.0	112.0					4																	183714357		1994	4175	6169	TENM3	SO:0001587	stop_gained	0			-	HGNC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6532C>T	4.37:g.183714357C>T	ENSP00000424226:p.Arg2178*	Somatic	0	52	0.00		0.521819055958222	40	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R2178*	ENST00000511685.1	37	c.6532	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	C	45	11.305584	0.99544	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	.	.	.	4.75	3.83	0.44106	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3578	0.43975	0.3932:0.6068:0.0:0.0	.	.	.	.	X	2178	.	ENSP00000385276:R2178X	R	+	1	2	ODZ3	183951351	1.000000	0.71417	1.000000	0.80357	0.418000	0.31294	0.882000	0.28186	2.460000	0.83146	0.455000	0.32223	CGA	-	superfamily_Cyt_c-like_dom		0.468	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	protein_coding	OTTHUMT00000361734.1	C		-		183714357	+1	no_errors	ENST00000406950	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RNFT2	84900	genome.wustl.edu	37	12	117290182	117290183	+	3'UTR	INS	-	-	TTCCCC	rs140709252|rs71099009|rs201262887	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:117290182_117290183insTTCCCC	ENST00000392549.2	+	0	1644_1645				RNFT2_ENST00000319176.7_3'UTR|RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000551251.1_3'UTR	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AAACCAGGACTTTCCCCTTGGC	0.564														2254	0.45008	0.0386	0.7738	5008	,	,		20897	0.4732		0.7296	False		,,,				2504	0.4652																0								ENSG00000135119																																			RNFT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.*77->TTCCCC	12.37:g.117290183_117290188dupTTCCCC		Somatic	NA	NA	NA		0.521819055958222	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PAM7|Q96SU5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392549.2	37	NULL	CCDS44987.1	12																																																																																			-	-		0.564	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding		-	NM_032814			117290183	+1	no_errors	ENST00000551251	ensembl	human	known	74_37	rna	INS	0.014:0.009	TTCCCC
LRRK2	120892	genome.wustl.edu	37	12	40692910	40692910	+	Splice_Site	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:40692910G>A	ENST00000298910.7	+	25	3405		c.e25-1		LRRK2_ENST00000343742.2_Splice_Site	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTGTGACTAGAAATAAAATA	0.313																																																	0								ENSG00000188906						77.0	82.0	80.0					12																	40692910		2203	4300	6503	LRRK2	SO:0001630	splice_region_variant	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3348-1G>A	12.37:g.40692910G>A		Somatic	0	70	0.00		0.521819055958222	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	88	14.56	A6NJU2|Q6ZS50|Q8NCX9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e25-1	ENST00000298910.7	37	c.3348-1	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756488	0.49362	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4993	0.90876	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRK2	38979177	1.000000	0.71417	0.996000	0.52242	0.568000	0.35870	7.722000	0.84778	2.365000	0.80145	0.491000	0.48974	.	-	-		0.313	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513	-	Intron	40692910	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	splice_site	SNP	1.000	A
WDR27	253769	genome.wustl.edu	37	6	170070759	170070759	+	Missense_Mutation	SNP	G	G	A	rs201671423	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:170070759G>A	ENST00000448612.1	-	4	471	c.362C>T	c.(361-363)tCg>tTg	p.S121L	WDR27_ENST00000420344.2_Missense_Mutation_p.S121L|WDR27_ENST00000423258.1_Intron|WDR27_ENST00000333572.6_Missense_Mutation_p.S121L	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	121						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TCCCAAAAGCGAGCCCATGAC	0.443													G|||	2	0.000399361	0.0	0.0	5008	,	,		17480	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000184465						128.0	126.0	127.0					6																	170070759		1929	4154	6083	WDR27	SO:0001583	missense	0			-	HGNC	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.362C>T	6.37:g.170070759G>A	ENSP00000416289:p.Ser121Leu	Somatic	0	74	0.00		0.521819055958222	11	21.43	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	65	22.62	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S121L	ENST00000448612.1	37	c.362	CCDS47520.2	6	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693750	0.30052	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000420344	T;T;T	0.70749	1.07;2.18;-0.51	5.52	4.65	0.58169	.	0.214503	0.37669	N	0.002000	T	0.40398	0.1115	L	0.43152	1.355	0.26027	N	0.981797	P;P	0.52692	0.913;0.955	B;B	0.31337	0.089;0.128	T	0.36089	-0.9762	10	0.56958	D	0.05	-13.1103	13.1852	0.59677	0.0782:0.0:0.9217:0.0	.	121;121	F2Z2U5;C9JGV0	.;.	L	121	ENSP00000416289:S121L;ENSP00000330265:S121L;ENSP00000406114:S121L	ENSP00000330265:S121L	S	-	2	0	WDR27	169812684	0.987000	0.35691	0.058000	0.19502	0.009000	0.06853	4.115000	0.57865	1.324000	0.45282	-0.339000	0.08088	TCG	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.443	WDR27-010	KNOWN	basic|CCDS	protein_coding	WDR27	protein_coding	OTTHUMT00000407334.1	G	NM_182552	-		170070759	-1	no_errors	ENST00000448612	ensembl	human	known	74_37	missense	SNP	0.787	A
LRRC8C	84230	genome.wustl.edu	37	1	90180397	90180397	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:90180397C>G	ENST00000370454.4	+	3	2523	c.2268C>G	c.(2266-2268)taC>taG	p.Y756*	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	756					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TTCTTTCCTACTTAGATGTAA	0.393																																																	0								ENSG00000171488						80.0	82.0	81.0					1																	90180397		2203	4300	6503	LRRC8C	SO:0001587	stop_gained	0			-	HGNC		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2268C>G	1.37:g.90180397C>G	ENSP00000359483:p.Tyr756*	Somatic	0	42	0.00		0.521819055958222	44	30.16	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	26	35.00	B3KXS9|Q29RV6|Q9H075	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Y756*	ENST00000370454.4	37	c.2268	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.149310	0.97324	.	.	ENSG00000171488	ENST00000370454	.	.	.	5.87	-2.66	0.06077	.	0.307495	0.36703	N	0.002450	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.468	0.55771	0.0:0.4346:0.0:0.5654	.	.	.	.	X	756	.	ENSP00000359483:Y756X	Y	+	3	2	LRRC8C	89952985	0.055000	0.20627	0.977000	0.42913	0.925000	0.55904	-0.588000	0.05774	-0.409000	0.07553	0.655000	0.94253	TAC	-	smart_Leu-rich_rpt_typical-subtyp		0.393	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	protein_coding	OTTHUMT00000028435.2	C	NM_032270	-		90180397	+1	no_errors	ENST00000370454	ensembl	human	known	74_37	nonsense	SNP	0.969	G
CYB561A3	220002	genome.wustl.edu	37	11	61117028	61117028	+	3'UTR	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:61117028G>T	ENST00000294072.4	-	0	2249				CYB561A3_ENST00000426130.2_3'UTR|CYB561A3_ENST00000540317.1_5'UTR|CYB561A3_ENST00000447532.2_3'UTR	NM_001161452.1|NM_153611.4	NP_001154924.1|NP_705839.3	Q8NBI2	CYAC3_HUMAN	cytochrome b561 family, member A3							integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)										GGGAGAGCAGGTCACCAGGAT	0.582																																																	0								ENSG00000162144																																			CYB561A3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK024953	CCDS8004.1, CCDS53639.1, CCDS73296.1	11q12.2	2013-03-14	2013-03-14	2013-03-14		ENSG00000162144		"""Cytochrome b genes"""	23014	protein-coding gene	gene with protein product			"""cytochrome b, ascorbate dependent 3"""	CYBASC3		23249217	Standard	NM_153611		Approved		uc001nrf.4	Q8NBI2		ENST00000294072.4:c.*843C>A	11.37:g.61117028G>T		Somatic	0	51	0.00		0.521819055958222	82	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B3KPU2|B4DLN9|J3KQH4|Q6PK96	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000294072.4	37	NULL	CCDS8004.1	11																																																																																			-	-		0.582	CYB561A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB561A3	protein_coding	OTTHUMT00000398714.2	G	NM_153611	-		61117028	-1	no_errors	ENST00000540317	ensembl	human	known	74_37	rna	SNP	0.629	T
HEPHL1	341208	genome.wustl.edu	37	11	93806290	93806290	+	Silent	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:93806290A>G	ENST00000315765.9	+	7	1340	c.1332A>G	c.(1330-1332)agA>agG	p.R444R		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	444	Plastocyanin-like 3.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TTACTAAAAGAAAGAGACTCT	0.428																																																	0								ENSG00000181333						90.0	83.0	85.0					11																	93806290		1837	4086	5923	HEPHL1	SO:0001819	synonymous_variant	0			-	HGNC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.1332A>G	11.37:g.93806290A>G		Somatic	0	43	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	Q3C1W7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.R444	ENST00000315765.9	37	c.1332	CCDS44710.1	11																																																																																			-	superfamily_Cupredoxin		0.428	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	A	XM_291947	-		93806290	+1	no_errors	ENST00000315765	ensembl	human	known	74_37	silent	SNP	0.120	G
B3GALNT2	148789	genome.wustl.edu	37	1	235643459	235643459	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:235643459G>A	ENST00000366600.3	-	5	790	c.562C>T	c.(562-564)Ctc>Ttc	p.L188F	B3GALNT2_ENST00000494378.1_5'UTR|B3GALNT2_ENST00000313984.3_Missense_Mutation_p.L229F	NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	188					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GCAATGAAGAGGGCCTCCTAC	0.428																																																	0								ENSG00000162885						84.0	77.0	80.0					1																	235643459		2203	4300	6503	B3GALNT2	SO:0001583	missense	0			-	HGNC	BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.562C>T	1.37:g.235643459G>A	ENSP00000355559:p.Leu188Phe	Somatic	0	77	0.00		0.521819055958222	14	36.36	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	75	27.18	Q59GR3|Q5TCI3|Q96AL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_31	p.L188F	ENST00000366600.3	37	c.562	CCDS1606.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468240	0.84533	.	.	ENSG00000162885	ENST00000366599;ENST00000366600;ENST00000313984	T;T	0.64991	-0.13;1.04	6.02	6.02	0.97574	.	0.055808	0.64402	D	0.000001	T	0.79747	0.4499	M	0.77616	2.38	0.41763	D	0.989729	D;D	0.76494	0.999;0.975	D;P	0.72982	0.979;0.721	T	0.81013	-0.1125	10	0.66056	D	0.02	-21.7582	16.763	0.85517	0.0:0.0:0.8705:0.1295	.	229;188	Q8NCR0-2;Q8NCR0	.;B3GL2_HUMAN	F	229;188;229	ENSP00000355559:L188F;ENSP00000315678:L229F	ENSP00000315678:L229F	L	-	1	0	B3GALNT2	233710082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.222000	0.51223	2.850000	0.98022	0.650000	0.86243	CTC	-	NULL		0.428	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALNT2	protein_coding	OTTHUMT00000097376.1	G	NM_152490	-		235643459	-1	no_errors	ENST00000366600	ensembl	human	known	74_37	missense	SNP	1.000	A
MYH1	4619	genome.wustl.edu	37	17	10411236	10411236	+	Silent	SNP	A	A	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr17:10411236A>T	ENST00000226207.5	-	17	2029	c.1935T>A	c.(1933-1935)ggT>ggA	p.G645G	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	645	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GGAAAGAAGAACCCTTCTTCT	0.403																																																	0								ENSG00000109061						72.0	80.0	77.0					17																	10411236		2203	4300	6503	MYH1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1935T>A	17.37:g.10411236A>T		Somatic	0	147	0.00		0.521819055958222	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	237	13.45	Q14CA4|Q9Y622	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G645	ENST00000226207.5	37	c.1935	CCDS11155.1	17																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.403	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	A	NM_005963	-		10411236	-1	no_errors	ENST00000226207	ensembl	human	known	74_37	silent	SNP	1.000	T
CDC27	996	genome.wustl.edu	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	A	T	rs200148949		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr17:45234367A>T	ENST00000066544.3	-	7	847	c.754T>A	c.(754-756)Tcc>Acc	p.S252T	CDC27_ENST00000527547.1_Missense_Mutation_p.S252T|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.S252T|CDC27_ENST00000446365.2_Missense_Mutation_p.S191T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.S252T(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATAATATGGAAGTTCCTGTT	0.383																																																	3	Substitution - Missense(3)	prostate(3)						ENSG00000004897						54.0	60.0	58.0					17																	45234367		2197	4295	6492	CDC27	SO:0001583	missense	0			-	HGNC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.754T>A	17.37:g.45234367A>T	ENSP00000066544:p.Ser252Thr	Somatic	1	118	0.84		0.521819055958222	84	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	129	10.42	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S252T	ENST00000066544.3	37	c.754	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	A	11.88	1.770710	0.31320	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.26;0.01;-0.31;0.83	5.44	2.92	0.33932	.	0.295461	0.32687	N	0.005769	T	0.46425	0.1392	N	0.24115	0.695	0.34835	D	0.740078	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.001	T	0.45702	-0.9243	10	0.19590	T	0.45	-13.824	7.977	0.30161	0.7316:0.1283:0.0:0.1401	.	191;252;252;252	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	252;252;191;252;252	ENSP00000066544:S252T;ENSP00000434614:S252T;ENSP00000392802:S191T;ENSP00000437339:S252T;ENSP00000432105:S252T	ENSP00000066544:S252T	S	-	1	0	CDC27	42589366	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.784000	0.47774	0.864000	0.35578	0.377000	0.23210	TCC	-	NULL		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	protein_coding	OTTHUMT00000389742.2	A		rs200148949		45234367	-1	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7045892	7045906	+	In_Frame_Del	DEL	CAGCAGCAGCAGCAG	CAGCAGCAGCAGCAG	-	rs377147612|rs60216939		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	CAGCAGCAGCAGCAG	CAGCAGCAGCAGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:7045892_7045906delCAGCAGCAGCAGCAG	ENST00000356654.4	+	5	1699_1713	c.1462_1476delCAGCAGCAGCAGCAG	c.(1462-1476)cagcagcagcagcagdel	p.QQQQQ498del	ATN1_ENST00000396684.2_In_Frame_Del_p.QQQQQ498del	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.Q487_Q488insQ(1)|p.Q488delQ(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						gcaacagcaacagcagcagcagcagcagcagcagc	0.642																																																	2	Insertion - In frame(1)|Deletion - In frame(1)	breast(2)						ENSG00000111676																																			ATN1	SO:0001651	inframe_deletion	0				HGNC	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1462_1476delCAGCAGCAGCAGCAG	12.37:g.7045892_7045906delCAGCAGCAGCAGCAG	ENSP00000349076:p.Gln498_Gln502del	Somatic	NA	NA	NA		0.521819055958222	162	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q99495|Q99621|Q9UEK7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Atrophin-like,prints_Atrophin-1	p.QQQQQ491in_frame_del	ENST00000356654.4	37	c.1462_1476	CCDS31734.1	12																																																																																			-	pfam_Atrophin-like		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	protein_coding	OTTHUMT00000401948.2	CAGCAGCAGCAGCAG	NM_001940			7045906	+1	no_errors	ENST00000356654	ensembl	human	known	74_37	in_frame_del	DEL	0.834:0.709:0.730:0.772:0.719:0.700:0.962:0.955:0.948:0.969:0.915:0.004:0.157:0.124:0.121	-
LRRK2	120892	genome.wustl.edu	37	12	40693045	40693045	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:40693045G>A	ENST00000298910.7	+	25	3540	c.3482G>A	c.(3481-3483)aGa>aAa	p.R1161K	LRRK2_ENST00000343742.2_Missense_Mutation_p.R1161K	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1161					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTCAGTGCCAGAATGAATTTT	0.408																																																	0								ENSG00000188906						169.0	179.0	175.0					12																	40693045		2203	4300	6503	LRRK2	SO:0001583	missense	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3482G>A	12.37:g.40693045G>A	ENSP00000298910:p.Arg1161Lys	Somatic	0	117	0.00		0.521819055958222	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	119	13.77	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.R1161K	ENST00000298910.7	37	c.3482	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250404	0.39797	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.25085	2.21;1.82	5.12	4.23	0.50019	.	0.194250	0.43260	N	0.000600	T	0.14657	0.0354	N	0.21240	0.645	0.25307	N	0.989239	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.26573	-1.0099	10	0.11794	T	0.64	.	9.3216	0.37968	0.0768:0.1444:0.7788:0.0	.	1161;1161	E9PC85;Q5S007	.;LRRK2_HUMAN	K	1161	ENSP00000341930:R1161K;ENSP00000298910:R1161K	ENSP00000298910:R1161K	R	+	2	0	LRRK2	38979312	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	3.609000	0.54117	1.142000	0.42291	0.313000	0.20887	AGA	-	NULL		0.408	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513	-		40693045	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	SNP	0.998	A
LRRC74A	145497	genome.wustl.edu	37	14	77323797	77323797	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr14:77323797G>T	ENST00000393774.3	+	10	1207	c.1083G>T	c.(1081-1083)agG>agT	p.R361S		NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CCAAATCCAGGATGGAAGAGC	0.453																																					Ovarian(165;1056 1958 32571 36789 48728)												0								ENSG00000100565						81.0	77.0	78.0					14																	77323797		1880	4118	5998	C14orf166B	SO:0001583	missense	0			-	HGNC																												ENST00000393774.3:c.1083G>T	14.37:g.77323797G>T	ENSP00000377369:p.Arg361Ser	Somatic	0	38	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R361S	ENST00000393774.3	37	c.1083	CCDS9853.2	14	.	.	.	.	.	.	.	.	.	.	G	5.692	0.312250	0.10789	.	.	ENSG00000100565	ENST00000393774	T	0.52983	0.64	5.17	3.33	0.38152	.	1.549250	0.03617	N	0.235778	T	0.31451	0.0797	N	0.16602	0.42	0.19775	N	0.999957	B	0.15719	0.014	B	0.10450	0.005	T	0.23261	-1.0193	10	0.09084	T	0.74	.	7.0486	0.25061	0.1503:0.0:0.7084:0.1413	.	361	Q0VAA2	CN16B_HUMAN	S	361	ENSP00000377369:R361S	ENSP00000377369:R361S	R	+	3	2	C14orf166B	76393550	0.964000	0.33143	0.645000	0.29479	0.973000	0.67179	1.313000	0.33585	0.557000	0.29117	-0.379000	0.06801	AGG	-	NULL		0.453	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	protein_coding	OTTHUMT00000316592.1	G		-		77323797	+1	no_errors	ENST00000393774	ensembl	human	known	74_37	missense	SNP	0.214	T
AASDH	132949	genome.wustl.edu	37	4	57244546	57244546	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:57244546A>G	ENST00000205214.6	-	4	616	c.436T>C	c.(436-438)Tgg>Cgg	p.W146R	AASDH_ENST00000510762.1_5'UTR|AASDH_ENST00000513376.1_Missense_Mutation_p.W46R|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000602986.1_5'UTR|AASDH_ENST00000502617.1_Missense_Mutation_p.W146R|AASDH_ENST00000451613.1_Missense_Mutation_p.W146R	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	146					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GTATTTTTCCAGTGAAGTCTG	0.313																																																	0								ENSG00000157426						83.0	80.0	81.0					4																	57244546		2203	4299	6502	AASDH	SO:0001583	missense	0			-	HGNC	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.436T>C	4.37:g.57244546A>G	ENSP00000205214:p.Trp146Arg	Somatic	0	39	0.00		0.521819055958222	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.W146R	ENST00000205214.6	37	c.436	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.949431	0.00475	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000451613;ENST00000502617	T;T;T;T	0.62941	-0.01;0.11;2.9;0.58	5.95	4.74	0.60224	AMP-dependent synthetase/ligase (1);	0.234254	0.35903	N	0.002917	T	0.39860	0.1094	N	0.25332	0.735	0.20403	N	0.999905	B;B;B	0.25351	0.124;0.124;0.007	B;B;B	0.20767	0.031;0.031;0.008	T	0.18398	-1.0338	10	0.14252	T	0.57	-3.8543	2.9397	0.05826	0.6283:0.1511:0.0763:0.1443	.	146;146;146	Q4L235-4;Q4L235-3;Q4L235	.;.;ACSF4_HUMAN	R	146;46;146;146	ENSP00000205214:W146R;ENSP00000423760:W46R;ENSP00000409656:W146R;ENSP00000421171:W146R	ENSP00000205214:W146R	W	-	1	0	AASDH	56939303	0.129000	0.22400	0.903000	0.35520	0.242000	0.25591	2.701000	0.47094	1.039000	0.40074	0.533000	0.62120	TGG	-	pfam_AMP-dep_Synth/Lig		0.313	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	protein_coding	OTTHUMT00000250780.1	A	NM_181806	-		57244546	-1	no_errors	ENST00000205214	ensembl	human	known	74_37	missense	SNP	0.462	G
KLHL22	84861	genome.wustl.edu	37	22	20825717	20825717	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr22:20825717G>T	ENST00000328879.4	-	3	469	c.313C>A	c.(313-315)Cta>Ata	p.L105I	KLHL22_ENST00000440659.2_Intron	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	105	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			ATGAAATGTAGGATTTGGCAC	0.507																																																	0								ENSG00000099910						162.0	141.0	148.0					22																	20825717		2203	4300	6503	KLHL22	SO:0001583	missense	0			-	HGNC		CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.313C>A	22.37:g.20825717G>T	ENSP00000331682:p.Leu105Ile	Somatic	0	66	0.00		0.521819055958222	71	7.79	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	77	10.47	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L105I	ENST00000328879.4	37	c.313	CCDS13780.1	22	.	.	.	.	.	.	.	.	.	.	G	3.624	-0.077016	0.07184	.	.	ENSG00000099910	ENST00000328879;ENST00000451553;ENST00000444967;ENST00000458248;ENST00000443285;ENST00000431430	T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	5.3	4.29	0.51040	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.154073	0.44097	D	0.000495	T	0.68449	0.3002	L	0.37466	1.105	0.80722	D	1	B	0.31769	0.339	B	0.38296	0.27	T	0.61038	-0.7143	10	0.02654	T	1	.	6.9801	0.24698	0.0885:0.0:0.7403:0.1712	.	105	Q53GT1	KLH22_HUMAN	I	105;28;137;105;139;105	ENSP00000331682:L105I;ENSP00000400095:L28I;ENSP00000403999:L137I;ENSP00000398616:L105I;ENSP00000397882:L139I;ENSP00000409092:L105I	ENSP00000331682:L105I	L	-	1	2	KLHL22	19155717	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.086000	0.50159	1.243000	0.43853	0.650000	0.86243	CTA	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.507	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	protein_coding	OTTHUMT00000320045.2	G	NM_032775	-		20825717	-1	no_errors	ENST00000328879	ensembl	human	known	74_37	missense	SNP	1.000	T
NTRK2	4915	genome.wustl.edu	37	9	87342760	87342761	+	In_Frame_Ins	INS	-	-	ATA			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr9:87342760_87342761insATA	ENST00000323115.4	+	8	1398_1399	c.1045_1046insATA	c.(1045-1047)gat>gATAat	p.350_351insN	NTRK2_ENST00000304053.6_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000277120.3_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000376208.1_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000395882.1_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000376213.1_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000395866.2_In_Frame_Ins_p.194_195insN|NTRK2_ENST00000376214.1_In_Frame_Ins_p.350_351insN|NTRK2_ENST00000359847.3_In_Frame_Ins_p.350_351insN			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	350	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCTCCAGCTGGATAATCCCACT	0.446										TSP Lung(25;0.17)																																							0								ENSG00000148053																																			NTRK2	SO:0001652	inframe_insertion	0				HGNC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1046_1048dupATA	9.37:g.87342761_87342763dupATA	ENSP00000314586:p.Asn350_Asn350dup	Somatic	0	56	0.00		0.521819055958222	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	39	27.78	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.351in_frame_insN	ENST00000323115.4	37	c.1045_1046	CCDS35050.1	9																																																																																			-	pfam_Ig_I-set,prints_Tyr_kinase_NGF_rcpt		0.446	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	-				87342761	+1	no_errors	ENST00000277120	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	ATA
ST14	6768	genome.wustl.edu	37	11	130059725	130059725	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:130059725G>T	ENST00000278742.5	+	5	950	c.532G>T	c.(532-534)Gta>Tta	p.V178L		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	178	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CGAGGAGCGCGTAGTCATGCT	0.672																																																	0								ENSG00000149418						88.0	87.0	88.0					11																	130059725		2201	4297	6498	ST14	SO:0001583	missense	0			-	HGNC	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.532G>T	11.37:g.130059725G>T	ENSP00000278742:p.Val178Leu	Somatic	0	67	0.00		0.521819055958222	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Peptidase_S1A_matripase,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.V178L	ENST00000278742.5	37	c.532	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	G	9.247	1.039847	0.19669	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	D	0.87809	-2.3	5.1	-0.024	0.13941	SEA (1);	1.427190	0.05189	N	0.502703	T	0.74366	0.3707	L	0.31664	0.95	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.58584	-0.7611	10	0.02654	T	1	.	2.4426	0.04498	0.4293:0.1154:0.337:0.1182	.	178	Q9Y5Y6	ST14_HUMAN	L	178;80	ENSP00000278742:V178L	ENSP00000278742:V178L	V	+	1	0	ST14	129564935	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.205000	0.09411	-0.188000	0.10499	-0.140000	0.14226	GTA	-	pirsf_Peptidase_S1A_matripase,pfam_SEA_dom		0.672	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	protein_coding	OTTHUMT00000386119.1	G		-		130059725	+1	no_errors	ENST00000278742	ensembl	human	known	74_37	missense	SNP	0.000	T
SETD1B	23067	genome.wustl.edu	37	12	122247688	122247688	+	Silent	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:122247688G>A	ENST00000604567.1	+	6	905	c.837G>A	c.(835-837)ctG>ctA	p.L279L	SETD1B_ENST00000267197.5_Silent_p.L279L|SETD1B_ENST00000542440.1_Silent_p.L279L			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	279					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CACCGCGCCTGGGCACCCCTT	0.642																																																	0								ENSG00000139718						62.0	69.0	67.0					12																	122247688		692	1591	2283	SETD1B	SO:0001819	synonymous_variant	0			-	HGNC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.837G>A	12.37:g.122247688G>A		Somatic	0	151	0.00		0.521819055958222	18	14.29	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	139	17.65	F6MFW1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.L279	ENST00000604567.1	37	c.837		12																																																																																			-	NULL		0.642	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	protein_coding	OTTHUMT00000468264.1	G	XM_037523	-		122247688	+1	no_errors	ENST00000267197	ensembl	human	known	74_37	silent	SNP	1.000	A
UTP3	57050	genome.wustl.edu	37	4	71554620	71554622	+	In_Frame_Del	DEL	GAG	GAG	-	rs369776055		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:71554620_71554622delGAG	ENST00000254803.2	+	1	425_427	c.226_228delGAG	c.(226-228)gagdel	p.E81del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	81	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaggatggcgaggaggaggagg	0.567																																																	0								ENSG00000132467																																			UTP3	SO:0001651	inframe_deletion	0				HGNC	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.226_228delGAG	4.37:g.71554629_71554631delGAG	ENSP00000254803:p.Glu81del	Somatic	0	34	0.00		0.521819055958222	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q6FI82	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E79in_frame_del	ENST00000254803.2	37	c.226_228	CCDS3546.1	4																																																																																			-	NULL		0.567	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	protein_coding	OTTHUMT00000252163.2	GAG	NM_020368			71554622	+1	no_errors	ENST00000254803	ensembl	human	known	74_37	in_frame_del	DEL	0.044:0.001:0.001	-
CHD7	55636	genome.wustl.edu	37	8	61654811	61654811	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr8:61654811A>G	ENST00000423902.2	+	2	1299	c.820A>G	c.(820-822)Aga>Gga	p.R274G	CHD7_ENST00000525508.1_Missense_Mutation_p.R274G|CHD7_ENST00000524602.1_Missense_Mutation_p.R274G	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	274					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CCACAGTCCCAGATTCTCCCC	0.557																																																	0								ENSG00000171316						105.0	106.0	105.0					8																	61654811		1982	4156	6138	CHD7	SO:0001583	missense	0			-	HGNC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.820A>G	8.37:g.61654811A>G	ENSP00000392028:p.Arg274Gly	Somatic	0	33	0.00		0.521819055958222	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	85	10.53	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R274G	ENST00000423902.2	37	c.820	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	A	10.78	1.447330	0.25987	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	D;T;T	0.81739	-1.53;1.98;-1.14	5.09	2.57	0.30868	.	0.000000	0.46758	D	0.000273	T	0.52613	0.1745	N	0.03608	-0.345	0.37139	D	0.901632	P	0.43477	0.808	B	0.30943	0.122	T	0.59209	-0.7497	10	0.27785	T	0.31	-13.2456	12.0981	0.53767	0.5566:0.4434:0.0:0.0	.	274	Q9P2D1	CHD7_HUMAN	G	274	ENSP00000392028:R274G;ENSP00000437061:R274G;ENSP00000436027:R274G	ENSP00000307304:R274G	R	+	1	2	CHD7	61817365	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.799000	0.47892	0.794000	0.33899	0.533000	0.62120	AGA	-	NULL		0.557	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	A	XM_098762	-		61654811	+1	no_errors	ENST00000423902	ensembl	human	known	74_37	missense	SNP	1.000	G
ASTN2	23245	genome.wustl.edu	37	9	119495717	119495717	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr9:119495717delC	ENST00000313400.4	-	14	2582	c.2482delG	c.(2482-2484)gtcfs	p.V828fs	ASTN2_ENST00000361209.2_Frame_Shift_Del_p.V777fs|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Frame_Shift_Del_p.V824fs			O75129	ASTN2_HUMAN	astrotactin 2	828					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TCGGAGAGGACCCCCCGGCAC	0.612																																																	0								ENSG00000148219						91.0	98.0	96.0					9																	119495717		2203	4300	6503	ASTN2	SO:0001589	frameshift_variant	0				HGNC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2482delG	9.37:g.119495717delC	ENSP00000314038:p.Val828fs	Somatic	0	46	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	58	13.43	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.V828fs	ENST00000313400.4	37	c.2482		9																																																																																			-	NULL		0.612	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	protein_coding		C	NM_014010			119495717	-1	no_errors	ENST00000313400	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ZNF479	90827	genome.wustl.edu	37	7	57188073	57188073	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr7:57188073T>C	ENST00000331162.4	-	5	1319	c.1049A>G	c.(1048-1050)gAg>gGg	p.E350G		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			ATAGGGTTTCTCTCTAGTATG	0.433																																																	0								ENSG00000185177						25.0	27.0	26.0					7																	57188073		2085	4254	6339	ZNF479	SO:0001583	missense	0			-	HGNC	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1049A>G	7.37:g.57188073T>C	ENSP00000333776:p.Glu350Gly	Somatic	0	136	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	141	17.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E350G	ENST00000331162.4	37	c.1049	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	t	14.09	2.432845	0.43224	.	.	ENSG00000185177	ENST00000331162	T	0.27557	1.66	0.946	0.946	0.19549	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44973	0.1319	L	0.57536	1.79	0.32089	N	0.592173	D	0.89917	1.0	D	0.80764	0.994	T	0.51687	-0.8674	9	0.87932	D	0	.	5.7317	0.18042	0.0:0.0:0.0:1.0	.	350	Q96JC4	ZN479_HUMAN	G	350	ENSP00000333776:E350G	ENSP00000333776:E350G	E	-	2	0	ZNF479	57192015	0.467000	0.25831	0.037000	0.18230	0.035000	0.12851	1.481000	0.35476	0.339000	0.23719	0.329000	0.21502	GAG	-	pfscan_Znf_C2H2		0.433	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	protein_coding	OTTHUMT00000345302.1	T	XM_291202	-		57188073	-1	no_errors	ENST00000331162	ensembl	human	known	74_37	missense	SNP	1.000	C
MAP3K15	389840	genome.wustl.edu	37	X	19449651	19449651	+	Silent	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chrX:19449651G>T	ENST00000338883.4	-	7	1070	c.1071C>A	c.(1069-1071)ggC>ggA	p.G357G	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_5'UTR|MAP3K15_ENST00000469203.2_Silent_p.G189G	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	357							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					ACATGTCGGGGCCCGGGTGAT	0.517																																																	0								ENSG00000180815						77.0	69.0	71.0					X																	19449651		1568	3582	5150	MAP3K15	SO:0001819	synonymous_variant	0			-	HGNC	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1071C>A	X.37:g.19449651G>T		Somatic	0	68	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G357	ENST00000338883.4	37	c.1071		X																																																																																			-	NULL		0.517	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	protein_coding		G	NM_001001671	-		19449651	-1	no_errors	ENST00000338883	ensembl	human	known	74_37	silent	SNP	0.686	T
AC005307.1	0	genome.wustl.edu	37	19	28910190	28910191	+	lincRNA	INS	-	-	TTTTT	rs201139948|rs67115110|rs372866410	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:28910190_28910191insTTTTT	ENST00000567877.1	-	0	768_769																											aagaccttatctTTTTTTTTTT	0.46																																																	0								ENSG00000260725																																			AC005307.1			0				Clone_based_vega_gene																													19.37:g.28910196_28910200dupTTTTT		Somatic	NA	NA	NA		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567877.1	37	NULL		19																																																																																			-	-		0.460	AC005307.1-001	KNOWN	basic	lincRNA	ENSG00000260725	lincRNA	OTTHUMT00000431036.1	-				28910191	-1	no_errors	ENST00000567877	ensembl	human	known	74_37	rna	INS	0.004:0.005	TTTTT
TGM7	116179	genome.wustl.edu	37	15	43568678	43568678	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr15:43568678A>G	ENST00000452443.2	-	13	2112	c.2108T>C	c.(2107-2109)tTc>tCc	p.F703S		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	703					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CACAGTGACGAAGATGTCCTT	0.602																																																	0								ENSG00000159495						135.0	116.0	123.0					15																	43568678		2202	4299	6501	TGM7	SO:0001583	missense	0			-	HGNC	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.2108T>C	15.37:g.43568678A>G	ENSP00000389466:p.Phe703Ser	Somatic	0	61	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	64	38.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.F703S	ENST00000452443.2	37	c.2108	CCDS32213.1	15	.	.	.	.	.	.	.	.	.	.	A	8.969	0.972470	0.18736	.	.	ENSG00000159495	ENST00000452443	T	0.67523	-0.27	4.47	2.05	0.26809	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.517672	0.19039	N	0.124329	T	0.62612	0.2442	L	0.46157	1.445	0.09310	N	1	D	0.55172	0.97	P	0.54815	0.761	T	0.50684	-0.8799	10	0.19147	T	0.46	-0.2483	4.4299	0.11522	0.7245:0.0:0.0993:0.1762	.	703	Q96PF1	TGM7_HUMAN	S	703	ENSP00000389466:F703S	ENSP00000389466:F703S	F	-	2	0	TGM7	41355970	0.327000	0.24678	0.134000	0.22075	0.212000	0.24457	1.668000	0.37481	0.641000	0.30601	0.477000	0.44152	TTC	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.602	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	protein_coding	OTTHUMT00000432489.1	A	NM_052955	-		43568678	-1	no_errors	ENST00000452443	ensembl	human	known	74_37	missense	SNP	0.139	G
GPR98	84059	genome.wustl.edu	37	5	90050957	90050957	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr5:90050957G>C	ENST00000405460.2	+	55	11631	c.11535G>C	c.(11533-11535)atG>atC	p.M3845I		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3845	Calx-beta 25. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAATAATAATGAAAGAAAACA	0.343																																																	0								ENSG00000164199						59.0	59.0	59.0					5																	90050957		1835	4080	5915	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11535G>C	5.37:g.90050957G>C	ENSP00000384582:p.Met3845Ile	Somatic	0	40	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.M3845I	ENST00000405460.2	37	c.11535	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.96|13.96	2.391734|2.391734	0.42410|0.42410	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.32023|.	1.47|.	5.73|5.73	4.84|4.84	0.62591|0.62591	.|.	0.311043|.	0.46442|.	N|.	0.000289|.	T|.	0.71702|.	0.3371|.	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	B;B|.	0.14012|.	0.009;0.001|.	B;B|.	0.10450|.	0.005;0.001|.	T|.	0.71533|.	-0.4564|.	10|.	0.49607|.	T|.	0.09|.	.|.	14.935|14.935	0.70948|0.70948	0.0:0.1427:0.8573:0.0|0.0:0.1427:0.8573:0.0	.|.	3845;3845|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	I|S	3845|1411	ENSP00000384582:M3845I|.	ENSP00000296619:M3845I|.	M|X	+|+	3|2	0|2	GPR98|GPR98	90086713|90086713	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.735000|0.735000	0.41995|0.41995	3.944000|3.944000	0.56629|0.56629	1.393000|1.393000	0.46605|0.46605	0.655000|0.655000	0.94253|0.94253	ATG|TGA	-	NULL		0.343	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		90050957	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	C
ENTPD1	953	genome.wustl.edu	37	10	97607265	97607265	+	Missense_Mutation	SNP	C	C	G	rs199648967	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:97607265C>G	ENST00000371205.4	+	7	1159	c.876C>G	c.(874-876)aaC>aaG	p.N292K	ENTPD1_ENST00000453258.2_Missense_Mutation_p.N299K|ENTPD1_ENST00000539125.1_Missense_Mutation_p.N154K|ENTPD1_ENST00000371203.5_Missense_Mutation_p.N154K|ENTPD1_ENST00000543964.1_Missense_Mutation_p.N184K|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000371207.3_Missense_Mutation_p.N304K|ENTPD1-AS1_ENST00000416301.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	292					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		AGGTAGTGAACGTAAGTGACC	0.418																																																	0								ENSG00000138185						130.0	126.0	127.0					10																	97607265		2203	4300	6503	ENTPD1	SO:0001583	missense	0			-	HGNC	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.876C>G	10.37:g.97607265C>G	ENSP00000360248:p.Asn292Lys	Somatic	0	80	0.00		0.521819055958222	77	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	57	26.92	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDA1_CD39_NTPase	p.N304K	ENST00000371205.4	37	c.912	CCDS7444.1	10	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322139	0.23994	.	.	ENSG00000138185	ENST00000453258;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	T;T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78;2.78	5.77	-11.5	0.00074	.	0.512547	0.24479	N	0.038167	T	0.04452	0.0122	N	0.25992	0.78	0.09310	N	1	B;B;B	0.25351	0.102;0.006;0.124	B;B;B	0.32393	0.089;0.015;0.145	T	0.30238	-0.9985	10	0.06891	T	0.86	-7.215	9.1455	0.36930	0.0776:0.6575:0.1571:0.1079	.	304;299;292	G3XAF6;P49961-2;P49961	.;.;ENTP1_HUMAN	K	299;304;184;154;154;292	ENSP00000390955:N299K;ENSP00000360250:N304K;ENSP00000442968:N184K;ENSP00000440027:N154K;ENSP00000360246:N154K;ENSP00000360248:N292K	ENSP00000360246:N154K	N	+	3	2	ENTPD1	97597255	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-2.168000	0.01270	-2.926000	0.00302	-0.300000	0.09419	AAC	-	pfam_GDA1_CD39_NTPase		0.418	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1	protein_coding	OTTHUMT00000049566.1	C	NM_001776	-		97607265	+1	no_errors	ENST00000371207	ensembl	human	known	74_37	missense	SNP	0.000	G
SLC12A3	6559	genome.wustl.edu	37	16	56914083	56914083	+	Silent	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:56914083C>T	ENST00000563236.1	+	12	1510	c.1485C>T	c.(1483-1485)ttC>ttT	p.F495F	SLC12A3_ENST00000438926.2_Silent_p.F495F|SLC12A3_ENST00000566786.1_Silent_p.F494F|SLC12A3_ENST00000262502.5_Silent_p.F494F			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	495					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TCGGCTTCTTCGGCAAAGGCT	0.617																																																	0			GRCh37	CM081805	SLC12A3	M		ENSG00000070915						47.0	38.0	41.0					16																	56914083		2198	4300	6498	SLC12A3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1485C>T	16.37:g.56914083C>T		Somatic	0	238	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	98	135	42.06	A8MSJ2|C9JNN9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F495	ENST00000563236.1	37	c.1485	CCDS58464.1	16																																																																																			-	pfam_AA-permease/SLC12A_dom,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS		0.617	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	protein_coding	OTTHUMT00000432337.1	C		-		56914083	+1	no_errors	ENST00000438926	ensembl	human	known	74_37	silent	SNP	0.994	T
ZNF268	10795	genome.wustl.edu	37	12	133780214	133780214	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:133780214G>A	ENST00000536435.2	+	6	2272	c.1942G>A	c.(1942-1944)Gcc>Acc	p.A648T	ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.A648T|ZNF268_ENST00000537565.1_Missense_Mutation_p.A487T|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	648					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ATGTGGAAAAGCCTTTACGTT	0.383																																																	0								ENSG00000090612						87.0	77.0	80.0					12																	133780214		692	1591	2283	ZNF268	SO:0001583	missense	0			-	HGNC	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1942G>A	12.37:g.133780214G>A	ENSP00000444412:p.Ala648Thr	Somatic	0	62	0.00		0.521819055958222	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A648T	ENST00000536435.2	37	c.1942	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672277	0.29693	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.13778	2.56;2.56	4.28	-1.39	0.08997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07908	0.0198	N	0.25957	0.775	0.09310	N	1	B;B	0.22003	0.063;0.051	B;B	0.18263	0.021;0.012	T	0.40627	-0.9553	8	.	.	.	.	6.269	0.20943	0.1629:0.0:0.2451:0.592	.	648;487	Q14587;Q14587-2	ZN268_HUMAN;.	T	648;648;487;487	ENSP00000228289:A648T;ENSP00000445713:A487T	.	A	+	1	0	ZNF268	.	0.000000	0.05858	0.843000	0.33291	0.940000	0.58332	-1.013000	0.03645	-0.184000	0.10567	-0.182000	0.12963	GCC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	protein_coding	OTTHUMT00000397191.2	G	NM_152943	-		133780214	+1	no_errors	ENST00000228289	ensembl	human	known	74_37	missense	SNP	0.001	A
CHDH	55349	genome.wustl.edu	37	3	53857739	53857739	+	Silent	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr3:53857739G>A	ENST00000315251.6	-	3	734	c.297C>T	c.(295-297)tgC>tgT	p.C99C		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	99					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ACCTGTCGTCGCACAGGTTGG	0.697																																																	0								ENSG00000016391						10.0	13.0	12.0					3																	53857739		2091	4085	6176	CHDH	SO:0001819	synonymous_variant	0			-	HGNC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.297C>T	3.37:g.53857739G>A		Somatic	0	62	0.00		0.521819055958222	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	Q9NY17	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GMC_OxRdtase_N,pfam_GMC_OxRtase_C,pirsf_GMC_OxRdtase	p.C99	ENST00000315251.6	37	c.297	CCDS2873.1	3																																																																																			-	pfam_GMC_OxRdtase_N,pirsf_GMC_OxRdtase		0.697	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDH	protein_coding	OTTHUMT00000350567.2	G	NM_018397	-		53857739	-1	no_errors	ENST00000315251	ensembl	human	known	74_37	silent	SNP	0.710	A
ZDHHC11	79844	genome.wustl.edu	37	5	710820	710821	+	Intron	DEL	GA	GA	-			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr5:710820_710821delGA	ENST00000424784.2	-	14	2007				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CCAGGACTGTGAGCTTCCATTT	0.51																																																	0								ENSG00000206077																																			ZDHHC11B	SO:0001627	intron_variant	0				HGNC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1236+102TC>-	5.37:g.710820_710821delGA		Somatic	0	52	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q6UWR9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			-	-		0.510	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	protein_coding		GA	NM_024786			710821	-1	no_errors	ENST00000522356	ensembl	human	known	74_37	rna	DEL	0.786:0.478	-
C14orf37	145407	genome.wustl.edu	37	14	58582973	58582973	+	Intron	SNP	T	T	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr14:58582973T>C	ENST00000267485.7	-	4	2026				C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37							integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						atttCCTCCATTGTAGCCTTA	0.264																																																	0								ENSG00000139971																																			C14orf37	SO:0001627	intron_variant	0			-	HGNC		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1831+15256A>G	14.37:g.58582973T>C		Somatic	0	51	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K8Z8|Q6P5Q1|Q86TY1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267485.7	37	NULL	CCDS32089.1	14																																																																																			-	-		0.264	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	protein_coding	OTTHUMT00000412059.1	T	NM_001001872	-		58582973	-1	no_errors	ENST00000334342	ensembl	human	known	74_37	rna	SNP	0.007	C
CCDC7	79741	genome.wustl.edu	37	10	33165274	33165274	+	Splice_Site	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:33165274G>T	ENST00000375030.2	+	23	2335		c.e23-1		C10orf68_ENST00000375025.4_Splice_Site|C10orf68_ENST00000375028.3_Splice_Site			Q9H943	CJ068_HUMAN												breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TTTCTTTAAAGTGTTACATGC	0.303																																																	0								ENSG00000150076						67.0	65.0	66.0					10																	33165274		2203	4300	6503	C10orf68	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000375030.2:c.1718-1G>T	10.37:g.33165274G>T		Somatic	0	99	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	27	42.55	B0QZ71|Q08AN7|Q8N7T7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e22-1	ENST00000375030.2	37	c.2033-1		10	.	.	.	.	.	.	.	.	.	.	.	8.710	0.911834	0.17907	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	.	.	.	4.23	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.33809	D	0.627637	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1748	0.31275	0.1083:0.0:0.8917:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf68	33205280	0.366000	0.25014	0.030000	0.17652	0.046000	0.14306	0.692000	0.25482	1.370000	0.46153	-0.140000	0.14226	.	-	-		0.303	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	protein_coding	OTTHUMT00000313999.2	G		-	Intron	33165274	+1	no_errors	ENST00000375025	ensembl	human	known	74_37	splice_site	SNP	0.040	T
CTIF	9811	genome.wustl.edu	37	18	46163008	46163008	+	Silent	SNP	G	G	A	rs577092756	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr18:46163008G>A	ENST00000256413.3	+	3	499	c.204G>A	c.(202-204)ccG>ccA	p.P68P	CTIF_ENST00000382998.4_Silent_p.P68P	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	68	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GCAGCGAACCGCTGGACAGCA	0.627													G|||	2	0.000399361	0.0	0.0029	5008	,	,		17984	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000134030						30.0	27.0	28.0					18																	46163008		2203	4300	6503	CTIF	SO:0001819	synonymous_variant	0			-	HGNC	AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.204G>A	18.37:g.46163008G>A		Somatic	0	85	0.00		0.521819055958222	16	15.79	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	57	25.64	B3KTR8|Q8IVD5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.P68	ENST00000256413.3	37	c.204	CCDS11935.1	18																																																																																			-	NULL		0.627	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTIF	protein_coding	OTTHUMT00000255907.1	G	NM_014772	-		46163008	+1	no_errors	ENST00000382998	ensembl	human	known	74_37	silent	SNP	0.918	A
LRRK2	120892	genome.wustl.edu	37	12	40693049	40693049	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:40693049G>A	ENST00000298910.7	+	25	3544	c.3486G>A	c.(3484-3486)atG>atA	p.M1162I	LRRK2_ENST00000343742.2_Missense_Mutation_p.M1162I	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1162					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GTGCCAGAATGAATTTTCTTG	0.398																																																	0								ENSG00000188906						167.0	177.0	173.0					12																	40693049		2203	4300	6503	LRRK2	SO:0001583	missense	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3486G>A	12.37:g.40693049G>A	ENSP00000298910:p.Met1162Ile	Somatic	0	110	0.00		0.521819055958222	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	116	14.07	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.M1162I	ENST00000298910.7	37	c.3486	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512916	0.27123	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.24151	2.25;1.87	5.12	3.06	0.35304	.	0.205916	0.51477	N	0.000092	T	0.12860	0.0312	N	0.17082	0.46	0.31181	N	0.702017	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.17349	-1.0372	10	0.22109	T	0.4	.	6.1283	0.20192	0.165:0.0:0.6877:0.1473	.	1162;1162	E9PC85;Q5S007	.;LRRK2_HUMAN	I	1162	ENSP00000341930:M1162I;ENSP00000298910:M1162I	ENSP00000298910:M1162I	M	+	3	0	LRRK2	38979316	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	1.912000	0.39946	0.403000	0.25479	0.313000	0.20887	ATG	-	NULL		0.398	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513	-		40693049	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	SNP	1.000	A
C8B	732	genome.wustl.edu	37	1	57425757	57425757	+	Missense_Mutation	SNP	G	G	A	rs151070962		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:57425757G>A	ENST00000371237.4	-	2	251	c.185C>T	c.(184-186)cCc>cTc	p.P62L	C8B_ENST00000543257.1_Missense_Mutation_p.P10L|C8B_ENST00000494324.1_5'UTR|C8B_ENST00000535057.1_5'UTR	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	62					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ACAATCAATGGGCATCAGGGT	0.493																																																	0								ENSG00000021852	G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	173.0	141.0	152.0		185	4.0	1.0	1	dbSNP_134	152	0,8600		0,0,4300	no	missense	C8B	NM_000066.2	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	62/592	57425757	1,13005	2203	4300	6503	C8B	SO:0001583	missense	0			-	HGNC	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.185C>T	1.37:g.57425757G>A	ENSP00000360281:p.Pro62Leu	Somatic	0	65	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	46	30.88	A1L4K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.P62L	ENST00000371237.4	37	c.185	CCDS30730.1	1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.180949	0.57800	2.27E-4	0.0	ENSG00000021852	ENST00000371237;ENST00000543257	T;T	0.35048	1.33;1.4	4.92	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.946	T	0.63462	-0.6632	10	0.87932	D	0	-8.1555	8.8935	0.35449	0.0817:0.0:0.7704:0.1479	.	10;62	F5H7G1;P07358	.;CO8B_HUMAN	L	62;10	ENSP00000360281:P62L;ENSP00000442548:P10L	ENSP00000360281:P62L	P	-	2	0	C8B	57198345	1.000000	0.71417	0.975000	0.42487	0.453000	0.32348	4.251000	0.58778	1.408000	0.46895	0.563000	0.77884	CCC	-	superfamily_Thrombospondin_1_rpt		0.493	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8B	protein_coding	OTTHUMT00000022886.2	G		rs151070962		57425757	-1	no_errors	ENST00000371237	ensembl	human	known	74_37	missense	SNP	0.983	A
SLC12A4	6560	genome.wustl.edu	37	16	67981265	67981265	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:67981265C>T	ENST00000316341.3	-	16	2181	c.2041G>A	c.(2041-2043)Gag>Aag	p.E681K	SLC12A4_ENST00000338335.3_Missense_Mutation_p.E681K|SLC12A4_ENST00000537830.2_Missense_Mutation_p.E675K|SLC12A4_ENST00000576616.1_Missense_Mutation_p.E681K|SLC12A4_ENST00000572037.1_Missense_Mutation_p.E633K|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000422611.2_Missense_Mutation_p.E683K|SLC12A4_ENST00000541864.2_Missense_Mutation_p.E650K	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	681					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGCCCCTCCTCCAGCCGCAAC	0.672																																																	0								ENSG00000124067						31.0	39.0	36.0					16																	67981265		2193	4299	6492	SLC12A4	SO:0001583	missense	0			-	HGNC		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.2041G>A	16.37:g.67981265C>T	ENSP00000318557:p.Glu681Lys	Somatic	0	12	0.00		0.521819055958222	25	34.21	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,prints_K/Cl_cotranspt1,tigrfam_Na/K/Cl_cotransptS	p.E683K	ENST00000316341.3	37	c.2047	CCDS10855.1	16	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987437	0.93106	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96;-4.96	5.76	5.76	0.90799	Amino acid permease domain (1);	0.046590	0.85682	N	0.000000	D	0.98833	0.9606	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D;D	0.89917	0.984;1.0;0.996;0.999;0.999;0.998	D;D;D;D;D;D	0.81914	0.939;0.995;0.954;0.979;0.979;0.978	D	0.99827	1.1051	10	0.66056	D	0.02	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	683;681;650;675;681;681	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	K	683;650;675;681;681	ENSP00000395983:E683K;ENSP00000438334:E650K;ENSP00000445962:E675K;ENSP00000343374:E681K;ENSP00000318557:E681K	ENSP00000318557:E681K	E	-	1	0	SLC12A4	66538766	1.000000	0.71417	0.977000	0.42913	0.245000	0.25701	7.768000	0.85345	2.732000	0.93576	0.655000	0.94253	GAG	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS		0.672	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A4	protein_coding	OTTHUMT00000268864.4	C	NM_005072	-		67981265	-1	no_errors	ENST00000422611	ensembl	human	known	74_37	missense	SNP	1.000	T
HOPX	84525	genome.wustl.edu	37	4	57514964	57514964	+	Splice_Site	SNP	C	C	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:57514964C>A	ENST00000337881.7	-	3	801		c.e3-1		HOPX_ENST00000556376.2_Splice_Site|HOPX_ENST00000381255.3_Splice_Site|HOPX_ENST00000420433.1_Splice_Site|HOPX_ENST00000554144.1_Splice_Site|HOPX_ENST00000317745.7_Splice_Site|HOPX_ENST00000556614.2_Splice_Site|HOPX_ENST00000555760.2_Splice_Site|HOPX_ENST00000381260.3_Splice_Site|HOPX_ENST00000553379.2_Splice_Site|HOPX_ENST00000508121.1_Splice_Site|HOPX_ENST00000503639.3_Splice_Site	NM_139212.3	NP_631958.1	Q9BPY8	HOP_HUMAN	HOP homeobox						heart development (GO:0007507)|histone deacetylation (GO:0016575)|lung alveolus development (GO:0048286)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of heart contraction (GO:0008016)|regulation of protein binding (GO:0043393)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(5)|skin(1)	8	Glioma(25;0.08)|all_neural(26;0.101)					TAAACCATTTCTGGAAGAGAG	0.483																																																	0								ENSG00000171476						57.0	58.0	58.0					4																	57514964		2203	4300	6503	HOPX	SO:0001630	splice_region_variant	0			-	HGNC		CCDS3507.1, CCDS47062.1, CCDS54767.1	4q12	2011-06-20			ENSG00000171476	ENSG00000171476		"""Homeoboxes / PRD class"""	24961	protein-coding gene	gene with protein product	"""homeobox only domain"""	607275				12297045	Standard	NM_032495		Approved	LAGY, HOP, OB1, NECC1, SMAP31	uc003hbz.2	Q9BPY8	OTTHUMG00000128768	ENST00000337881.7:c.145-1G>T	4.37:g.57514964C>A		Somatic	0	35	0.00		0.521819055958222	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K0Z2|E9PB55|G3V294|Q8N0V6|Q96CI1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-1	ENST00000337881.7	37	c.329-1	CCDS3507.1	4	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296761	0.81025	.	.	ENSG00000171476	ENST00000420433;ENST00000554144;ENST00000508121;ENST00000556376;ENST00000553379;ENST00000381260;ENST00000381255;ENST00000317745;ENST00000503639;ENST00000503864;ENST00000337881;ENST00000555760;ENST00000556614;ENST00000509435;ENST00000514890;ENST00000506661	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8335	0.78778	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HOPX	57209721	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.708000	0.68377	2.818000	0.97014	0.591000	0.81541	.	-	-		0.483	HOPX-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HOPX	protein_coding	OTTHUMT00000250689.4	C		-	Intron	57514964	-1	no_errors	ENST00000554144	ensembl	human	known	74_37	splice_site	SNP	1.000	A
OR5L1	219437	genome.wustl.edu	37	11	55579721	55579721	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:55579721G>A	ENST00000333973.2	+	1	868	c.779G>A	c.(778-780)tGc>tAc	p.C260Y		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TCCATTTATTGCAGGCCCAGT	0.512																																																	0								ENSG00000186117						116.0	100.0	105.0					11																	55579721		2200	4296	6496	OR5L1	SO:0001583	missense	0			-	HGNC	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.779G>A	11.37:g.55579721G>A	ENSP00000335529:p.Cys260Tyr	Somatic	0	48	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B2RNK6|Q6IFD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C260Y	ENST00000333973.2	37	c.779	CCDS31509.1	11	.	.	.	.	.	.	.	.	.	.	g	11.02	1.515055	0.27123	.	.	ENSG00000186117	ENST00000333973	T	0.35421	1.31	4.12	-0.804	0.10882	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000022	T	0.33876	0.0878	L	0.48986	1.54	0.09310	N	1	B	0.23806	0.091	B	0.32022	0.139	T	0.45934	-0.9227	10	0.87932	D	0	-23.9671	13.0222	0.58794	0.0:0.0:0.2447:0.7553	.	260	Q8NGL2	OR5L1_HUMAN	Y	260	ENSP00000335529:C260Y	ENSP00000335529:C260Y	C	+	2	0	OR5L1	55336297	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	0.164000	0.16542	-0.102000	0.12197	0.428000	0.28381	TGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	protein_coding	OTTHUMT00000391514.1	G	NM_001004738	-		55579721	+1	no_errors	ENST00000333973	ensembl	human	known	74_37	missense	SNP	0.000	A
LAMC3	10319	genome.wustl.edu	37	9	133967312	133967313	+	3'UTR	INS	-	-	CC	rs386416363		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr9:133967312_133967313insCC	ENST00000361069.4	+	0	4999_5000				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GTGGATAGTCACTCCCTGCCGA	0.594																																																	0								ENSG00000050555																																			LAMC3	SO:0001624	3_prime_UTR_variant	0				HGNC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*139->CC	9.37:g.133967312_133967313insCC		Somatic	0	26	0.00		0.521819055958222	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B1APX9|B1APY0|Q59H72	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9																																																																																			-	-		0.594	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	-	NM_006059			133967313	+1	no_errors	ENST00000462567	ensembl	human	known	74_37	rna	INS	0.001:0.000	CC
CLDN2	9075	genome.wustl.edu	37	X	106171471	106171471	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chrX:106171471G>A	ENST00000541806.1	+	2	532	c.13G>A	c.(13-15)Ggc>Agc	p.G5S	CLDN2_ENST00000336803.1_Missense_Mutation_p.G5S|CLDN2_ENST00000540876.1_Missense_Mutation_p.G5S	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	5					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GGCCTCTCTTGGCCTCCAACT	0.547																																																	0								ENSG00000165376						69.0	60.0	63.0					X																	106171471		2203	4300	6503	CLDN2	SO:0001583	missense	0			-	HGNC	AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.13G>A	X.37:g.106171471G>A	ENSP00000441283:p.Gly5Ser	Somatic	0	60	0.00		0.521819055958222	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	42	26.32	B2R6B9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin2,prints_Claudin,prints_Claudin14	p.G5S	ENST00000541806.1	37	c.13	CCDS14524.1	X	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979460	0.53827	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.89270	-2.49;-2.49;-2.49	5.61	3.84	0.44239	.	0.049621	0.85682	D	0.000000	D	0.88588	0.6477	M	0.83774	2.66	0.47659	D	0.999488	B	0.09022	0.002	B	0.21151	0.033	D	0.83751	0.0209	10	0.56958	D	0.05	.	9.2028	0.37270	0.1809:0.0:0.8191:0.0	.	5	P57739	CLD2_HUMAN	S	5	ENSP00000441283:G5S;ENSP00000443230:G5S;ENSP00000336571:G5S	ENSP00000336571:G5S	G	+	1	0	CLDN2	106058127	1.000000	0.71417	0.838000	0.33150	0.994000	0.84299	4.468000	0.60162	0.538000	0.28769	0.600000	0.82982	GGC	-	pfam_PMP22/EMP/MP20/Claudin		0.547	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN2	protein_coding	OTTHUMT00000057815.1	G		-		106171471	+1	no_errors	ENST00000336803	ensembl	human	known	74_37	missense	SNP	1.000	A
CNTNAP5	129684	genome.wustl.edu	37	2	124999855	124999855	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr2:124999855C>T	ENST00000431078.1	+	3	630	c.266C>T	c.(265-267)aCa>aTa	p.T89I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	89	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTAGAGATTACAGCAGTGGCC	0.522																																																	0								ENSG00000155052						67.0	71.0	70.0					2																	124999855		2046	4190	6236	CNTNAP5	SO:0001583	missense	0			-	HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.266C>T	2.37:g.124999855C>T	ENSP00000399013:p.Thr89Ile	Somatic	0	97	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	59	50.41	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T89I	ENST00000431078.1	37	c.266	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390218	0.82902	.	.	ENSG00000155052	ENST00000431078	D	0.98567	-5.0	5.71	5.71	0.89125	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.246954	0.28549	N	0.014958	D	0.97999	0.9341	M	0.91768	3.24	0.48395	D	0.999647	B	0.27910	0.193	B	0.30646	0.118	D	0.96828	0.9609	10	0.72032	D	0.01	.	12.1234	0.53903	0.0:0.9134:0.0:0.0866	.	89	Q8WYK1	CNTP5_HUMAN	I	89	ENSP00000399013:T89I	ENSP00000399013:T89I	T	+	2	0	CNTNAP5	124716325	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	4.799000	0.62517	2.696000	0.92011	0.650000	0.86243	ACA	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.522	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	C		-		124999855	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	SNP	0.997	T
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000577866.1_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577985.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000577273.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356														1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0								ENSG00000196704																																			AMZ2	SO:0001627	intron_variant	0				HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG		Somatic	NA	NA	NA		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																			-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	-	NM_016627			66247427	+1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna	INS	0.001:0.003	CTGTATAG
SLC25A48	153328	genome.wustl.edu	37	5	135188287	135188287	+	Silent	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr5:135188287C>T	ENST00000420621.1	+	4	370	c.198C>T	c.(196-198)ctC>ctT	p.L66L	SLC25A48_ENST00000425402.1_Intron|SLC25A48_ENST00000433282.2_Silent_p.L12L|SLC25A48_ENST00000412661.2_Silent_p.L66L|SLC25A48_ENST00000274513.5_Silent_p.L66L			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	66					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						CCTTCCCCCTCGCCAGCATTG	0.622																																																	0								ENSG00000145832						129.0	138.0	135.0					5																	135188287		2035	4193	6228	SLC25A48	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.198C>T	5.37:g.135188287C>T		Somatic	0	39	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	32	23.81	Q8TAV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R53C	ENST00000420621.1	37	c.157		5																																																																																			-	NULL		0.622	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	SLC25A48	protein_coding		C	NM_145282	-		135188287	+1	no_errors	ENST00000462340	ensembl	human	known	74_37	missense	SNP	0.582	T
SIPA1L3	23094	genome.wustl.edu	37	19	38633272	38633272	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:38633272C>T	ENST00000222345.6	+	12	3964	c.3455C>T	c.(3454-3456)cCt>cTt	p.P1152L		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1152					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GACAGAGTCCCTCCCTACCGA	0.582											OREG0025445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000105738						217.0	209.0	211.0					19																	38633272		2203	4300	6503	SIPA1L3	SO:0001583	missense	0			-	HGNC	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3455C>T	19.37:g.38633272C>T	ENSP00000222345:p.Pro1152Leu	Somatic	0	88	0.00	879	0.521819055958222	78	57.61	106	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	114	42.13	Q2TV87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3401,pfam_Rap_GAP_dom,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.P1152L	ENST00000222345.6	37	c.3455	CCDS33007.1	19	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900581	0.33535	.	.	ENSG00000105738	ENST00000222345	T	0.75367	-0.93	4.82	3.74	0.42951	.	0.513030	0.19730	N	0.107362	T	0.65626	0.2709	L	0.52905	1.665	0.50467	D	0.999878	B	0.10296	0.003	B	0.06405	0.002	T	0.59059	-0.7525	10	0.20519	T	0.43	-8.2667	10.0247	0.42063	0.3489:0.6511:0.0:0.0	.	1152	O60292	SI1L3_HUMAN	L	1152	ENSP00000222345:P1152L	ENSP00000222345:P1152L	P	+	2	0	SIPA1L3	43325112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.581000	0.36558	2.506000	0.84524	0.563000	0.77884	CCT	-	NULL		0.582	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	protein_coding	OTTHUMT00000156294.2	C	XM_032278	-		38633272	+1	no_errors	ENST00000222345	ensembl	human	known	74_37	missense	SNP	1.000	T
C17orf74	201243	genome.wustl.edu	37	17	7330144	7330144	+	Silent	SNP	G	G	A	rs374298397		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr17:7330144G>A	ENST00000333870.3	+	3	908	c.834G>A	c.(832-834)tcG>tcA	p.S278S	RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_3'UTR	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	278						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				AGTGGGCCTCGTCTCCACCAC	0.657																																																	0								ENSG00000184560			1,4161		0,1,2080	36.0	39.0	38.0		834	-9.2	0.0	17		38	0,8434		0,0,4217	no	coding-synonymous	C17orf74	NM_175734.4		0,1,6297	AA,AG,GG		0.0,0.024,0.0079		278/502	7330144	1,12595	2081	4217	6298	C17orf74	SO:0001819	synonymous_variant	0			-	HGNC	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.834G>A	17.37:g.7330144G>A		Somatic	0	93	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	87	18.69		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S278	ENST00000333870.3	37	c.834	CCDS42255.1	17																																																																																			-	NULL		0.657	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf74	protein_coding	OTTHUMT00000440933.2	G	NM_175734	-		7330144	+1	no_errors	ENST00000333870	ensembl	human	known	74_37	silent	SNP	0.000	A
RCVRN	5957	genome.wustl.edu	37	17	9801318	9801318	+	3'UTR	SNP	C	C	T	rs549924573	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr17:9801318C>T	ENST00000226193.5	-	0	1137				RCVRN_ENST00000570909.3_5'UTR	NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin						phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						tgtgtgtgtgcgcgcgcgtgt	0.592													C|||	18	0.00359425	0.0061	0.0014	5008	,	,		16139	0.003		0.002	False		,,,				2504	0.0041																0								ENSG00000109047																																			RCVRN	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.*94G>A	17.37:g.9801318C>T		Somatic	0	33	0.00		0.521819055958222	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	Q53XL0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000226193.5	37	NULL	CCDS11151.1	17																																																																																			-	-		0.592	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCVRN	protein_coding	OTTHUMT00000252600.2	C	NM_002903	-		9801318	-1	no_errors	ENST00000570909	ensembl	human	putative	74_37	rna	SNP	0.000	T
IGSF3	3321	genome.wustl.edu	37	1	117146496	117146496	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:117146496G>T	ENST00000369486.3	-	6	2139	c.1374C>A	c.(1372-1374)agC>agA	p.S458R	IGSF3_ENST00000318837.6_Missense_Mutation_p.S478R|IGSF3_ENST00000369483.1_Missense_Mutation_p.S478R	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	458	Ig-like C2-type 4.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ACATGATATTGCTGCGGCGGT	0.652																																																	0								ENSG00000143061						70.0	68.0	68.0					1																	117146496		2202	4299	6501	IGSF3	SO:0001583	missense	0			-	HGNC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1374C>A	1.37:g.117146496G>T	ENSP00000358498:p.Ser458Arg	Somatic	0	82	0.00		0.521819055958222	13	31.58	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	65	24.42	A6NJZ6|A6NMC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S478R	ENST00000369486.3	37	c.1434	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854894	0.32791	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.64438	-0.1;-0.1;-0.1	5.27	3.27	0.37495	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.241069	0.45606	D	0.000356	T	0.21718	0.0523	L	0.27053	0.805	0.38126	D	0.937994	B;P;B	0.38827	0.087;0.649;0.106	B;B;B	0.36030	0.113;0.216;0.18	T	0.07501	-1.0769	10	0.12430	T	0.62	-37.3051	4.4564	0.11645	0.2008:0.1865:0.6127:0.0	.	478;458;478	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	R	458;478;478	ENSP00000358498:S458R;ENSP00000358495:S478R;ENSP00000321184:S478R	ENSP00000321184:S478R	S	-	3	2	IGSF3	116948019	0.898000	0.30612	1.000000	0.80357	0.989000	0.77384	0.041000	0.13927	1.460000	0.47911	0.557000	0.71058	AGC	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.652	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	protein_coding	OTTHUMT00000059040.1	G	NM_001542	-		117146496	-1	no_errors	ENST00000318837	ensembl	human	known	74_37	missense	SNP	1.000	T
MAST1	22983	genome.wustl.edu	37	19	12975906	12975906	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:12975906C>T	ENST00000251472.4	+	14	1591	c.1552C>T	c.(1552-1554)Ctc>Ttc	p.L518F		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						AGATTTCGGCCTCTCCAAGAT	0.572																																																	0								ENSG00000105613						128.0	109.0	116.0					19																	12975906		2203	4300	6503	MAST1	SO:0001583	missense	0			-	HGNC	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1552C>T	19.37:g.12975906C>T	ENSP00000251472:p.Leu518Phe	Somatic	0	29	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.L518F	ENST00000251472.4	37	c.1552	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629919	0.46944	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.34072	1.38	4.64	4.64	0.57946	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.082187	0.49305	N	0.000141	T	0.56455	0.1986	L	0.58669	1.825	0.53688	D	0.999973	D	0.89917	1.0	D	0.87578	0.998	T	0.60357	-0.7279	10	0.87932	D	0	-34.0227	15.363	0.74496	0.0:1.0:0.0:0.0	.	518	Q9Y2H9	MAST1_HUMAN	F	518	ENSP00000251472:L518F	ENSP00000251472:L518F	L	+	1	0	MAST1	12836906	0.999000	0.42202	0.977000	0.42913	0.343000	0.28985	4.020000	0.57189	2.314000	0.78098	0.561000	0.74099	CTC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.572	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	protein_coding	OTTHUMT00000451733.2	C	NM_014975	-		12975906	+1	no_errors	ENST00000251472	ensembl	human	known	74_37	missense	SNP	0.997	T
ADAMTS14	140766	genome.wustl.edu	37	10	72520516	72520516	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:72520516G>T	ENST00000373207.1	+	22	3579	c.3579G>T	c.(3577-3579)caG>caT	p.Q1193H	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.Q1196H	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1193	Pro-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GCTGGACTCAGACACCTACGC	0.647																																																	0								ENSG00000138316						56.0	56.0	56.0					10																	72520516		2203	4300	6503	ADAMTS14	SO:0001583	missense	0			-	HGNC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3579G>T	10.37:g.72520516G>T	ENSP00000362303:p.Gln1193His	Somatic	0	37	0.00		0.521819055958222	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q1196H	ENST00000373207.1	37	c.3588	CCDS7306.1	10	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372003	0.24857	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.61742	0.08;0.11	4.58	-1.88	0.07713	.	2.652540	0.02160	N	0.058724	T	0.36771	0.0979	N	0.19112	0.55	0.09310	N	1	B;B	0.30664	0.289;0.289	B;B	0.25405	0.06;0.06	T	0.11817	-1.0572	10	0.46703	T	0.11	.	1.0626	0.01604	0.3633:0.1479:0.3376:0.1512	.	1193;1196	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	H	1196;1193	ENSP00000362304:Q1196H;ENSP00000362303:Q1193H	ENSP00000362303:Q1193H	Q	+	3	2	ADAMTS14	72190522	0.000000	0.05858	0.000000	0.03702	0.254000	0.26022	-0.165000	0.09968	-0.495000	0.06659	-0.253000	0.11424	CAG	-	NULL		0.647	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	protein_coding	OTTHUMT00000048522.1	G	NM_080722	-		72520516	+1	no_errors	ENST00000373208	ensembl	human	known	74_37	missense	SNP	0.001	T
LCMT2	9836	genome.wustl.edu	37	15	43622562	43622562	+	Silent	SNP	A	A	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr15:43622562A>T	ENST00000305641.5	-	1	241	c.126T>A	c.(124-126)gtT>gtA	p.V42V	ADAL_ENST00000422466.2_5'Flank|LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000389651.4_5'Flank|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Intron	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	42					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CCGCGCCCGGAACCAGCAACG	0.697																																																	0								ENSG00000168806						21.0	27.0	25.0					15																	43622562		2092	4093	6185	LCMT2	SO:0001819	synonymous_variant	0			-	HGNC	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.126T>A	15.37:g.43622562A>T		Somatic	0	39	0.00		0.521819055958222	12	14.29	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.05	Q4JFT6|Q96B55|Q9NR10	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LCM_MeTrfase	p.V42	ENST00000305641.5	37	c.126	CCDS10094.1	15																																																																																			-	pfam_LCM_MeTrfase		0.697	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	protein_coding	OTTHUMT00000253205.1	A	NM_014793	-		43622562	-1	no_errors	ENST00000305641	ensembl	human	known	74_37	silent	SNP	0.003	T
THBS1	7057	genome.wustl.edu	37	15	39882082	39882082	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr15:39882082A>C	ENST00000260356.5	+	13	2168	c.2003A>C	c.(2002-2004)cAc>cCc	p.H668P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	668	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.H668R(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TACCTGGGCCACTATAGCGAC	0.602																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000137801						113.0	96.0	102.0					15																	39882082		2200	4297	6497	THBS1	SO:0001583	missense	0			-	HGNC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2003A>C	15.37:g.39882082A>C	ENSP00000260356:p.His668Pro	Somatic	0	80	0.00		0.521819055958222	123	38.50	77	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	65	29.35	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.H668P	ENST00000260356.5	37	c.2003	CCDS32194.1	15	.	.	.	.	.	.	.	.	.	.	A	17.23	3.337583	0.60963	.	.	ENSG00000137801	ENST00000260356	T	0.77489	-1.1	5.99	4.85	0.62838	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.37857	N	0.001907	T	0.68220	0.2977	L	0.35288	1.05	0.51767	D	0.999937	B;B	0.16166	0.016;0.001	B;B	0.23852	0.049;0.003	T	0.60495	-0.7252	10	0.22706	T	0.39	-35.3274	13.3861	0.60797	0.8685:0.1315:0.0:0.0	.	583;668	B4E3J7;P07996	.;TSP1_HUMAN	P	668	ENSP00000260356:H668P	ENSP00000260356:H668P	H	+	2	0	THBS1	37669374	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.171000	0.71926	1.058000	0.40530	0.533000	0.62120	CAC	-	smart_EG-like_dom,pfscan_EG-like_dom		0.602	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	protein_coding	OTTHUMT00000257831.2	A	NM_003246	-		39882082	+1	no_errors	ENST00000260356	ensembl	human	known	74_37	missense	SNP	1.000	C
MIR7162	102466227	genome.wustl.edu	37	15	62538270	62538270	+	RNA	SNP	T	T	C			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr15:62538270T>C	ENST00000570077.1	-	0	946				AC126323.1_ENST00000408214.1_RNA																							GCTTCTGCTCTAGCAGCCTCT	0.597																																																	0								ENSG00000166104																																			hsa-mir-7162			0			-	miRBase																													15.37:g.62538270T>C		Somatic	0	69	0.00		0.521819055958222	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	73	9.88		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000570077.1	37	NULL		15																																																																																			-	-		0.597	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	ENSG00000166104	pseudogene	OTTHUMT00000422143.1	T		-		62538270	-1	no_errors	ENST00000570077	ensembl	human	known	74_37	rna	SNP	0.000	C
PSMB9	5698	genome.wustl.edu	37	6	32823978	32823978	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:32823978G>T	ENST00000374859.2	+	2	193	c.124G>T	c.(124-126)Gca>Tca	p.A42S	PSMB9_ENST00000395330.1_Missense_Mutation_p.A19S|PSMB9_ENST00000453265.2_Missense_Mutation_p.A42S|TAP1_ENST00000354258.4_5'Flank	NM_002800.4	NP_002791.1	P28065	PSB9_HUMAN	proteasome (prosome, macropain) subunit, beta type, 9	42					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			large_intestine(4)|lung(4)|skin(1)	9					Carfilzomib(DB08889)	CCGAGTGTCTGCAGGGTGAGT	0.468																																																	0								ENSG00000240065						178.0	147.0	158.0					6																	32823978		1511	2709	4220	PSMB9	SO:0001583	missense	0			-	HGNC		CCDS4759.1	6p21.3	2013-03-27	2013-03-27		ENSG00000240065	ENSG00000240065		"""Proteasome (prosome, macropain) subunits"""	9546	protein-coding gene	gene with protein product		177045	"""proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2)"", ""large multifunctional peptidase 2"""	LMP2		1922385, 1529427	Standard	NM_002800		Approved	RING12, beta1i, PSMB6i	uc003sga.3	P28065	OTTHUMG00000031287	ENST00000374859.2:c.124G>T	6.37:g.32823978G>T	ENSP00000363993:p.Ala42Ser	Somatic	0	127	0.00		0.521819055958222	511	9.88	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	99	15.38	B0V0T1|Q16523|Q5JNW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.A42S	ENST00000374859.2	37	c.124	CCDS4759.1	6	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464677	0.43736	.	.	ENSG00000240065	ENST00000395330;ENST00000414474;ENST00000374859;ENST00000453265;ENST00000395333	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.4	5.4	0.78164	Proteasome, beta-type subunit, conserved site (1);	0.118882	0.56097	D	0.000034	T	0.31638	0.0803	L	0.28274	0.84	0.49213	D	0.999766	D;D	0.65815	0.995;0.987	D;D	0.69307	0.913;0.963	T	0.01791	-1.1273	10	0.32370	T	0.25	-28.1064	16.7172	0.85399	0.0:0.0:1.0:0.0	.	42;42	B4DZW2;P28065	.;PSB9_HUMAN	S	19;19;42;42;42	ENSP00000378739:A19S;ENSP00000394363:A19S;ENSP00000363993:A42S;ENSP00000394773:A42S	ENSP00000363993:A42S	A	+	1	0	PSMB9	32931956	0.983000	0.35010	1.000000	0.80357	0.130000	0.20726	2.661000	0.46758	2.808000	0.96608	0.551000	0.68910	GCA	-	pfam_Proteasome_sua/b,prints_Pept_T1A_subB		0.468	PSMB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB9	protein_coding	OTTHUMT00000076624.5	G	NM_002800	-		32823978	+1	no_errors	ENST00000374859	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM132B	114795	genome.wustl.edu	37	12	126139120	126139120	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:126139120C>A	ENST00000299308.3	+	9	3109	c.3101C>A	c.(3100-3102)cCa>cAa	p.P1034Q	TMEM132B_ENST00000535886.1_Missense_Mutation_p.P546Q	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	1034						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		ACCATCCTCCCAGAGGACGGC	0.473																																																	0								ENSG00000139364						65.0	63.0	64.0					12																	126139120		1877	4107	5984	TMEM132B	SO:0001583	missense	0			-	HGNC	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.3101C>A	12.37:g.126139120C>A	ENSP00000299308:p.Pro1034Gln	Somatic	0	49	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	51	19.05	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P1034Q	ENST00000299308.3	37	c.3101	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396708	0.83120	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.13089	3.38;2.62	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000003	T	0.38161	0.1030	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.03374	-1.1043	10	0.87932	D	0	.	20.0839	0.97794	0.0:1.0:0.0:0.0	.	1034	Q14DG7	T132B_HUMAN	Q	1034;546	ENSP00000299308:P1034Q;ENSP00000440436:P546Q	ENSP00000299308:P1034Q	P	+	2	0	TMEM132B	124705073	1.000000	0.71417	0.945000	0.38365	0.976000	0.68499	5.864000	0.69575	2.741000	0.93983	0.655000	0.94253	CCA	-	NULL		0.473	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	C	NM_052907	-		126139120	+1	no_errors	ENST00000299308	ensembl	human	known	74_37	missense	SNP	1.000	A
ASPDH	554235	genome.wustl.edu	37	19	51017820	51017820	+	5'Flank	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:51017820C>T	ENST00000389208.4	-	0	0				ASPDH_ENST00000376916.3_5'UTR|ASPDH_ENST00000597030.1_5'UTR	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing						NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CCGTCCCTCCCGTTCCCCAGC	0.632																																																	0								ENSG00000204653						220.0	175.0	189.0					19																	51017820		692	1591	2283	ASPDH	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91			19.37:g.51017820C>T	Exception_encountered	Somatic	0	20	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	Q6NZ37	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389208.4	37	NULL	CCDS46153.1	19																																																																																			-	-		0.632	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	protein_coding	OTTHUMT00000464861.1	C	NM_001024656	-		51017820	-1	no_errors	ENST00000597030	ensembl	human	known	74_37	rna	SNP	0.000	T
BRAP	8315	genome.wustl.edu	37	12	112110525	112110525	+	Silent	SNP	T	T	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:112110525T>A	ENST00000327551.6	-	5	737	c.597A>T	c.(595-597)atA>atT	p.I199I	BRAP_ENST00000539060.1_Intron|BRAP_ENST00000419234.4_Silent_p.I229I			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CGTCATCTTCTATTGAGTTGA	0.368																																					Pancreas(146;846 1904 7830 25130 26065)												0								ENSG00000089234						106.0	93.0	98.0					12																	112110525		2203	4300	6503	BRAP	SO:0001819	synonymous_variant	0			-	HGNC	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.597A>T	12.37:g.112110525T>A		Somatic	0	64	0.00		0.521819055958222	57	24.68	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	51	20.31	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.I229	ENST00000327551.6	37	c.687		12																																																																																			-	pfam_BRAP2		0.368	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	BRAP	protein_coding	OTTHUMT00000404994.2	T		-		112110525	-1	no_errors	ENST00000419234	ensembl	human	known	74_37	silent	SNP	0.993	A
SGCG	6445	genome.wustl.edu	37	13	23853610	23853610	+	Silent	SNP	A	A	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr13:23853610A>T	ENST00000218867.3	+	5	622	c.498A>T	c.(496-498)cgA>cgT	p.R166R	SGCG_ENST00000545013.1_Silent_p.R166R|SGCG_ENST00000537476.1_Silent_p.R166R	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	166					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		ATAAACTTCGAGTAACTGGTA	0.383																																																	0								ENSG00000102683						101.0	87.0	92.0					13																	23853610		2203	4300	6503	SGCG	SO:0001819	synonymous_variant	0			-	HGNC	U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.498A>T	13.37:g.23853610A>T		Somatic	0	62	0.00		0.521819055958222	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	50	15.25	Q32M32|Q5T9J6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sarcoglycan	p.R166	ENST00000218867.3	37	c.498	CCDS9299.1	13																																																																																			-	pfam_Sarcoglycan		0.383	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCG	protein_coding	OTTHUMT00000044151.1	A	NM_000231	-		23853610	+1	no_errors	ENST00000218867	ensembl	human	known	74_37	silent	SNP	0.998	T
CACNA1C	775	genome.wustl.edu	37	12	2602406	2602406	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:2602406G>A	ENST00000347598.4	+	7	967	c.967G>A	c.(967-969)Ggg>Agg	p.G323R	CACNA1C_ENST00000344100.3_Missense_Mutation_p.G323R|CACNA1C_ENST00000399597.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399621.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399601.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000480911.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399655.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399649.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399595.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000406454.3_Missense_Mutation_p.G323R|CACNA1C_ENST00000399617.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399606.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399603.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000402845.3_Missense_Mutation_p.G323R|CACNA1C_ENST00000399638.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399634.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399644.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000327702.7_Missense_Mutation_p.G323R|CACNA1C_ENST00000399591.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399629.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000399641.1_Missense_Mutation_p.G323R|CACNA1C_ENST00000335762.5_Missense_Mutation_p.G323R|CACNA1C_ENST00000399637.1_Missense_Mutation_p.G323R	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	323					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AACGGGCCACGGGCGGCAGTG	0.602																																																	0								ENSG00000151067						80.0	82.0	81.0					12																	2602406		2160	4279	6439	CACNA1C	SO:0001583	missense	0			-	HGNC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.967G>A	12.37:g.2602406G>A	ENSP00000266376:p.Gly323Arg	Somatic	0	55	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	63	14.86	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G323R	ENST00000347598.4	37	c.967	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216876	0.79352	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97480	-4.34;-4.34;-4.33;-4.34;-4.33;-4.33;-4.35;-4.26;-4.3;-4.36;-4.28;-4.27;-4.35;-4.39;-4.27;-4.19;-4.4;-4.35;-4.33;-4.4;-4.28;-4.38;-4.4	5.06	5.06	0.68205	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98438	0.9480	M	0.80746	2.51	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.921;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;B;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;0.996;1.0;0.999;1.0;1.0;1.0;1.0;0.999;0.399;1.0;0.998;0.999;1.0;1.0;0.999;0.999	D	0.99490	1.0950	10	0.87932	D	0	.	18.6169	0.91305	0.0:0.0:1.0:0.0	.	323;320;323;323;323;323;323;323;323;323;323;294;323;323;323;323;323;323;323;323;323;323;323;323	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	R	323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;323;164	ENSP00000336982:G323R;ENSP00000382563:G323R;ENSP00000437936:G323R;ENSP00000382552:G323R;ENSP00000382547:G323R;ENSP00000382506:G323R;ENSP00000382530:G323R;ENSP00000382546:G323R;ENSP00000382500:G323R;ENSP00000382549:G323R;ENSP00000266376:G323R;ENSP00000382515:G323R;ENSP00000382510:G323R;ENSP00000341092:G323R;ENSP00000382537:G323R;ENSP00000329877:G323R;ENSP00000382557:G323R;ENSP00000385724:G323R;ENSP00000382512:G323R;ENSP00000382542:G323R;ENSP00000382526:G323R;ENSP00000385896:G323R;ENSP00000382504:G323R	ENSP00000323129:G164R	G	+	1	0	CACNA1C	2472667	1.000000	0.71417	0.962000	0.40283	0.400000	0.30750	9.601000	0.98297	2.633000	0.89246	0.455000	0.32223	GGG	-	pfam_Ion_trans_dom		0.602	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317035.1	G	NM_000719	-		2602406	+1	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	SNP	1.000	A
ENKUR	219670	genome.wustl.edu	37	10	25284683	25284683	+	Silent	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:25284683G>T	ENST00000331161.4	-	3	558	c.339C>A	c.(337-339)atC>atA	p.I113I	ENKUR_ENST00000376363.1_Silent_p.I113I	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	113						motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						CTCCCATGATGATATCAGCTG	0.398																																																	0								ENSG00000151023						134.0	132.0	132.0					10																	25284683		2203	4300	6503	ENKUR	SO:0001819	synonymous_variant	0			-	HGNC	AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.339C>A	10.37:g.25284683G>T		Somatic	0	54	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K8Y0|D3DRV2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I113	ENST00000331161.4	37	c.339	CCDS7146.1	10																																																																																			-	NULL		0.398	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	protein_coding	OTTHUMT00000047239.2	G	NM_145010	-		25284683	-1	no_errors	ENST00000331161	ensembl	human	known	74_37	silent	SNP	1.000	T
MKI67	4288	genome.wustl.edu	37	10	129907069	129907069	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:129907069G>T	ENST00000368654.3	-	13	3410	c.3035C>A	c.(3034-3036)cCa>cAa	p.P1012Q	MKI67_ENST00000368653.3_Missense_Mutation_p.P652Q|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1012	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TATTGGTTCTGGTTGTAATGA	0.483																																																	0								ENSG00000148773						524.0	512.0	516.0					10																	129907069		2203	4300	6503	MKI67	SO:0001583	missense	0			-	HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3035C>A	10.37:g.129907069G>T	ENSP00000357643:p.Pro1012Gln	Somatic	0	30	0.00		0.521819055958222	64	18.99	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	Q5VWH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.P1012Q	ENST00000368654.3	37	c.3035	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	9.084	1.000101	0.19121	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03035	4.07;4.07	3.77	-0.48	0.12085	.	2.862750	0.01484	N	0.016790	T	0.08358	0.0208	L	0.58101	1.795	0.09310	N	1	P;D;P	0.53312	0.835;0.959;0.918	B;P;P	0.52267	0.368;0.66;0.694	T	0.35773	-0.9775	10	0.19147	T	0.46	.	4.8605	0.13581	0.2845:0.1551:0.5604:0.0	.	1011;652;1012	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Q	1012;652;1011	ENSP00000357643:P1012Q;ENSP00000357642:P652Q	ENSP00000357642:P652Q	P	-	2	0	MKI67	129797059	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.147000	0.16202	-0.192000	0.10432	-0.264000	0.10439	CCA	-	pfam_K167R		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417	-		129907069	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	SNP	0.000	T
LRRC16A	55604	genome.wustl.edu	37	6	25279425	25279447	+	5'Flank	DEL	CGGAGGCCGGCCTCGCACCGGTG	CGGAGGCCGGCCTCGCACCGGTG	-	rs559614087	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	CGGAGGCCGGCCTCGCACCGGTG	CGGAGGCCGGCCTCGCACCGGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:25279425_25279447delCGGAGGCCGGCCTCGCACCGGTG	ENST00000329474.6	+	0	0				LRRC16A_ENST00000377969.3_5'Flank	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						GCTCGGGCACCGGAGGCCGGCCTCGCACCGGTGCGGAGGCCGG	0.749														26	0.00519169	0.0182	0.0014	5008	,	,		14170	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000079691																																			LRRC16A	SO:0001631	upstream_gene_variant	0				HGNC	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393		6.37:g.25279425_25279447delCGGAGGCCGGCCTCGCACCGGTG	Exception_encountered	Somatic	NA	NA	NA		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329474.6	37	NULL	CCDS54973.1	6																																																																																			-	-		0.749	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	protein_coding	OTTHUMT00000040045.2	CGGAGGCCGGCCTCGCACCGGTG	NM_017640			25279447	+1	no_errors	ENST00000461945	ensembl	human	known	74_37	rna	DEL	0.002:0.067:0.543:0.412:0.391:0.373:0.090:0.001:0.000:0.000:0.001:0.001:0.000:0.001:0.002:0.001:0.001:0.000:0.000:0.000:0.001:0.000:0.021	-
NLRP2	55655	genome.wustl.edu	37	19	55494429	55494429	+	Missense_Mutation	SNP	G	G	A	rs200762489		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr19:55494429G>A	ENST00000543010.1	+	6	1506	c.1363G>A	c.(1363-1365)Gcg>Acg	p.A455T	NLRP2_ENST00000537859.1_Missense_Mutation_p.A433T|NLRP2_ENST00000448584.2_Missense_Mutation_p.A455T|NLRP2_ENST00000427260.2_Missense_Mutation_p.A432T|NLRP2_ENST00000339757.7_Missense_Mutation_p.A433T|NLRP2_ENST00000391721.4_Missense_Mutation_p.A431T|NLRP2_ENST00000263437.6_Missense_Mutation_p.A452T|NLRP2_ENST00000538819.1_Missense_Mutation_p.A431T	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	455	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CCTCCTGGCCGCGCAGGGCCT	0.697													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15207	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000022556	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4382		0,0,2191	21.0	21.0	21.0		1363,1297,1294,1363	-0.4	0.0	19		21	2,8554		0,2,4276	no	missense,missense,missense,missense	NLRP2	NM_001174081.1,NM_001174082.1,NM_001174083.1,NM_017852.3	58,58,58,58	0,2,6467	AA,AG,GG		0.0234,0.0,0.0155	probably-damaging,probably-damaging,probably-damaging,probably-damaging	455/1063,433/1041,432/1040,455/1063	55494429	2,12936	2191	4278	6469	NLRP2	SO:0001583	missense	0			-	HGNC	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1363G>A	19.37:g.55494429G>A	ENSP00000445135:p.Ala455Thr	Somatic	0	35	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A455T	ENST00000543010.1	37	c.1363	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797658	0.50208	0.0	2.34E-4	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.75821	-0.94;-0.86;-0.87;-0.94;-0.87;-0.97;-0.86;-0.94	1.9	-0.359	0.12571	.	0.555794	0.13592	N	0.376546	T	0.76997	0.4066	M	0.73319	2.225	0.09310	N	1	D;D;D;D;D	0.64830	0.973;0.994;0.99;0.994;0.99	P;P;P;P;P	0.57960	0.545;0.83;0.68;0.83;0.68	T	0.64360	-0.6426	10	0.41790	T	0.15	.	4.0455	0.09771	0.1477:0.0:0.6222:0.2301	.	432;433;452;431;455	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	T	455;431;433;455;433;432;431;452	ENSP00000445135:A455T;ENSP00000375601:A431T;ENSP00000344074:A433T;ENSP00000409370:A455T;ENSP00000440601:A433T;ENSP00000402474:A432T;ENSP00000441133:A431T;ENSP00000263437:A452T	ENSP00000263437:A452T	A	+	1	0	NLRP2	60186241	0.209000	0.23505	0.000000	0.03702	0.021000	0.10359	2.197000	0.42696	-0.005000	0.14395	0.556000	0.70494	GCG	-	NULL		0.697	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	protein_coding	OTTHUMT00000396152.1	G	NM_017852	rs200762489		55494429	+1	no_errors	ENST00000448584	ensembl	human	known	74_37	missense	SNP	0.000	A
MAP3K5	4217	genome.wustl.edu	37	6	136934374	136934374	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:136934374G>A	ENST00000359015.4	-	17	2659	c.2299C>T	c.(2299-2301)Cgt>Tgt	p.R767C	MAP3K5_ENST00000355845.4_Missense_Mutation_p.R14C	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	767	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CATTTGGAACGAAGGAGAGCA	0.318																																																	0								ENSG00000197442						89.0	84.0	86.0					6																	136934374		2203	4300	6503	MAP3K5	SO:0001583	missense	0			-	HGNC	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2299C>T	6.37:g.136934374G>A	ENSP00000351908:p.Arg767Cys	Somatic	0	99	0.00		0.521819055958222	22	8.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	100	9.91	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R767C	ENST00000359015.4	37	c.2299	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684138	0.68157	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	T;T	0.66815	-0.23;-0.23	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.101256	0.64402	D	0.000003	T	0.75236	0.3822	M	0.66297	2.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.76575	0.988;0.896	T	0.78011	-0.2371	10	0.87932	D	0	.	13.2619	0.60111	0.0:0.0:0.7227:0.2773	.	847;767	Q59GL6;Q99683	.;M3K5_HUMAN	C	767;14;847	ENSP00000351908:R767C;ENSP00000348104:R14C	ENSP00000348104:R14C	R	-	1	0	MAP3K5	136976067	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.620000	0.36976	2.667000	0.90743	0.655000	0.94253	CGT	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.318	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	protein_coding	OTTHUMT00000042383.1	G		-		136934374	-1	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	SNP	0.997	A
DFNA5	1687	genome.wustl.edu	37	7	24784186	24784186	+	Silent	SNP	G	G	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr7:24784186G>A	ENST00000342947.3	-	3	824	c.399C>T	c.(397-399)gcC>gcT	p.A133A	DFNA5_ENST00000419307.1_5'UTR|DFNA5_ENST00000409970.1_5'UTR|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000409775.3_Silent_p.A133A	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	133					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						CTTACCTCTCGGCAGAGTCTC	0.488																																					GBM(78;184 1250 20134 20900 23600)												0								ENSG00000105928						116.0	113.0	114.0					7																	24784186		2203	4300	6503	DFNA5	SO:0001819	synonymous_variant	0			-	HGNC	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.399C>T	7.37:g.24784186G>A		Somatic	0	58	0.00		0.521819055958222	96	43.27	74	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	46	41.03	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Gasdermin	p.A133	ENST00000342947.3	37	c.399	CCDS5389.1	7																																																																																			-	pfam_Gasdermin		0.488	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	protein_coding	OTTHUMT00000214060.2	G	NM_004403	-		24784186	-1	no_errors	ENST00000342947	ensembl	human	known	74_37	silent	SNP	0.000	A
MTUS2	23281	genome.wustl.edu	37	13	29599892	29599892	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr13:29599892C>T	ENST00000431530.3	+	1	1145	c.1087C>T	c.(1087-1089)Cac>Tac	p.H363Y		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	353						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TGGGGAAGCACACCCGGAAGC	0.567																																																	0								ENSG00000132938						50.0	54.0	53.0					13																	29599892		2076	4209	6285	MTUS2	SO:0001583	missense	0			-	HGNC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1087C>T	13.37:g.29599892C>T	ENSP00000392057:p.His363Tyr	Somatic	0	33	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H363Y	ENST00000431530.3	37	c.1087	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	c	0.223	-1.026984	0.02045	.	.	ENSG00000132938	ENST00000431530	T	0.11385	2.78	4.81	2.03	0.26663	.	2.113130	0.01909	N	0.039738	T	0.05044	0.0135	N	0.03115	-0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32745	-0.9895	9	.	.	.	.	3.5666	0.07903	0.1891:0.5113:0.0:0.2996	.	353	Q5JR59	MTUS2_HUMAN	Y	363	ENSP00000392057:H363Y	.	H	+	1	0	MTUS2	28497892	0.014000	0.17966	0.000000	0.03702	0.001000	0.01503	0.664000	0.25068	0.605000	0.29947	0.591000	0.81541	CAC	-	NULL		0.567	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	protein_coding	OTTHUMT00000044336.3	C	XM_166270	-		29599892	+1	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	SNP	0.000	T
RBFOX1	54715	genome.wustl.edu	37	16	7637263	7637263	+	Silent	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr16:7637263C>T	ENST00000550418.1	+	7	1417	c.429C>T	c.(427-429)atC>atT	p.I143I	RBFOX1_ENST00000311745.5_Silent_p.I163I|RBFOX1_ENST00000553186.1_Silent_p.I143I|RBFOX1_ENST00000552089.1_Intron|RBFOX1_ENST00000355637.4_Silent_p.I163I|RBFOX1_ENST00000436368.2_Silent_p.I163I|RBFOX1_ENST00000547338.1_Silent_p.I143I|RBFOX1_ENST00000422070.4_Silent_p.I186I|RBFOX1_ENST00000535565.2_Silent_p.I131I|RBFOX1_ENST00000340209.4_Silent_p.I148I|RBFOX1_ENST00000547372.1_Silent_p.I186I	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	143	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TTGGTAAAATCTTAGATGTTG	0.284																																					Ovarian(157;934 2567 15163 39509)												0								ENSG00000078328						62.0	67.0	65.0					16																	7637263		2197	4294	6491	RBFOX1	SO:0001819	synonymous_variant	0			-	HGNC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.429C>T	16.37:g.7637263C>T		Somatic	0	128	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	122	17.57	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.I186	ENST00000550418.1	37	c.558	CCDS55983.1	16																																																																																			-	pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom		0.284	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	protein_coding	OTTHUMT00000409492.2	C	NM_145891	-		7637263	+1	no_errors	ENST00000547372	ensembl	human	known	74_37	silent	SNP	1.000	T
SPTBN2	6712	genome.wustl.edu	37	11	66460047	66460047	+	Missense_Mutation	SNP	G	G	A	rs376579703		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:66460047G>A	ENST00000533211.1	-	26	5481	c.5150C>T	c.(5149-5151)gCg>gTg	p.A1717V	SPTBN2_ENST00000529997.1_Missense_Mutation_p.A1717V|SPTBN2_ENST00000309996.2_Missense_Mutation_p.A1717V			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1717					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GTGGGAGGCCGCCACCACCTC	0.672																																																	0								ENSG00000173898	G	VAL/ALA	1,4399	2.1+/-5.4	0,1,2199	62.0	57.0	59.0		5150	4.9	1.0	11		59	0,8590		0,0,4295	no	missense	SPTBN2	NM_006946.2	64	0,1,6494	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1717/2391	66460047	1,12989	2200	4295	6495	SPTBN2	SO:0001583	missense	0			-	HGNC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5150C>T	11.37:g.66460047G>A	ENSP00000432568:p.Ala1717Val	Somatic	0	24	0.00		0.521819055958222	1	88.89	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	12	61.76	O14872|O14873	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A1717V	ENST00000533211.1	37	c.5150	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.332684	0.95733	2.27E-4	0.0	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.48836	0.8;0.8;0.8	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63180	-0.6695	10	0.31617	T	0.26	.	17.0374	0.86480	0.0:0.0:1.0:0.0	.	1717	O15020	SPTN2_HUMAN	V	1717	ENSP00000432568:A1717V;ENSP00000311489:A1717V;ENSP00000433593:A1717V	ENSP00000311489:A1717V	A	-	2	0	SPTBN2	66216623	1.000000	0.71417	0.973000	0.42090	0.931000	0.56810	9.563000	0.98148	2.550000	0.86006	0.462000	0.41574	GCG	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.672	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	protein_coding	OTTHUMT00000393892.2	G	NM_006946	-		66460047	-1	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	SNP	1.000	A
ALPK1	80216	genome.wustl.edu	37	4	113303659	113303659	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr4:113303659A>G	ENST00000458497.1	+	4	506	c.227A>G	c.(226-228)gAc>gGc	p.D76G	ALPK1_ENST00000177648.9_Missense_Mutation_p.D76G|ALPK1_ENST00000504176.2_Intron	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	76							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGCCCAGAGGACAAAACAAAC	0.537																																																	0								ENSG00000073331						89.0	74.0	79.0					4																	113303659		2203	4300	6503	ALPK1	SO:0001583	missense	0			-	HGNC	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.227A>G	4.37:g.113303659A>G	ENSP00000398048:p.Asp76Gly	Somatic	0	109	0.00		0.521819055958222	12	14.29	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	108	12.20	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.D76G	ENST00000458497.1	37	c.227	CCDS3697.1	4	.	.	.	.	.	.	.	.	.	.	A	23.6	4.433128	0.83776	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610	T;T	0.27557	1.66;1.66	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.57110	0.2031	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	T	0.61768	-0.6995	10	0.87932	D	0	-27.5908	15.839	0.78831	1.0:0.0:0.0:0.0	.	51;76;76	E7EX13;Q96QP1;B3KUH8	.;ALPK1_HUMAN;.	G	76;76;51	ENSP00000398048:D76G;ENSP00000177648:D76G	ENSP00000177648:D76G	D	+	2	0	ALPK1	113523108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.406000	0.90216	2.130000	0.65690	0.533000	0.62120	GAC	-	NULL		0.537	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	protein_coding	OTTHUMT00000256421.2	A	NM_025144	-		113303659	+1	no_errors	ENST00000177648	ensembl	human	known	74_37	missense	SNP	1.000	G
EML4	27436	genome.wustl.edu	37	2	42522363	42522363	+	Silent	SNP	C	C	T	rs201724206		TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr2:42522363C>T	ENST00000318522.5	+	12	1579	c.1317C>T	c.(1315-1317)agC>agT	p.S439S	EML4_ENST00000402711.2_Silent_p.S381S|EML4_ENST00000401738.3_Silent_p.S450S	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	439					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						GGACCTGGAGCGGCAATTCAC	0.333			T	ALK	NSCLC								C|||	1	0.000199681	0.0008	0.0	5008	,	,		18251	0.0		0.0	False		,,,				2504	0.0							Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0								ENSG00000143924						101.0	103.0	103.0					2																	42522363		2203	4300	6503	EML4	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.1317C>T	2.37:g.42522363C>T		Somatic	0	95	0.00		0.521819055958222	47	41.98	34	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	45	32.35	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S439	ENST00000318522.5	37	c.1317	CCDS1807.1	2																																																																																			-	superfamily_Quinonprotein_ADH-like_supfam		0.333	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	protein_coding	OTTHUMT00000250463.3	C	NM_019063	rs201724206		42522363	+1	no_errors	ENST00000318522	ensembl	human	known	74_37	silent	SNP	1.000	T
LINC00303	284573	genome.wustl.edu	37	1	204002163	204002163	+	lincRNA	SNP	A	A	G			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:204002163A>G	ENST00000367207.3	-	0	1302							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		TCACCCTGATAGTCCCTCTGC	0.562																																																	0								ENSG00000176754																																			LINC00303			0			-	HGNC	AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204002163A>G		Somatic	0	50	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q3SY06|Q8N7U1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367207.3	37	NULL		1																																																																																			-	-		0.562	LINC00303-001	KNOWN	basic	lincRNA	LINC00303	lincRNA	OTTHUMT00000087885.3	A	NR_027902	-		204002163	-1	no_errors	ENST00000367207	ensembl	human	known	74_37	rna	SNP	0.000	G
AFAP1L2	84632	genome.wustl.edu	37	10	116093020	116093020	+	Silent	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr10:116093020C>T	ENST00000304129.4	-	3	209	c.180G>A	c.(178-180)gtG>gtA	p.V60V	AFAP1L2_ENST00000369271.3_Silent_p.V60V|AFAP1L2_ENST00000545353.1_Silent_p.V60V			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	60					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		TGTTGATGGTCACTTTGTTCA	0.502																																																	0								ENSG00000169129						301.0	230.0	254.0					10																	116093020		2203	4300	6503	AFAP1L2	SO:0001819	synonymous_variant	0			-	HGNC	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.180G>A	10.37:g.116093020C>T		Somatic	0	48	0.00		0.521819055958222	22	21.43	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V60	ENST00000304129.4	37	c.180	CCDS31286.1	10																																																																																			-	NULL		0.502	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	protein_coding	OTTHUMT00000050462.1	C	NM_032550	-		116093020	-1	no_errors	ENST00000545353	ensembl	human	known	74_37	silent	SNP	0.972	T
MUC5B	727897	genome.wustl.edu	37	11	1266479	1266479	+	Missense_Mutation	SNP	G	G	T	rs202133597	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr11:1266479G>T	ENST00000529681.1	+	31	8427	c.8369G>T	c.(8368-8370)gGg>gTg	p.G2790V	MUC5B_ENST00000447027.1_Missense_Mutation_p.G2793V|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2790	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCCACGGGGACTTCCCAC	0.667																																																	0								ENSG00000117983						19.0	24.0	22.0					11																	1266479		1776	3932	5708	MUC5B	SO:0001583	missense	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8369G>T	11.37:g.1266479G>T	ENSP00000436812:p.Gly2790Val	Somatic	0	33	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	51	13.56	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G2793V	ENST00000529681.1	37	c.8378	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	2.799	-0.249517	0.05867	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.24723	1.84;2.02	1.58	-1.18	0.09617	.	.	.	.	.	T	0.06050	0.0157	N	0.00436	-1.5	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31447	-0.9943	9	0.87932	D	0	.	3.1646	0.06531	0.0:0.421:0.2369:0.3421	.	3373;2793	A7Y9J9;E9PBJ0	.;.	V	2790;2793;2762;2750	ENSP00000436812:G2790V;ENSP00000415793:G2793V	ENSP00000343037:G2762V	G	+	2	0	MUC5B	1223055	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-4.009000	0.00314	-0.877000	0.04012	-1.241000	0.01538	GGG	-	NULL		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	G	XM_001126093	rs202133597		1266479	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	SNP	0.000	T
COL4A3BP	10087	genome.wustl.edu	37	5	74696029	74696029	+	Splice_Site	SNP	C	C	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr5:74696029C>A	ENST00000405807.4	-	10	1532		c.e10+1		COL4A3BP_ENST00000380494.5_Splice_Site|COL4A3BP_ENST00000261415.7_Splice_Site	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein						cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		CATTAGCTTACCTTTTGGACA	0.398																																																	0								ENSG00000113163						105.0	101.0	102.0					5																	74696029		2203	4300	6503	COL4A3BP	SO:0001630	splice_region_variant	0			-	HGNC	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.1110+1G>T	5.37:g.74696029C>A		Somatic	0	139	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	71	12.20	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e11+1	ENST00000405807.4	37	c.1494+1	CCDS4028.1	5	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733506	0.89482	.	.	ENSG00000113163	ENST00000405807;ENST00000380494;ENST00000261415	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.134	0.93418	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A3BP	74731785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.529000	0.73812	2.531000	0.85337	0.650000	0.86243	.	-	-		0.398	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3BP	protein_coding	OTTHUMT00000219875.2	C	NM_005713	-	Intron	74696029	-1	no_errors	ENST00000380494	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SAMD9	54809	genome.wustl.edu	37	7	92731597	92731598	+	Frame_Shift_Ins	INS	-	-	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr7:92731597_92731598insA	ENST00000379958.2	-	3	4082_4083	c.3813_3814insT	c.(3811-3816)tttgatfs	p.D1272fs		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1272						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AAGTATTCATCAAAAAAATCAA	0.312																																																	0								ENSG00000205413		,	4,4208		0,4,2102					,	2.7	1.0			47	2,8214		0,2,4106	no	frameshift,frameshift	SAMD9	NM_017654.3,NM_001193307.1	,	0,6,6208	A1A1,A1R,RR		0.0243,0.095,0.0483	,	,		6,12422				SAMD9	SO:0001589	frameshift_variant	0				HGNC	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3814dupT	7.37:g.92731604_92731604dupA	ENSP00000369292:p.Asp1272fs	Somatic	0	82	0.00		0.521819055958222	43	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	68	19.05	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.D1271fs	ENST00000379958.2	37	c.3814_3813	CCDS34680.1	7																																																																																			-	NULL		0.312	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	protein_coding	OTTHUMT00000341761.1	-	NM_017654			92731598	-1	no_errors	ENST00000379958	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
LY6G6C	80740	genome.wustl.edu	37	6	31686906	31686906	+	Silent	SNP	G	G	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:31686906G>T	ENST00000375819.2	-	3	510	c.345C>A	c.(343-345)tcC>tcA	p.S115S	LY6G6C_ENST00000495859.1_Silent_p.S59S	NM_025261.2	NP_079537.1	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex, locus G6C	115						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|large_intestine(1)|lung(1)|skin(1)	4						GGCCAGCCAAGGAGGTAAGGA	0.607																																																	0								ENSG00000204421						95.0	85.0	88.0					6																	31686906		2203	4300	6503	LY6G6C	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4714.1	6p21	2008-08-29	2002-07-29	2002-08-01	ENSG00000204421	ENSG00000204421			13936	protein-coding gene	gene with protein product		610435	"""chromosome 6 open reading frame 24"""	C6orf24		10384126, 12079290	Standard	NM_025261		Approved	G6c, NG24	uc003nwh.3	O95867	OTTHUMG00000031251	ENST00000375819.2:c.345C>A	6.37:g.31686906G>T		Somatic	0	33	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q5SRS8|Q8IY94	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S115	ENST00000375819.2	37	c.345	CCDS4714.1	6																																																																																			-	NULL		0.607	LY6G6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6C	protein_coding	OTTHUMT00000076530.2	G		-		31686906	-1	no_errors	ENST00000375819	ensembl	human	known	74_37	silent	SNP	0.931	T
C6orf132	647024	genome.wustl.edu	37	6	42074123	42074123	+	Silent	SNP	C	C	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr6:42074123C>A	ENST00000341865.4	-	4	1526	c.1527G>T	c.(1525-1527)ctG>ctT	p.L509L		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	509										breast(1)	1						CCTTCTCAGGCAGGCGGGGGC	0.617																																																	0								ENSG00000188112						7.0	9.0	8.0					6																	42074123		688	1585	2273	C6orf132	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.1527G>T	6.37:g.42074123C>A		Somatic	0	12	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	A6NI05	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L509	ENST00000341865.4	37	c.1527	CCDS47428.1	6																																																																																			-	NULL		0.617	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	protein_coding	OTTHUMT00000040548.2	C	NM_001164446	-		42074123	-1	no_errors	ENST00000341865	ensembl	human	putative	74_37	silent	SNP	0.000	A
FAM230A	653203	genome.wustl.edu	37	22	20710005	20710005	+	Silent	SNP	C	C	A			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr22:20710005C>A	ENST00000434783.3	+	8	1921	c.1737C>A	c.(1735-1737)ccC>ccA	p.P579P	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		GGAGGCCGCCCAGGCCATCGC	0.672																																																	0								ENSG00000188280																																			FAM230A	SO:0001819	synonymous_variant	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1737C>A	22.37:g.20710005C>A		Somatic	0	47	0.00		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	45	21.05		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.P579	ENST00000434783.3	37	c.1737		22																																																																																			-	superfamily_Kinase-like_dom		0.672	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	C		-		20710005	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	SNP	0.114	A
AC136188.1	0	genome.wustl.edu	37	12	74293700	74293709	+	RNA	DEL	ACACACACAC	ACACACACAC	-	rs146159159|rs61932867|rs375254855|rs61932865|rs61932866|rs199815745|rs61932868|rs142009105|rs71437008	byFrequency	TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	ACACACACAC	ACACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr12:74293700_74293709delACACACACAC	ENST00000606199.1	+	0	51_60																											atatacacatacacacacacacacacacac	0.295																																																	0								ENSG00000272231																																			AC136188.1			0				Clone_based_ensembl_gene																													12.37:g.74293710_74293719delACACACACAC		Somatic	NA	NA	NA		0.521819055958222	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606199.1	37	NULL		12																																																																																			-	-		0.295	AC136188.1-201	NOVEL	basic	miRNA	ENSG00000272231	miRNA		ACACACACAC				74293709	+1	no_errors	ENST00000606199	ensembl	human	novel	74_37	rna	DEL	0.011:0.011:0.017:0.021:0.026:0.029:0.033:0.036:0.039:0.041	-
PTPRF	5792	genome.wustl.edu	37	1	44054430	44054430	+	Silent	SNP	C	C	T			TCGA-X6-A8C3-01A-11D-A36J-09	TCGA-X6-A8C3-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0106ac31-330d-4d39-b9d4-3d3e84e20d39	f855dc78-d931-4312-8cb7-5f7187895b37	g.chr1:44054430C>T	ENST00000359947.4	+	8	1048	c.708C>T	c.(706-708)atC>atT	p.I236I	PTPRF_ENST00000438120.1_Silent_p.I236I|PTPRF_ENST00000372414.3_Silent_p.I236I|PTPRF_ENST00000372413.3_Silent_p.I236I|PTPRF_ENST00000422171.2_5'Flank	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	236	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTTTCTCCATCCCTCCCAGCA	0.667																																																	0								ENSG00000142949						56.0	49.0	51.0					1																	44054430		2203	4300	6503	PTPRF	SO:0001819	synonymous_variant	0			-	HGNC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.708C>T	1.37:g.44054430C>T		Somatic	0	21	0.00		0.521819055958222	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.I236	ENST00000359947.4	37	c.708	CCDS489.2	1																																																																																			-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.667	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	protein_coding	OTTHUMT00000019710.1	C		-		44054430	+1	no_errors	ENST00000359947	ensembl	human	known	74_37	silent	SNP	1.000	T
