#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TMEM204	79652	genome.wustl.edu	37	16	1604942	1604942	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr16:1604942delC	ENST00000566264.1	+	3	1299	c.596delC	c.(595-597)gccfs	p.A199fs	IFT140_ENST00000426508.2_Intron|IFT140_ENST00000439987.2_Intron|TMEM204_ENST00000253934.5_Frame_Shift_Del_p.A199fs	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	199					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				GACTGCATGGCCCCCCGGGTG	0.617																																																	0								ENSG00000131634						48.0	53.0	51.0					16																	1604942		2049	4170	6219	TMEM204	SO:0001589	frameshift_variant	0				HGNC		CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.596delC	16.37:g.1604942delC	ENSP00000454945:p.Ala199fs	Somatic	0	48	0.00		0.6352087463037039	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	D3DU76|Q3KRC1|Q9H7G5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.R201fs	ENST00000566264.1	37	c.596	CCDS42098.1	16																																																																																			-	NULL		0.617	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM204	protein_coding	OTTHUMT00000432610.1	C	NM_024600			1604942	+1	no_errors	ENST00000253934	ensembl	human	known	74_37	frame_shift_del	DEL	0.995	-
UROC1	131669	genome.wustl.edu	37	3	126216947	126216947	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr3:126216947G>A	ENST00000290868.2	-	14	1438	c.1385C>T	c.(1384-1386)gCg>gTg	p.A462V	UROC1_ENST00000383579.3_Missense_Mutation_p.A522V	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	462					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GTCTGTGACCGCCAGGTCCTG	0.632																																																	0								ENSG00000159650						126.0	136.0	133.0					3																	126216947		2203	4300	6503	UROC1	SO:0001583	missense	0			-	HGNC	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1385C>T	3.37:g.126216947G>A	ENSP00000290868:p.Ala462Val	Somatic	0	122	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	59	11.76	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	p.A462V	ENST00000290868.2	37	c.1385	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	G	3.698	-0.062098	0.07317	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.44881	0.91;0.91	4.4	1.09	0.20402	Urocanase domain (2);	0.175056	0.49916	D	0.000139	T	0.23688	0.0573	L	0.31926	0.97	0.44469	D	0.9974	B;B	0.15473	0.013;0.003	B;B	0.16289	0.015;0.008	T	0.04481	-1.0948	10	0.15499	T	0.54	-2.6188	4.5283	0.11992	0.2222:0.0:0.5978:0.1801	.	522;462	E9PE13;Q96N76	.;HUTU_HUMAN	V	462;522	ENSP00000290868:A462V;ENSP00000373073:A522V	ENSP00000290868:A462V	A	-	2	0	UROC1	127699637	0.999000	0.42202	0.831000	0.32960	0.010000	0.07245	2.381000	0.44336	0.868000	0.35678	-0.332000	0.08345	GCG	-	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase		0.632	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	protein_coding	OTTHUMT00000370325.2	G	NM_144639	-		126216947	-1	no_errors	ENST00000290868	ensembl	human	known	74_37	missense	SNP	0.763	A
ADAMTS18	170692	genome.wustl.edu	37	16	77398240	77398240	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr16:77398240A>G	ENST00000282849.5	-	5	1235	c.817T>C	c.(817-819)Ttt>Ctt	p.F273L		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	273					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TATTCATCAAACCTTAGATAG	0.468																																																	0								ENSG00000140873						68.0	65.0	66.0					16																	77398240		2198	4300	6498	ADAMTS18	SO:0001583	missense	0			-	HGNC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.817T>C	16.37:g.77398240A>G	ENSP00000282849:p.Phe273Leu	Somatic	0	46	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F273L	ENST00000282849.5	37	c.817	CCDS10926.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.08|10.08	1.252381|1.252381	0.22880|0.22880	.|.	.|.	ENSG00000140873|ENSG00000140873	ENST00000282849|ENST00000449265	T|T	0.58797|0.11821	0.31|2.74	5.17|5.17	1.62|1.62	0.23740|0.23740	.|.	0.382521|.	0.27981|.	N|.	0.017064|.	T|T	0.15869|0.15869	0.0382|0.0382	L|L	0.47716|0.47716	1.5|1.5	0.23751|0.23751	N|N	0.996948|0.996948	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.20107|0.20107	-1.0285|-1.0285	10|7	0.25751|0.87932	T|D	0.34|0	.|.	6.0724|6.0724	0.19897|0.19897	0.6235:0.2139:0.1625:0.0|0.6235:0.2139:0.1625:0.0	.|.	273|.	Q8TE60|.	ATS18_HUMAN|.	L|A	273|274	ENSP00000282849:F273L|ENSP00000392540:V274A	ENSP00000282849:F273L|ENSP00000392540:V274A	F|V	-|-	1|2	0|0	ADAMTS18|ADAMTS18	75955741|75955741	0.889000|0.889000	0.30405|0.30405	0.871000|0.871000	0.34182|0.34182	0.995000|0.995000	0.86356|0.86356	1.998000|1.998000	0.40796|0.40796	0.450000|0.450000	0.26774|0.26774	0.482000|0.482000	0.46254|0.46254	TTT|GTT	-	NULL		0.468	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	A		-		77398240	-1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	SNP	0.523	G
CWC27	10283	genome.wustl.edu	37	5	64314187	64314187	+	3'UTR	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:64314187C>T	ENST00000381070.3	+	0	1675				RP11-307L14.1_ENST00000607786.1_lincRNA|RP11-307L14.2_ENST00000606057.1_lincRNA|CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)						mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						TGGAAATGTGCCTACAATGGC	0.358																																																	0								ENSG00000153015						21.0	24.0	23.0					5																	64314187		2176	4292	6468	CWC27	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.*39C>T	5.37:g.64314187C>T		Somatic	0	46	0.00		0.6352087463037039	162	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	O60529|O60530|Q96EM3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381070.3	37	NULL	CCDS3982.2	5																																																																																			-	-		0.358	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC27	protein_coding	OTTHUMT00000157247.4	C	NM_005869	-		64314187	+1	no_errors	ENST00000545000	ensembl	human	known	74_37	rna	SNP	0.079	T
CDC27	996	genome.wustl.edu	37	17	45234327	45234327	+	Missense_Mutation	SNP	C	C	T	rs7350889		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:45234327C>T	ENST00000066544.3	-	7	887	c.794G>A	c.(793-795)gGt>gAt	p.G265D	CDC27_ENST00000531206.1_Missense_Mutation_p.G265D|CDC27_ENST00000527547.1_Missense_Mutation_p.G265D|CDC27_ENST00000446365.2_Missense_Mutation_p.G204D|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	265					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.G265D(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAACTTCGACCAGTTTTTGG	0.368																																																	2	Substitution - Missense(2)	skin(2)						ENSG00000004897						60.0	65.0	63.0					17																	45234327		2201	4295	6496	CDC27	SO:0001583	missense	0			-	HGNC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.794G>A	17.37:g.45234327C>T	ENSP00000066544:p.Gly265Asp	Somatic	0	88	0.00		0.6352087463037039	40	2.44	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	62	11.43	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G265D	ENST00000066544.3	37	c.794	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725453	0.48833	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.3;-0.11;-0.31;0.86	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.32350	0.251;0.366;0.247;0.251	B;B;B;B	0.27076	0.045;0.056;0.076;0.055	T	0.51694	-0.8673	10	0.33141	T	0.24	1.6987	17.2083	0.86924	0.0:1.0:0.0:0.0	rs7350889;rs7350889	204;265;265;265	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	265;265;204;265;265	ENSP00000066544:G265D;ENSP00000434614:G265D;ENSP00000392802:G204D;ENSP00000437339:G265D;ENSP00000432105:G265D	ENSP00000066544:G265D	G	-	2	0	CDC27	42589326	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.618000	0.67722	2.665000	0.90641	0.460000	0.39030	GGT	-	NULL		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	protein_coding	OTTHUMT00000389742.2	C		rs7350889		45234327	-1	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	SNP	1.000	T
THSD7B	80731	genome.wustl.edu	37	2	137917905	137917905	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:137917905C>A	ENST00000409968.1	+	6	1670	c.1492C>A	c.(1492-1494)Cat>Aat	p.H498N	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.H498N|THSD7B_ENST00000485379.1_3'UTR|THSD7B_ENST00000413152.2_Missense_Mutation_p.H467N			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	498	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTGTGCATCCATGAAAACTG	0.498																																																	0								ENSG00000144229						119.0	120.0	119.0					2																	137917905		2042	4203	6245	THSD7B	SO:0001583	missense	0			-	HGNC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1492C>A	2.37:g.137917905C>A	ENSP00000387145:p.His498Asn	Somatic	0	62	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	5	76.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.H498N	ENST00000409968.1	37	c.1492		2	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247246	0.22880	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.21734	2.52;2.38;1.99	5.96	4.17	0.49024	.	0.306413	0.39210	N	0.001428	T	0.27313	0.0670	M	0.64997	1.995	0.19300	N	0.999977	B;B	0.34329	0.449;0.449	B;B	0.42771	0.397;0.397	T	0.11842	-1.0571	10	0.25751	T	0.34	.	10.2388	0.43299	0.0:0.7868:0.0:0.2132	.	498;467	Q9C0I4;C9JKN6	THS7B_HUMAN;.	N	498;498;467	ENSP00000387145:H498N;ENSP00000272643:H498N;ENSP00000413841:H467N	ENSP00000272643:H498N	H	+	1	0	THSD7B	137634375	0.839000	0.29477	0.640000	0.29408	0.576000	0.36127	1.431000	0.34925	0.849000	0.35215	0.650000	0.86243	CAT	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.498	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9	-		137917905	+1	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	SNP	0.121	A
RGS11	8786	genome.wustl.edu	37	16	320782	320782	+	Missense_Mutation	SNP	G	G	T	rs370263768		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr16:320782G>T	ENST00000397770.3	-	14	1045	c.1028C>A	c.(1027-1029)gCg>gAg	p.A343E	RGS11_ENST00000359740.5_Missense_Mutation_p.A332E|ARHGDIG_ENST00000464609.1_Intron|RGS11_ENST00000316163.5_Missense_Mutation_p.A322E			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	343	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				CTGGGCCTGCGCTCCATATCG	0.652																																																	0								ENSG00000076344						28.0	24.0	25.0					16																	320782		2202	4298	6500	RGS11	SO:0001583	missense	0			-	HGNC	AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.1028C>A	16.37:g.320782G>T	ENSP00000380876:p.Ala343Glu	Somatic	0	26	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	O75883|Q4TT71|Q4TT72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.A343E	ENST00000397770.3	37	c.1028	CCDS42088.1	16	.	.	.	.	.	.	.	.	.	.	G	0.657	-0.807179	0.02819	.	.	ENSG00000076344	ENST00000397770;ENST00000316163;ENST00000359740	T;T;T	0.27256	1.68;1.68;1.68	5.0	-0.0363	0.13888	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.438821	0.25109	N	0.033071	T	0.05410	0.0143	N	0.00788	-1.185	0.38546	D	0.949345	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.10450	0.004;0.005;0.005	T	0.26677	-1.0096	10	0.10111	T	0.7	-9.2558	4.0161	0.09644	0.0:0.2344:0.4167:0.3489	.	332;343;343	O94810-2;Q4TT70;O94810	.;.;RGS11_HUMAN	E	343;322;332	ENSP00000380876:A343E;ENSP00000319069:A322E;ENSP00000352778:A332E	ENSP00000319069:A322E	A	-	2	0	RGS11	260783	0.386000	0.25180	0.008000	0.14137	0.051000	0.14879	1.081000	0.30791	0.127000	0.18452	-0.502000	0.04539	GCG	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam		0.652	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS11	protein_coding	OTTHUMT00000139325.2	G		-		320782	-1	no_errors	ENST00000397770	ensembl	human	known	74_37	missense	SNP	0.415	T
KRTAP2-2	728279	genome.wustl.edu	37	17	39211139	39211140	+	In_Frame_Ins	INS	-	-	GCAGGGGGGCCGGCA	rs9674636		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:39211139_39211140insGCAGGGGGGCCGGCA	ENST00000398477.1	-	1	342_343	c.324_325insTGCCGGCCCCCCTGC	c.(322-327)tgcggc>tgcTGCCGGCCCCCCTGCggc	p.107_108insCCRPP	KRTAP2-2_ENST00000542910.1_In_Frame_Ins_p.107_108insCCRPP	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	107	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GTCGGCTGGCCGCAGGGGGACT	0.703																																																	0								ENSG00000214518			369,641		167,35,303						3.3	1.0			2	525,2849		188,149,1350	no	coding	KRTAP2-2	NM_033032.2		355,184,1653	A1A1,A1R,RR		15.5602,36.5347,20.3923				894,3490				KRTAP2-2	SO:0001652	inframe_insertion	0				HGNC	AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.324_325insTGCCGGCCCCCCTGC	17.37:g.39211139_39211140insGCAGGGGGGCCGGCA	ENSP00000381494:p.Pro107_Cys108insCysCysArgProPro	Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MTN3|A8MXM4	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Keratin-assoc	p.108in_frame_insCRPPC	ENST00000398477.1	37	c.325_324	CCDS54122.1	17																																																																																			-	NULL		0.703	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	protein_coding	OTTHUMT00000257697.1	-				39211140	-1	no_errors	ENST00000542910	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	GCAGGGGGGCCGGCA
MUC17	140453	genome.wustl.edu	37	7	100683989	100683989	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr7:100683989T>G	ENST00000306151.4	+	3	9356	c.9292T>G	c.(9292-9294)Tca>Gca	p.S3098A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3098	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CATGCCAATCTCAACTTATAG	0.488																																																	0								ENSG00000169876						262.0	266.0	265.0					7																	100683989		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9292T>G	7.37:g.100683989T>G	ENSP00000302716:p.Ser3098Ala	Somatic	0	148	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	64	12.33	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3098A	ENST00000306151.4	37	c.9292	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	t	6.842	0.524518	0.13066	.	.	ENSG00000169876	ENST00000306151	T	0.02067	4.47	1.15	-0.265	0.12946	.	.	.	.	.	T	0.02304	0.0071	N	0.14661	0.345	0.09310	N	1	P	0.38711	0.643	P	0.51170	0.661	T	0.48043	-0.9069	9	0.13470	T	0.59	.	4.2476	0.10679	0.0:0.4653:0.0:0.5347	.	3098	Q685J3	MUC17_HUMAN	A	3098	ENSP00000302716:S3098A	ENSP00000302716:S3098A	S	+	1	0	MUC17	100470709	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.765000	0.04730	-0.050000	0.13356	0.102000	0.15555	TCA	-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	T	NM_001040105	-		100683989	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.001	G
SLC5A7	60482	genome.wustl.edu	37	2	108604789	108604789	+	Splice_Site	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:108604789G>T	ENST00000264047.2	+	2	454	c.178G>T	c.(178-180)Gct>Tct	p.A60S	SLC5A7_ENST00000540517.1_Intron|SLC5A7_ENST00000409059.1_Splice_Site_p.A60S	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	60					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TACCATGACAGGTACGTTCAG	0.522																																																	0								ENSG00000115665						122.0	108.0	113.0					2																	108604789		2203	4300	6503	SLC5A7	SO:0001630	splice_region_variant	0			-	HGNC	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.178+1G>T	2.37:g.108604789G>T		Somatic	0	35	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	Q53TF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter	p.A60S	ENST00000264047.2	37	c.178	CCDS2074.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.252514	0.95336	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	D;D	0.90385	-2.66;-2.66	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.96040	0.8710	M	0.84585	2.705	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.95865	0.8886	10	0.87932	D	0	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	60	Q9GZV3	SC5A7_HUMAN	S	60	ENSP00000387346:A60S;ENSP00000264047:A60S	ENSP00000264047:A60S	A	+	1	0	SLC5A7	107971221	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	9.420000	0.97426	2.882000	0.98803	0.655000	0.94253	GCT	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter		0.522	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A7	protein_coding	OTTHUMT00000253562.1	G		-	Missense_Mutation	108604789	+1	no_errors	ENST00000264047	ensembl	human	known	74_37	missense	SNP	1.000	T
GALC	2581	genome.wustl.edu	37	14	88454869	88454870	+	Splice_Site	INS	-	-	A	rs561184126	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr14:88454869_88454870insA	ENST00000261304.2	-	2	302		c.e2-2		GALC_ENST00000544807.2_Splice_Site|GALC_ENST00000554916.1_Splice_Site|GALC_ENST00000393569.2_Splice_Site|GALC_ENST00000393568.4_Intron	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase						carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAGGTTGCCTAAAAAAAAAAG	0.351																																																	0								ENSG00000054983																																			GALC	SO:0001630	splice_region_variant	0				HGNC	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.196-2->T	14.37:g.88454879_88454879dupA		Somatic	0	24	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e2-2	ENST00000261304.2	37	c.196-3_196-2	CCDS9878.2	14																																																																																			-	-		0.351	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	protein_coding	OTTHUMT00000071559.2	-			Intron	88454870	-1	no_errors	ENST00000261304	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.945	A
NUP54	53371	genome.wustl.edu	37	4	77065614	77065614	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr4:77065614C>A	ENST00000264883.3	-	2	220	c.80G>T	c.(79-81)gGa>gTa	p.G27V	NUP54_ENST00000342467.6_5'UTR|NUP54_ENST00000458189.2_5'UTR|NUP54_ENST00000514987.1_Missense_Mutation_p.G27V|NUP54_ENST00000515460.1_5'UTR	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	27	9 X 2 AA repeats of F-G.|Gly-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						TGTCCCAAATCCTCCAAACCC	0.343																																																	0								ENSG00000138750						80.0	77.0	78.0					4																	77065614		2203	4300	6503	NUP54	SO:0001583	missense	0			-	HGNC	AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.80G>T	4.37:g.77065614C>A	ENSP00000264883:p.Gly27Val	Somatic	0	101	0.00		0.6352087463037039	0	98.00	49	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	5	91.53	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G27V	ENST00000264883.3	37	c.80	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755278	0.69648	.	.	ENSG00000138750	ENST00000264883;ENST00000514987;ENST00000514901	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.83839	0.5341	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.83667	0.0164	9	0.51188	T	0.08	-21.5053	18.8088	0.92050	0.0:1.0:0.0:0.0	.	27;27	B4DT35;Q7Z3B4	.;NUP54_HUMAN	V	27;27;81	.	ENSP00000264883:G27V	G	-	2	0	NUP54	77284638	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.528000	0.73807	2.871000	0.98454	0.655000	0.94253	GGA	-	NULL		0.343	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	protein_coding	OTTHUMT00000252402.3	C		-		77065614	-1	no_errors	ENST00000264883	ensembl	human	known	74_37	missense	SNP	1.000	A
CLLU1	574028	genome.wustl.edu	37	12	92819404	92819404	+	3'UTR	DEL	T	T	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:92819404delT	ENST00000378485.1	+	0	1670				CLLU1_ENST00000472839.2_3'UTR|CLLU1OS_ENST00000378487.2_Intron|RP11-693J15.4_ENST00000508671.1_RNA|CLLU1OS_ENST00000538965.1_Intron	NM_001025233.1	NP_001020404.1	Q5K131	CLLU1_HUMAN	chronic lymphocytic leukemia up-regulated 1							cytoplasm (GO:0005737)				NS(1)|breast(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						ATAAATATTCTTTTTTTTTTT	0.338																																																	0								ENSG00000257127																																			CLLU1	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ845162		12q22	2012-04-19			ENSG00000257127	ENSG00000257127			29841	protein-coding gene	gene with protein product						19726446	Standard	NR_027932		Approved		uc001tcg.1	Q5K131	OTTHUMG00000170103	ENST00000378485.1:c.*582T>-	12.37:g.92819404delT		Somatic	0	19	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378485.1	37	NULL		12																																																																																			-	-		0.338	CLLU1-003	KNOWN	NMD_exception|basic|appris_principal	protein_coding	CLLU1	protein_coding	OTTHUMT00000366643.1	T	NM_001025233			92819404	+1	no_errors	ENST00000472839	ensembl	human	known	74_37	rna	DEL	0.009	-
HTR3C	170572	genome.wustl.edu	37	3	183770933	183770933	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr3:183770933delA	ENST00000318351.1	+	1	99	c.65delA	c.(64-66)caafs	p.Q22fs		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	22					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	CTTCTGCTTCAAGGTAAGATG	0.527																																																	0								ENSG00000178084						110.0	92.0	98.0					3																	183770933		2203	4300	6503	HTR3C	SO:0001589	frameshift_variant	0				HGNC	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.65delA	3.37:g.183770933delA	ENSP00000322617:p.Gln22fs	Somatic	0	49	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	A2RRR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.G23fs	ENST00000318351.1	37	c.65	CCDS3250.1	3																																																																																			-	NULL		0.527	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3C	protein_coding	OTTHUMT00000346296.1	A	NM_130770			183770933	+1	no_errors	ENST00000318351	ensembl	human	known	74_37	frame_shift_del	DEL	0.997	-
BAGE2	85319	genome.wustl.edu	37	21	11047523	11047523	+	RNA	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr21:11047523T>C	ENST00000470054.1	-	0	731							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCATAATTCGTTGAAGACAAA	0.353																																																	0								ENSG00000187172																																			BAGE2			0			-	HGNC	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11047523T>C		Somatic	0	465	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	125	16.67	A8K925|Q08ER0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000470054.1	37	NULL		21																																																																																			-	-		0.353	BAGE2-001	KNOWN	basic	processed_transcript	BAGE2	pseudogene	OTTHUMT00000157417.3	T	NM_182482	-		11047523	-1	no_errors	ENST00000470054	ensembl	human	known	74_37	rna	SNP	1.000	C
C15orf27	123591	genome.wustl.edu	37	15	76467986	76467986	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr15:76467986A>T	ENST00000388942.3	+	8	1015	c.739A>T	c.(739-741)Agg>Tgg	p.R247W	RP11-593F23.1_ENST00000558424.1_RNA	NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	247					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						GCAGCTGGAGAGGCTGACGCA	0.562																																																	0								ENSG00000169758						120.0	99.0	106.0					15																	76467986		2197	4294	6491	C15orf27	SO:0001583	missense	0			-	HGNC	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.739A>T	15.37:g.76467986A>T	ENSP00000373594:p.Arg247Trp	Somatic	0	88	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	121	15.38	Q8N993|Q96LL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R247W	ENST00000388942.3	37	c.739	CCDS10289.2	15	.	.	.	.	.	.	.	.	.	.	A	20.3	3.974887	0.74360	.	.	ENSG00000169758	ENST00000388942	T	0.36699	1.24	5.22	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.58566	0.2131	M	0.77103	2.36	0.50467	D	0.999873	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60875	-0.7176	10	0.87932	D	0	-16.8774	10.4777	0.44674	0.6862:0.3138:0.0:0.0	.	211;247	Q2M3C6-2;Q2M3C6	.;CO027_HUMAN	W	247	ENSP00000373594:R247W	ENSP00000373594:R247W	R	+	1	2	C15orf27	74255041	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	2.620000	0.46410	0.789000	0.33779	0.459000	0.35465	AGG	-	NULL		0.562	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C15orf27	protein_coding	OTTHUMT00000286637.2	A	NM_152335	-		76467986	+1	no_errors	ENST00000388942	ensembl	human	known	74_37	missense	SNP	0.980	T
USP6	9098	genome.wustl.edu	37	17	5071226	5071226	+	Splice_Site	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:5071226G>A	ENST00000574788.1	+	34	5266		c.e34-1		USP6_ENST00000332776.4_Splice_Site|USP6_ENST00000304328.5_Splice_Site|USP6_ENST00000250066.6_Splice_Site			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6						cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCTACCTACAGGTTGTAGATA	0.527			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0								ENSG00000129204						54.0	52.0	52.0					17																	5071226		2203	4300	6503	USP6	SO:0001630	splice_region_variant	0			-	HGNC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3037-1G>A	17.37:g.5071226G>A		Somatic	0	151	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	72	82	46.75	Q15634|Q86WP6|Q8IWT4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e25-1	ENST00000574788.1	37	c.3037-1	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	8.437	0.849981	0.17034	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	.	.	.	2.35	2.35	0.29111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4068	0.44266	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP6	5011950	1.000000	0.71417	0.894000	0.35097	0.089000	0.18198	9.035000	0.93752	1.313000	0.45069	0.184000	0.17185	.	-	-		0.527	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	G	NM_004505	-	Intron	5071226	+1	no_errors	ENST00000250066	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PHF20L1	51105	genome.wustl.edu	37	8	133816235	133816235	+	Missense_Mutation	SNP	G	G	A	rs201918932		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr8:133816235G>A	ENST00000395386.2	+	7	978	c.679G>A	c.(679-681)Gta>Ata	p.V227I	PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000337920.4_Missense_Mutation_p.V201I|PHF20L1_ENST00000395379.1_Missense_Mutation_p.V227I|PHF20L1_ENST00000395390.2_Missense_Mutation_p.V201I|PHF20L1_ENST00000395376.1_Missense_Mutation_p.V231I	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	227							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CACACCAGACGTAGAGAAGAA	0.368																																																	0								ENSG00000129292	G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	98.0	84.0	89.0		601,679,679	0.3	0.2	8		89	2,8596	2.2+/-6.3	0,2,4297	yes	missense,missense,missense	PHF20L1	NM_198513.1,NM_032205.3,NM_016018.4	29,29,29	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign	201/286,227/574,227/1018	133816235	2,13002	2203	4299	6502	PHF20L1	SO:0001583	missense	0			-	HGNC	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.679G>A	8.37:g.133816235G>A	ENSP00000378784:p.Val227Ile	Somatic	0	75	0.00		0.6352087463037039	34	35.85	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3776,smart_Tudor,smart_Tudor-like_plant	p.V201I	ENST00000395386.2	37	c.601	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	3.788	-0.044181	0.07452	0.0	2.33E-4	ENSG00000129292	ENST00000395383;ENST00000395379;ENST00000361997;ENST00000395386;ENST00000315808;ENST00000337920;ENST00000395376;ENST00000395382;ENST00000395390;ENST00000395374	T;T;T;T;T;T;T;T	0.45276	0.96;0.9;0.97;1.49;0.9;0.96;0.94;1.53	5.29	0.265	0.15612	.	0.783877	0.12375	N	0.474424	T	0.15782	0.0380	N	0.04508	-0.205	0.09310	N	0.999997	B;B;B;B;B	0.11235	0.001;0.004;0.004;0.003;0.0	B;B;B;B;B	0.09377	0.001;0.004;0.002;0.002;0.001	T	0.29088	-1.0023	10	0.10902	T	0.67	-1.6761	4.9743	0.14133	0.3788:0.0:0.4908:0.1304	.	201;66;227;227;201	F8W9L8;G5E9D0;A8MW92;A8MW92-4;A8MW92-2	.;.;P20L1_HUMAN;.;.	I	231;227;201;227;227;201;231;97;201;66	ENSP00000378781:V231I;ENSP00000378777:V227I;ENSP00000355301:V201I;ENSP00000378784:V227I;ENSP00000324519:V227I;ENSP00000338269:V201I;ENSP00000378775:V231I;ENSP00000378788:V201I	ENSP00000324519:V227I	V	+	1	0	PHF20L1	133885417	0.195000	0.23338	0.155000	0.22561	0.779000	0.44077	0.194000	0.17135	-0.011000	0.14247	-0.225000	0.12378	GTA	-	pfam_DUF3776		0.368	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	protein_coding	OTTHUMT00000308949.3	G	NM_016018	rs201918932		133816235	+1	no_errors	ENST00000486199	ensembl	human	known	74_37	missense	SNP	0.061	A
RPTN	126638	genome.wustl.edu	37	1	152127868	152127868	+	Silent	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:152127868A>G	ENST00000316073.3	-	3	1771	c.1707T>C	c.(1705-1707)taT>taC	p.Y569Y		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	569	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GACCATAATGATAGCTCTGGC	0.488																																																	0								ENSG00000215853						574.0	513.0	531.0					1																	152127868		1568	3582	5150	RPTN	SO:0001819	synonymous_variant	0			-	HGNC	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1707T>C	1.37:g.152127868A>G		Somatic	1	227	0.44		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	218	10.66	B7ZBZ3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Y569	ENST00000316073.3	37	c.1707	CCDS41397.1	1																																																																																			-	NULL		0.488	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	protein_coding	OTTHUMT00000333867.1	A	XM_371312	-		152127868	-1	no_errors	ENST00000316073	ensembl	human	known	74_37	silent	SNP	0.000	G
ZNF578	147660	genome.wustl.edu	37	19	52961721	52961722	+	Intron	INS	-	-	TATATATATATA	rs139009068|rs1991476	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:52961721_52961722insTATATATATATA	ENST00000421239.2	+	2	123				ZNF578_ENST00000596382.1_3'UTR	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GCTACTATGTTTATATATATAT	0.327														2936	0.586262	0.6241	0.6354	5008	,	,		6779	0.3194		0.8151	False		,,,				2504	0.5399																0								ENSG00000258405																																			ZNF578	SO:0001627	intron_variant	0				HGNC	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.-122+1510->TATATATATATA	19.37:g.52961721_52961722insTATATATATATA		Somatic	NA	NA	NA		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DR51|I3L1Y6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000421239.2	37	NULL	CCDS54310.1	19																																																																																			-	-		0.327	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	protein_coding	OTTHUMT00000344298.3	-	NM_152472			52961722	+1	no_errors	ENST00000594118	ensembl	human	known	74_37	rna	INS	0.001:0.023	TATATATATATA
PGLYRP2	114770	genome.wustl.edu	37	19	15579541	15579541	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:15579541C>G	ENST00000340880.4	-	5	2144	c.1664G>C	c.(1663-1665)aGg>aCg	p.R555T	PGLYRP2_ENST00000292609.4_3'UTR	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	555					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						AGAGACACTCCTGGCAGGTCT	0.552																																																	0								ENSG00000161031						99.0	105.0	103.0					19																	15579541		1959	4147	6106	PGLYRP2	SO:0001583	missense	0			-	HGNC	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1664G>C	19.37:g.15579541C>G	ENSP00000345968:p.Arg555Thr	Somatic	0	58	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.R555T	ENST00000340880.4	37	c.1664	CCDS12330.2	19	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047725	0.36085	.	.	ENSG00000161031	ENST00000340880	T	0.04502	3.61	3.26	1.04	0.20106	.	.	.	.	.	T	0.03608	0.0103	L	0.47716	1.5	0.09310	N	1	P	0.41673	0.759	B	0.34824	0.19	T	0.40040	-0.9584	9	0.18710	T	0.47	.	3.7209	0.08456	0.2536:0.6131:0.0:0.1333	.	555	Q96PD5	PGRP2_HUMAN	T	555	ENSP00000345968:R555T	ENSP00000345968:R555T	R	-	2	0	PGLYRP2	15440541	0.018000	0.18449	0.010000	0.14722	0.060000	0.15804	-0.061000	0.11693	0.353000	0.24079	0.650000	0.86243	AGG	-	NULL		0.552	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP2	protein_coding	OTTHUMT00000319626.1	C	NM_052890	-		15579541	-1	no_errors	ENST00000340880	ensembl	human	known	74_37	missense	SNP	0.014	G
ARSE	415	genome.wustl.edu	37	X	2853045	2853045	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chrX:2853045A>G	ENST00000381134.3	-	11	1664	c.1598T>C	c.(1597-1599)gTg>gCg	p.V533A	ARSE_ENST00000540563.1_Missense_Mutation_p.V488A|ARSE_ENST00000545496.1_Missense_Mutation_p.V558A	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	533					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGATAGAACACGGGCTCTGA	0.567																																																	0								ENSG00000157399						80.0	57.0	65.0					X																	2853045		2203	4300	6503	ARSE	SO:0001583	missense	0			-	HGNC	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1598T>C	X.37:g.2853045A>G	ENSP00000370526:p.Val533Ala	Somatic	0	169	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	75	43.61	Q53FT2|Q53FU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.V558A	ENST00000381134.3	37	c.1673	CCDS14122.1	X	.	.	.	.	.	.	.	.	.	.	A	1.689	-0.504532	0.04261	.	.	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.88586	-2.4;-2.4;-2.4	3.45	-5.49	0.02584	Alkaline-phosphatase-like, core domain (1);	0.877183	0.09880	N	0.743844	T	0.64832	0.2634	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.60234	-0.7303	10	0.08179	T	0.78	.	3.2013	0.06651	0.6009:0.1511:0.1221:0.126	.	488;558;533	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	A	488;558;533	ENSP00000438198:V488A;ENSP00000441417:V558A;ENSP00000370526:V533A	ENSP00000370526:V533A	V	-	2	0	ARSE	2863045	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.079000	0.11357	-1.178000	0.02741	0.235000	0.17854	GTG	-	superfamily_Alkaline_phosphatase_core		0.567	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSE	protein_coding	OTTHUMT00000055643.1	A	NM_000047	-		2853045	-1	no_errors	ENST00000545496	ensembl	human	known	74_37	missense	SNP	0.000	G
MOG	4340	genome.wustl.edu	37	6	29640430	29640430	+	IGR	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:29640430A>G	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Silent_p.S466S|ZFP57_ENST00000376883.1_Silent_p.S466S|ZFP57_ENST00000488757.1_Silent_p.S486S	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GGACATCATGAGAGAAGCCAA	0.567																																																	0								ENSG00000204644						57.0	63.0	61.0					6																	29640430		1271	2562	3833	ZFP57	SO:0001628	intergenic_variant	0			-	HGNC		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640430A>G		Somatic	0	59	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S486	ENST00000376917.3	37	c.1458	CCDS34370.1	6																																																																																			-	NULL		0.567	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	protein_coding	OTTHUMT00000076160.3	A	NM_002433	-		29640430	-1	no_errors	ENST00000488757	ensembl	human	known	74_37	silent	SNP	0.000	G
BUD13	84811	genome.wustl.edu	37	11	116646344	116646361	+	5'Flank	DEL	AAAAAAAAAAAAAAAAAA	AAAAAAAAAAAAAAAAAA	-	rs576700557|rs36148817|rs58466262|rs55995223	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	AAAAAAAAAAAAAAAAAA	AAAAAAAAAAAAAAAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:116646344_116646361delAAAAAAAAAAAAAAAAAA	ENST00000260210.4	-	0	0				AP006216.11_ENST00000366405.2_lincRNA|AP006216.10_ENST00000439104.1_RNA|BUD13_ENST00000375445.3_5'Flank	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)						mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		actccgtctcaaaaaaaaaaaaaaaaaaaaaaaaaaaa	0.413											OREG0003483	type=REGULATORY REGION|Gene=BC035670|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay		3434	0.685703	0.8896	0.7277	5008	,	,		18201	0.4365		0.8101	False		,,,				2504	0.5092																0								ENSG00000231611																																			AP006216.11	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136		11.37:g.116646344_116646361delAAAAAAAAAAAAAAAAAA	Exception_encountered	Somatic	NA	NA	NA	1474	0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K0S0|Q96LS7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000260210.4	37	NULL	CCDS8374.1	11																																																																																			-	-		0.413	BUD13-001	KNOWN	basic|CCDS	protein_coding	ENSG00000231611	protein_coding	OTTHUMT00000104864.1	AAAAAAAAAAAAAAAAAA	NM_032725			116646361	-1	no_errors	ENST00000366405	ensembl	human	known	74_37	rna	DEL	0.001:0.001:0.001:0.001:0.001:0.001:0.002:0.001:0.002:0.003:0.003:0.003:0.002:0.002:0.003:0.007:0.009:0.011	-
LOC100129434	100129434	genome.wustl.edu	37	2	56403230	56403230	+	RNA	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:56403230T>C	ENST00000596663.1	-	0	513				AC007743.1_ENST00000432793.1_RNA|AC007743.1_ENST00000447423.2_RNA|RP11-482H16.1_ENST00000607540.1_RNA|RP11-481J13.1_ENST00000606639.1_lincRNA																							GTTTGTGATCTGCAGCTCTTC	0.483																																																	0								ENSG00000233251																																			AC007743.1			0			-	Clone_based_vega_gene																													2.37:g.56403230T>C		Somatic	0	111	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	58	27.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596663.1	37	NULL		2																																																																																			-	-		0.483	AC007743.1-005	KNOWN	basic	antisense	LOC100129434	antisense	OTTHUMT00000470756.1	T		-		56403230	-1	no_errors	ENST00000432793	ensembl	human	known	74_37	rna	SNP	0.503	C
ACHE	43	genome.wustl.edu	37	7	100490238	100490238	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr7:100490238G>A	ENST00000412389.1	-	2	1425	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	ACHE_ENST00000419336.2_Intron|ACHE_ENST00000302913.4_Missense_Mutation_p.R424C|ACHE_ENST00000411582.1_Missense_Mutation_p.R424C|ACHE_ENST00000428317.1_Missense_Mutation_p.R424C|ACHE_ENST00000241069.5_Missense_Mutation_p.R424C|UFSP1_ENST00000388761.2_5'Flank			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	424					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	TCCCTCAGGCGTGCCGGGTCC	0.697																																																	0								ENSG00000087085						24.0	26.0	25.0					7																	100490238		2203	4299	6502	ACHE	SO:0001583	missense	0			-	HGNC		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1270C>T	7.37:g.100490238G>A	ENSP00000394976:p.Arg424Cys	Somatic	0	125	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	68	13.92	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Cholinesterase	p.R424C	ENST00000412389.1	37	c.1270	CCDS5709.1	7	.	.	.	.	.	.	.	.	.	.	G	13.43	2.233581	0.39498	.	.	ENSG00000087085	ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000411582;ENST00000422451	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	3.82	3.82	0.43975	Carboxylesterase, type B (1);	0.216426	0.37761	N	0.001960	T	0.73869	0.3642	M	0.70903	2.155	0.09310	N	0.999999	D;D	0.76494	0.999;0.998	P;P	0.54372	0.75;0.717	T	0.67413	-0.5677	9	.	.	.	.	13.556	0.61759	0.0:0.0:1.0:0.0	.	424;424	P22303-2;P22303	.;ACES_HUMAN	C	424	ENSP00000241069:R424C;ENSP00000414858:R424C;ENSP00000303211:R424C;ENSP00000394976:R424C;ENSP00000404865:R424C	.	R	-	1	0	ACHE	100328174	0.000000	0.05858	0.321000	0.25320	0.965000	0.64279	0.494000	0.22467	2.143000	0.66587	0.491000	0.48974	CGC	-	pfam_CarbesteraseB		0.697	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACHE	protein_coding	OTTHUMT00000347201.1	G	NM_015831	-		100490238	-1	no_errors	ENST00000302913	ensembl	human	known	74_37	missense	SNP	0.075	A
NTSR1	4923	genome.wustl.edu	37	20	61391754	61391755	+	3'UTR	INS	-	-	C	rs59903116		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr20:61391754_61391755insC	ENST00000370501.3	+	0	1763_1764				NTSR1_ENST00000482259.1_3'UTR	NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)						adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GAGGCCTGGGACCCCCCCCTCC	0.658																																					GBM(37;400 780 6403 19663 35669)												0								ENSG00000101188																																			NTSR1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.*136->C	20.37:g.61391762_61391762dupC		Somatic	0	51	0.00		0.6352087463037039	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	Q9H4H1|Q9H4T5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370501.3	37	NULL	CCDS13502.1	20																																																																																			-	-		0.658	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	protein_coding	OTTHUMT00000080061.1	-				61391755	+1	no_errors	ENST00000482259	ensembl	human	known	74_37	rna	INS	0.000:0.000	C
IDI1	3422	genome.wustl.edu	37	10	1087240	1087240	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr10:1087240delT	ENST00000381344.3	-	5	908	c.742delA	c.(742-744)attfs	p.I248fs	IDI2-AS1_ENST00000437374.1_RNA|RNU7-163P_ENST00000459467.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI1_ENST00000491735.1_5'UTR|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	191					cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		GTTATCTTAATTTCACCACTG	0.328																																																	0								ENSG00000067064						76.0	75.0	76.0					10																	1087240		2202	4297	6499	IDI1	SO:0001589	frameshift_variant	0				HGNC	BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.742delA	10.37:g.1087240delT	ENSP00000370748:p.Ile248fs	Somatic	0	96	0.00		0.6352087463037039	94	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	p.I248fs	ENST00000381344.3	37	c.742	CCDS7056.1	10																																																																																			-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1		0.328	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI1	protein_coding	OTTHUMT00000046409.2	T	NM_004508			1087240	-1	no_errors	ENST00000381344	ensembl	human	known	74_37	frame_shift_del	DEL	0.884	-
REV3L	5980	genome.wustl.edu	37	6	111688940	111688940	+	Silent	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:111688940T>C	ENST00000358835.3	-	15	6505	c.6051A>G	c.(6049-6051)gaA>gaG	p.E2017E	REV3L_ENST00000368802.3_Silent_p.E2017E|REV3L_ENST00000368805.1_Silent_p.E2017E|REV3L_ENST00000435970.1_Silent_p.E1939E			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2017					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TCTTGGAACGTTCGTATTCTT	0.418								DNA polymerases (catalytic subunits)																																									0								ENSG00000009413						145.0	138.0	141.0					6																	111688940		2203	4300	6503	REV3L	SO:0001819	synonymous_variant	0			-	HGNC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6051A>G	6.37:g.111688940T>C		Somatic	0	66	0.00		0.6352087463037039	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	O43214|Q5TC33	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.E2017	ENST00000358835.3	37	c.6051	CCDS5091.2	6																																																																																			-	superfamily_RNaseH-like_dom		0.418	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	protein_coding	OTTHUMT00000043695.1	T	NM_002912	-		111688940	-1	no_errors	ENST00000358835	ensembl	human	known	74_37	silent	SNP	1.000	C
TLR10	81793	genome.wustl.edu	37	4	38776300	38776300	+	Silent	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr4:38776300C>T	ENST00000308973.4	-	4	1517	c.912G>A	c.(910-912)ttG>ttA	p.L304L	TLR10_ENST00000507953.1_5'Flank|TLR10_ENST00000361424.2_Silent_p.L304L|TLR10_ENST00000508334.1_Silent_p.L304L|TLR10_ENST00000506111.1_Silent_p.L304L	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	304					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						GTACATGCTCCAATTTTATAG	0.333																																																	0								ENSG00000174123						84.0	86.0	85.0					4																	38776300		2203	4299	6502	TLR10	SO:0001819	synonymous_variant	0			-	HGNC	AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.912G>A	4.37:g.38776300C>T		Somatic	0	78	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	58	22.67	A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L304	ENST00000308973.4	37	c.912	CCDS3445.1	4																																																																																			-	pirsf_Toll-like_receptor		0.333	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR10	protein_coding	OTTHUMT00000250430.1	C		-		38776300	-1	no_errors	ENST00000308973	ensembl	human	known	74_37	silent	SNP	0.842	T
FZD3	7976	genome.wustl.edu	37	8	28384942	28384942	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr8:28384942T>C	ENST00000240093.3	+	5	1143	c.665T>C	c.(664-666)tTa>tCa	p.L222S	RNA5SP259_ENST00000365541.1_RNA|FZD3_ENST00000537916.1_Missense_Mutation_p.L222S	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	222					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TTTACTTTTTTAACTTTTTTG	0.343																																																	0								ENSG00000104290						133.0	132.0	132.0					8																	28384942		2202	4300	6502	FZD3	SO:0001583	missense	0			-	HGNC	AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.665T>C	8.37:g.28384942T>C	ENSP00000240093:p.Leu222Ser	Somatic	0	72	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	15	44.44	A8K615	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.L222S	ENST00000240093.3	37	c.665	CCDS6069.1	8	.	.	.	.	.	.	.	.	.	.	T	17.67	3.447129	0.63178	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.82255	-1.59;-1.59	5.24	5.24	0.73138	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000002	D	0.90321	0.6972	M	0.76002	2.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.91222	0.5007	10	0.62326	D	0.03	.	14.3288	0.66537	0.0:0.0:0.0:1.0	.	222	Q9NPG1	FZD3_HUMAN	S	222	ENSP00000437489:L222S;ENSP00000240093:L222S	ENSP00000240093:L222S	L	+	2	0	FZD3	28440861	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	1.974000	0.57490	0.533000	0.62120	TTA	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled		0.343	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD3	protein_coding	OTTHUMT00000219986.2	T	NM_145866	-		28384942	+1	no_errors	ENST00000240093	ensembl	human	known	74_37	missense	SNP	1.000	C
PRDM14	63978	genome.wustl.edu	37	8	70981631	70981631	+	Silent	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr8:70981631C>T	ENST00000276594.2	-	2	666	c.465G>A	c.(463-465)gcG>gcA	p.A155A		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	155					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GAGAAGCATCCGCAGGGGGCG	0.567																																					NSCLC(129;99 1813 5906 40656 46114)												0								ENSG00000147596						65.0	63.0	64.0					8																	70981631		2203	4300	6503	PRDM14	SO:0001819	synonymous_variant	0			-	HGNC	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.465G>A	8.37:g.70981631C>T		Somatic	0	91	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	26	64.86	Q86UX9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A155	ENST00000276594.2	37	c.465	CCDS6206.1	8																																																																																			-	NULL		0.567	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	protein_coding	OTTHUMT00000318505.1	C		-		70981631	-1	no_errors	ENST00000276594	ensembl	human	known	74_37	silent	SNP	0.001	T
PTCHD4	442213	genome.wustl.edu	37	6	47847610	47847610	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:47847610G>A	ENST00000339488.4	-	3	1003	c.970C>T	c.(970-972)Ccc>Tcc	p.P324S		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	324	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.					integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TCTTTGAAGGGCAAGTTCTCT	0.418																																																	0								ENSG00000244694						30.0	32.0	31.0					6																	47847610		2203	4299	6502	PTCHD4	SO:0001583	missense	0			-	HGNC		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.970C>T	6.37:g.47847610G>A	ENSP00000341914:p.Pro324Ser	Somatic	0	74	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.P324S	ENST00000339488.4	37	c.970	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	G	3.062	-0.192950	0.06259	.	.	ENSG00000244694	ENST00000339488	D	0.90788	-2.73	5.25	5.25	0.73442	Sterol-sensing domain (1);	.	.	.	.	T	0.77164	0.4090	N	0.21373	0.66	0.80722	D	1	B	0.18741	0.03	B	0.28465	0.09	T	0.74581	-0.3618	9	0.07482	T	0.82	.	18.8631	0.92281	0.0:0.0:1.0:0.0	.	324	Q6ZW05	CF138_HUMAN	S	324	ENSP00000341914:P324S	ENSP00000341914:P324S	P	-	1	0	C6orf138	47955569	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.473000	0.83533	0.650000	0.86243	CCC	-	pfam_Patched,pfscan_SSD		0.418	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	protein_coding	OTTHUMT00000317987.2	G	NM_001013732	-		47847610	-1	no_errors	ENST00000339488	ensembl	human	known	74_37	missense	SNP	1.000	A
EVA1A	84141	genome.wustl.edu	37	2	75745210	75745210	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:75745210G>A	ENST00000233712.1	-	3	494	c.57C>T	c.(55-57)aaC>aaT	p.N19N	EVA1A_ENST00000410071.1_Silent_p.N19N|EVA1A_ENST00000410010.1_5'Flank|EVA1A_ENST00000490746.1_5'UTR|EVA1A_ENST00000410113.1_Silent_p.N19N|EVA1A_ENST00000393913.3_Silent_p.N19N	NM_032181.2	NP_115557.1	Q9H8M9	EVA1A_HUMAN	eva-1 homolog A (C. elegans)	19	Necessary for the localization and biological activity.				apoptotic process (GO:0006915)|autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)											CCGCTAGGATGTTGCTGAGCA	0.602																																																	0								ENSG00000115363						121.0	108.0	112.0					2																	75745210		2203	4300	6503	EVA1A	SO:0001819	synonymous_variant	0			-	HGNC	BC016157	CCDS1959.1	2p12	2012-11-05	2012-11-05	2012-11-05	ENSG00000115363	ENSG00000115363			25816	protein-coding gene	gene with protein product			"""transmembrane protein 166"", ""family with sequence similarity 176, member A"""	TMEM166, FAM176A		12477932	Standard	NM_001135032		Approved	FLJ13391	uc002sni.2	Q9H8M9	OTTHUMG00000129991	ENST00000233712.1:c.57C>T	2.37:g.75745210G>A		Somatic	0	92	0.00		0.6352087463037039	70	30.69	31	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	54	22.86	D6W5J3|Q9HC41	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N19	ENST00000233712.1	37	c.57	CCDS1959.1	2																																																																																			-	NULL		0.602	EVA1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EVA1A	protein_coding	OTTHUMT00000328707.1	G	NM_032181	-		75745210	-1	no_errors	ENST00000233712	ensembl	human	known	74_37	silent	SNP	0.937	A
R3HDM1	23518	genome.wustl.edu	37	2	136373731	136373731	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:136373731C>T	ENST00000264160.4	+	4	551	c.181C>T	c.(181-183)Cag>Tag	p.Q61*	R3HDM1_ENST00000409478.1_Intron|R3HDM1_ENST00000409606.1_Nonsense_Mutation_p.Q61*|R3HDM1_ENST00000329971.3_Intron|R3HDM1_ENST00000410054.1_Intron	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	61							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		GCGGCCATTGCAGTCATTTGG	0.358																																																	0								ENSG00000048991						94.0	95.0	95.0					2																	136373731		2203	4300	6503	R3HDM1	SO:0001587	stop_gained	0			-	HGNC	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.181C>T	2.37:g.136373731C>T	ENSP00000264160:p.Gln61*	Somatic	0	119	0.00		0.6352087463037039	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.Q61*	ENST00000264160.4	37	c.181	CCDS2177.1	2	.	.	.	.	.	.	.	.	.	.	C	38	6.879866	0.97904	.	.	ENSG00000048991	ENST00000264160;ENST00000409606	.	.	.	5.38	5.38	0.77491	.	0.153264	0.46145	D	0.000301	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-5.3005	17.3126	0.87213	0.0:1.0:0.0:0.0	.	.	.	.	X	61	.	ENSP00000264160:Q61X	Q	+	1	0	R3HDM1	136090201	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.675000	0.68123	2.535000	0.85469	0.650000	0.86243	CAG	-	NULL		0.358	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	protein_coding	OTTHUMT00000254659.1	C	NM_015361	-		136373731	+1	no_errors	ENST00000264160	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118305709	118305709	+	5'Flank	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:118305709T>C	ENST00000389506.5	+	0	0				RP11-770J1.4_ENST00000532619.1_Missense_Mutation_p.S38G|KMT2A_ENST00000534358.1_5'Flank|KMT2A_ENST00000354520.4_5'Flank			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A						anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GGGCCAGAGCTGAGTGCAACC	0.592																																																	0								ENSG00000255384																																			RP11-770J1.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337		11.37:g.118305709T>C	Exception_encountered	Somatic	0	81	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S38G	ENST00000389506.5	37	c.112	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	T	8.068	0.769524	0.15983	.	.	ENSG00000255384	ENST00000532619	.	.	.	4.75	1.04	0.20106	.	.	.	.	.	T	0.33440	0.0863	.	.	.	.	.	.	B	0.15930	0.015	B	0.16722	0.016	T	0.35699	-0.9778	6	0.87932	D	0	.	3.7056	0.08400	0.0:0.2114:0.2115:0.5771	.	38	Q9BRP9	YK016_HUMAN	G	38	.	ENSP00000435815:S38G	S	-	1	0	RP11-770J1.4	117810919	0.086000	0.21541	0.361000	0.25849	0.805000	0.45488	-0.028000	0.12350	0.336000	0.23639	0.459000	0.35465	AGC	-	NULL		0.592	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000255384	protein_coding	OTTHUMT00000399085.2	T	NM_005933	-		118305709	-1	no_errors	ENST00000532619	ensembl	human	putative	74_37	missense	SNP	0.246	C
ECEL1P2	347694	genome.wustl.edu	37	2	233251457	233251457	+	RNA	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:233251457G>A	ENST00000461596.1	-	0	297					NR_028501.1				endothelin converting enzyme-like 1, pseudogene 2																		CTGACCATAAGCGAGAAGAGC	0.682																																																	0								ENSG00000244280																																			ECEL1P2			0			-	HGNC	BC067110		2q37.1	2013-01-17			ENSG00000244280	ENSG00000244280			14019	pseudogene	pseudogene						11352565, 10698686	Standard	NR_028501		Approved	ECEL2	uc021vyg.2		OTTHUMG00000153343		2.37:g.233251457G>A		Somatic	0	139	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	92	17.12		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000461596.1	37	NULL		2																																																																																			-	-		0.682	ECEL1P2-002	PUTATIVE	mRNA_end_NF|basic	processed_transcript	ECEL1P2	pseudogene	OTTHUMT00000330820.1	G	NR_028501	-		233251457	-1	no_errors	ENST00000461596	ensembl	human	putative	74_37	rna	SNP	1.000	A
SLC36A2	153201	genome.wustl.edu	37	5	150722534	150722534	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:150722534G>T	ENST00000335244.4	-	4	484	c.355C>A	c.(355-357)Ccc>Acc	p.P119T	SLC36A2_ENST00000521967.1_Missense_Mutation_p.P119T	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	119					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	TCCATAAAGGGCTTGTTAAGC	0.502																																																	0								ENSG00000186335						133.0	112.0	119.0					5																	150722534		2203	4300	6503	SLC36A2	SO:0001583	missense	0			-	HGNC	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.355C>A	5.37:g.150722534G>T	ENSP00000334223:p.Pro119Thr	Somatic	0	98	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.P119T	ENST00000335244.4	37	c.355	CCDS4315.1	5	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799400	0.50208	.	.	ENSG00000186335	ENST00000335244;ENST00000521967	T;T	0.01933	4.55;4.55	4.87	4.87	0.63330	.	0.163679	0.53938	D	0.000041	T	0.05868	0.0153	L	0.48642	1.525	0.80722	D	1	B;B;B	0.27498	0.115;0.132;0.18	B;B;B	0.42163	0.262;0.06;0.378	T	0.51710	-0.8671	10	0.32370	T	0.25	-35.8918	18.1833	0.89785	0.0:0.0:1.0:0.0	.	119;119;119	B4DMY0;E5RJJ5;Q495M3	.;.;S36A2_HUMAN	T	119	ENSP00000334223:P119T;ENSP00000430535:P119T	ENSP00000334223:P119T	P	-	1	0	SLC36A2	150702727	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.038000	0.76537	2.683000	0.91414	0.655000	0.94253	CCC	-	pfam_AA_transpt_TM		0.502	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A2	protein_coding	OTTHUMT00000252437.1	G		-		150722534	-1	no_errors	ENST00000335244	ensembl	human	known	74_37	missense	SNP	1.000	T
POLR2A	5430	genome.wustl.edu	37	17	7414575	7414575	+	Silent	SNP	G	G	T	rs202160361		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:7414575G>T	ENST00000322644.6	+	23	4254	c.3855G>T	c.(3853-3855)ctG>ctT	p.L1285L		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1285					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				ATGTCTTCCTGCGCTGCATCG	0.577																																																	0								ENSG00000181222						186.0	138.0	154.0					17																	7414575		2203	4300	6503	POLR2A	SO:0001819	synonymous_variant	0			-	HGNC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.3855G>T	17.37:g.7414575G>T		Somatic	0	48	0.00		0.6352087463037039	355	0.28	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A6NN93|B9EH88|Q6NX41	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.L1285	ENST00000322644.6	37	c.3855	CCDS32548.1	17																																																																																			-	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_7		0.577	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	protein_coding	OTTHUMT00000437967.1	G	NM_000937	-		7414575	+1	no_errors	ENST00000322644	ensembl	human	known	74_37	silent	SNP	1.000	T
MPDZ	8777	genome.wustl.edu	37	9	13175821	13175821	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:13175821G>A	ENST00000319217.7	-	21	3232	c.2985C>T	c.(2983-2985)gtC>gtT	p.V995V	MPDZ_ENST00000536827.1_Silent_p.V995V|MPDZ_ENST00000447879.1_Silent_p.V995V|MPDZ_ENST00000546205.1_Silent_p.V995V|MPDZ_ENST00000381022.2_Silent_p.V995V|MPDZ_ENST00000381015.4_Silent_p.V995V|MPDZ_ENST00000541718.1_Silent_p.V995V	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	995					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTTGAAGCATGACACACTCAG	0.383																																																	0								ENSG00000107186						51.0	48.0	49.0					9																	13175821		1855	4097	5952	MPDZ	SO:0001819	synonymous_variant	0			-	HGNC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2985C>T	9.37:g.13175821G>A		Somatic	0	89	0.00		0.6352087463037039	0	100.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	125	6	95.42	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.V995	ENST00000319217.7	37	c.2985		9																																																																																			-	superfamily_PDZ		0.383	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	protein_coding	OTTHUMT00000055485.2	G	NM_003829	-		13175821	-1	no_errors	ENST00000319217	ensembl	human	known	74_37	silent	SNP	0.001	A
EXD2	55218	genome.wustl.edu	37	14	69707775	69707775	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr14:69707775G>A	ENST00000409018.3	+	9	1952	c.1824G>A	c.(1822-1824)ctG>ctA	p.L608L	EXD2_ENST00000449989.1_Silent_p.L483L|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409242.1_Silent_p.L483L|EXD2_ENST00000409675.1_Silent_p.L483L|EXD2_ENST00000409949.1_Silent_p.L483L|EXD2_ENST00000312994.5_Silent_p.L608L|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409014.1_Silent_p.L483L	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	608							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						ATCAGAAGCTGCTCCGGAAAT	0.567																																																	0								ENSG00000081177						52.0	47.0	49.0					14																	69707775		2203	4300	6503	EXD2	SO:0001819	synonymous_variant	0			-	HGNC	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1824G>A	14.37:g.69707775G>A		Somatic	0	57	0.00		0.6352087463037039	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	31	25.58	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.L608	ENST00000409018.3	37	c.1824	CCDS53902.1	14																																																																																			-	NULL		0.567	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	protein_coding	OTTHUMT00000335504.1	G		-		69707775	+1	no_errors	ENST00000312994	ensembl	human	known	74_37	silent	SNP	1.000	A
MYO3B	140469	genome.wustl.edu	37	2	171056780	171056780	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:171056780T>C	ENST00000408978.4	+	3	450	c.307T>C	c.(307-309)Tgg>Cgg	p.W103R	MYO3B_ENST00000409044.3_Missense_Mutation_p.W103R|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000334231.6_Missense_Mutation_p.W112R	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	103	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GGGACAGCTGTGGCTGGTCCT	0.458																																																	0								ENSG00000071909						74.0	77.0	76.0					2																	171056780		1873	4103	5976	MYO3B	SO:0001583	missense	0			-	HGNC		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.307T>C	2.37:g.171056780T>C	ENSP00000386213:p.Trp103Arg	Somatic	0	78	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	41	33.87	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.W112R	ENST00000408978.4	37	c.334	CCDS42773.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.7|21.7	4.190748|4.190748	0.78789|0.78789	.|.	.|.	ENSG00000071909|ENSG00000071909	ENST00000442690|ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	.|T;T;T;T	.|0.65732	.|-0.17;-0.17;-0.17;-0.17	5.29|5.29	5.29|5.29	0.74685|0.74685	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76905|0.76905	0.4053|0.4053	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.998;1.0	T|T	0.79621|0.79621	-0.1727|-0.1727	5|10	.|0.87932	.|D	.|0	.|.	15.5409|15.5409	0.76048|0.76048	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|103;103;103;103	.|Q8WXR4-5;B7ZM71;Q8WXR4-4;Q8WXR4	.|.;.;.;MYO3B_HUMAN	A|R	102|103;103;102;112;112	.|ENSP00000386497:W103R;ENSP00000386213:W103R;ENSP00000446237:W112R;ENSP00000335100:W112R	.|ENSP00000314213:W102R	V|W	+|+	2|1	0|0	MYO3B|MYO3B	170765026|170765026	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.997000|7.997000	0.88414|0.88414	2.140000|2.140000	0.66376|0.66376	0.460000|0.460000	0.39030|0.39030	GTG|TGG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.458	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	protein_coding	OTTHUMT00000333410.1	T		-		171056780	+1	no_errors	ENST00000334231	ensembl	human	known	74_37	missense	SNP	1.000	C
SOD2	6648	genome.wustl.edu	37	6	160113476	160113476	+	3'UTR	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:160113476C>G	ENST00000452684.2	-	0	519				SOD2_ENST00000367054.2_Intron|SOD2_ENST00000337404.4_Intron|SOD2_ENST00000538183.2_Intron|SOD2_ENST00000367055.4_Intron|SOD2_ENST00000546087.1_Intron|SOD2_ENST00000444946.2_Intron			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial						age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		CCCAAGTTCCCTGAGATGACA	0.478																																																	0								ENSG00000112096																																			SOD2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000452684.2:c.*20G>C	6.37:g.160113476C>G		Somatic	0	99	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452684.2	37	NULL		6																																																																																			-	-		0.478	SOD2-003	PUTATIVE	basic	protein_coding	SOD2	protein_coding	OTTHUMT00000042923.2	C	NM_000636	-		160113476	-1	no_errors	ENST00000540491	ensembl	human	known	74_37	rna	SNP	0.048	G
AKAP5	9495	genome.wustl.edu	37	14	64935948	64935948	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr14:64935948A>G	ENST00000394718.4	+	2	1214	c.836A>G	c.(835-837)gAa>gGa	p.E279G	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron|AKAP5_ENST00000320636.5_Missense_Mutation_p.E279G	NM_004857.3	NP_004848.3	P24588	AKAP5_HUMAN	A kinase (PRKA) anchor protein 5	279					energy reserve metabolic process (GO:0006112)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|stomach(1)	13				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		ATTGTGGAAGAAGCCAGTAAC	0.413																																																	0								ENSG00000179841						73.0	77.0	75.0					14																	64935948		2203	4300	6503	AKAP5	SO:0001583	missense	0			-	HGNC	M90359	CCDS9764.1	14q23.3	2012-05-16			ENSG00000179841	ENSG00000179841		"""A-kinase anchor proteins"""	375	protein-coding gene	gene with protein product		604688				1512224, 1618839	Standard	NM_004857		Approved	AKAP75, AKAP79	uc001xhd.4	P24588	OTTHUMG00000029634	ENST00000394718.4:c.836A>G	14.37:g.64935948A>G	ENSP00000378207:p.Glu279Gly	Somatic	0	81	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	4	89.47	A2RRB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pkinase-A_anch_WSK-motif	p.E279G	ENST00000394718.4	37	c.836	CCDS9764.1	14	.	.	.	.	.	.	.	.	.	.	A	10.44	1.351575	0.24512	.	.	ENSG00000179841	ENST00000394718;ENST00000320636	T;T	0.34275	1.37;1.37	5.91	0.793	0.18632	.	0.426594	0.22125	N	0.064266	T	0.30198	0.0757	M	0.61703	1.905	0.25074	N	0.990978	B	0.12013	0.005	B	0.11329	0.006	T	0.27905	-1.0060	10	0.66056	D	0.02	-2.0645	4.7596	0.13100	0.4426:0.2914:0.2659:0.0	.	279	P24588	AKAP5_HUMAN	G	279	ENSP00000378207:E279G;ENSP00000315615:E279G	ENSP00000315615:E279G	E	+	2	0	AKAP5	64005701	0.101000	0.21875	0.714000	0.30535	0.179000	0.23085	0.348000	0.20031	-0.092000	0.12417	-0.313000	0.08912	GAA	-	NULL		0.413	AKAP5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKAP5	protein_coding	OTTHUMT00000268070.3	A		-		64935948	+1	no_errors	ENST00000320636	ensembl	human	known	74_37	missense	SNP	0.522	G
POM121L7	728418	genome.wustl.edu	37	22	21477351	21477351	+	Intron	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr22:21477351C>T	ENST00000419447.1	-	2	1516				BCRP2_ENST00000461808.1_RNA|KB-1592A4.15_ENST00000420508.1_lincRNA					POM121 transmembrane nucleoporin-like 7																		AAAGGCTGCCCGTGGCCAATG	0.632																																																	0								ENSG00000197210																																			KB-1592A4.15	SO:0001627	intron_variant	0			-	Clone_based_vega_gene			22q11.21	2013-03-28	2012-03-13		ENSG00000239511	ENSG00000239511			35444	other	unknown			"""POM121 membrane glycoprotein-like 7"""				Standard	NG_009026		Approved		uc010gsw.2		OTTHUMG00000150783	ENST00000419447.1:c.1387-129G>A	22.37:g.21477351C>T		Somatic	0	14	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000419447.1	37	NULL		22																																																																																			-	-		0.632	POM121L7-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000197210	protein_coding		C	NG_009026	-		21477351	-1	no_errors	ENST00000420508	ensembl	human	known	74_37	rna	SNP	0.003	T
LRRC56	115399	genome.wustl.edu	37	11	541546	541546	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:541546G>A	ENST00000270115.7	+	5	687	c.187G>A	c.(187-189)Gcc>Acc	p.A63T		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	63										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGGCCCTGGCCCGGGTGGA	0.637																																																	0								ENSG00000161328						95.0	90.0	91.0					11																	541546		2203	4300	6503	LRRC56	SO:0001583	missense	0			-	HGNC		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.187G>A	11.37:g.541546G>A	ENSP00000270115:p.Ala63Thr	Somatic	0	61	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q8N3Q4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A63T	ENST00000270115.7	37	c.187	CCDS7700.1	11	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562496	0.27915	.	.	ENSG00000161328	ENST00000270115	T	0.08720	3.06	4.66	4.66	0.58398	.	0.211927	0.41194	D	0.000937	T	0.04952	0.0133	L	0.29908	0.895	0.33834	D	0.630571	B	0.26512	0.151	B	0.16722	0.016	T	0.13845	-1.0494	10	0.05833	T	0.94	-24.2374	8.6314	0.33922	0.1019:0.0:0.8981:0.0	.	63	Q8IYG6	LRC56_HUMAN	T	63	ENSP00000270115:A63T	ENSP00000270115:A63T	A	+	1	0	LRRC56	531546	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.489000	0.45285	2.418000	0.82041	0.591000	0.81541	GCC	-	NULL		0.637	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC56	protein_coding	OTTHUMT00000254969.1	G	NM_198075	-		541546	+1	no_errors	ENST00000270115	ensembl	human	known	74_37	missense	SNP	1.000	A
IZUMO1	284359	genome.wustl.edu	37	19	49245485	49245485	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:49245485G>C	ENST00000332955.2	-	7	1128	c.581C>G	c.(580-582)aCt>aGt	p.T194S	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	194	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GCTGTAATCAGTGAGGCCTTC	0.512																																																	0								ENSG00000182264						168.0	152.0	157.0					19																	49245485		2203	4300	6503	IZUMO1	SO:0001583	missense	0			-	HGNC	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.581C>G	19.37:g.49245485G>C	ENSP00000327786:p.Thr194Ser	Somatic	0	133	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	65	10.96	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T194S	ENST00000332955.2	37	c.581	CCDS12732.1	19	.	.	.	.	.	.	.	.	.	.	G	9.860	1.196018	0.22037	.	.	ENSG00000182264	ENST00000332955	D	0.83506	-1.73	4.57	3.52	0.40303	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.332615	0.25887	N	0.027649	T	0.78735	0.4330	L	0.29908	0.895	0.27287	N	0.957943	D	0.54207	0.965	P	0.50659	0.647	T	0.71381	-0.4610	10	0.49607	T	0.09	-17.2747	10.1603	0.42847	0.0:0.0:0.801:0.199	.	194	Q8IYV9	IZUM1_HUMAN	S	194	ENSP00000327786:T194S	ENSP00000327786:T194S	T	-	2	0	IZUMO1	53937297	0.976000	0.34144	0.687000	0.30102	0.022000	0.10575	1.919000	0.40015	1.274000	0.44362	0.561000	0.74099	ACT	-	NULL		0.512	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IZUMO1	protein_coding	OTTHUMT00000466189.1	G	NM_182575	-		49245485	-1	no_errors	ENST00000332955	ensembl	human	known	74_37	missense	SNP	0.807	C
ZNF142	7701	genome.wustl.edu	37	2	219503495	219503495	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:219503495C>T	ENST00000449707.1	-	10	5052	c.4631G>A	c.(4630-4632)tGc>tAc	p.C1544Y	ZNF142_ENST00000411696.2_Missense_Mutation_p.C1544Y	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1544					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCGGTTGGTGCAGTACTCACA	0.572																																					Colon(170;867 1942 8995 15834 18053)												0								ENSG00000115568						30.0	32.0	31.0					2																	219503495		2107	4231	6338	ZNF142	SO:0001583	missense	0			-	HGNC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.4631G>A	2.37:g.219503495C>T	ENSP00000408643:p.Cys1544Tyr	Somatic	0	42	0.00		0.6352087463037039	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q92510	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1544Y	ENST00000449707.1	37	c.4631	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492916	0.84962	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.16597	2.33;2.33	6.1	6.1	0.99115	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.086330	0.85682	D	0.000000	T	0.36552	0.0971	L	0.38838	1.175	0.41549	D	0.988566	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.01697	-1.1293	10	0.62326	D	0.03	-16.8626	20.7114	0.99707	0.0:1.0:0.0:0.0	.	1544;1381	P52746;A8MWU9	ZN142_HUMAN;.	Y	1544	ENSP00000408643:C1544Y;ENSP00000398798:C1544Y	ENSP00000398798:C1544Y	C	-	2	0	ZNF142	219211739	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.844000	0.62846	2.902000	0.99343	0.603000	0.83216	TGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.572	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	protein_coding	OTTHUMT00000336833.1	C	NM_005081	-		219503495	-1	no_errors	ENST00000411696	ensembl	human	known	74_37	missense	SNP	1.000	T
UBAP1L	390595	genome.wustl.edu	37	15	65386877	65386877	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr15:65386877C>T	ENST00000559089.1	-	5	1167	c.947G>A	c.(946-948)cGt>cAt	p.R316H	UBAP1L_ENST00000502113.2_Missense_Mutation_p.R316H			F5GYI3	UBA1L_HUMAN	ubiquitin associated protein 1-like	316										breast(1)|endometrium(1)|kidney(1)	3						ATATCCCTGACGTAACAGGCG	0.637																																																	0								ENSG00000246922						77.0	71.0	73.0					15																	65386877		691	1590	2281	UBAP1L	SO:0001583	missense	0			-	HGNC		CCDS53948.1	15q22.31	2011-08-15			ENSG00000246922	ENSG00000246922			40028	protein-coding gene	gene with protein product							Standard	NM_001163692		Approved		uc010uit.2	F5GYI3		ENST00000559089.1:c.947G>A	15.37:g.65386877C>T	ENSP00000454012:p.Arg316His	Somatic	0	32	0.00		0.6352087463037039	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_UBA-like	p.R316H	ENST00000559089.1	37	c.947	CCDS53948.1	15	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513157	0.44660	.	.	ENSG00000246922	ENST00000502113	.	.	.	4.49	-3.34	0.04943	.	.	.	.	.	T	0.24851	0.0603	N	0.14661	0.345	0.22918	N	0.998566	B	0.21381	0.055	B	0.12156	0.007	T	0.23868	-1.0176	8	0.66056	D	0.02	.	12.3594	0.55194	0.0:0.1631:0.0:0.8369	.	316	F5GYI3	UBA1L_HUMAN	H	316	.	ENSP00000440243:R316H	R	-	2	0	AC013553.1	63173930	0.967000	0.33354	0.240000	0.24138	0.050000	0.14768	1.559000	0.36320	-0.463000	0.06973	-0.377000	0.06932	CGT	-	NULL		0.637	UBAP1L-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAP1L	protein_coding	OTTHUMT00000418469.1	C	NM_001163692	-		65386877	-1	no_errors	ENST00000502113	ensembl	human	known	74_37	missense	SNP	0.741	T
MAP1B	4131	genome.wustl.edu	37	5	71493048	71493048	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:71493048C>T	ENST00000296755.7	+	5	4164	c.3866C>T	c.(3865-3867)tCt>tTt	p.S1289F		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1289					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATTAAAGTCTCTGCAGAGGCA	0.522																																					Melanoma(17;367 822 11631 31730 47712)												0								ENSG00000131711						54.0	52.0	53.0					5																	71493048		2203	4300	6503	MAP1B	SO:0001583	missense	0			-	HGNC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3866C>T	5.37:g.71493048C>T	ENSP00000296755:p.Ser1289Phe	Somatic	0	72	0.00		0.6352087463037039	41	22.64	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	34	29.17	A2BDK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP1B_neuraxin	p.S1289F	ENST00000296755.7	37	c.3866	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332590	0.41297	.	.	ENSG00000131711	ENST00000296755	T	0.03801	3.8	5.86	5.86	0.93980	.	0.103314	0.43747	D	0.000537	T	0.08537	0.0212	N	0.08118	0	0.51767	D	0.99993	D;D	0.61080	0.989;0.989	P;P	0.57283	0.817;0.726	T	0.43734	-0.9373	10	0.72032	D	0.01	-16.3276	20.1772	0.98182	0.0:1.0:0.0:0.0	.	1163;1289	A2BDK6;P46821	.;MAP1B_HUMAN	F	1289	ENSP00000296755:S1289F	ENSP00000296755:S1289F	S	+	2	0	MAP1B	71528804	0.787000	0.28750	0.934000	0.37439	0.710000	0.40934	1.593000	0.36686	2.778000	0.95560	0.655000	0.94253	TCT	-	NULL		0.522	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	C	NM_005909	-		71493048	+1	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	SNP	0.979	T
HSD17B4	3295	genome.wustl.edu	37	5	118865588	118865588	+	Splice_Site	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:118865588G>T	ENST00000256216.6	+	21	1900		c.e21-1		HSD17B4_ENST00000510025.1_Splice_Site|HSD17B4_ENST00000504811.1_Splice_Site|HSD17B4_ENST00000513628.1_Splice_Site|HSD17B4_ENST00000509514.1_Splice_Site|HSD17B4_ENST00000414835.2_Splice_Site|HSD17B4_ENST00000522415.1_Splice_Site|HSD17B4_ENST00000515320.1_Splice_Site	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4						alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		CTCCTCCTAAGGTCCAAGAAA	0.338																																					Colon(35;490 801 34689 41394 43344)												0								ENSG00000133835						76.0	75.0	75.0					5																	118865588		2202	4300	6502	HSD17B4	SO:0001630	splice_region_variant	0			-	HGNC		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1768-1G>T	5.37:g.118865588G>T		Somatic	0	52	0.00		0.6352087463037039	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	46	29.23	B4DNV1|B4DVS5|E9PB82|F5HE57	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e21-1	ENST00000256216.6	37	c.1768-1	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919829	0.52653	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8624	0.92278	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HSD17B4	118893487	1.000000	0.71417	0.143000	0.22291	0.531000	0.34715	7.566000	0.82347	2.755000	0.94549	0.591000	0.81541	.	-	-		0.338	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	protein_coding	OTTHUMT00000250863.3	G	NM_000414	-	Intron	118865588	+1	no_errors	ENST00000256216	ensembl	human	known	74_37	splice_site	SNP	1.000	T
CDC27	996	genome.wustl.edu	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																																	0								ENSG00000004897						44.0	48.0	47.0					17																	45234397		2191	4293	6484	CDC27	SO:0001583	missense	0			-	HGNC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser	Somatic	0	126	0.00		0.6352087463037039	52	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	59	11.94	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P242S	ENST00000066544.3	37	c.724	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT	-	NULL		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	protein_coding	OTTHUMT00000389742.2	G		rs7350908		45234397	-1	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	SNP	1.000	A
BRINP1	1620	genome.wustl.edu	37	9	122011259	122011259	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:122011259G>A	ENST00000265922.3	-	3	849	c.388C>T	c.(388-390)Ctc>Ttc	p.L130F	BRINP1_ENST00000373964.2_Missense_Mutation_p.L130F	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	130	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GCTGAGATGAGCAGGTGGGTG	0.542																																																	0								ENSG00000078725						118.0	82.0	94.0					9																	122011259		2203	4300	6503	BRINP1	SO:0001583	missense	0			-	HGNC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.388C>T	9.37:g.122011259G>A	ENSP00000265922:p.Leu130Phe	Somatic	0	69	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	20	61.54	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.L130F	ENST00000265922.3	37	c.388	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631150	0.87660	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	D;D	0.85861	-2.04;-2.04	5.66	5.66	0.87406	Membrane attack complex component/perforin (MACPF) domain (2);	0.000000	0.85682	D	0.000000	D	0.91506	0.7318	L	0.61218	1.895	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.68943	0.961;0.95	D	0.91581	0.5279	10	0.87932	D	0	-23.2241	20.1076	0.97898	0.0:0.0:1.0:0.0	.	130;130	O60477-2;O60477	.;DBC1_HUMAN	F	130	ENSP00000265922:L130F;ENSP00000363075:L130F	ENSP00000265922:L130F	L	-	1	0	DBC1	121051080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.645000	0.74343	2.823000	0.97156	0.650000	0.86243	CTC	-	pfam_MACPF,smart_MACPF		0.542	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	protein_coding	OTTHUMT00000055440.2	G	NM_014618	-		122011259	-1	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	SNP	1.000	A
OPN4	94233	genome.wustl.edu	37	10	88422052	88422052	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr10:88422052G>T	ENST00000241891.5	+	8	1284	c.1117G>T	c.(1117-1119)Ggt>Tgt	p.G373C	OPN4_ENST00000372071.2_Missense_Mutation_p.G384C	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	373					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GGTGCTGCTGGGTGTATCACG	0.667																																																	0								ENSG00000122375						32.0	26.0	28.0					10																	88422052		2203	4299	6502	OPN4	SO:0001583	missense	0			-	HGNC	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1117G>T	10.37:g.88422052G>T	ENSP00000241891:p.Gly373Cys	Somatic	0	122	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	76	12.64	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opsin	p.G384C	ENST00000241891.5	37	c.1150	CCDS7376.1	10	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318495	0.40996	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.37752	1.18;1.18;1.18	5.39	3.43	0.39272	.	0.395852	0.26496	N	0.024046	T	0.24236	0.0587	L	0.41492	1.28	0.41204	D	0.986392	B;B;B	0.16166	0.005;0.009;0.016	B;B;B	0.17979	0.006;0.006;0.02	T	0.29243	-1.0018	10	0.51188	T	0.08	.	2.7608	0.05306	0.2396:0.0:0.5208:0.2395	.	384;373;384	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	C	384;373;384	ENSP00000361141:G384C;ENSP00000241891:G373C;ENSP00000393132:G384C	ENSP00000241891:G373C	G	+	1	0	OPN4	88412032	0.967000	0.33354	0.965000	0.40720	0.970000	0.65996	1.561000	0.36342	2.528000	0.85240	0.655000	0.94253	GGT	-	NULL		0.667	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN4	protein_coding	OTTHUMT00000049158.2	G	NM_033282	-		88422052	+1	no_errors	ENST00000372071	ensembl	human	known	74_37	missense	SNP	0.973	T
OR1A2	26189	genome.wustl.edu	37	17	3101480	3101480	+	Missense_Mutation	SNP	C	C	G	rs184251188	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:3101480C>G	ENST00000381951.1	+	1	668	c.668C>G	c.(667-669)aCa>aGa	p.T223R		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	223					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						GTCTTTTCCACAGTCTTCCAA	0.438																																																	0								ENSG00000172150						202.0	180.0	188.0					17																	3101480		2203	4300	6503	OR1A2	SO:0001583	missense	0			-	HGNC	AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.668C>G	17.37:g.3101480C>G	ENSP00000371377:p.Thr223Arg	Somatic	0	53	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00	Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T223R	ENST00000381951.1	37	c.668	CCDS11021.1	17	.	.	.	.	.	.	.	.	.	.	C	8.314	0.822816	0.16678	.	.	ENSG00000172150	ENST00000381951	T	0.00193	8.58	4.0	0.467	0.16721	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000097	T	0.00356	0.0011	M	0.90705	3.14	0.09310	N	1	P	0.48294	0.908	P	0.49387	0.609	T	0.37244	-0.9714	10	0.87932	D	0	.	7.3047	0.26440	0.2897:0.6218:0.0:0.0885	.	223	Q9Y585	OR1A2_HUMAN	R	223	ENSP00000371377:T223R	ENSP00000371377:T223R	T	+	2	0	OR1A2	3048230	0.000000	0.05858	0.016000	0.15963	0.093000	0.18481	0.838000	0.27572	0.433000	0.26313	-0.399000	0.06403	ACA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.438	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A2	protein_coding	OTTHUMT00000207293.1	C	NM_012352	-		3101480	+1	no_errors	ENST00000381951	ensembl	human	known	74_37	missense	SNP	0.000	G
ZNF768	79724	genome.wustl.edu	37	16	30537359	30537359	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr16:30537359C>G	ENST00000380412.5	-	2	277	c.102G>C	c.(100-102)gaG>gaC	p.E34D	ZNF768_ENST00000562803.1_Missense_Mutation_p.E3D|ZNF747_ENST00000569360.1_3'UTR|ZNF747_ENST00000535210.1_3'UTR	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	34	Poly-Glu.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						ctTCCTCATTCTCACTCATGT	0.512																																																	0								ENSG00000169957						108.0	107.0	107.0					16																	30537359		2197	4300	6497	ZNF768	SO:0001583	missense	0			-	HGNC	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.102G>C	16.37:g.30537359C>G	ENSP00000369777:p.Glu34Asp	Somatic	0	71	0.00		0.6352087463037039	70	35.45	39	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	42	34.38	Q569L7|Q96CX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_RNA_pol_II_repeat_euk,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E34D	ENST00000380412.5	37	c.102	CCDS10681.2	16	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865952	0.32977	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.06768	3.26	4.91	1.66	0.24008	.	0.145053	0.32002	N	0.006730	T	0.04497	0.0123	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40175	-0.9577	10	0.35671	T	0.21	-9.5956	4.0888	0.09960	0.2392:0.5269:0.1508:0.0831	.	34	Q9H5H4	ZN768_HUMAN	D	34;3	ENSP00000369777:E34D	ENSP00000369777:E34D	E	-	3	2	ZNF768	30444860	0.080000	0.21391	0.998000	0.56505	0.978000	0.69477	-0.075000	0.11431	0.633000	0.30452	0.561000	0.74099	GAG	-	NULL		0.512	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF768	protein_coding	OTTHUMT00000255522.2	C	NM_024671	-		30537359	-1	no_errors	ENST00000380412	ensembl	human	known	74_37	missense	SNP	0.929	G
IFNA8	3445	genome.wustl.edu	37	9	21409413	21409413	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:21409413C>T	ENST00000380205.1	+	1	268	c.238C>T	c.(238-240)Ctc>Ttc	p.L80F		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	80					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		CATCTCTGTCCTCCATGAGAT	0.463																																																	0								ENSG00000120242						100.0	94.0	96.0					9																	21409413		2203	4300	6503	IFNA8	SO:0001583	missense	0			-	HGNC		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.238C>T	9.37:g.21409413C>T	ENSP00000369553:p.Leu80Phe	Somatic	0	149	0.00		0.6352087463037039	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	90	43	67.67	P01565|P09236|Q5VWV7|Q5VYQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.L80F	ENST00000380205.1	37	c.238	CCDS6507.1	9	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802417	0.31869	.	.	ENSG00000120242	ENST00000380205	T	0.04551	3.6	3.57	0.492	0.16872	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.829753	0.10704	N	0.643733	T	0.11239	0.0274	M	0.67517	2.055	0.09310	N	1	B	0.18166	0.026	B	0.35655	0.207	T	0.39292	-0.9621	10	0.62326	D	0.03	.	14.6341	0.68676	0.0:0.8301:0.1699:0.0	.	80	P32881	IFNA8_HUMAN	F	80	ENSP00000369553:L80F	ENSP00000369553:L80F	L	+	1	0	IFNA8	21399413	0.000000	0.05858	0.002000	0.10522	0.951000	0.60555	-2.350000	0.01092	-0.009000	0.14296	0.561000	0.74099	CTC	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.463	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA8	protein_coding	OTTHUMT00000051906.1	C	NM_002170	-		21409413	+1	no_errors	ENST00000380205	ensembl	human	known	74_37	missense	SNP	0.007	T
NLRP12	91662	genome.wustl.edu	37	19	54299150	54299150	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:54299150G>A	ENST00000324134.6	-	9	3229	c.3061C>T	c.(3061-3063)Cgg>Tgg	p.R1021W	NLRP12_ENST00000351894.4_Missense_Mutation_p.R909W|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000535162.1_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.R1022W|NLRP12_ENST00000391775.3_Missense_Mutation_p.R964W|NLRP12_ENST00000345770.5_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	1021					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGGCTCAGCCGCTTGCAAAGC	0.557																																																	0								ENSG00000142405						92.0	71.0	78.0					19																	54299150		2203	4300	6503	NLRP12	SO:0001583	missense	0			-	HGNC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.3061C>T	19.37:g.54299150G>A	ENSP00000319377:p.Arg1021Trp	Somatic	0	98	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	34	46.03	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R1021W	ENST00000324134.6	37	c.3061	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	G	8.901	0.956243	0.18507	.	.	ENSG00000142405	ENST00000324134;ENST00000351894;ENST00000358661;ENST00000391775;ENST00000391773	T;T;T;T	0.52983	0.65;0.64;0.64;0.65	4.15	-8.07	0.01098	.	0.862246	0.09479	U	0.796587	T	0.49270	0.1547	L	0.36672	1.1	0.09310	N	1	D;D;D;D	0.89917	0.989;0.999;1.0;0.994	P;P;D;P	0.79108	0.844;0.841;0.992;0.591	T	0.57476	-0.7805	10	0.72032	D	0.01	.	8.1131	0.30926	0.0:0.3664:0.4412:0.1924	.	247;1021;964;1021	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	W	1021;909;247;964;1022	ENSP00000319377:R1021W;ENSP00000340473:R909W;ENSP00000375655:R964W;ENSP00000375653:R1022W	ENSP00000319377:R1021W	R	-	1	2	NLRP12	58990962	0.004000	0.15560	0.000000	0.03702	0.099000	0.18886	0.137000	0.15995	-1.833000	0.01195	0.442000	0.29010	CGG	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	protein_coding	OTTHUMT00000134340.1	G	NM_144687	-		54299150	-1	no_errors	ENST00000324134	ensembl	human	known	74_37	missense	SNP	0.019	A
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				RP11-649A18.12_ENST00000585075.1_RNA|SLC25A19_ENST00000320362.3_Intron|SLC25A19_ENST00000580994.1_Intron|RP11-649A18.12_ENST00000582668.1_RNA|MIF4GD_ENST00000580571.1_5'Flank|MIF4GD_ENST00000579297.1_5'Flank|SLC25A19_ENST00000416858.2_Intron|MIF4GD_ENST00000245551.5_5'Flank|MIF4GD_ENST00000577542.1_5'Flank|MIF4GD_ENST00000325102.8_5'Flank|SLC25A19_ENST00000375261.4_Intron|SLC25A19_ENST00000442286.2_Intron|MIF4GD_ENST00000578305.1_5'Flank			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.6352087463037039	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
GABRG1	2565	genome.wustl.edu	37	4	46053588	46053588	+	Silent	SNP	A	A	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr4:46053588A>C	ENST00000295452.4	-	8	1151	c.984T>G	c.(982-984)tcT>tcG	p.S328S		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	328					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGTCACATAAGAAACCTTAG	0.373																																																	0								ENSG00000163285						101.0	94.0	96.0					4																	46053588		2203	4300	6503	GABRG1	SO:0001819	synonymous_variant	0			-	HGNC	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.984T>G	4.37:g.46053588A>C		Somatic	0	83	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	15	44.44	Q5H9T8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg1_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S328	ENST00000295452.4	37	c.984	CCDS3470.1	4																																																																																			-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,tigrfam_Neur_channel		0.373	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG1	protein_coding	OTTHUMT00000250470.1	A	NM_173536	-		46053588	-1	no_errors	ENST00000295452	ensembl	human	known	74_37	silent	SNP	0.659	C
KMT2A	4297	genome.wustl.edu	37	11	118376882	118376882	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:118376882G>A	ENST00000389506.5	+	27	10266	c.10266G>A	c.(10264-10266)gcG>gcA	p.A3422A	KMT2A_ENST00000534358.1_Silent_p.A3425A|KMT2A_ENST00000354520.4_Silent_p.A3384A			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3422					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAATAACAGCGGCATCTAGCA	0.547																																																	0								ENSG00000118058						94.0	91.0	92.0					11																	118376882		2200	4295	6495	KMT2A	SO:0001819	synonymous_variant	0			-	HGNC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10266G>A	11.37:g.118376882G>A		Somatic	0	25	0.00		0.6352087463037039	1	95.45	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	1	90.00	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.A3422	ENST00000389506.5	37	c.10266	CCDS31686.1	11																																																																																			-	pirsf_MeTrfase_trithorax		0.547	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	protein_coding	OTTHUMT00000399085.2	G	NM_005933	-		118376882	+1	no_errors	ENST00000389506	ensembl	human	known	74_37	silent	SNP	0.074	A
EXOSC10	5394	genome.wustl.edu	37	1	11137565	11137565	+	Intron	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:11137565G>T	ENST00000376936.4	-	16	1850				EXOSC10_ENST00000304457.7_Intron|EXOSC10_ENST00000544779.1_Missense_Mutation_p.S631R	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CTTTCTGCCAGCTGTCAGCAC	0.527																																					Colon(179;105 1987 14326 27364 29542)												0								ENSG00000171824																																			EXOSC10	SO:0001627	intron_variant	0			-	HGNC	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1801-65C>A	1.37:g.11137565G>T		Somatic	0	35	0.00		0.6352087463037039	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,pfam_Exosome-assoc_fac_Rrp6_N,pfam_HRDC_dom,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_HRDC_dom,pfscan_HRDC_dom	p.S631R	ENST00000376936.4	37	c.1893	CCDS30584.1	1	.	.	.	.	.	.	.	.	.	.	G	9.402	1.078341	0.20227	.	.	ENSG00000171824	ENST00000544779	.	.	.	3.52	2.6	0.31112	.	.	.	.	.	T	0.33059	0.0850	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20472	-1.0274	4	.	.	.	.	7.0311	0.24967	0.1283:0.0:0.8717:0.0	.	.	.	.	R	631	.	.	S	-	3	2	EXOSC10	11060152	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	0.095000	0.15127	0.809000	0.34255	0.563000	0.77884	AGC	-	NULL		0.527	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOSC10	protein_coding	OTTHUMT00000006078.1	G	NM_001001998	-		11137565	-1	no_errors	ENST00000544779	ensembl	human	known	74_37	missense	SNP	0.001	T
KMO	8564	genome.wustl.edu	37	1	241719027	241719027	+	Intron	SNP	T	T	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:241719027T>A	ENST00000366559.4	+	5	672				KMO_ENST00000484628.1_Intron|KMO_ENST00000366558.3_Intron|KMO_ENST00000366557.4_Intron	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TCTTGTCATATGATTTATTGG	0.358																																																	0								ENSG00000117009						86.0	74.0	78.0					1																	241719027		692	1590	2282	KMO	SO:0001627	intron_variant	0			-	HGNC	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.361+67T>A	1.37:g.241719027T>A		Somatic	0	74	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	66	26.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366559.4	37	NULL	CCDS1618.1	1																																																																																			-	-		0.358	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	protein_coding	OTTHUMT00000095612.1	T	NM_003679	-		241719027	+1	no_errors	ENST00000481087	ensembl	human	known	74_37	rna	SNP	0.002	A
MPP2	4355	genome.wustl.edu	37	17	41957293	41957293	+	Missense_Mutation	SNP	G	G	A	rs374234227		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:41957293G>A	ENST00000461854.1	-	12	1367	c.1282C>T	c.(1282-1284)Cgt>Tgt	p.R428C	MPP2_ENST00000520305.1_Missense_Mutation_p.R265C|MPP2_ENST00000377184.3_Missense_Mutation_p.R421C|MPP2_ENST00000536246.1_Missense_Mutation_p.R393C|MPP2_ENST00000523501.1_Missense_Mutation_p.R393C|MPP2_ENST00000473246.1_5'Flank|MPP2_ENST00000518766.1_Missense_Mutation_p.R449C|MPP2_ENST00000269095.4_Missense_Mutation_p.R404C			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	428	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.R404C(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		ATCTCCCCACGGGACACAAAG	0.622											OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	large_intestine(1)						ENSG00000108852	G	CYS/ARG	0,4406		0,0,2203	174.0	117.0	136.0		1210	4.8	1.0	17		136	1,8599	1.2+/-3.3	0,1,4299	no	missense	MPP2	NM_005374.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	404/553	41957293	1,13005	2203	4300	6503	MPP2	SO:0001583	missense	0			-	HGNC		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.1282C>T	17.37:g.41957293G>A	ENSP00000428286:p.Arg428Cys	Somatic	0	53	0.00	905	0.6352087463037039	3	50.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.R428C	ENST00000461854.1	37	c.1282		17	.	.	.	.	.	.	.	.	.	.	g	14.95	2.688402	0.48097	0.0	1.16E-4	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000520305;ENST00000523501;ENST00000536246;ENST00000518766	T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13	4.83	4.83	0.62350	.	.	.	.	.	T	0.57946	0.2088	H	0.95780	3.72	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67231	0.95;0.916	T	0.72590	-0.4247	9	0.87932	D	0	.	15.844	0.78874	0.0:0.0:1.0:0.0	.	449;421	E7EV80;Q14168-3	.;.	C	421;404;428;265;393;393;449	ENSP00000366389:R421C;ENSP00000269095:R404C;ENSP00000428286:R428C;ENSP00000428136:R265C;ENSP00000430540:R393C;ENSP00000438012:R393C;ENSP00000428182:R449C	ENSP00000269095:R404C	R	-	1	0	MPP2	39312819	1.000000	0.71417	0.960000	0.40013	0.042000	0.13812	3.155000	0.50700	2.390000	0.81377	0.579000	0.79373	CGT	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like		0.622	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	MPP2	protein_coding	OTTHUMT00000258388.2	G	NM_005374	-		41957293	-1	no_errors	ENST00000461854	ensembl	human	known	74_37	missense	SNP	0.996	A
OR51H1P	401663	genome.wustl.edu	37	11	4881657	4881657	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:4881657G>A	ENST00000322059.1	-	1	137	c.138C>T	c.(136-138)acC>acT	p.T46T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron			Q8NH63	O51H1_HUMAN	olfactory receptor, family 51, subfamily H, member 1 pseudogene	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)	1						CAGCTAGGATGGTACCATTTC	0.502																																																	0								ENSG00000176904																																			OR51H1P	SO:0001819	synonymous_variant	0			-	HGNC			11p15.4	2013-09-24		2004-03-10	ENSG00000176904	ENSG00000176904		"""GPCR / Class A : Olfactory receptors"""	14833	pseudogene	pseudogene				OR51H1			Standard	NG_004388		Approved			Q8NH63	OTTHUMG00000066512	ENST00000322059.1:c.138C>T	11.37:g.4881657G>A		Somatic	0	108	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	2	95.56	Q6IFI3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T46	ENST00000322059.1	37	c.138		11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.502	OR51H1P-001	PUTATIVE	basic|appris_principal	protein_coding	OR51H1P	protein_coding	OTTHUMT00000142185.1	G		-		4881657	-1	no_errors	ENST00000322059	ensembl	human	putative	74_37	silent	SNP	0.002	A
CTNND2	1501	genome.wustl.edu	37	5	10973495	10973495	+	3'UTR	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:10973495C>G	ENST00000304623.8	-	0	3937				CTNND2_ENST00000511377.1_3'UTR|CTNND2_ENST00000359640.2_3'UTR|CTNND2_ENST00000458100.2_3'UTR|CTNND2_ENST00000503622.1_3'UTR|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GAGAAAAAAACAAAACAGAAA	0.453																																																	0								ENSG00000169862																																			CTNND2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.*70G>C	5.37:g.10973495C>G		Somatic	0	36	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000304623.8	37	NULL	CCDS3881.1	5																																																																																			-	-		0.453	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	C	NM_001332	-		10973495	-1	no_errors	ENST00000495388	ensembl	human	known	74_37	rna	SNP	0.028	G
TKTL1	8277	genome.wustl.edu	37	X	153555748	153555748	+	Intron	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chrX:153555748G>T	ENST00000369915.3	+	11	1590				TKTL1_ENST00000217905.7_Intron|TKTL1_ENST00000369912.2_Intron|TKTL1_ENST00000482044.1_3'UTR	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1						glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGACAGCTGGAGCAGTGTAA	0.413																																																	0								ENSG00000007350						240.0	212.0	220.0					X																	153555748		876	1991	2867	TKTL1	SO:0001627	intron_variant	0			-	HGNC	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1402-189G>T	X.37:g.153555748G>T		Somatic	0	60	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369915.3	37	NULL	CCDS35448.1	X	.	.	.	.	.	.	.	.	.	.	G	2.657	-0.280591	0.05642	.	.	ENSG00000007350	ENST00000441970	.	.	.	2.01	0.92	0.19397	.	.	.	.	.	T	0.36468	0.0968	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.34403	-0.9830	5	0.59425	D	0.04	.	4.5771	0.12240	0.0:0.0:0.6245:0.3755	.	.	.	.	C	420	.	ENSP00000406836:W420C	W	+	3	0	TKTL1	153208942	0.000000	0.05858	0.003000	0.11579	0.025000	0.11179	-0.932000	0.03963	1.014000	0.39417	0.529000	0.55759	TGG	-	-		0.413	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	protein_coding	OTTHUMT00000058923.1	G	NM_012253	-		153555748	+1	no_errors	ENST00000463884	ensembl	human	known	74_37	rna	SNP	0.002	T
SVEP1	79987	genome.wustl.edu	37	9	113139339	113139349	+	Intron	DEL	TTAGATGGATC	TTAGATGGATC	-	rs199857649|rs150807622|rs3831124|rs200967302	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	TTAGATGGATC	TTAGATGGATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:113139339_113139349delTTAGATGGATC	ENST00000401783.2	-	45	10841				SVEP1_ENST00000297826.5_Intron|SVEP1_ENST00000374469.1_Intron	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1						cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAAAATGACTTTAGATGGATCTTAATAACAG	0.379														720	0.14377	0.2133	0.1614	5008	,	,		22497	0.0913		0.1064	False		,,,				2504	0.1299																0								ENSG00000165124																																			SVEP1	SO:0001627	intron_variant	0				HGNC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10504+201GATCCATCTAA>-	9.37:g.113139339_113139349delTTAGATGGATC		Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401783.2	37	NULL	CCDS48004.1	9																																																																																			-	-		0.379	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		TTAGATGGATC				113139349	-1	no_errors	ENST00000476205	ensembl	human	known	74_37	rna	DEL	0.001:0.002:0.000:0.000:0.006:0.013:0.026:0.029:0.025:0.023:0.001	-
SHROOM2	357	genome.wustl.edu	37	X	9905685	9905685	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chrX:9905685C>G	ENST00000380913.3	+	7	4189	c.4099C>G	c.(4099-4101)Ctg>Gtg	p.L1367V	SHROOM2_ENST00000418909.2_Missense_Mutation_p.L202V	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1367	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACGGAGGAAGCTGCTCCCCAA	0.557																																																	0								ENSG00000146950						39.0	31.0	34.0					X																	9905685		2203	4299	6502	SHROOM2	SO:0001583	missense	0			-	HGNC	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.4099C>G	X.37:g.9905685C>G	ENSP00000370299:p.Leu1367Val	Somatic	0	149	0.00		0.6352087463037039	5	37.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	45	43.75	B9EIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1367V	ENST00000380913.3	37	c.4099	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	C	12.37	1.916448	0.33815	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.29917	1.55;1.55;1.55	4.95	4.02	0.46733	Apx/shroom, ASD2 (2);	0.180691	0.38058	N	0.001837	T	0.34135	0.0887	N	0.19112	0.55	0.38801	D	0.955201	B;D	0.64830	0.008;0.994	B;D	0.63283	0.026;0.913	T	0.09975	-1.0650	10	0.22109	T	0.4	-12.2775	13.3015	0.60328	0.1587:0.8413:0.0:0.0	.	202;1367	Q68DU3;Q13796	.;SHRM2_HUMAN	V	1367;202;202;202	ENSP00000370299:L1367V;ENSP00000415229:L202V;ENSP00000406724:L202V	ENSP00000370299:L1367V	L	+	1	2	SHROOM2	9865685	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.710000	0.54860	2.040000	0.60383	0.506000	0.49869	CTG	-	pfam_ASD2		0.557	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	protein_coding	OTTHUMT00000055721.1	C	NM_001649	-		9905685	+1	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	SNP	1.000	G
PTCH2	8643	genome.wustl.edu	37	1	45296673	45296673	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:45296673C>G	ENST00000372192.3	-	6	790	c.660G>C	c.(658-660)caG>caC	p.Q220H	PTCH2_ENST00000447098.2_Missense_Mutation_p.Q220H	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	220					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CCTCCAGCAGCTGCTCTGGAT	0.632									Basal Cell Nevus syndrome																																								0								ENSG00000117425						30.0	31.0	31.0					1																	45296673		2203	4300	6503	PTCH2	SO:0001583	missense	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	-	HGNC	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.660G>C	1.37:g.45296673C>G	ENSP00000361266:p.Gln220His	Somatic	0	100	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	20	70.59	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.Q220H	ENST00000372192.3	37	c.660	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819675	0.71028	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.92647	-3.07;-3.08	4.83	2.92	0.33932	.	0.000000	0.47852	D	0.000203	D	0.91713	0.7380	L	0.54323	1.7	0.38946	D	0.958242	D	0.60575	0.988	P	0.53146	0.719	D	0.91474	0.5199	10	0.51188	T	0.08	-20.2067	10.5776	0.45235	0.0:0.8347:0.0:0.1653	.	220	Q9Y6C5	PTC2_HUMAN	H	220	ENSP00000389703:Q220H;ENSP00000361266:Q220H	ENSP00000361266:Q220H	Q	-	3	2	PTCH2	45069260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.057000	0.41365	1.263000	0.44181	0.655000	0.94253	CAG	-	tigrfam_TM_rcpt_patched		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	protein_coding	OTTHUMT00000023428.4	C	NM_003738	-		45296673	-1	no_errors	ENST00000372192	ensembl	human	known	74_37	missense	SNP	1.000	G
LARP4B	23185	genome.wustl.edu	37	10	863681	863681	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr10:863681delC	ENST00000316157.3	-	14	1719	c.1679delG	c.(1678-1680)ggafs	p.G560fs	LARP4B_ENST00000469487.1_5'Flank	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	560					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TTTGGATGGTCCTATTATCAA	0.473																																																	0								ENSG00000107929						232.0	246.0	241.0					10																	863681		2203	4300	6503	LARP4B	SO:0001589	frameshift_variant	0				HGNC	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1679delG	10.37:g.863681delC	ENSP00000326128:p.Gly560fs	Somatic	0	93	0.00		0.6352087463037039	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.G560fs	ENST00000316157.3	37	c.1679	CCDS31131.1	10																																																																																			-	NULL		0.473	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	protein_coding	OTTHUMT00000046395.2	C	NM_015155			863681	-1	no_errors	ENST00000316157	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DEAF1	10522	genome.wustl.edu	37	11	680002	680003	+	Intron	INS	-	-	ACCAGGATG	rs71278583|rs398038332|rs67467914	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:680002_680003insACCAGGATG	ENST00000382409.3	-	8	1482				DEAF1_ENST00000525904.1_5'UTR|DEAF1_ENST00000338675.6_Intron|RP11-754B17.1_ENST00000527799.1_RNA	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor						anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CACAGGAGAAAACCAGGATGGC	0.52														2632	0.525559	0.2927	0.5303	5008	,	,		20992	0.7173		0.5686	False		,,,				2504	0.5951																0								ENSG00000177030																																			DEAF1	SO:0001627	intron_variant	0				HGNC	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.998-186->CATCCTGGT	11.37:g.680003_680011dupACCAGGATG		Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382409.3	37	NULL	CCDS31327.1	11																																																																																			-	-		0.520	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	protein_coding	OTTHUMT00000383614.3	-	NM_021008			680003	-1	no_errors	ENST00000525904	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACCAGGATG
C12orf54	121273	genome.wustl.edu	37	12	48882265	48882265	+	Intron	DEL	A	A	-	rs71439447		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:48882265delA	ENST00000548364.1	+	4	192				C12orf54_ENST00000548913.1_3'UTR|C12orf54_ENST00000314014.2_Intron|RP11-722P11.4_ENST00000551847.1_RNA			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54											endometrium(1)|large_intestine(4)	5						ACTTACAGCCAAAAAAAAAAA	0.348																																																	0								ENSG00000177627																																			C12orf54	SO:0001627	intron_variant	0				HGNC	BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.136-442A>-	12.37:g.48882265delA		Somatic	0	24	0.00		0.6352087463037039	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q6X4S9|Q8N5S2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548364.1	37	NULL	CCDS8764.1	12																																																																																			-	-		0.348	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	C12orf54	protein_coding	OTTHUMT00000406875.1	A	NM_152319			48882265	+1	no_errors	ENST00000548913	ensembl	human	known	74_37	rna	DEL	0.084	-
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693														1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT		Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRG1|A6NIR9|Q70LJ1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	-				46048197	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	INS	0.001:0.001	CGCTGGT
ECEL1	9427	genome.wustl.edu	37	2	233350833	233350833	+	Silent	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:233350833C>T	ENST00000304546.1	-	2	741	c.531G>A	c.(529-531)caG>caA	p.Q177Q	ECEL1_ENST00000409941.1_Silent_p.Q177Q	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	177					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GCACCTTGCGCTgggccgcgc	0.716																																																	0								ENSG00000171551						4.0	5.0	5.0					2																	233350833		1996	3995	5991	ECEL1	SO:0001819	synonymous_variant	0			-	HGNC	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.531G>A	2.37:g.233350833C>T		Somatic	0	12	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.Q177	ENST00000304546.1	37	c.531	CCDS2493.1	2																																																																																			-	pfam_Peptidase_M13_N		0.716	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	protein_coding	OTTHUMT00000257039.2	C	NM_004826	-		233350833	-1	no_errors	ENST00000304546	ensembl	human	known	74_37	silent	SNP	1.000	T
KRTAP9-9	81870	genome.wustl.edu	37	17	39411670	39411671	+	In_Frame_Ins	INS	-	-	ACCTGCTGCAGGACC	rs67700678|rs540633489	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:39411670_39411671insACCTGCTGCAGGACC	ENST00000394008.1	+	1	35_36	c.33_34insACCTGCTGCAGGACC	c.(34-36)acc>ACCTGCTGCAGGACCacc	p.12_12T>TCCRTT		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	12	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTCAGCCTACCTGCTGCAG	0.604														2488	0.496805	0.298	0.647	5008	,	,		16406	0.4196		0.5805	False		,,,				2504	0.6524																0								ENSG00000198083																																			KRTAP9-9	SO:0001652	inframe_insertion	0				HGNC	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.34_48dupACCTGCTGCAGGACC	17.37:g.39411670_39411671insACCTGCTGCAGGACC	Exception_encountered	Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B5MDD6|Q9BYQ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.15in_frame_insTTCCR	ENST00000394008.1	37	c.33_34	CCDS54127.1	17																																																																																			-	NULL		0.604	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	protein_coding	OTTHUMT00000257710.1	-	NM_030975			39411671	+1	no_errors	ENST00000394008	ensembl	human	known	74_37	in_frame_ins	INS	0.053:0.940	ACCTGCTGCAGGACC
AMER3	205147	genome.wustl.edu	37	2	131521477	131521477	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:131521477G>T	ENST00000423981.1	+	2	1942	c.1832G>T	c.(1831-1833)gGc>gTc	p.G611V	AMER3_ENST00000321420.4_Missense_Mutation_p.G611V	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	611					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CACTCTGAAGGCTTGTTCTCC	0.577																																																	0								ENSG00000178171						69.0	72.0	71.0					2																	131521477		2203	4300	6503	AMER3	SO:0001583	missense	0			-	HGNC	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1832G>T	2.37:g.131521477G>T	ENSP00000392700:p.Gly611Val	Somatic	0	85	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	B7ZLH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM123	p.G611V	ENST00000423981.1	37	c.1832	CCDS2164.1	2	.	.	.	.	.	.	.	.	.	.	G	9.489	1.100268	0.20552	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.48522	0.81;0.81	4.57	1.71	0.24356	.	1.746490	0.03424	N	0.206703	T	0.42223	0.1193	L	0.27053	0.805	0.09310	N	0.999998	P	0.34780	0.468	B	0.39503	0.301	T	0.41378	-0.9512	10	0.52906	T	0.07	.	8.6796	0.34201	0.2848:0.0:0.7152:0.0	.	611	Q8N944	F123C_HUMAN	V	611	ENSP00000314914:G611V;ENSP00000392700:G611V	ENSP00000314914:G611V	G	+	2	0	FAM123C	131237947	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.284000	0.18864	0.137000	0.18759	-1.134000	0.01955	GGC	-	NULL		0.577	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER3	protein_coding	OTTHUMT00000254531.3	G	NM_152698	-		131521477	+1	no_errors	ENST00000321420	ensembl	human	known	74_37	missense	SNP	0.010	T
MAPK11	5600	genome.wustl.edu	37	22	50705444	50705444	+	Missense_Mutation	SNP	C	C	T	rs202139039		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr22:50705444C>T	ENST00000330651.6	-	7	629	c.529G>A	c.(529-531)Gag>Aag	p.E177K	MAPK11_ENST00000495277.1_5'Flank|MAPK11_ENST00000449719.2_Missense_Mutation_p.E69K	NM_002751.5	NP_002742.3	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	177	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|lung(4)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Regorafenib(DB08896)	GTCATCTCCTCGTCCGCCTGG	0.657																																					GBM(9;634 739 50668)												0								ENSG00000185386						66.0	60.0	62.0					22																	50705444		2201	4299	6500	MAPK11	SO:0001583	missense	0			-	HGNC	Y14440	CCDS14090.1	22q13.33	2011-06-09			ENSG00000185386	ENSG00000185386	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6873	protein-coding gene	gene with protein product		602898		PRKM11		9218798	Standard	NM_002751		Approved	p38-2, p38Beta, SAPK2	uc003bkr.3	Q15759	OTTHUMG00000150226	ENST00000330651.6:c.529G>A	22.37:g.50705444C>T	ENSP00000333685:p.Glu177Lys	Somatic	0	26	0.00		0.6352087463037039	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	17.78	A8K730|B0LPG1|B7Z630|E7ETQ1|L7RT27|O00284|O15472|Q2XNF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_p38,prints_MAPK_JNK	p.E177K	ENST00000330651.6	37	c.529	CCDS14090.1	22	.	.	.	.	.	.	.	.	.	.	c	14.98	2.697830	0.48307	.	.	ENSG00000185386	ENST00000330651;ENST00000449719	T;T	0.14516	2.5;2.5	4.96	4.96	0.65561	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.220722	0.38959	U	0.001505	T	0.15003	0.0362	N	0.21583	0.68	0.58432	D	0.999997	P;B	0.48764	0.915;0.026	P;B	0.48425	0.577;0.011	T	0.06570	-1.0819	10	0.27785	T	0.31	-22.0367	17.0156	0.86418	0.0:1.0:0.0:0.0	.	69;177	B7Z630;Q15759	.;MK11_HUMAN	K	177;69	ENSP00000333685:E177K;ENSP00000406921:E69K	ENSP00000333685:E177K	E	-	1	0	MAPK11	49047571	0.997000	0.39634	0.957000	0.39632	0.020000	0.10135	3.780000	0.55386	2.332000	0.79248	0.537000	0.68136	GAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.657	MAPK11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK11	protein_coding	OTTHUMT00000316900.1	C		rs202139039		50705444	-1	no_errors	ENST00000330651	ensembl	human	known	74_37	missense	SNP	1.000	T
IZUMO1	284359	genome.wustl.edu	37	19	49245484	49245484	+	Silent	SNP	A	A	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:49245484A>C	ENST00000332955.2	-	7	1129	c.582T>G	c.(580-582)acT>acG	p.T194T	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	194	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		AGCTGTAATCAGTGAGGCCTT	0.507																																																	0								ENSG00000182264						167.0	151.0	157.0					19																	49245484		2203	4300	6503	IZUMO1	SO:0001819	synonymous_variant	0			-	HGNC	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.582T>G	19.37:g.49245484A>C		Somatic	0	134	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	65	10.96	Q6Q8P6|Q6Q8P7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T194	ENST00000332955.2	37	c.582	CCDS12732.1	19																																																																																			-	NULL		0.507	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IZUMO1	protein_coding	OTTHUMT00000466189.1	A	NM_182575	-		49245484	-1	no_errors	ENST00000332955	ensembl	human	known	74_37	silent	SNP	0.003	C
SLAMF6	114836	genome.wustl.edu	37	1	160465892	160465892	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:160465892T>C	ENST00000368057.3	-	2	401	c.341A>G	c.(340-342)aAg>aGg	p.K114R	SLAMF6_ENST00000368055.1_Intron|SLAMF6_ENST00000368059.3_Missense_Mutation_p.K114R			Q96DU3	SLAF6_HUMAN	SLAM family member 6	114	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			TGCAGAGGTCTTTGTGGATAT	0.423																																																	0								ENSG00000162739						152.0	147.0	149.0					1																	160465892		2203	4300	6503	SLAMF6	SO:0001583	missense	0			-	HGNC	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.341A>G	1.37:g.160465892T>C	ENSP00000357036:p.Lys114Arg	Somatic	0	126	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	100	15.25	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.K114R	ENST00000368057.3	37	c.341	CCDS53394.1	1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.317737	0.23994	.	.	ENSG00000162739	ENST00000368059;ENST00000368057	T;T	0.65549	-0.16;-0.16	4.95	-3.71	0.04424	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	33.255300	0.00166	N	0.000001	T	0.21347	0.0514	N	0.21508	0.67	0.20074	N	0.999936	B;B;B;B	0.17465	0.009;0.005;0.022;0.022	B;B;B;B	0.12837	0.007;0.005;0.008;0.008	T	0.06445	-1.0826	10	0.27082	T	0.32	6.1126	6.2116	0.20631	0.3684:0.0:0.376:0.2555	.	65;114;114;114	B4E1U5;Q96DU3-2;Q96DU3;B2R8X8	.;.;SLAF6_HUMAN;.	R	114	ENSP00000357038:K114R;ENSP00000357036:K114R	ENSP00000357036:K114R	K	-	2	0	SLAMF6	158732516	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.525000	0.06214	-0.925000	0.03775	0.533000	0.62120	AAG	-	pfam_Ig_V-set,smart_Ig_sub		0.423	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF6	protein_coding	OTTHUMT00000059010.1	T	NM_052931	-		160465892	-1	no_errors	ENST00000368057	ensembl	human	known	74_37	missense	SNP	0.000	C
CYLC2	1539	genome.wustl.edu	37	9	105767425	105767425	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:105767425G>A	ENST00000374798.3	+	5	582	c.512G>A	c.(511-513)gGc>gAc	p.G171D	CYLC2_ENST00000487798.1_Missense_Mutation_p.G171D	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	171	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				gcagagaagggcaaagactca	0.348																																																	0								ENSG00000155833						75.0	72.0	73.0					9																	105767425		2203	4300	6503	CYLC2	SO:0001583	missense	0			-	HGNC	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.512G>A	9.37:g.105767425G>A	ENSP00000420256:p.Gly171Asp	Somatic	0	44	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G171D	ENST00000374798.3	37	c.512	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	G	8.979	0.974767	0.18736	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.14022	2.54;2.54	4.54	-2.69	0.06022	.	0.310345	0.23354	N	0.049095	T	0.11110	0.0271	M	0.79258	2.445	0.21220	N	0.999751	P	0.40107	0.703	B	0.38562	0.276	T	0.18116	-1.0347	10	0.20519	T	0.43	-0.9296	1.07	0.01619	0.3371:0.2622:0.2669:0.1338	.	171	Q14093	CYLC2_HUMAN	D	171	ENSP00000420256:G171D;ENSP00000417674:G171D	ENSP00000420256:G171D	G	+	2	0	CYLC2	104807246	0.000000	0.05858	0.033000	0.17914	0.038000	0.13279	-0.677000	0.05215	-0.279000	0.09167	0.543000	0.68304	GGC	-	NULL		0.348	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	protein_coding	OTTHUMT00000053463.3	G	NM_001340	-		105767425	+1	no_errors	ENST00000374798	ensembl	human	known	74_37	missense	SNP	0.006	A
DLX3	1747	genome.wustl.edu	37	17	48070845	48070845	+	Silent	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:48070845C>T	ENST00000434704.2	-	2	660	c.435G>A	c.(433-435)caG>caA	p.Q145Q	DLX3_ENST00000512495.2_Silent_p.Q25Q	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	145					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						GGAAGCGGCGCTGCAGGGCGG	0.662																																																	0								ENSG00000064195						47.0	43.0	44.0					17																	48070845		2203	4300	6503	DLX3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.435G>A	17.37:g.48070845C>T		Somatic	0	72	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	B3KQL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Distal-less_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.Q145	ENST00000434704.2	37	c.435	CCDS11556.1	17																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.662	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX3	protein_coding	OTTHUMT00000366307.1	C		-		48070845	-1	no_errors	ENST00000434704	ensembl	human	known	74_37	silent	SNP	1.000	T
FAM153C	653316	genome.wustl.edu	37	5	177480916	177480916	+	3'UTR	SNP	T	T	G	rs138887342		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:177480916T>G	ENST00000511511.1	+	0	964							Q494X1	F153C_HUMAN	family with sequence similarity 153, member C											kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCACACTCTTCTGAAACGA	0.398																																																	0								ENSG00000204677																																			FAM153C	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC101338		5q35.3	2008-01-09				ENSG00000204677			33936	protein-coding gene	gene with protein product							Standard	NR_038353		Approved	NY-REN-7-like	uc011dge.2	Q494X1		ENST00000511511.1:c.*961T>G	5.37:g.177480916T>G		Somatic	0	11	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	3	66.67	A4IF33|B2RUV5|B7ZW12	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000511511.1	37	NULL		5																																																																																			-	-		0.398	FAM153C-006	KNOWN	basic	processed_transcript	FAM153C	protein_coding	OTTHUMT00000373560.1	T	NM_001079527	rs138887342		177480916	+1	no_errors	ENST00000506096	ensembl	human	known	74_37	rna	SNP	0.011	G
LAG3	3902	genome.wustl.edu	37	12	6883914	6883914	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:6883914C>T	ENST00000203629.2	+	4	998	c.665C>T	c.(664-666)gCg>gTg	p.A222V	LAG3_ENST00000441671.2_Missense_Mutation_p.A222V	NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	222	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CACCACTTAGCGGAAAGCTTC	0.627																																																	0								ENSG00000089692						74.0	74.0	74.0					12																	6883914		2203	4300	6503	LAG3	SO:0001583	missense	0			-	HGNC		CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.665C>T	12.37:g.6883914C>T	ENSP00000203629:p.Ala222Val	Somatic	0	113	0.00		0.6352087463037039	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	70	33.96	A8K7T9|Q7Z643	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,pfscan_Ig-like_dom	p.A222V	ENST00000203629.2	37	c.665	CCDS8561.1	12	.	.	.	.	.	.	.	.	.	.	C	9.756	1.168796	0.21621	.	.	ENSG00000089692	ENST00000441671;ENST00000203629	T;T	0.14893	2.47;2.75	5.06	-3.77	0.04346	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.793216	0.11197	N	0.589247	T	0.06416	0.0165	N	0.12746	0.255	0.09310	N	1	B;B	0.18310	0.011;0.027	B;B	0.15484	0.013;0.013	T	0.33033	-0.9884	10	0.28530	T	0.3	0.0922	2.3737	0.04337	0.1217:0.3348:0.1201:0.4234	.	222;222	P18627;Q7Z643	LAG3_HUMAN;.	V	222	ENSP00000413825:A222V;ENSP00000203629:A222V	ENSP00000203629:A222V	A	+	2	0	LAG3	6754175	0.000000	0.05858	0.000000	0.03702	0.742000	0.42306	-1.449000	0.02392	-0.669000	0.05289	0.313000	0.20887	GCG	-	smart_Ig_sub,pfscan_Ig-like_dom		0.627	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAG3	protein_coding	OTTHUMT00000402846.1	C		-		6883914	+1	no_errors	ENST00000203629	ensembl	human	known	74_37	missense	SNP	0.000	T
LPAR2	9170	genome.wustl.edu	37	19	19735363	19735363	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:19735363C>T	ENST00000542587.1	-	6	1660	c.758G>A	c.(757-759)tGc>tAc	p.C253Y	LPAR2_ENST00000586703.1_Missense_Mutation_p.C253Y|LPAR2_ENST00000407877.3_Missense_Mutation_p.C253Y			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	253					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						TGGTGTCCAGCAGACCACGAA	0.597																																																	0								ENSG00000064547						53.0	51.0	52.0					19																	19735363		2203	4300	6503	LPAR2	SO:0001583	missense	0			-	HGNC	AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.758G>A	19.37:g.19735363C>T	ENSP00000443256:p.Cys253Tyr	Somatic	0	32	0.00		0.6352087463037039	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	O00543|O43431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG4,prints_GPCR_Rhodpsn,prints_LPA_rcpt,prints_LPA_rcpt_EDG2,prints_Melcrt_ACTH_rcpt,prints_S1P_rcpt	p.C253Y	ENST00000542587.1	37	c.758	CCDS12407.1	19	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186760	0.78789	.	.	ENSG00000064547	ENST00000407877;ENST00000542587	T;T	0.54279	0.58;0.58	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.050757	0.85682	D	0.000000	T	0.78349	0.4269	H	0.94620	3.56	0.80722	D	1	D	0.56746	0.977	D	0.65323	0.934	D	0.84984	0.0890	10	0.87932	D	0	.	14.8828	0.70545	0.0:1.0:0.0:0.0	.	253	Q9HBW0	LPAR2_HUMAN	Y	253	ENSP00000384665:C253Y;ENSP00000443256:C253Y	ENSP00000384665:C253Y	C	-	2	0	LPAR2	19596363	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.454000	0.80714	2.370000	0.80446	0.561000	0.74099	TGC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.597	LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	LPAR2	protein_coding	OTTHUMT00000460544.1	C	NM_004720	-		19735363	-1	no_errors	ENST00000407877	ensembl	human	known	74_37	missense	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152282747	152282747	+	Missense_Mutation	SNP	T	T	G	rs536230632		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:152282747T>G	ENST00000368799.1	-	3	4650	c.4615A>C	c.(4615-4617)Agt>Cgt	p.S1539R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1539	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1539R(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGGTCCT	0.572									Ichthyosis				T|||	1	0.000199681	0.0	0.0	5008	,	,		20676	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	large_intestine(1)|lung(1)						ENSG00000143631						303.0	293.0	296.0					1																	152282747		2203	4300	6503	FLG	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	-	HGNC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4615A>C	1.37:g.152282747T>G	ENSP00000357789:p.Ser1539Arg	Somatic	0	151	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	118	18.49	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S1539R	ENST00000368799.1	37	c.4615	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203497	0.22121	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.67	-0.792	0.10925	.	.	.	.	.	T	0.00784	0.0026	M	0.75447	2.3	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.42050	-0.9474	9	0.25106	T	0.35	.	5.1967	0.15243	0.0:0.4182:0.0:0.5818	.	1539	P20930	FILA_HUMAN	R	1539	ENSP00000357789:S1539R	ENSP00000357789:S1539R	S	-	1	0	FLG	150549371	0.003000	0.15002	0.000000	0.03702	0.169000	0.22640	0.226000	0.17776	-0.281000	0.09141	0.397000	0.26171	AGT	-	NULL		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	T	NM_002016	-		152282747	-1	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	SNP	0.000	G
LOC100190940	100190940	genome.wustl.edu	37	12	130521460	130521460	+	lincRNA	SNP	A	A	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:130521460A>C	ENST00000567788.1	-	0	1241				RP11-474D1.4_ENST00000561864.1_lincRNA																							TGGGGCCTCAAGGTCCAGTGT	0.572																																																	0								ENSG00000214039																																			RP11-474D1.3			0			-	Clone_based_vega_gene																													12.37:g.130521460A>C		Somatic	0	59	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			-	-		0.572	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	lincRNA	OTTHUMT00000399498.1	A		-		130521460	-1	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	SNP	0.000	C
WHSC1	7468	genome.wustl.edu	37	4	1902605	1902605	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr4:1902605C>T	ENST00000382895.3	+	4	655	c.224C>T	c.(223-225)cCa>cTa	p.P75L	WHSC1_ENST00000514045.1_Missense_Mutation_p.P75L|WHSC1_ENST00000382891.5_Missense_Mutation_p.P75L|WHSC1_ENST00000420906.2_Missense_Mutation_p.P75L|WHSC1_ENST00000503128.1_Missense_Mutation_p.P75L|WHSC1_ENST00000436793.1_Missense_Mutation_p.P75L|WHSC1_ENST00000398261.1_Missense_Mutation_p.P75L|WHSC1_ENST00000508803.1_Missense_Mutation_p.P75L|WHSC1_ENST00000382892.2_Missense_Mutation_p.P75L	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	75					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CCCTTTATTCCAGCCGACAAG	0.542			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0								ENSG00000109685						62.0	65.0	64.0					4																	1902605		2203	4300	6503	WHSC1	SO:0001583	missense	0			-	HGNC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.224C>T	4.37:g.1902605C>T	ENSP00000372351:p.Pro75Leu	Somatic	0	63	0.00		0.6352087463037039	84	44.08	67	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	32	48.39	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.P75L	ENST00000382895.3	37	c.224	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892967	0.91889	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000515806;ENST00000382891;ENST00000382892;ENST00000436793;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000509115;ENST00000398261	D;T;T;D;D;T;T;D;T;T;T	0.95103	-3.61;1.12;0.81;-3.61;-3.61;0.84;1.12;-3.61;1.1;1.15;1.1	5.59	5.59	0.84812	.	0.000000	0.64402	D	0.000020	D	0.96744	0.8937	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.995;1.0;1.0	D;D;P;D;D	0.91635	0.999;0.999;0.856;0.999;0.999	D	0.97057	0.9768	10	0.87932	D	0	.	19.5874	0.95495	0.0:1.0:0.0:0.0	.	75;75;75;75;75	O96028-3;O96028-7;O96028;O96028-5;O96028-6	.;.;NSD2_HUMAN;.;.	L	75	ENSP00000423972:P75L;ENSP00000421681:P75L;ENSP00000427434:P75L;ENSP00000372347:P75L;ENSP00000372348:P75L;ENSP00000416725:P75L;ENSP00000399251:P75L;ENSP00000372351:P75L;ENSP00000425761:P75L;ENSP00000422878:P75L;ENSP00000381311:P75L	ENSP00000308780:P75L	P	+	2	0	WHSC1	1872403	1.000000	0.71417	0.530000	0.27963	0.965000	0.64279	4.189000	0.58358	2.622000	0.88805	0.655000	0.94253	CCA	-	NULL		0.542	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	protein_coding	OTTHUMT00000366269.2	C	NM_133330	-		1902605	+1	no_errors	ENST00000382891	ensembl	human	known	74_37	missense	SNP	0.996	T
MSH3	4437	genome.wustl.edu	37	5	79950700	79950717	+	In_Frame_Del	DEL	GCAGCGGCTGCAGCGGCC	GCAGCGGCTGCAGCGGCC	-	rs530525176|rs2431220|rs2405875|rs144776112|rs201874762|rs201906899	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	GCAGCGGCTGCAGCGGCC	GCAGCGGCTGCAGCGGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:79950700_79950717delGCAGCGGCTGCAGCGGCC	ENST00000265081.6	+	1	234_251	c.154_171delGCAGCGGCTGCAGCGGCC	c.(154-171)gcagcggctgcagcggccdel	p.AAAAAA52del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	52	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CCCTGGCGCTgcagcggctgcagcggccgcagcggccg	0.693								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318		,	1153,2933		197,759,1087					,		0.2		dbSNP_100	12	2199,5723		382,1435,2144	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	579,2194,3231	A1A1,A1R,RR		27.7581,28.2183,27.9147	,	,		3352,8656				MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.154_171delGCAGCGGCTGCAGCGGCC	5.37:g.79950700_79950717delGCAGCGGCTGCAGCGGCC	ENSP00000265081:p.Ala52_Ala57del	Somatic	NA	NA	NA		0.6352087463037039	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.AAAAAA55in_frame_del	ENST00000265081.6	37	c.154_171	CCDS34195.1	5																																																																																			-	NULL		0.693	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	GCAGCGGCTGCAGCGGCC	NM_002439			79950717	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.640:0.607:0.574:0.541:0.508:0.474:0.440:0.406:0.372:0.338:0.304:0.271:0.238:0.205:0.172:0.140:0.107:0.075	-
CBLB	868	genome.wustl.edu	37	3	105412343	105412343	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr3:105412343G>T	ENST00000264122.4	-	13	2370	c.2049C>A	c.(2047-2049)agC>agA	p.S683R	CBLB_ENST00000394027.3_Missense_Mutation_p.S705R|CBLB_ENST00000403724.1_Missense_Mutation_p.S683R|CBLB_ENST00000405772.1_Missense_Mutation_p.S683R	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	683	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						CTCACTTTATGCTAGGGAGGA	0.428			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)			Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0								ENSG00000114423						96.0	93.0	94.0					3																	105412343		2203	4300	6503	CBLB	SO:0001583	missense	0			-	HGNC	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2049C>A	3.37:g.105412343G>T	ENSP00000264122:p.Ser683Arg	Somatic	0	82	0.00		0.6352087463037039	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.S683R	ENST00000264122.4	37	c.2049	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761154	0.31137	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	T;D;D;D;D	0.85171	-1.37;-1.91;-1.91;-1.93;-1.95	5.45	3.66	0.41972	.	0.295779	0.41605	D	0.000853	T	0.78534	0.4298	L	0.51422	1.61	0.80722	D	1	B;B;B	0.29805	0.079;0.062;0.257	B;B;B	0.26517	0.07;0.031;0.049	T	0.74417	-0.3672	10	0.87932	D	0	-8.91	6.7233	0.23342	0.3982:0.0:0.6018:0.0	.	705;683;683	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	R	66;683;705;683;683	ENSP00000377598:S66R;ENSP00000264122:S683R;ENSP00000377595:S705R;ENSP00000384816:S683R;ENSP00000384938:S683R	ENSP00000264122:S683R	S	-	3	2	CBLB	106895033	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.038000	0.30254	0.674000	0.31244	0.591000	0.81541	AGC	-	NULL		0.428	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	protein_coding	OTTHUMT00000319417.2	G	NM_170662	-		105412343	-1	no_errors	ENST00000264122	ensembl	human	known	74_37	missense	SNP	0.998	T
PDE7A	5150	genome.wustl.edu	37	8	66754199	66754207	+	5'Flank	DEL	GCCGCCGCC	GCCGCCGCC	-	rs374471521|rs568131931|rs376061587	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	GCCGCCGCC	GCCGCCGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr8:66754199_66754207delGCCGCCGCC	ENST00000401827.3	-	0	0				CTD-2532N20.1_ENST00000607622.1_lincRNA|PDE7A_ENST00000396642.3_5'Flank	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A						cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	ACCAGCTCGGgccgccgccgccgccgccg	0.722																																																	0								ENSG00000205268																																			PDE7A	SO:0001631	upstream_gene_variant	0				HGNC	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946			8.37:g.66754208_66754216delGCCGCCGCC	Exception_encountered	Somatic	NA	NA	NA		0.6352087463037039	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401827.3	37	NULL	CCDS56538.1	8																																																																																			-	-		0.722	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7A	protein_coding	OTTHUMT00000378905.1	GCCGCCGCC				66754207	-1	no_errors	ENST00000519231	ensembl	human	known	74_37	rna	DEL	0.022:0.022:0.011:0.011:0.010:0.012:0.436:0.989:0.997	-
EDIL3	10085	genome.wustl.edu	37	5	83362283	83362283	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:83362283G>A	ENST00000296591.5	-	7	1212	c.794C>T	c.(793-795)aCc>aTc	p.T265I	EDIL3_ENST00000510271.1_5'UTR|EDIL3_ENST00000380138.3_Missense_Mutation_p.T255I	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	265	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GTCTTCATTGGTGCCTTTCAC	0.343																																																	0								ENSG00000164176						89.0	97.0	94.0					5																	83362283		2203	4300	6503	EDIL3	SO:0001583	missense	0			-	HGNC	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.794C>T	5.37:g.83362283G>A	ENSP00000296591:p.Thr265Ile	Somatic	0	64	0.00		0.6352087463037039	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,pfam_EGF_extracell,superfamily_Galactose-bd-like,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.T265I	ENST00000296591.5	37	c.794	CCDS4062.1	5	.	.	.	.	.	.	.	.	.	.	G	17.27	3.348044	0.61183	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.98987	-5.3;-5.3	6.06	5.16	0.70880	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.179623	0.64402	D	0.000016	D	0.97851	0.9294	L	0.35854	1.095	0.49798	D	0.99982	B;P;P	0.48503	0.019;0.911;0.457	B;P;B	0.47981	0.034;0.563;0.216	D	0.97925	1.0317	10	0.49607	T	0.09	-20.0602	17.4333	0.87544	0.0:0.124:0.876:0.0	.	42;255;265	B7Z865;O43854-2;O43854	.;.;EDIL3_HUMAN	I	265;255	ENSP00000296591:T265I;ENSP00000369483:T255I	ENSP00000296591:T265I	T	-	2	0	EDIL3	83398039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.394000	0.52551	2.882000	0.98803	0.655000	0.94253	ACC	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.343	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EDIL3	protein_coding	OTTHUMT00000239258.1	G	NM_005711	-		83362283	-1	no_errors	ENST00000296591	ensembl	human	known	74_37	missense	SNP	1.000	A
APBA1	320	genome.wustl.edu	37	9	72056032	72056032	+	Splice_Site	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:72056032C>G	ENST00000265381.4	-	11	2404		c.e11-1			NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1						axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TCTTTAAGCCCTTAAACATGA	0.473																																																	0								ENSG00000107282						109.0	95.0	100.0					9																	72056032		2203	4300	6503	APBA1	SO:0001630	splice_region_variant	0			-	HGNC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2182-1G>C	9.37:g.72056032C>G		Somatic	0	55	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	O14914|O60570|Q5VYR8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e10-1	ENST00000265381.4	37	c.2182-1	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493200	0.84962	.	.	ENSG00000107282	ENST00000265381	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	APBA1	71245852	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.711000	0.84669	2.793000	0.96121	0.655000	0.94253	.	-	-		0.473	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	protein_coding	OTTHUMT00000052589.2	C	NM_001163	-	Intron	72056032	-1	no_errors	ENST00000265381	ensembl	human	known	74_37	splice_site	SNP	1.000	G
AP3S2	10239	genome.wustl.edu	37	15	90378806	90378806	+	Missense_Mutation	SNP	G	G	A	rs139910320		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr15:90378806G>A	ENST00000336418.4	-	6	915	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	AP3S2_ENST00000560771.1_5'UTR|AP3S2_ENST00000560940.1_Intron|AP3S2_ENST00000558011.1_Missense_Mutation_p.R187W|C15orf38-AP3S2_ENST00000398333.3_Missense_Mutation_p.R376W	NM_005829.4	NP_005820.1	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2 subunit	175					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)	protein transporter activity (GO:0008565)			NS(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(1)	6	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			TTGATGTTCCGAGGAATCTCT	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		17947	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000250021	G	TRP/ARG,TRP/ARG	0,4400		0,0,2200	210.0	186.0	195.0		1126,523	2.5	0.5	15	dbSNP_134	195	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	AP3S2,C15orf38-AP3S2	NM_001199058.1,NM_005829.4	101,101	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	376/395,175/194	90378806	1,12997	2200	4299	6499	C15orf38-AP3S2	SO:0001583	missense	0			GMAF=0.0005	HGNC	X99459	CCDS10357.1	15q26.1	2010-08-13			ENSG00000157823	ENSG00000157823			571	protein-coding gene	gene with protein product		602416				9118953	Standard	NM_005829		Approved	sigma3b		P59780	OTTHUMG00000149811	ENST00000336418.4:c.523C>T	15.37:g.90378806G>A	ENSP00000338777:p.Arg175Trp	Somatic	0	88	0.00		0.6352087463037039	182	20.87	48	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	81	11.96	B2R677|B4DGQ3|O09077|O09149|Q53H83|Q99589	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0552,pfam_AP_mu_sigma_su,superfamily_Longin-like_dom	p.R376W	ENST00000336418.4	37	c.1126	CCDS10357.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	21.0	4.086444	0.76642	0.0	1.16E-4	ENSG00000157823;ENSG00000250021	ENST00000336418;ENST00000398333	T;T	0.48836	0.81;0.8	5.53	2.54	0.30619	.	0.075543	0.53938	N	0.000051	T	0.52597	0.1744	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.68765	0.96;0.834	T	0.50717	-0.8795	10	0.87932	D	0	-15.4349	7.9248	0.29867	0.0771:0.0:0.6294:0.2935	.	376;175	E2QRD5;P59780	.;AP3S2_HUMAN	W	175;376	ENSP00000338777:R175W;ENSP00000381377:R376W	ENSP00000338777:R175W	R	-	1	2	C15orf38-AP3S2;AP3S2	88179810	1.000000	0.71417	0.532000	0.27989	0.988000	0.76386	3.781000	0.55394	0.346000	0.23899	-0.140000	0.14226	CGG	-	NULL		0.488	AP3S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf38-AP3S2	protein_coding	OTTHUMT00000313422.1	G		rs139910320		90378806	-1	no_errors	ENST00000398333	ensembl	human	known	74_37	missense	SNP	0.961	A
PRG4	10216	genome.wustl.edu	37	1	186282866	186282866	+	Missense_Mutation	SNP	C	C	A	rs146737948		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:186282866C>A	ENST00000445192.2	+	13	4216	c.4171C>A	c.(4171-4173)Cgt>Agt	p.R1391S	PRG4_ENST00000367486.3_Missense_Mutation_p.R1348S|RNU6-1240P_ENST00000365155.1_RNA|TPR_ENST00000367478.4_3'UTR|PRG4_ENST00000367483.4_Missense_Mutation_p.R1350S|PRG4_ENST00000367484.3_Missense_Mutation_p.R920S|PRG4_ENST00000367485.4_Missense_Mutation_p.R1298S	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1391					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AATTACTACTCGTTCTGGGCA	0.348																																																	0								ENSG00000116690						118.0	113.0	115.0					1																	186282866		2203	4300	6503	PRG4	SO:0001583	missense	0			-	HGNC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.4171C>A	1.37:g.186282866C>A	ENSP00000399679:p.Arg1391Ser	Somatic	0	106	0.00		0.6352087463037039	3	72.73	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	47	57.66	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.R1391S	ENST00000445192.2	37	c.4171	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780022	0.49891	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.95	5.02	0.67125	Hemopexin/matrixin (2);	0.152547	0.30639	N	0.009183	T	0.60130	0.2245	L	0.57536	1.79	0.22754	N	0.998775	D;D;D;D	0.63880	0.993;0.993;0.989;0.993	P;P;P;P	0.60473	0.875;0.875;0.822;0.875	T	0.56086	-0.8037	10	0.72032	D	0.01	-2.6052	11.8645	0.52486	0.138:0.7293:0.1327:0.0	.	1257;1298;1391;1350	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	S	1348;920;1350;1298;1391	ENSP00000356456:R1348S;ENSP00000356454:R920S;ENSP00000356453:R1350S;ENSP00000356455:R1298S;ENSP00000399679:R1391S	ENSP00000356453:R1350S	R	+	1	0	PRG4	184549489	0.578000	0.26717	0.993000	0.49108	0.996000	0.88848	1.424000	0.34848	1.485000	0.48380	0.650000	0.86243	CGT	-	superfamily_Hemopexin-like_dom		0.348	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	protein_coding	OTTHUMT00000086346.1	C	NM_005807	-		186282866	+1	no_errors	ENST00000445192	ensembl	human	known	74_37	missense	SNP	0.672	A
GAB4	128954	genome.wustl.edu	37	22	17443672	17443672	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr22:17443672T>C	ENST00000400588.1	-	10	1783	c.1676A>G	c.(1675-1677)cAg>cGg	p.Q559R		NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	559										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CAGGCACATCTGTTCATGCAT	0.612																																																	0								ENSG00000215568						58.0	61.0	60.0					22																	17443672		2198	4300	6498	GAB4	SO:0001583	missense	0			-	HGNC	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1676A>G	22.37:g.17443672T>C	ENSP00000383431:p.Gln559Arg	Somatic	0	51	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	12	80.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q559R	ENST00000400588.1	37	c.1676	CCDS42976.1	22	.	.	.	.	.	.	.	.	.	.	T	8.171	0.791632	0.16258	.	.	ENSG00000215568	ENST00000400588	T	0.22134	1.97	2.46	1.42	0.22433	.	0.118666	0.64402	D	0.000008	T	0.10165	0.0249	N	0.22421	0.69	0.26106	N	0.980744	P	0.37061	0.58	B	0.26614	0.071	T	0.19289	-1.0310	10	0.72032	D	0.01	.	7.054	0.25089	0.0:0.8455:0.0:0.1545	.	559	Q2WGN9	GAB4_HUMAN	R	559	ENSP00000383431:Q559R	ENSP00000383431:Q559R	Q	-	2	0	GAB4	15823672	1.000000	0.71417	0.997000	0.53966	0.001000	0.01503	5.207000	0.65197	0.577000	0.29470	-0.427000	0.05922	CAG	-	NULL		0.612	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	protein_coding	OTTHUMT00000315426.1	T	XM_372882	-		17443672	-1	no_errors	ENST00000400588	ensembl	human	known	74_37	missense	SNP	1.000	C
OR6N1	128372	genome.wustl.edu	37	1	158735723	158735723	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:158735723G>A	ENST00000335094.2	-	1	769	c.750C>T	c.(748-750)atC>atT	p.I250I		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TCCCATAGAAGATGAGAACCA	0.537																																																	0								ENSG00000197403						174.0	164.0	168.0					1																	158735723		2203	4300	6503	OR6N1	SO:0001819	synonymous_variant	0			-	HGNC	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.750C>T	1.37:g.158735723G>A		Somatic	0	51	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	21	53.33	Q5VUU8|Q96R35	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I250	ENST00000335094.2	37	c.750	CCDS30905.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.537	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	protein_coding	OTTHUMT00000059067.1	G	NM_001005185	-		158735723	-1	no_errors	ENST00000335094	ensembl	human	known	74_37	silent	SNP	0.996	A
CASP5	838	genome.wustl.edu	37	11	104868114	104868114	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:104868114C>T	ENST00000260315.3	-	8	1201	c.1202G>A	c.(1201-1203)cGg>cAg	p.R401Q	CASP5_ENST00000531367.1_Missense_Mutation_p.R259Q|CASP5_ENST00000393139.2_3'UTR|CASP5_ENST00000418434.1_Missense_Mutation_p.R259Q|CASP5_ENST00000393141.2_Missense_Mutation_p.R414Q|CASP5_ENST00000526056.1_Missense_Mutation_p.R414Q|CASP5_ENST00000444749.2_Missense_Mutation_p.R343Q			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	401					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GCTTACCTTCCGAAATATTTC	0.388																																																	0								ENSG00000137757						90.0	88.0	88.0					11																	104868114		2202	4299	6501	CASP5	SO:0001583	missense	0			-	HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.1202G>A	11.37:g.104868114C>T	ENSP00000260315:p.Arg401Gln	Somatic	0	113	0.00		0.6352087463037039	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	31	47.46	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R414Q	ENST00000260315.3	37	c.1241	CCDS8328.2	11	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803843	0.31869	.	.	ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367	T;T;T;T;T;T	0.03152	4.03;4.03;4.03;4.03;4.03;4.03	3.6	-7.01	0.01594	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.527934	0.18195	N	0.148715	T	0.02929	0.0087	L	0.45744	1.44	0.09310	N	1	B;P;B;B	0.49696	0.278;0.927;0.1;0.153	B;P;B;B	0.44518	0.192;0.452;0.291;0.204	T	0.08848	-1.0702	10	0.30078	T	0.28	.	4.268	0.10773	0.2361:0.3596:0.0:0.4042	.	259;343;401;414	P51878-3;P51878-2;P51878;P51878-5	.;.;CASP5_HUMAN;.	Q	414;259;401;343;414;259	ENSP00000376849:R414Q;ENSP00000398130:R259Q;ENSP00000260315:R401Q;ENSP00000388365:R343Q;ENSP00000436877:R414Q;ENSP00000434471:R259Q	ENSP00000260315:R401Q	R	-	2	0	CASP5	104373324	0.002000	0.14202	0.005000	0.12908	0.186000	0.23388	-0.471000	0.06631	-1.358000	0.02177	-0.412000	0.06146	CGG	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_p10		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	C	NM_004347	-		104868114	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	missense	SNP	0.001	T
TARSL2	123283	genome.wustl.edu	37	15	102226182	102226182	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr15:102226182C>A	ENST00000335968.3	-	11	1620	c.1404G>T	c.(1402-1404)tgG>tgT	p.W468C	snoU13_ENST00000458877.1_RNA	NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	468					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.W468*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGTAATGCTGCCAGTGGCCTG	0.458																																																	1	Substitution - Nonsense(1)	central_nervous_system(1)						ENSG00000185418						154.0	143.0	147.0					15																	102226182		2203	4300	6503	TARSL2	SO:0001583	missense	0			-	HGNC	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1404G>T	15.37:g.102226182C>A	ENSP00000338093:p.Trp468Cys	Somatic	0	55	0.00		0.6352087463037039	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.W468C	ENST00000335968.3	37	c.1404	CCDS10394.1	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507525	0.85282	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	T;T	0.69435	-0.4;-0.4	5.93	5.93	0.95920	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.90400	0.6995	H	0.99516	4.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94034	0.7303	10	0.87932	D	0	-8.1057	17.8477	0.88736	0.0:1.0:0.0:0.0	.	468;373	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	C	468;373;468	ENSP00000338093:W468C;ENSP00000439899:W468C	ENSP00000329291:W373C	W	-	3	0	TARSL2	100043705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.624000	0.83124	2.826000	0.97356	0.655000	0.94253	TGG	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa		0.458	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	protein_coding	OTTHUMT00000313619.3	C	NM_152334	-		102226182	-1	no_errors	ENST00000335968	ensembl	human	known	74_37	missense	SNP	1.000	A
FBXL18	80028	genome.wustl.edu	37	7	5540803	5540803	+	Missense_Mutation	SNP	G	G	A	rs376586905		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr7:5540803G>A	ENST00000382368.3	-	3	1220	c.1097C>T	c.(1096-1098)gCg>gTg	p.A366V	FBXL18_ENST00000453700.3_Missense_Mutation_p.A366V	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	366									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GTCGTCCTCCGCCTTGCGGAG	0.667																																																	0								ENSG00000155034	G	VAL/ALA	0,4264		0,0,2132	21.0	28.0	26.0		1097	4.9	1.0	7		26	1,8499		0,1,4249	no	missense	FBXL18	NM_024963.4	64	0,1,6381	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	366/719	5540803	1,12763	2132	4250	6382	FBXL18	SO:0001583	missense	0			-	HGNC	AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1097C>T	7.37:g.5540803G>A	ENSP00000371805:p.Ala366Val	Somatic	0	19	0.00		0.6352087463037039	7	22.22	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom,pfscan_F-box_dom	p.A366V	ENST00000382368.3	37	c.1097	CCDS43546.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.62|16.62	3.175098|3.175098	0.57692|0.57692	0.0|0.0	1.18E-4|1.18E-4	ENSG00000155034|ENSG00000155034	ENST00000382368;ENST00000312577;ENST00000453700|ENST00000458142	T;T|.	0.50277|.	0.8;0.75|.	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.224065|.	0.46145|.	D|.	0.000309|.	T|T	0.50565|0.50565	0.1623|0.1623	L|L	0.27053|0.27053	0.805|0.805	0.35115|0.35115	D|D	0.766469|0.766469	P;D|.	0.61697|.	0.897;0.99|.	B;P|.	0.49332|.	0.127;0.607|.	T|T	0.57400|0.57400	-0.7818|-0.7818	10|5	0.72032|.	D|.	0.01|.	.|.	17.3775|17.3775	0.87396|0.87396	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	366;366|.	F5H4Z4;Q96ME1-4|.	.;.|.	V|W	366|250	ENSP00000371805:A366V;ENSP00000444797:A366V|.	ENSP00000311990:A366V|.	A|R	-|-	2|1	0|2	FBXL18|FBXL18	5507329|5507329	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.981000|0.981000	0.71138|0.71138	5.035000|5.035000	0.64158|0.64158	2.428000|2.428000	0.82296|0.82296	0.585000|0.585000	0.79938|0.79938	GCG|CGG	-	NULL		0.667	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL18	protein_coding	OTTHUMT00000324093.1	G	NM_024963	-		5540803	-1	no_errors	ENST00000453700	ensembl	human	known	74_37	missense	SNP	0.981	A
CTSG	1511	genome.wustl.edu	37	14	25043934	25043934	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr14:25043934G>A	ENST00000216336.2	-	3	322	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	96	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TGAGGGTGGCGGATGGCTCTG	0.532																																																	0								ENSG00000100448						219.0	175.0	190.0					14																	25043934		2203	4300	6503	CTSG	SO:0001583	missense	0			-	HGNC	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.286C>T	14.37:g.25043934G>A	ENSP00000216336:p.Arg96Cys	Somatic	0	76	0.00		0.6352087463037039	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	4	87.88	Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R96C	ENST00000216336.2	37	c.286	CCDS9631.1	14	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315496	0.40996	.	.	ENSG00000100448	ENST00000216336	D	0.93133	-3.17	5.14	4.22	0.49857	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.559992	0.13176	N	0.407885	D	0.88716	0.6512	L	0.31371	0.925	0.48571	D	0.999673	B	0.20261	0.043	B	0.19666	0.026	D	0.84148	0.0421	10	0.44086	T	0.13	.	11.4846	0.50346	0.0:0.0:0.8199:0.18	.	96	P08311	CATG_HUMAN	C	96	ENSP00000216336:R96C	ENSP00000216336:R96C	R	-	1	0	CTSG	24113774	0.996000	0.38824	0.896000	0.35187	0.017000	0.09413	3.373000	0.52394	1.437000	0.47472	0.655000	0.94253	CGC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.532	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	protein_coding	OTTHUMT00000276536.2	G	NM_001911	-		25043934	-1	no_errors	ENST00000216336	ensembl	human	known	74_37	missense	SNP	0.930	A
XKR6	286046	genome.wustl.edu	37	8	10892720	10892722	+	Intron	DEL	GAT	GAT	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	GAT	GAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr8:10892720_10892722delGAT	ENST00000416569.2	-	2	791				MIR598_ENST00000384868.1_RNA	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		tggctGCTCGgatgatgatgatg	0.537																																																	0								ENSG00000207600																																			MIR598	SO:0001627	intron_variant	0				HGNC	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.765-110380ATC>-	8.37:g.10892729_10892731delGAT		Somatic	0	55	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	Q8TBA0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000416569.2	37	NULL	CCDS5978.2	8																																																																																			-	-		0.537	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR598	protein_coding	OTTHUMT00000383958.1	GAT	NM_173683			10892722	-1	no_errors	ENST00000384868	ensembl	human	known	74_37	rna	DEL	0.938:0.976:0.995	-
ACKR1	2532	genome.wustl.edu	37	1	159175905	159175905	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:159175905T>G	ENST00000368122.2	+	2	1355	c.676T>G	c.(676-678)Ttt>Gtt	p.F226V	DARC_ENST00000537147.1_Missense_Mutation_p.F226V|DARC_ENST00000368121.2_Missense_Mutation_p.F228V|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		226					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					ATTGGGTTTGTTTGGAGCCAA	0.542																																																	0								ENSG00000213088						89.0	79.0	82.0					1																	159175905		2203	4300	6503	DARC	SO:0001583	missense	0			-	HGNC																												ENST00000368122.2:c.676T>G	1.37:g.159175905T>G	ENSP00000357104:p.Phe226Val	Somatic	0	65	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	68	16.05	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_Duffy_chemokine_rcpt	p.F228V	ENST00000368122.2	37	c.682	CCDS1183.1	1	.	.	.	.	.	.	.	.	.	.	T	2.728	-0.265118	0.05754	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.37058	1.22;1.22;1.22	4.84	-1.38	0.09027	.	1.002520	0.08054	U	0.997144	T	0.04227	0.0117	N	0.03608	-0.345	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.12156	0.007;0.007	T	0.35847	-0.9772	10	0.46703	T	0.11	-3.2166	1.3148	0.02104	0.1323:0.3078:0.2312:0.3286	.	228;226	Q5Y7A1;Q16570	.;DUFFY_HUMAN	V	226;226;226;228	ENSP00000357104:F226V;ENSP00000441985:F226V;ENSP00000357103:F228V	ENSP00000352341:F226V	F	+	1	0	DARC	157442529	0.071000	0.21146	0.026000	0.17262	0.170000	0.22686	-0.687000	0.05156	-0.361000	0.08125	-0.388000	0.06559	TTT	-	prints_Duffy_chemokine_rcpt		0.542	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	protein_coding	OTTHUMT00000090338.2	T		-		159175905	+1	no_errors	ENST00000368121	ensembl	human	known	74_37	missense	SNP	0.009	G
ZMYM2	7750	genome.wustl.edu	37	13	20567661	20567661	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr13:20567661C>A	ENST00000382874.2	+	4	639	c.449C>A	c.(448-450)aCc>aAc	p.T150N	ZMYM2_ENST00000382881.3_Missense_Mutation_p.T150N|ZMYM2_ENST00000382869.3_Missense_Mutation_p.T150N|ZMYM2_ENST00000382871.2_Missense_Mutation_p.T150N	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AAAAACAGAACCAATGATGTG	0.383																																																	0								ENSG00000121741						111.0	118.0	116.0					13																	20567661		2133	4269	6402	ZMYM2	SO:0001583	missense	0			-	HGNC	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.449C>A	13.37:g.20567661C>A	ENSP00000372327:p.Thr150Asn	Somatic	0	79	0.00		0.6352087463037039	7	41.67	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.T150N	ENST00000382874.2	37	c.449	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978423	0.34942	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382881;ENST00000382874;ENST00000382871	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.39	4.53	0.55603	.	0.270971	0.31963	N	0.006796	T	0.45994	0.1370	L	0.52573	1.65	0.80722	D	1	B;B;D	0.63880	0.278;0.238;0.993	B;B;D	0.63703	0.115;0.058;0.917	T	0.27191	-1.0081	10	0.23891	T	0.37	-4.3271	15.6172	0.76775	0.1387:0.8613:0.0:0.0	.	150;150;150	A8K126;Q9UBW7;Q9UBW7-2	.;ZMYM2_HUMAN;.	N	150	ENSP00000372322:T150N;ENSP00000372334:T150N;ENSP00000372327:T150N;ENSP00000372324:T150N	ENSP00000372322:T150N	T	+	2	0	ZMYM2	19465661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.819000	0.48049	1.351000	0.45789	0.650000	0.86243	ACC	-	NULL		0.383	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	protein_coding	OTTHUMT00000044051.2	C	NM_003453	-		20567661	+1	no_errors	ENST00000382869	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP12A	479	genome.wustl.edu	37	13	25259493	25259493	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr13:25259493T>A	ENST00000381946.3	+	3	377	c.210T>A	c.(208-210)taT>taA	p.Y70*	ATP12A_ENST00000218548.6_Nonsense_Mutation_p.Y70*			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	70					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AAGAGAAATATGGCACAGACA	0.483																																					Pancreas(156;1582 1935 18898 22665 26498)												0								ENSG00000075673						112.0	110.0	111.0					13																	25259493		2203	4300	6503	ATP12A	SO:0001587	stop_gained	0			-	HGNC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.210T>A	13.37:g.25259493T>A	ENSP00000371372:p.Tyr70*	Somatic	0	74	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.Y70*	ENST00000381946.3	37	c.210	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	T	32	5.132666	0.94517	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	.	.	.	5.24	0.161	0.14977	.	0.195459	0.35903	N	0.002905	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3477	0.32284	0.0:0.3236:0.0:0.6764	.	.	.	.	X	70	.	ENSP00000218548:Y70X	Y	+	3	2	ATP12A	24157493	0.942000	0.31987	0.258000	0.24420	0.115000	0.19883	-0.032000	0.12266	-0.084000	0.12595	0.533000	0.62120	TAT	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_Na/K_IIC		0.483	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	protein_coding	OTTHUMT00000044199.1	T	NM_001676	-		25259493	+1	no_errors	ENST00000218548	ensembl	human	known	74_37	nonsense	SNP	0.426	A
TEP1	7011	genome.wustl.edu	37	14	20848393	20848393	+	Splice_Site	SNP	C	C	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr14:20848393C>G	ENST00000262715.5	-	34	5044		c.e34+1		TEP1_ENST00000545983.1_Splice_Site|TEP1_ENST00000556935.1_Splice_Site	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1						RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAAGGTCTTACCTTTGCTGAT	0.517																																																	0								ENSG00000129566						205.0	179.0	188.0					14																	20848393		2203	4300	6503	TEP1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.5003+1G>C	14.37:g.20848393C>G		Somatic	0	129	0.00		0.6352087463037039	2	66.67	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	23	60.34	A0AUV9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e33+1	ENST00000262715.5	37	c.5003+1	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579998	0.65992	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6769	0.77336	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEP1	19918233	0.816000	0.29132	0.985000	0.45067	0.830000	0.47004	3.545000	0.53648	2.766000	0.95052	0.655000	0.94253	.	-	-		0.517	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	protein_coding	OTTHUMT00000073563.2	C	NM_007110	-	Intron	20848393	-1	no_errors	ENST00000262715	ensembl	human	known	74_37	splice_site	SNP	1.000	G
CNR1	1268	genome.wustl.edu	37	6	88854277	88854277	+	Silent	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:88854277C>T	ENST00000537554.1	-	2	4279	c.717G>A	c.(715-717)ctG>ctA	p.L239L	CNR1_ENST00000535130.1_Silent_p.L239L|CNR1_ENST00000549716.1_Silent_p.L178L|CNR1_ENST00000468898.1_Silent_p.L206L|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000369499.2_Silent_p.L239L|CNR1_ENST00000369501.2_Silent_p.L239L|CNR1_ENST00000549890.1_Silent_p.L239L|CNR1_ENST00000428600.2_Silent_p.L239L	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	239					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TGGTCCACATCAGGCAAAACG	0.542																																																	0								ENSG00000118432						71.0	66.0	68.0					6																	88854277		2203	4300	6503	CNR1	SO:0001819	synonymous_variant	0			-	HGNC	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.717G>A	6.37:g.88854277C>T		Somatic	0	34	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.L239	ENST00000537554.1	37	c.717	CCDS5015.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.542	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	protein_coding	OTTHUMT00000354204.2	C		-		88854277	-1	no_errors	ENST00000369499	ensembl	human	known	74_37	silent	SNP	1.000	T
LPO	4025	genome.wustl.edu	37	17	56343551	56343551	+	Silent	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:56343551G>A	ENST00000262290.4	+	11	1873	c.1557G>A	c.(1555-1557)aaG>aaA	p.K519K	LPO_ENST00000582328.1_Silent_p.K436K|LPO_ENST00000421678.2_Silent_p.K436K|LPO_ENST00000543544.1_Silent_p.K460K	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	519					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGCTGGCCAAGAAATCCAAGC	0.527																																																	0								ENSG00000167419						60.0	54.0	56.0					17																	56343551		2203	4300	6503	LPO	SO:0001819	synonymous_variant	0			-	HGNC	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1557G>A	17.37:g.56343551G>A		Somatic	0	77	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.K519	ENST00000262290.4	37	c.1557	CCDS32689.1	17																																																																																			-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.527	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	protein_coding	OTTHUMT00000443961.1	G		-		56343551	+1	no_errors	ENST00000262290	ensembl	human	known	74_37	silent	SNP	0.882	A
PDE4D	5144	genome.wustl.edu	37	5	59189332	59189332	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:59189332G>T	ENST00000340635.6	-	1	293	c.118C>A	c.(118-120)Cag>Aag	p.Q40K	PDE4D_ENST00000502484.2_Intron|PDE4D_ENST00000546160.1_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	40					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	agcgggTACTGGTGGTGCTGC	0.756																																																	0								ENSG00000113448						8.0	17.0	14.0					5																	59189332		1506	2961	4467	PDE4D	SO:0001583	missense	0			-	HGNC		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.118C>A	5.37:g.59189332G>T	ENSP00000345502:p.Gln40Lys	Somatic	0	12	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,prints_PDEase	p.Q40K	ENST00000340635.6	37	c.118	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264570	0.39995	.	.	ENSG00000113448	ENST00000340635	T	0.67171	-0.25	3.09	3.09	0.35607	.	.	.	.	.	T	0.52419	0.1733	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.56323	-0.7998	9	0.87932	D	0	.	12.8231	0.57704	0.0:0.0:1.0:0.0	.	40	Q08499	PDE4D_HUMAN	K	40	ENSP00000345502:Q40K	ENSP00000345502:Q40K	Q	-	1	0	PDE4D	59225089	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	2.914000	0.48797	1.733000	0.51620	0.542000	0.68232	CAG	-	NULL		0.756	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	protein_coding	OTTHUMT00000367940.3	G		-		59189332	-1	no_errors	ENST00000340635	ensembl	human	known	74_37	missense	SNP	1.000	T
GSN	2934	genome.wustl.edu	37	9	124045037	124045037	+	Intron	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:124045037G>T	ENST00000373823.3	+	9	896				GSN_ENST00000412819.1_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000449733.1_Intron|GSN-AS1_ENST00000414544.1_RNA|RP11-477J21.6_ENST00000437135.1_RNA|GSN_ENST00000394353.2_Intron|GSN_ENST00000436847.1_Intron			P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						ACTGAGCCCTGATAACTCCAA	0.483																																																	0								ENSG00000235865																																			GSN-AS1	SO:0001627	intron_variant	0			-	HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373823.3:c.-10+1197G>T	9.37:g.124045037G>T		Somatic	0	70	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373823.3	37	NULL	CCDS6829.1	9																																																																																			-	-		0.483	GSN-013	KNOWN	basic|appris_principal|CCDS	protein_coding	GSN-AS1	protein_coding	OTTHUMT00000254323.3	G	NM_000177	-		124045037	-1	no_errors	ENST00000414544	ensembl	human	known	74_37	rna	SNP	0.016	T
WARS2	10352	genome.wustl.edu	37	1	119575715	119575715	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr1:119575715C>T	ENST00000235521.4	-	6	928	c.902G>A	c.(901-903)cGc>cAc	p.R301H	WARS2_ENST00000369426.5_3'UTR|WARS2_ENST00000537870.1_Missense_Mutation_p.R207H	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	301					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	CAGCTTGTAGCGAGCAGTGTT	0.577																																																	0								ENSG00000116874						94.0	95.0	94.0					1																	119575715		2203	4300	6503	WARS2	SO:0001583	missense	0			-	HGNC	BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.902G>A	1.37:g.119575715C>T	ENSP00000235521:p.Arg301His	Somatic	0	53	0.00		0.6352087463037039	30	40.00	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	45	34.78	B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synth_Ic,prints_Trp-tRNA-ligase,tigrfam_Trp-tRNA-ligase	p.R301H	ENST00000235521.4	37	c.902	CCDS900.1	1	.	.	.	.	.	.	.	.	.	.	C	7.024	0.559247	0.13436	.	.	ENSG00000116874	ENST00000235521;ENST00000537870	T;T	0.51071	0.72;0.72	5.87	-2.51	0.06365	.	1.085230	0.06719	N	0.774587	T	0.06142	0.0159	N	0.00569	-1.365	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.005	T	0.31503	-0.9941	10	0.27785	T	0.31	-0.7117	14.9993	0.71459	0.0:0.3651:0.0:0.6349	.	244;301	B7Z6G7;Q9UGM6	.;SYWM_HUMAN	H	301;207	ENSP00000235521:R301H;ENSP00000438807:R207H	ENSP00000235521:R301H	R	-	2	0	WARS2	119377238	0.927000	0.31430	0.070000	0.20053	0.315000	0.28087	0.086000	0.14935	-0.782000	0.04541	-1.731000	0.00696	CGC	-	pfam_aa-tRNA-synth_Ic,tigrfam_Trp-tRNA-ligase		0.577	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WARS2	protein_coding	OTTHUMT00000034362.1	C	NM_015836	-		119575715	-1	no_errors	ENST00000235521	ensembl	human	known	74_37	missense	SNP	0.088	T
DAPK1	1612	genome.wustl.edu	37	9	90252979	90252979	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:90252979G>A	ENST00000408954.3	+	4	741	c.406G>A	c.(406-408)Gcc>Acc	p.A136T	DAPK1_ENST00000358077.5_Missense_Mutation_p.A136T|DAPK1_ENST00000469640.2_Missense_Mutation_p.A136T|DAPK1_ENST00000491893.1_Missense_Mutation_p.A136T|DAPK1_ENST00000472284.1_Missense_Mutation_p.A136T	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						CCTTCAAATCGCCCACTTTGA	0.393									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0								ENSG00000196730						91.0	83.0	86.0					9																	90252979		1908	4128	6036	DAPK1	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	-	HGNC	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.406G>A	9.37:g.90252979G>A	ENSP00000386135:p.Ala136Thr	Somatic	1	130	0.76		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	99	22.66	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.A136T	ENST00000408954.3	37	c.406	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873645	0.91664	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48286	D	0.000194	T	0.55065	0.1897	L	0.53617	1.68	0.80722	D	1	D;P;D	0.65815	0.995;0.953;0.99	P;P;P	0.53954	0.738;0.633;0.567	T	0.55515	-0.8129	10	0.66056	D	0.02	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	136;136;136	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	T	136	ENSP00000350785:A136T;ENSP00000417076:A136T;ENSP00000418885:A136T;ENSP00000386135:A136T;ENSP00000419026:A136T	ENSP00000350785:A136T	A	+	1	0	DAPK1	89442799	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	7.671000	0.83941	2.861000	0.98227	0.655000	0.94253	GCC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.393	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	protein_coding	OTTHUMT00000356843.1	G	NM_004938	-		90252979	+1	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC400867	400867	genome.wustl.edu	37	21	40250900	40250901	+	lincRNA	INS	-	-	TGTTTTGCC			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr21:40250900_40250901insTGTTTTGCC	ENST00000380931.2	-	0	2136_2137																											GCCCTCATGATTGTTTTGCCTG	0.391																																																	0								ENSG00000205622																																			AF064858.6			0				Clone_based_vega_gene																													21.37:g.40250901_40250909dupTGTTTTGCC		Somatic	NA	NA	NA		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380931.2	37	NULL		21																																																																																			-	-		0.391	AF064858.6-001	KNOWN	basic	lincRNA	FLJ45139	lincRNA	OTTHUMT00000141410.2	-				40250901	-1	no_errors	ENST00000380931	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGTTTTGCC
USP47	55031	genome.wustl.edu	37	11	11976640	11976640	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:11976640G>T	ENST00000399455.2	+	28	4002	c.3882G>T	c.(3880-3882)tgG>tgT	p.W1294C	USP47_ENST00000305481.6_3'UTR|USP47_ENST00000339865.5_Missense_Mutation_p.W1206C|USP47_ENST00000539466.1_Missense_Mutation_p.W76C|USP47_ENST00000527733.1_Missense_Mutation_p.W1274C	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1294					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		ATTTAGACTGGAATCCTAAAG	0.358																																																	0								ENSG00000170242						162.0	149.0	153.0					11																	11976640		1841	4096	5937	USP47	SO:0001583	missense	0			-	HGNC	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3882G>T	11.37:g.11976640G>T	ENSP00000382382:p.Trp1294Cys	Somatic	0	74	0.00		0.6352087463037039	93	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.W1294C	ENST00000399455.2	37	c.3882		11	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603734	0.87157	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000539466;ENST00000399455	T;T;T	0.17054	2.32;2.31;2.3	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.45397	0.1340	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.27020	-1.0086	10	0.87932	D	0	.	19.9763	0.97309	0.0:0.0:1.0:0.0	.	1274;1206	E9PM46;Q96K76-2	.;.	C	1206;1274;76;1294	ENSP00000339957:W1206C;ENSP00000433146:W1274C;ENSP00000382382:W1294C	ENSP00000339957:W1206C	W	+	3	0	USP47	11933216	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.821000	0.97095	0.650000	0.86243	TGG	-	NULL		0.358	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	protein_coding	OTTHUMT00000385853.2	G	NM_017944	-		11976640	+1	no_errors	ENST00000399455	ensembl	human	known	74_37	missense	SNP	1.000	T
PAPL	390928	genome.wustl.edu	37	19	39589686	39589686	+	Missense_Mutation	SNP	G	G	A	rs567807660		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:39589686G>A	ENST00000331256.5	+	4	683	c.409G>A	c.(409-411)Gct>Act	p.A137T	PAPL_ENST00000594229.1_Missense_Mutation_p.A137T	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		137						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										TCCCCGTCTGGCTGTGTTTGG	0.647													g|||	1	0.000199681	0.0	0.0014	5008	,	,		12040	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000183760						46.0	51.0	49.0					19																	39589686		2203	4300	6503	PAPL	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000331256.5:c.409G>A	19.37:g.39589686G>A	ENSP00000327557:p.Ala137Thr	Somatic	0	100	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B2RN68	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom,superfamily_Purple_acid_Pase-like_N	p.A137T	ENST00000331256.5	37	c.409	CCDS33018.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.866363	0.97043	.	.	ENSG00000183760	ENST00000331256	D	0.85258	-1.96	5.13	5.13	0.70059	Metallophosphoesterase domain (1);	0.063407	0.64402	D	0.000008	D	0.92599	0.7649	M	0.89095	3.005	0.80722	D	1	D	0.62365	0.991	P	0.61275	0.886	D	0.93915	0.7200	10	0.72032	D	0.01	-7.6482	16.0462	0.80722	0.0:0.0:1.0:0.0	.	137	Q6ZNF0	PAPL_HUMAN	T	137	ENSP00000327557:A137T	ENSP00000327557:A137T	A	+	1	0	AC011443.1	44281526	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.980000	0.93460	2.367000	0.80283	0.650000	0.86243	GCT	-	pfam_PEstase_dom		0.647	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPL	protein_coding	OTTHUMT00000463810.1	G		-		39589686	+1	no_errors	ENST00000331256	ensembl	human	known	74_37	missense	SNP	1.000	A
EMC10	284361	genome.wustl.edu	37	19	50985746	50985764	+	3'UTR	DEL	GGCCCCATGCAGCCCCAGG	GGCCCCATGCAGCCCCAGG	-	rs574967678		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	GGCCCCATGCAGCCCCAGG	GGCCCCATGCAGCCCCAGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:50985746_50985764delGGCCCCATGCAGCCCCAGG	ENST00000334976.6	+	0	1065_1083				CTD-2545M3.2_ENST00000598194.1_RNA|EMC10_ENST00000376918.3_3'UTR|EMC10_ENST00000598585.1_Frame_Shift_Del_p.GPMQPQG293fs	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10							ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)											CCTCCCCCATGGCCCCATGCAGCCCCAGGGGCTTCCCCC	0.671																																																	0								ENSG00000161671																																			EMC10	SO:0001624	3_prime_UTR_variant	0				HGNC	BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.*248GGCCCCATGCAGCCCCAGG>-	19.37:g.50985746_50985764delGGCCCCATGCAGCCCCAGG		Somatic	NA	NA	NA		0.6352087463037039	38	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.P294fs	ENST00000334976.6	37	c.877_895	CCDS12796.1	19																																																																																			-	NULL		0.671	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC10	protein_coding	OTTHUMT00000464760.2	GGCCCCATGCAGCCCCAGG	NM_175063			50985764	+1	no_errors	ENST00000598585	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000:0.000:0.001:0.001:0.001:0.000:0.000:0.003:0.001:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000	-
KRT16P6	353194	genome.wustl.edu	37	17	16722363	16722363	+	RNA	SNP	G	G	A	rs140156032		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr17:16722363G>A	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							GCTCCATCTCGCAGCAGAGCT	0.612													N|||	1	0.000199681	0.0	0.0	5008	,	,		20043	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000226145																																			AC022596.6			0			GMAF=0.0005	Clone_based_vega_gene																													17.37:g.16722363G>A		Somatic	1	250	0.40		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	183	21.12		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			-	-		0.612	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	processed_transcript	OTTHUMT00000468034.1	G		rs140156032		16722363	-1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	SNP	0.986	A
PKNOX2	63876	genome.wustl.edu	37	11	125301193	125301195	+	In_Frame_Del	DEL	GAG	GAG	-	rs397840770|rs397849304|rs3832749	byFrequency	TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr11:125301193_125301195delGAG	ENST00000298282.9	+	13	1595_1597	c.1324_1326delGAG	c.(1324-1326)gagdel	p.E447del	PKNOX2_ENST00000542175.1_In_Frame_Del_p.E383del|PKNOX2_ENST00000530517.1_3'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	447	Asp/Glu-rich (acidic).		Missing. {ECO:0000269|PubMed:15489334}.		regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		tgagatggaagaggaggaggagg	0.571														294	0.0587061	0.0129	0.0576	5008	,	,		20223	0.0744		0.1123	False		,,,				2504	0.0501																0								ENSG00000165495																																			PKNOX2	SO:0001651	inframe_deletion	0				HGNC	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.1324_1326delGAG	11.37:g.125301202_125301204delGAG	ENSP00000298282:p.Glu447del	Somatic	0	41	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.E445in_frame_del	ENST00000298282.9	37	c.1324_1326	CCDS41730.1	11																																																																																			-	NULL		0.571	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	protein_coding	OTTHUMT00000386866.3	GAG				125301195	+1	no_errors	ENST00000298282	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
MUC16	94025	genome.wustl.edu	37	19	9024855	9024855	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:9024855G>A	ENST00000397910.4	-	16	37210	c.37007C>T	c.(37006-37008)aCc>aTc	p.T12336I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12338	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTGTCCAGGGTGTAGGGGCC	0.527																																																	0								ENSG00000181143						166.0	153.0	157.0					19																	9024855		1974	4164	6138	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37007C>T	19.37:g.9024855G>A	ENSP00000381008:p.Thr12336Ile	Somatic	0	134	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	82	20.39	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T12336I	ENST00000397910.4	37	c.37007	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	9.610	1.131096	0.21041	.	.	ENSG00000181143	ENST00000397910	T	0.18502	2.21	2.73	0.525	0.17072	.	.	.	.	.	T	0.31606	0.0802	M	0.79693	2.465	.	.	.	P	0.48694	0.914	P	0.56127	0.792	T	0.38542	-0.9656	8	0.87932	D	0	.	4.8245	0.13408	0.3116:0.0:0.6884:0.0	.	12336	B5ME49	.	I	12336	ENSP00000381008:T12336I	ENSP00000381008:T12336I	T	-	2	0	MUC16	8885855	0.026000	0.19158	0.204000	0.23530	0.020000	0.10135	-0.374000	0.07484	0.213000	0.20722	-0.450000	0.05554	ACC	-	smart_SEA_dom		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9024855	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.246	A
RFPL4A	342931	genome.wustl.edu	37	19	56273241	56273241	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr19:56273241A>T	ENST00000434937.2	+	2	246	c.75A>T	c.(73-75)aaA>aaT	p.K25N		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	25							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGCAACTGAAATGTGGATATG	0.463																																																	0								ENSG00000223638						3.0	3.0	3.0					19																	56273241		574	1294	1868	RFPL4A	SO:0001583	missense	0			-	HGNC		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.75A>T	19.37:g.56273241A>T	ENSP00000392936:p.Lys25Asn	Somatic	0	72	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	17	46.88		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.K25N	ENST00000434937.2	37	c.75	CCDS46201.1	19	.	.	.	.	.	.	.	.	.	.	A	8.081	0.772458	0.16051	.	.	ENSG00000223638	ENST00000434937	T	0.07114	3.22	3.31	-0.687	0.11320	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	.	.	.	.	T	0.04497	0.0123	N	0.21282	0.65	0.09310	N	1	B	0.20164	0.042	B	0.22152	0.038	T	0.45906	-0.9229	9	0.20519	T	0.43	-43.1797	2.1982	0.03916	0.4149:0.0:0.3399:0.2452	.	25	A6NLU0	RFPLA_HUMAN	N	25	ENSP00000392936:K25N	ENSP00000392936:K25N	K	+	3	2	RFPL4A	60965053	0.001000	0.12720	0.003000	0.11579	0.019000	0.09904	-1.794000	0.01753	0.030000	0.15379	0.383000	0.25322	AAA	-	pfscan_Znf_RING		0.463	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RFPL4A	protein_coding	OTTHUMT00000384184.1	A	XM_292796	-		56273241	+1	no_errors	ENST00000434937	ensembl	human	novel	74_37	missense	SNP	0.000	T
ANXA3	306	genome.wustl.edu	37	4	79503418	79503418	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr4:79503418G>A	ENST00000264908.6	+	5	665	c.286G>A	c.(286-288)Gca>Aca	p.A96T	ANXA3_ENST00000503570.2_Missense_Mutation_p.A57T|ANXA3_ENST00000512884.1_Missense_Mutation_p.A57T	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	96					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AGTCTTTGATGCAAAGCAGCT	0.463																																					GBM(2;126 157 27790 28920 42492)												0								ENSG00000138772						79.0	76.0	77.0					4																	79503418		2203	4300	6503	ANXA3	SO:0001583	missense	0			-	HGNC	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.286G>A	4.37:g.79503418G>A	ENSP00000264908:p.Ala96Thr	Somatic	0	69	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B2R9W6|Q6LET2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIII	p.A96T	ENST00000264908.6	37	c.286	CCDS3584.1	4	.	.	.	.	.	.	.	.	.	.	G	29.4	5.001309	0.93227	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000512373;ENST00000514171;ENST00000508214	T;T;T;T;T;T	0.22945	1.93;1.93;1.93;2.78;2.97;2.97	5.16	5.16	0.70880	.	0.110783	0.64402	D	0.000011	T	0.51143	0.1657	M	0.92268	3.29	0.49051	D	0.999742	P	0.52463	0.953	P	0.49752	0.621	T	0.65849	-0.6068	10	0.87932	D	0	.	17.5603	0.87905	0.0:0.0:1.0:0.0	.	96	P12429	ANXA3_HUMAN	T	96;57;57;96;96;96	ENSP00000264908:A96T;ENSP00000423068:A57T;ENSP00000421015:A57T;ENSP00000424584:A96T;ENSP00000421512:A96T;ENSP00000422281:A96T	ENSP00000264908:A96T	A	+	1	0	ANXA3	79722442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.587000	0.53957	2.674000	0.91012	0.591000	0.81541	GCA	-	pfam_Annexin_repeat		0.463	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA3	protein_coding	OTTHUMT00000252516.3	G	NM_005139	-		79503418	+1	no_errors	ENST00000264908	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC146	57639	genome.wustl.edu	37	7	76889409	76889409	+	Missense_Mutation	SNP	G	G	A	rs560273200		TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr7:76889409G>A	ENST00000285871.4	+	8	969	c.842G>A	c.(841-843)aGt>aAt	p.S281N	CCDC146_ENST00000415740.2_3'UTR|AC073635.5_ENST00000476561.2_RNA|CCDC146_ENST00000431197.1_Missense_Mutation_p.S27N	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	281										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AACAAGGTTAGTGCTATAGTG	0.363																																																	0								ENSG00000135205						95.0	97.0	97.0					7																	76889409		2203	4300	6503	CCDC146	SO:0001583	missense	0			-	HGNC	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.842G>A	7.37:g.76889409G>A	ENSP00000285871:p.Ser281Asn	Somatic	0	96	0.00		0.6352087463037039	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	57	28.75	A8K8X6|Q9P223	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S281N	ENST00000285871.4	37	c.842	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.971026	0.00457	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.21191	2.02;2.57	5.62	0.861	0.19048	.	0.501323	0.24438	N	0.038529	T	0.07503	0.0189	N	0.02916	-0.46	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.37911	-0.9685	10	0.18710	T	0.47	-4.4866	9.5864	0.39519	0.7951:0.0:0.2049:0.0	.	27;281	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	N	281;27	ENSP00000285871:S281N;ENSP00000413885:S27N	ENSP00000285871:S281N	S	+	2	0	AC007000.1	76727345	0.119000	0.22226	0.000000	0.03702	0.013000	0.08279	1.374000	0.34283	0.003000	0.14656	0.650000	0.86243	AGT	-	NULL		0.363	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	protein_coding	OTTHUMT00000341449.1	G	NM_020879	-		76889409	+1	no_errors	ENST00000285871	ensembl	human	known	74_37	missense	SNP	0.001	A
LINGO2	158038	genome.wustl.edu	37	9	27949775	27949775	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr9:27949775G>T	ENST00000379992.2	-	6	1344	c.895C>A	c.(895-897)Ctt>Att	p.L299I	LINGO2_ENST00000308675.3_Missense_Mutation_p.L299I	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	299						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		AGCTCCTGAAGGCGGATCAGG	0.522																																																	0								ENSG00000174482						118.0	119.0	119.0					9																	27949775		2203	4300	6503	LINGO2	SO:0001583	missense	0			-	HGNC	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.895C>A	9.37:g.27949775G>T	ENSP00000369328:p.Leu299Ile	Somatic	0	80	0.00		0.6352087463037039	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	19	70.77	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L299I	ENST00000379992.2	37	c.895	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294448	0.60086	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.93811	-3.29;-3.29	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.96907	0.8990	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96830	0.9610	9	.	.	.	.	14.5295	0.67915	0.0694:0.0:0.9306:0.0	.	299	Q7L985	LIGO2_HUMAN	I	299	ENSP00000369328:L299I;ENSP00000310126:L299I	.	L	-	1	0	LINGO2	27939775	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.767000	0.68850	2.824000	0.97209	0.655000	0.94253	CTT	-	smart_Leu-rich_rpt_typical-subtyp		0.522	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	protein_coding	OTTHUMT00000051978.2	G	NM_152570	-		27949775	-1	no_errors	ENST00000308675	ensembl	human	known	74_37	missense	SNP	1.000	T
KRT6B	3854	genome.wustl.edu	37	12	52844289	52844289	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:52844289T>C	ENST00000252252.3	-	2	703	c.656A>G	c.(655-657)aAc>aGc	p.N219S		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	219	Coil 1B.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CCTGAGGTTGTTGATGTACTG	0.577																																																	0								ENSG00000185479						153.0	150.0	151.0					12																	52844289		2203	4300	6503	KRT6B	SO:0001583	missense	0			-	HGNC	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.656A>G	12.37:g.52844289T>C	ENSP00000252252:p.Asn219Ser	Somatic	0	153	0.00		0.6352087463037039	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	83	17.00	P48669	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.N219S	ENST00000252252.3	37	c.656	CCDS8828.1	12	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.755712	0.00663	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	T	0.74315	-0.83	2.77	0.209	0.15226	Filament (1);	0.494750	0.20058	N	0.100142	T	0.43545	0.1252	N	0.10733	0.035	0.25162	N	0.990349	B	0.25007	0.116	B	0.26517	0.07	T	0.36237	-0.9756	10	0.06099	T	0.92	.	4.3236	0.11029	0.0:0.3043:0.1704:0.5253	.	219	P04259	K2C6B_HUMAN	S	219	ENSP00000252252:N219S	ENSP00000252252:N219S	N	-	2	0	KRT6B	51130556	0.002000	0.14202	0.982000	0.44146	0.338000	0.28826	-1.825000	0.01707	0.042000	0.15717	0.248000	0.18094	AAC	-	pfam_IF		0.577	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	protein_coding	OTTHUMT00000404969.1	T	NM_005555	-		52844289	-1	no_errors	ENST00000252252	ensembl	human	known	74_37	missense	SNP	0.994	C
PRSS16	10279	genome.wustl.edu	37	6	27222804	27222804	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr6:27222804C>A	ENST00000230582.3	+	11	1385	c.1370C>A	c.(1369-1371)gCt>gAt	p.A457D	PRSS16_ENST00000421826.2_Missense_Mutation_p.A200D|PRSS16_ENST00000377456.2_3'UTR	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	457					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GTAACACAGGCTTTAGGATCC	0.562																																					NSCLC(178;1118 2105 17078 23587 44429)												0								ENSG00000112812						125.0	132.0	130.0					6																	27222804		2203	4300	6503	PRSS16	SO:0001583	missense	0			-	HGNC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1370C>A	6.37:g.27222804C>A	ENSP00000230582:p.Ala457Asp	Somatic	1	108	0.92		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	47	22.95	O75416	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S28	p.A457D	ENST00000230582.3	37	c.1370	CCDS4623.1	6	.	.	.	.	.	.	.	.	.	.	C	0.054	-1.242218	0.01481	.	.	ENSG00000112812	ENST00000421826;ENST00000230582	T;T	0.13778	2.56;2.56	4.64	-0.413	0.12363	.	1.397340	0.04345	N	0.354765	T	0.01523	0.0049	N	0.03999	-0.3	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.12156	0.007;0.005	T	0.43048	-0.9415	10	0.10377	T	0.69	-2.1371	8.5164	0.33248	0.6917:0.2228:0.0:0.0855	.	200;457	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	D	200;457	ENSP00000404349:A200D;ENSP00000230582:A457D	ENSP00000230582:A457D	A	+	2	0	PRSS16	27330783	0.000000	0.05858	0.012000	0.15200	0.622000	0.37654	0.348000	0.20031	-0.202000	0.10268	0.552000	0.68991	GCT	-	pfam_Peptidase_S28		0.562	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS16	protein_coding	OTTHUMT00000043418.2	C		-		27222804	+1	no_errors	ENST00000230582	ensembl	human	known	74_37	missense	SNP	0.002	A
IRX6	79190	genome.wustl.edu	37	16	55362613	55362613	+	Splice_Site	SNP	A	A	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr16:55362613A>C	ENST00000290552.7	+	5	2055	c.723A>C	c.(721-723)gaA>gaC	p.E241D	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	241					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TTCCTGCAGAAGTTACTGCTA	0.587																																																	0								ENSG00000159387						43.0	52.0	49.0					16																	55362613		2169	4228	6397	IRX6	SO:0001630	splice_region_variant	0			-	HGNC	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.722-1A>C	16.37:g.55362613A>C		Somatic	0	95	0.00		0.6352087463037039	9	35.71	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	10	56.52	B2RN06|Q7Z2K0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.E241D	ENST00000290552.7	37	c.723	CCDS32449.1	16	.	.	.	.	.	.	.	.	.	.	A	3.178	-0.168582	0.06461	.	.	ENSG00000159387	ENST00000290552	D	0.89810	-2.57	5.27	-10.5	0.00291	.	0.531595	0.18158	N	0.149867	T	0.58133	0.2101	N	0.03608	-0.345	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.65928	-0.6049	10	0.02654	T	1	.	3.563	0.07889	0.2725:0.104:0.0886:0.5348	.	241	P78412	IRX6_HUMAN	D	241	ENSP00000290552:E241D	ENSP00000290552:E241D	E	+	3	2	IRX6	53920114	0.000000	0.05858	0.001000	0.08648	0.907000	0.53573	-3.534000	0.00439	-1.910000	0.01083	-0.656000	0.03901	GAA	-	NULL		0.587	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX6	protein_coding	OTTHUMT00000417445.4	A	NM_024335	-	Missense_Mutation	55362613	+1	no_errors	ENST00000290552	ensembl	human	known	74_37	missense	SNP	0.000	C
POLQ	10721	genome.wustl.edu	37	3	121202431	121202431	+	Splice_Site	DEL	T	T	-			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr3:121202431delT	ENST00000264233.5	-	18	5902		c.e18-2			NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CACTAATTTCTTTaaaaaaaa	0.333								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0								ENSG00000051341						30.0	31.0	31.0					3																	121202431		2199	4297	6496	POLQ	SO:0001630	splice_region_variant	0				HGNC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.5774-2A>-	3.37:g.121202431delT		Somatic	0	49	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	O95160|Q6VMB5	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e18-2	ENST00000264233.5	37	c.5774-2	CCDS33833.1	3																																																																																			-	-		0.333	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	protein_coding	OTTHUMT00000355097.1	T	NM_199420		Intron	121202431	-1	no_errors	ENST00000264233	ensembl	human	known	74_37	splice_site_del	DEL	0.997	-
DNAH5	1767	genome.wustl.edu	37	5	13885205	13885205	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr5:13885205A>G	ENST00000265104.4	-	19	2980	c.2876T>C	c.(2875-2877)cTc>cCc	p.L959P	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	959	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GAAATGAGAGAGTAACTCGCG	0.433									Kartagener syndrome																																								0								ENSG00000039139						130.0	123.0	125.0					5																	13885205		2203	4300	6503	DNAH5	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2876T>C	5.37:g.13885205A>G	ENSP00000265104:p.Leu959Pro	Somatic	0	88	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	99	19.51	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L959P	ENST00000265104.4	37	c.2876	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	19.34	3.808632	0.70797	.	.	ENSG00000039139	ENST00000265104	T	0.25250	1.81	5.73	5.73	0.89815	.	0.128246	0.53938	D	0.000052	T	0.42988	0.1227	M	0.80183	2.485	0.80722	D	1	P	0.40250	0.709	P	0.46510	0.519	T	0.37174	-0.9717	10	0.45353	T	0.12	.	16.0225	0.80509	1.0:0.0:0.0:0.0	.	959	Q8TE73	DYH5_HUMAN	P	959	ENSP00000265104:L959P	ENSP00000265104:L959P	L	-	2	0	DNAH5	13938205	1.000000	0.71417	0.998000	0.56505	0.844000	0.47949	8.673000	0.91186	2.198000	0.70561	0.533000	0.62120	CTC	-	NULL		0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	A	NM_001369	-		13885205	-1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	SNP	1.000	G
YIPF4	84272	genome.wustl.edu	37	2	32526542	32526542	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr2:32526542A>G	ENST00000238831.4	+	5	821	c.575A>G	c.(574-576)gAa>gGa	p.E192G		NM_032312.3	NP_115688.1	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	192						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				kidney(2)|lung(3)|prostate(3)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					GGATCATTTGAAGTGGTGTCT	0.353																																																	0								ENSG00000119820						146.0	136.0	140.0					2																	32526542		2203	4299	6502	YIPF4	SO:0001583	missense	0			-	HGNC	AK098486	CCDS1781.1	2p22.3	2008-02-05			ENSG00000119820	ENSG00000119820		"""Yip1 domain family"""	28145	protein-coding gene	gene with protein product						12477932	Standard	NM_032312		Approved	MGC11061, FinGER4	uc002rok.3	Q9BSR8	OTTHUMG00000128452	ENST00000238831.4:c.575A>G	2.37:g.32526542A>G	ENSP00000238831:p.Glu192Gly	Somatic	0	180	0.00		0.6352087463037039	116	26.88	43	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	88	17.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Yip1	p.E192G	ENST00000238831.4	37	c.575	CCDS1781.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.12|15.12	2.737857|2.737857	0.49045|0.49045	.|.	.|.	ENSG00000119820|ENSG00000119820	ENST00000238831|ENST00000441084	T|.	0.38887|.	1.11|.	5.88|5.88	5.88|5.88	0.94601|0.94601	Yip1 domain (1);|.	0.101661|.	0.64402|.	D|.	0.000003|.	T|T	0.38401|0.38401	0.1039|0.1039	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.48089|.	0.905|.	P|.	0.47118|.	0.538|.	T|T	0.34403|0.34403	-0.9830|-0.9830	10|5	0.07482|.	T|.	0.82|.	.|.	14.0289|14.0289	0.64604|0.64604	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	192|.	Q9BSR8|.	YIPF4_HUMAN|.	G|E	192|11	ENSP00000238831:E192G|.	ENSP00000238831:E192G|.	E|K	+|+	2|1	0|0	YIPF4|YIPF4	32380046|32380046	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.926000|7.926000	0.87569|0.87569	2.242000|2.242000	0.73789|0.73789	0.533000|0.533000	0.62120|0.62120	GAA|AAG	-	pfam_Yip1		0.353	YIPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF4	protein_coding	OTTHUMT00000250250.3	A	NM_032312	-		32526542	+1	no_errors	ENST00000238831	ensembl	human	known	74_37	missense	SNP	1.000	G
CYP8B1	1582	genome.wustl.edu	37	3	42916302	42916302	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr3:42916302T>C	ENST00000316161.4	-	1	1331	c.1007A>G	c.(1006-1008)cAc>cGc	p.H336R	RP11-141M3.5_ENST00000471537.1_RNA|CYP8B1_ENST00000437102.1_Missense_Mutation_p.H336R|KRBOX1_ENST00000426937.1_Intron	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	336					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		AACTGGGGTGTGTTGCAGGGC	0.592																																																	0								ENSG00000180432						41.0	39.0	40.0					3																	42916302		2203	4300	6503	CYP8B1	SO:0001583	missense	0			-	HGNC	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.1007A>G	3.37:g.42916302T>C	ENSP00000318867:p.His336Arg	Somatic	0	56	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.H336R	ENST00000316161.4	37	c.1007	CCDS2707.1	3	.	.	.	.	.	.	.	.	.	.	T	0.658	-0.806843	0.02819	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01215	5.16;5.16	5.27	-3.55	0.04639	.	1.006310	0.07997	N	0.988043	T	0.00875	0.0029	N	0.11724	0.165	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.18263	0.021;0.021	T	0.46721	-0.9171	10	0.25751	T	0.34	-1.4825	11.4874	0.50361	0.0:0.424:0.0:0.576	.	336;336	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	R	336	ENSP00000404499:H336R;ENSP00000318867:H336R	ENSP00000318867:H336R	H	-	2	0	CYP8B1	42891306	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	-0.264000	0.08658	-0.623000	0.05618	-0.441000	0.05720	CAC	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.592	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP8B1	protein_coding	OTTHUMT00000256653.1	T	NM_004391	-		42916302	-1	no_errors	ENST00000316161	ensembl	human	known	74_37	missense	SNP	0.028	C
PIWIL1	9271	genome.wustl.edu	37	12	130851778	130851778	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C4-01A-11D-A36J-09	TCGA-X6-A8C4-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f4e5c7c0-877e-45ea-a9b9-a756d3200749	b804d91b-cdb0-4084-bd79-21af0f262b5e	g.chr12:130851778G>A	ENST00000245255.3	+	19	2568	c.2296G>A	c.(2296-2298)Gat>Aat	p.D766N	PIWIL1_ENST00000541480.1_3'UTR	NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	766	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AACAGTTATTGATGTAGAGGT	0.438																																																	0								ENSG00000125207						142.0	130.0	134.0					12																	130851778		2203	4300	6503	PIWIL1	SO:0001583	missense	0			-	HGNC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.2296G>A	12.37:g.130851778G>A	ENSP00000245255:p.Asp766Asn	Somatic	0	74	0.00		0.6352087463037039	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	41	25.00	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.D766N	ENST00000245255.3	37	c.2296	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937363	0.73557	.	.	ENSG00000125207	ENST00000245255	T	0.46063	0.88	5.88	5.88	0.94601	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.76205	0.3955	H	0.95437	3.67	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.952	T	0.82946	-0.0205	10	0.87932	D	0	-5.5109	19.2068	0.93734	0.0:0.0:1.0:0.0	.	766;766	Q96J94;Q96J94-2	PIWL1_HUMAN;.	N	766	ENSP00000245255:D766N	ENSP00000245255:D766N	D	+	1	0	PIWIL1	129417731	1.000000	0.71417	0.767000	0.31495	0.031000	0.12232	9.593000	0.98250	2.780000	0.95670	0.655000	0.94253	GAT	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.438	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	G		-		130851778	+1	no_errors	ENST00000245255	ensembl	human	known	74_37	missense	SNP	1.000	A
