#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SYCP2L	221711	genome.wustl.edu	37	6	10961632	10961632	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:10961632G>T	ENST00000283141.6	+	27	2646	c.2350G>T	c.(2350-2352)Gtt>Ttt	p.V784F		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	784						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TGAGAAGGAGGTTCTGGTAAG	0.383																																																	0								ENSG00000153157						119.0	110.0	113.0					6																	10961632		1848	4100	5948	SYCP2L	SO:0001583	missense	0			-	HGNC	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.2350G>T	6.37:g.10961632G>T	ENSP00000283141:p.Val784Phe	Somatic	1	106	0.93		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	17	67.31	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V784F	ENST00000283141.6	37	c.2350	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904505	0.33628	.	.	ENSG00000153157	ENST00000283141	T	0.18174	2.23	5.49	2.72	0.32119	.	0.823632	0.10734	N	0.640271	T	0.10937	0.0267	L	0.41236	1.265	0.09310	N	1	P	0.52061	0.95	P	0.53006	0.715	T	0.14476	-1.0471	10	0.66056	D	0.02	-1.8676	7.1043	0.25354	0.262:0.0:0.738:0.0	.	784	Q5T4T6	SYC2L_HUMAN	F	784	ENSP00000283141:V784F	ENSP00000283141:V784F	V	+	1	0	SYCP2L	11069618	0.000000	0.05858	0.029000	0.17559	0.098000	0.18820	0.297000	0.19101	1.309000	0.44985	0.655000	0.94253	GTT	-	NULL		0.383	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	protein_coding	OTTHUMT00000039845.3	G	NM_194299	-		10961632	+1	no_errors	ENST00000283141	ensembl	human	known	74_37	missense	SNP	0.001	T
CNR1	1268	genome.wustl.edu	37	6	88853662	88853662	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:88853662C>A	ENST00000537554.1	-	2	4894	c.1332G>T	c.(1330-1332)agG>agT	p.R444S	CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000369499.2_Missense_Mutation_p.R444S|CNR1_ENST00000369501.2_Missense_Mutation_p.R444S|CNR1_ENST00000535130.1_Missense_Mutation_p.R444S|CNR1_ENST00000468898.1_Missense_Mutation_p.R411S|CNR1_ENST00000428600.2_Missense_Mutation_p.R444S|CNR1_ENST00000549890.1_Missense_Mutation_p.R444S|CNR1_ENST00000549716.1_Missense_Mutation_p.R383S	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	444					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TTTCTGCGGCCCTGTGAACAC	0.562																																																	0								ENSG00000118432						218.0	196.0	203.0					6																	88853662		2203	4300	6503	CNR1	SO:0001583	missense	0			-	HGNC	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1332G>T	6.37:g.88853662C>A	ENSP00000441046:p.Arg444Ser	Somatic	0	48	0.00		0.5538374756952343	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	21	40.00	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.R444S	ENST00000537554.1	37	c.1332	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	C	5.555	0.287344	0.10513	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.75938	-0.93;-0.93;-0.93;-0.93;-0.93;-0.98;-0.93;-0.86	5.94	3.21	0.36854	.	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	L	0.27053	0.805	0.80722	D	1	B;B	0.30634	0.288;0.099	B;B	0.26969	0.075;0.025	T	0.15780	-1.0425	10	0.12766	T	0.61	.	6.5034	0.22182	0.0:0.6643:0.131:0.2046	.	411;444	P21554-3;P21554	.;CNR1_HUMAN	S	444;444;444;444;444;411;444;383	ENSP00000358513:R444S;ENSP00000442689:R444S;ENSP00000441046:R444S;ENSP00000358511:R444S;ENSP00000446819:R444S;ENSP00000420188:R411S;ENSP00000412192:R444S;ENSP00000449549:R383S	ENSP00000358511:R444S	R	-	3	2	CNR1	88910381	1.000000	0.71417	0.998000	0.56505	0.052000	0.14988	1.592000	0.36676	0.411000	0.25702	-0.175000	0.13238	AGG	-	pirsf_Canbinoid_rcpt_1,prints_Canbinoid_rcpt_1		0.562	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	protein_coding	OTTHUMT00000354204.2	C		-		88853662	-1	no_errors	ENST00000369499	ensembl	human	known	74_37	missense	SNP	1.000	A
CEACAM3	1084	genome.wustl.edu	37	19	42300630	42300630	+	Silent	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:42300630T>C	ENST00000357396.3	+	1	262	c.21T>C	c.(19-21)tcT>tcC	p.S7S	CEACAM3_ENST00000595255.1_3'UTR|CEACAM3_ENST00000344550.4_Silent_p.S7S|CEACAM3_ENST00000221999.4_Silent_p.S7S	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	7			S -> P (in dbSNP:rs1041999). {ECO:0000269|PubMed:2050678}.			integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						CCTCAGCCTCTCCCCACAGAG	0.602																																																	0								ENSG00000170956						43.0	44.0	43.0					19																	42300630		2203	4300	6503	CEACAM3	SO:0001819	synonymous_variant	0			-	HGNC	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.21T>C	19.37:g.42300630T>C		Somatic	0	39	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	G5E978|Q3KPH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set	p.S7	ENST00000357396.3	37	c.21	CCDS12586.2	19																																																																																			-	NULL		0.602	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM3	protein_coding	OTTHUMT00000316509.2	T	NM_001815	-		42300630	+1	no_errors	ENST00000357396	ensembl	human	known	74_37	silent	SNP	0.000	C
PRDM15	63977	genome.wustl.edu	37	21	43220665	43220665	+	IGR	DEL	A	A	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr21:43220665delA	ENST00000269844.3	-	0	4710				PRDM15_ENST00000422911.1_3'UTR|PRDM15_ENST00000398548.1_3'UTR|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000538201.1_3'UTR|PRDM15_ENST00000447207.2_3'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						AAATAAAGTTAAAAAAAAAAA	0.343																																																	0								ENSG00000141956																																			PRDM15	SO:0001628	intergenic_variant	0				HGNC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781		21.37:g.43220665delA		Somatic	0	24	0.00		0.5538374756952343	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000269844.3	37	NULL	CCDS13676.1	21																																																																																			-	-		0.343	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	protein_coding		A	NM_022115			43220665	-1	no_errors	ENST00000470586	ensembl	human	putative	74_37	rna	DEL	0.000	-
HID1	283987	genome.wustl.edu	37	17	72950352	72950352	+	Missense_Mutation	SNP	C	C	T	rs566625537		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:72950352C>T	ENST00000425042.2	-	14	1822	c.1745G>A	c.(1744-1746)cGg>cAg	p.R582Q		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	582					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											AGGTGTCCGCCGGCGCCGCTG	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		15282	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000167861																																			HID1	SO:0001583	missense	0			-	HGNC		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1745G>A	17.37:g.72950352C>T	ENSP00000413520:p.Arg582Gln	Somatic	0	50	0.00		0.5538374756952343	15	6.25	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	32	52.24	Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dymeclin	p.R582Q	ENST00000425042.2	37	c.1745	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175750	0.38413	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	4.47	4.47	0.54385	.	0.160773	0.52532	D	0.000078	T	0.33323	0.0859	N	0.20401	0.57	0.45035	D	0.998053	B	0.16603	0.018	B	0.20184	0.028	T	0.17289	-1.0374	9	0.34782	T	0.22	-25.6466	5.8677	0.18786	0.0:0.7421:0.0:0.2579	.	582	Q8IV36	CQ028_HUMAN	Q	354;582;354	.	ENSP00000317795:R354Q	R	-	2	0	C17orf28	70461947	1.000000	0.71417	0.896000	0.35187	0.361000	0.29550	3.589000	0.53972	2.026000	0.59711	0.561000	0.74099	CGG	-	NULL		0.692	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HID1	protein_coding	OTTHUMT00000390011.2	C	NM_030630	-		72950352	-1	no_errors	ENST00000425042	ensembl	human	known	74_37	missense	SNP	0.927	T
SLC25A3P1	163742	genome.wustl.edu	37	1	53904702	53904702	+	RNA	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:53904702A>T	ENST00000566100.1	-	0	536									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		GACCTCGTAAAGGCCGAACTT	0.657																																																	0								ENSG00000236253																																			SLC25A3P1			0			-	HGNC			1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53904702A>T		Somatic	0	22	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	14	44.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			-	-		0.657	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	pseudogene	OTTHUMT00000422839.1	A	NM_178501	-		53904702	-1	no_errors	ENST00000562700	ensembl	human	known	74_37	rna	SNP	1.000	T
DCDC2	51473	genome.wustl.edu	37	6	24205335	24205335	+	Intron	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:24205335T>C	ENST00000378454.3	-	8	1224				DCDC2_ENST00000378450.3_Silent_p.S59S	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2						cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				CTTCATCTATTGAGACAAACA	0.413																																																	0								ENSG00000146038						170.0	164.0	166.0					6																	24205335		2203	4299	6502	DCDC2	SO:0001627	intron_variant	0			-	HGNC	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.923-5A>G	6.37:g.24205335T>C		Somatic	0	88	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S59	ENST00000378454.3	37	c.177	CCDS4550.1	6																																																																																			-	NULL		0.413	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC2	protein_coding	OTTHUMT00000043604.1	T	NM_016356	-		24205335	-1	no_errors	ENST00000378450	ensembl	human	known	74_37	silent	SNP	0.000	C
HTR6	3362	genome.wustl.edu	37	1	19992517	19992517	+	Missense_Mutation	SNP	C	C	T	rs201177761		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:19992517C>T	ENST00000289753.1	+	1	738	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	91					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)			endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	GCTGTACGGGCGCTGGGTGCT	0.657																																					Esophageal Squamous(168;1879 2619 6848 21062)												0								ENSG00000158748						44.0	43.0	43.0					1																	19992517		2202	4298	6500	HTR6	SO:0001583	missense	0			-	HGNC	L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.271C>T	1.37:g.19992517C>T	ENSP00000289753:p.Arg91Cys	Somatic	0	24	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	Q13640|Q5TGZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT6_rcpt,prints_GPCR_Rhodpsn	p.R91C	ENST00000289753.1	37	c.271	CCDS197.1	1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584345	0.65992	.	.	ENSG00000158748	ENST00000289753	T	0.73258	-0.73	4.17	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.253351	0.41001	D	0.000970	T	0.65801	0.2726	N	0.17594	0.5	0.31124	N	0.708518	D	0.69078	0.997	P	0.58266	0.836	T	0.65861	-0.6065	9	.	.	.	.	10.8437	0.46730	0.1891:0.8109:0.0:0.0	.	91	P50406	5HT6R_HUMAN	C	91	ENSP00000289753:R91C	.	R	+	1	0	HTR6	19865104	0.992000	0.36948	1.000000	0.80357	0.986000	0.74619	1.490000	0.35573	2.048000	0.60808	0.485000	0.47835	CGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT6_rcpt		0.657	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR6	protein_coding	OTTHUMT00000007704.1	C	NM_000871	rs201177761		19992517	+1	no_errors	ENST00000289753	ensembl	human	known	74_37	missense	SNP	1.000	T
C1orf106	55765	genome.wustl.edu	37	1	200883099	200883099	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:200883099T>C	ENST00000367342.4	+	0	2534				C1orf106_ENST00000465162.1_3'UTR	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106											endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCTTGGGAGTTCTCCAACGCT	0.532																																																	0								ENSG00000163362																																			C1orf106	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.*342T>C	1.37:g.200883099T>C		Somatic	0	28	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367342.4	37	NULL		1																																																																																			-	-		0.532	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	protein_coding	OTTHUMT00000087057.2	T	NM_018265	-		200883099	+1	no_errors	ENST00000465162	ensembl	human	known	74_37	rna	SNP	0.002	C
SLC35F4	341880	genome.wustl.edu	37	14	58097265	58097265	+	Intron	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:58097265T>A	ENST00000556826.1	-	2	340				SLC35F4_ENST00000557430.1_Intron|CTD-2325K12.1_ENST00000600311.1_RNA	NM_001206920.1	NP_001193849.1	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCAAAACACATTATAAGTCTG	0.393																																																	0								ENSG00000258856																																			CTD-2325K12.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000556826.1:c.104-36423A>T	14.37:g.58097265T>A		Somatic	0	52	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A6NDQ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000556826.1	37	NULL		14																																																																																			-	-		0.393	SLC35F4-004	NOVEL	not_organism_supported|upstream_uORF|basic|appris_principal	protein_coding	ENSG00000258856	protein_coding	OTTHUMT00000412973.1	T	XM_292260	-		58097265	+1	no_errors	ENST00000600311	ensembl	human	known	74_37	rna	SNP	0.995	A
CXCR1	3577	genome.wustl.edu	37	2	219029327	219029327	+	Missense_Mutation	SNP	C	C	T	rs538588993		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:219029327C>T	ENST00000295683.2	-	2	728	c.608G>A	c.(607-609)cGg>cAg	p.R203Q		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	203					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)	p.R203Q(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	AGGCAGGATCCGCAACACCAT	0.522													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23628	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	prostate(1)						ENSG00000163464						106.0	93.0	97.0					2																	219029327		2203	4300	6503	CXCR1	SO:0001583	missense	0			-	HGNC	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.608G>A	2.37:g.219029327C>T	ENSP00000295683:p.Arg203Gln	Somatic	0	50	0.00		0.5538374756952343	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	48	20.00	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR1,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.R203Q	ENST00000295683.2	37	c.608	CCDS2409.1	2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984602	0.93044	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.37058	1.22	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.179642	0.48767	D	0.000179	T	0.53802	0.1819	L	0.59967	1.855	0.49915	D	0.999835	D	0.60160	0.987	P	0.62491	0.903	T	0.54063	-0.8349	10	0.46703	T	0.11	.	16.859	0.86013	0.0:1.0:0.0:0.0	.	203	P25024	CXCR1_HUMAN	Q	203;147	ENSP00000295683:R203Q	ENSP00000295683:R203Q	R	-	2	0	CXCR1	218737572	0.992000	0.36948	0.274000	0.24659	0.968000	0.65278	4.840000	0.62817	2.314000	0.78098	0.561000	0.74099	CGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn		0.522	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR1	protein_coding	OTTHUMT00000256773.2	C	NM_000634	-		219029327	-1	no_errors	ENST00000295683	ensembl	human	known	74_37	missense	SNP	0.997	T
PITPNC1	26207	genome.wustl.edu	37	17	65683225	65683225	+	Intron	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:65683225T>A	ENST00000581322.1	+	9	682				PITPNC1_ENST00000580974.1_Missense_Mutation_p.H242Q|PITPNC1_ENST00000299954.9_Missense_Mutation_p.H242Q|PITPNC1_ENST00000335257.6_Intron			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1						phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			AAAACATGCATGAACAAACCA	0.388																																																	0								ENSG00000154217						159.0	153.0	155.0					17																	65683225		1933	4122	6055	PITPNC1	SO:0001627	intron_variant	0			-	HGNC	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.683-5463T>A	17.37:g.65683225T>A		Somatic	0	67	0.00		0.5538374756952343	36	7.69	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	61	29.07	A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI_transfer,prints_PI_transfer	p.H242Q	ENST00000581322.1	37	c.726	CCDS58588.1	17	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059535	0.36373	.	.	ENSG00000154217	ENST00000299954	T	0.38077	1.16	5.13	5.13	0.70059	.	.	.	.	.	T	0.05960	0.0155	N	0.00017	-2.835	0.22521	N	0.999023	B	0.06786	0.001	B	0.06405	0.002	T	0.11251	-1.0595	9	0.02654	T	1	.	11.2641	0.49099	0.0:0.0:0.1527:0.8472	.	242	Q9UKF7-2	.	Q	242	ENSP00000299954:H242Q	ENSP00000299954:H242Q	H	+	3	2	PITPNC1	63113687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.092000	0.64511	2.046000	0.60703	0.482000	0.46254	CAT	-	pfam_PI_transfer		0.388	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNC1	protein_coding	OTTHUMT00000447194.1	T	NM_012417	-		65683225	+1	no_errors	ENST00000299954	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF521	25925	genome.wustl.edu	37	18	22932142	22932142	+	5'Flank	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:22932142G>C	ENST00000361524.3	-	0	0				ZNF521_ENST00000538137.2_5'Flank|ZNF521_ENST00000584787.1_5'Flank|ZNF521_ENST00000579111.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTCACACACAGACAGAGGGGC	0.662			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0								ENSG00000198795						80.0	81.0	81.0					18																	22932142		876	1991	2867	ZNF521	SO:0001631	upstream_gene_variant	0			-	HGNC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83			18.37:g.22932142G>C	Exception_encountered	Somatic	0	65	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	39	31.03	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361524.3	37	NULL	CCDS32806.1	18																																																																																			-	-		0.662	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	protein_coding	OTTHUMT00000446781.2	G	NM_015461	-		22932142	-1	no_errors	ENST00000579111	ensembl	human	known	74_37	rna	SNP	1.000	C
SGOL2	151246	genome.wustl.edu	37	2	201437697	201437697	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:201437697T>A	ENST00000357799.4	+	7	2726	c.2628T>A	c.(2626-2628)tgT>tgA	p.C876*		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	876					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GAAATTTATGTGATTATGACA	0.303																																																	0								ENSG00000163535						82.0	84.0	83.0					2																	201437697		1805	4054	5859	SGOL2	SO:0001587	stop_gained	0			-	HGNC	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2628T>A	2.37:g.201437697T>A	ENSP00000350447:p.Cys876*	Somatic	0	42	0.00		0.5538374756952343	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C876*	ENST00000357799.4	37	c.2628	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216796	0.79352	.	.	ENSG00000163535	ENST00000357799	.	.	.	4.7	3.55	0.40652	.	0.757356	0.11335	N	0.574592	.	.	.	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	0.3911	6.9437	0.24506	0.0:0.1035:0.0:0.8965	.	.	.	.	X	876	.	ENSP00000350447:C876X	C	+	3	2	SGOL2	201145942	0.001000	0.12720	0.018000	0.16275	0.054000	0.15201	0.113000	0.15499	0.947000	0.37659	0.477000	0.44152	TGT	-	NULL		0.303	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	protein_coding	OTTHUMT00000335834.1	T	NM_152524	-		201437697	+1	no_errors	ENST00000357799	ensembl	human	known	74_37	nonsense	SNP	0.012	A
FAM138C	654835	genome.wustl.edu	37	9	35199	35199	+	lincRNA	SNP	A	A	G	rs9408059		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:35199A>G	ENST00000449442.2	-	0	403									family with sequence similarity 138, member C																		tgggaggctgaggtgggagga	0.438																																																	0								ENSG00000218839																																			FAM138C			0			-	HGNC			9p24.3	2013-01-30			ENSG00000218839	ENSG00000218839		"""Long non-coding RNAs"""	32333	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026822		Approved	F379	uc003zfv.3		OTTHUMG00000019422		9.37:g.35199A>G		Somatic	0	31	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449442.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	A	1.738	-0.492428	0.04322	.	.	ENSG00000218839	ENST00000449442;ENST00000305248	.	.	.	0.185	-0.371	0.12525	.	.	.	.	.	T	0.33990	0.0882	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31752	-0.9932	4	0.52906	T	0.07	.	.	.	.	.	.	.	.	P	28	.	ENSP00000303458:S28P	S	-	1	0	FAM138C	25199	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.686000	0.05161	-0.785000	0.04522	-0.782000	0.03352	TCA	-	-		0.438	FAM138C-001	KNOWN	basic	lincRNA	FAM138C	lincRNA	OTTHUMT00000051450.2	A	NR_026822	-		35199	-1	no_errors	ENST00000305248	ensembl	human	known	74_37	rna	SNP	0.000	G
KRT23	25984	genome.wustl.edu	37	17	39081634	39081634	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:39081634G>A	ENST00000209718.3	-	7	1538	c.1114C>T	c.(1114-1116)Cga>Tga	p.R372*	KRT23_ENST00000436344.3_Nonsense_Mutation_p.R235*|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	372	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R372R(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AGGAGCCGTCGGTACGTGGTG	0.557																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000108244						199.0	152.0	168.0					17																	39081634		2203	4300	6503	KRT23	SO:0001587	stop_gained	0			-	HGNC	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.1114C>T	17.37:g.39081634G>A	ENSP00000209718:p.Arg372*	Somatic	0	48	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	21	30.00	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,prints_Keratin_I	p.R372*	ENST00000209718.3	37	c.1114	CCDS11380.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.752212	0.97813	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	.	.	.	5.49	5.49	0.81192	.	0.131519	0.35936	N	0.002893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3809	0.94532	0.0:0.0:1.0:0.0	.	.	.	.	X	372;235	.	ENSP00000209718:R372X	R	-	1	2	KRT23	36335160	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.762000	0.62250	2.581000	0.87130	0.655000	0.94253	CGA	-	pfam_IF		0.557	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT23	protein_coding	OTTHUMT00000257223.1	G		-		39081634	-1	no_errors	ENST00000209718	ensembl	human	known	74_37	nonsense	SNP	1.000	A
TLR4	7099	genome.wustl.edu	37	9	120466787	120466787	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:120466787C>A	ENST00000355622.6	+	1	138	c.37C>A	c.(37-39)Cca>Aca	p.P13T	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_5'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	13					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GACTCTGATCCCAGCCATGGC	0.592																																																	0								ENSG00000136869						63.0	62.0	62.0					9																	120466787		2203	4300	6503	TLR4	SO:0001583	missense	0			-	HGNC	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.37C>A	9.37:g.120466787C>A	ENSP00000363089:p.Pro13Thr	Somatic	0	19	0.00		0.5538374756952343	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.P13T	ENST00000355622.6	37	c.37	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	14.32	2.498943	0.44455	.	.	ENSG00000136869	ENST00000355622	T	0.36699	1.24	5.42	-0.378	0.12497	.	1.122620	0.06652	N	0.762877	T	0.19886	0.0478	L	0.29908	0.895	0.18873	N	0.999988	P	0.44627	0.839	B	0.33454	0.164	T	0.20472	-1.0274	10	0.40728	T	0.16	.	4.3046	0.10940	0.49:0.3282:0.0:0.1818	.	13	O00206	TLR4_HUMAN	T	13	ENSP00000363089:P13T	ENSP00000363089:P13T	P	+	1	0	TLR4	119506608	0.025000	0.19082	0.967000	0.41034	0.809000	0.45718	0.006000	0.13152	0.237000	0.21200	0.557000	0.71058	CCA	-	pirsf_Toll-like_receptor		0.592	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	protein_coding	OTTHUMT00000055549.3	C	NM_138554	-		120466787	+1	no_errors	ENST00000355622	ensembl	human	known	74_37	missense	SNP	0.720	A
WFDC12	128488	genome.wustl.edu	37	20	43752883	43752883	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr20:43752883G>T	ENST00000372785.3	-	2	120	c.103C>A	c.(103-105)Cca>Aca	p.P35T		NM_080869.1	NP_543145.1	Q8WWY7	WFD12_HUMAN	WAP four-disulfide core domain 12	35	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				defense response to bacterium (GO:0042742)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6		Myeloproliferative disorder(115;0.0122)				TTGTCAGCTGGGCAAACCCCT	0.577																																																	0								ENSG00000168703						104.0	88.0	94.0					20																	43752883		2203	4300	6503	WFDC12	SO:0001583	missense	0			-	HGNC	Z93016	CCDS13343.1	20q13.12	2013-01-21	2003-02-21	2003-02-21	ENSG00000168703	ENSG00000168703		"""WAP four-disulfide core domain containing"""	16115	protein-coding gene	gene with protein product		609872	"""chromosome 20 open reading frame 122"""	C20orf122		11779191, 12206714	Standard	NM_080869		Approved	dJ211D12.4, WAP2	uc002xnf.1	Q8WWY7	OTTHUMG00000046412	ENST00000372785.3:c.103C>A	20.37:g.43752883G>T	ENSP00000361871:p.Pro35Thr	Somatic	0	49	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q5H980|Q9BR31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,prints_WAP-type_4-diS_core	p.P35T	ENST00000372785.3	37	c.103	CCDS13343.1	20	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506807	0.44558	.	.	ENSG00000168703	ENST00000372785	D	0.90504	-2.68	3.46	3.46	0.39613	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	.	.	.	.	D	0.96956	0.9006	H	0.98487	4.245	0.09310	N	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.90058	0.4154	9	0.87932	D	0	-5.4346	10.4422	0.44472	0.0:0.0:1.0:0.0	.	35	Q8WWY7	WFD12_HUMAN	T	35	ENSP00000361871:P35T	ENSP00000361871:P35T	P	-	1	0	WFDC12	43186297	0.315000	0.24571	0.025000	0.17156	0.006000	0.05464	2.222000	0.42926	1.472000	0.48140	0.557000	0.71058	CCA	-	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,prints_WAP-type_4-diS_core		0.577	WFDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC12	protein_coding	OTTHUMT00000107194.1	G		-		43752883	-1	no_errors	ENST00000372785	ensembl	human	known	74_37	missense	SNP	0.140	T
OR6C2	341416	genome.wustl.edu	37	12	55846256	55846256	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:55846256G>T	ENST00000322678.1	+	1	259	c.259G>T	c.(259-261)Gac>Tac	p.D87Y	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	87					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						ATCAATGGGGGACAATACCAT	0.368																																																	0								ENSG00000179695						141.0	142.0	142.0					12																	55846256		2203	4299	6502	OR6C2	SO:0001583	missense	0			-	HGNC	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.259G>T	12.37:g.55846256G>T	ENSP00000323606:p.Asp87Tyr	Somatic	0	74	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	45	32.84		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D87Y	ENST00000322678.1	37	c.259	CCDS31824.1	12	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275717	0.40294	.	.	ENSG00000179695	ENST00000322678	T	0.02974	4.09	5.42	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.193967	0.35646	N	0.003069	T	0.09468	0.0233	M	0.64567	1.98	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.08207	-1.0733	10	0.72032	D	0.01	.	5.6019	0.17359	0.0753:0.1395:0.6407:0.1445	.	87	Q9NZP2	OR6C2_HUMAN	Y	87	ENSP00000323606:D87Y	ENSP00000323606:D87Y	D	+	1	0	OR6C2	54132523	0.000000	0.05858	0.016000	0.15963	0.005000	0.04900	-0.991000	0.03728	0.865000	0.35603	-0.175000	0.13238	GAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.368	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	protein_coding	OTTHUMT00000406676.1	G	NM_054105	-		55846256	+1	no_errors	ENST00000322678	ensembl	human	known	74_37	missense	SNP	0.005	T
SERTAD1	29950	genome.wustl.edu	37	19	40929254	40929254	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:40929254A>G	ENST00000357949.4	-	2	358	c.200T>C	c.(199-201)cTg>cCg	p.L67P		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	67	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)					endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GACCAGCACCAGGTGCCGCAG	0.682																																																	0								ENSG00000197019						21.0	24.0	23.0					19																	40929254		2203	4299	6502	SERTAD1	SO:0001583	missense	0			-	HGNC	AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.200T>C	19.37:g.40929254A>G	ENSP00000350633:p.Leu67Pro	Somatic	0	40	0.00		0.5538374756952343	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q9BUE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SERTA,pfscan_SERTA	p.L67P	ENST00000357949.4	37	c.200	CCDS12557.1	19	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568266	0.65651	.	.	ENSG00000197019	ENST00000357949	T	0.49720	0.77	5.16	5.16	0.70880	.	0.220217	0.33327	N	0.005028	T	0.58864	0.2152	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.58059	-0.7703	10	0.41790	T	0.15	-7.179	13.9786	0.64287	1.0:0.0:0.0:0.0	.	67	Q9UHV2	SRTD1_HUMAN	P	67	ENSP00000350633:L67P	ENSP00000350633:L67P	L	-	2	0	SERTAD1	45621094	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.943000	0.63554	1.952000	0.56665	0.459000	0.35465	CTG	-	pfam_SERTA,pfscan_SERTA		0.682	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD1	protein_coding	OTTHUMT00000462571.1	A	NM_013376	-		40929254	-1	no_errors	ENST00000357949	ensembl	human	known	74_37	missense	SNP	1.000	G
CXorf57	55086	genome.wustl.edu	37	X	105905498	105905498	+	Silent	SNP	C	C	T	rs140805762	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:105905498C>T	ENST00000372548.4	+	12	2341	c.2232C>T	c.(2230-2232)agC>agT	p.S744S	CXorf57_ENST00000497124.1_3'UTR|CXorf57_ENST00000372544.2_Silent_p.S647S	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	744							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						ATTTTAAGAGCGCCCGAAGCC	0.358																																																	0								ENSG00000147231	C	,	0,3833		0,0,0,1631,571	71.0	69.0	69.0		1941,2232	-3.3	0.1	X	dbSNP_134	69	3,6725		0,2,1,2426,1871	no	coding-synonymous,coding-synonymous	CXorf57	NM_001184782.1,NM_018015.5	,	0,2,1,4057,2442	TT,TC,T,CC,C		0.0446,0.0,0.0284	,	647/759,744/856	105905498	3,10558	2202	4300	6502	CXorf57	SO:0001819	synonymous_variant	0			-	HGNC	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.2232C>T	X.37:g.105905498C>T		Somatic	0	83	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	40	39.39	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_NA-bd_OB-fold	p.S744	ENST00000372548.4	37	c.2232	CCDS14519.1	X																																																																																			-	NULL		0.358	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	protein_coding	OTTHUMT00000057800.2	C	NM_018015	rs140805762		105905498	+1	no_errors	ENST00000372548	ensembl	human	known	74_37	silent	SNP	0.525	T
BRSK2	9024	genome.wustl.edu	37	11	1467009	1467009	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:1467009C>G	ENST00000528841.1	+	12	1482	c.1098C>G	c.(1096-1098)gaC>gaG	p.D366E	BRSK2_ENST00000526678.1_Missense_Mutation_p.D366E|BRSK2_ENST00000308219.9_Missense_Mutation_p.D366E|BRSK2_ENST00000544817.1_Missense_Mutation_p.D61E|BRSK2_ENST00000382179.1_Missense_Mutation_p.D412E|BRSK2_ENST00000308230.5_Missense_Mutation_p.D366E|BRSK2_ENST00000531197.1_Missense_Mutation_p.D366E|BRSK2_ENST00000528710.1_Missense_Mutation_p.D306E			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	366					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGCGTGTGGACTCCCCGATGC	0.716																																																	0								ENSG00000174672						37.0	48.0	44.0					11																	1467009		2127	4251	6378	BRSK2	SO:0001583	missense	0			-	HGNC	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1098C>G	11.37:g.1467009C>G	ENSP00000432000:p.Asp366Glu	Somatic	0	85	0.00		0.5538374756952343	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	79	35.25	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D412E	ENST00000528841.1	37	c.1236	CCDS58107.1	11	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498469	0.85069	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.73152	-0.7;-0.69;-0.7;-0.72;-0.7;1.91;-0.55;-0.42	4.18	3.25	0.37280	Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	D	0.82719	0.5098	M	0.84326	2.69	0.50313	D	0.999867	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.99;0.999;0.999;1.0	T	0.83078	-0.0139	10	0.59425	D	0.04	.	9.8543	0.41077	0.0:0.8291:0.0:0.1709	.	366;412;366;366;366	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	E	366;366;366;366;366;306;412;61	ENSP00000310697:D366E;ENSP00000431152:D366E;ENSP00000310805:D366E;ENSP00000432000:D366E;ENSP00000433370:D366E;ENSP00000433235:D306E;ENSP00000371614:D412E;ENSP00000445168:D61E	ENSP00000310697:D366E	D	+	3	2	BRSK2	1423585	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.707000	0.54838	0.956000	0.37904	0.462000	0.41574	GAC	-	superfamily_Kinase-like_dom		0.716	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRSK2	protein_coding	OTTHUMT00000393033.1	C	NM_003957	-		1467009	+1	no_errors	ENST00000382179	ensembl	human	known	74_37	missense	SNP	1.000	G
MFHAS1	9258	genome.wustl.edu	37	8	8750390	8750390	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr8:8750390G>C	ENST00000276282.6	-	1	765	c.179C>G	c.(178-180)gCc>gGc	p.A60G	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	60										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCCGAGGTTGGCCGGCAGCAC	0.746																																					Melanoma(103;1201 2045 17515 28966)												0								ENSG00000147324						9.0	11.0	10.0					8																	8750390		2172	4261	6433	MFHAS1	SO:0001583	missense	0			-	HGNC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.179C>G	8.37:g.8750390G>C	ENSP00000276282:p.Ala60Gly	Somatic	0	113	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	76	31.25	Q96CI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_typical-subtyp	p.A60G	ENST00000276282.6	37	c.179	CCDS34844.1	8	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928839	0.73327	.	.	ENSG00000147324	ENST00000276282	T	0.24723	1.84	4.54	3.62	0.41486	.	0.395788	0.21265	N	0.077412	T	0.14614	0.0353	N	0.14661	0.345	0.33699	D	0.614353	B	0.22276	0.067	B	0.17098	0.017	T	0.14035	-1.0487	10	0.30078	T	0.28	.	11.6332	0.51187	0.0:0.0:0.822:0.178	.	60	Q9Y4C4	MFHA1_HUMAN	G	60	ENSP00000276282:A60G	ENSP00000276282:A60G	A	-	2	0	MFHAS1	8787800	0.993000	0.37304	0.998000	0.56505	0.954000	0.61252	1.912000	0.39946	2.051000	0.60960	0.563000	0.77884	GCC	-	NULL		0.746	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFHAS1	protein_coding	OTTHUMT00000374724.2	G	NM_004225	-		8750390	-1	no_errors	ENST00000276282	ensembl	human	known	74_37	missense	SNP	1.000	C
PTGER2	5732	genome.wustl.edu	37	14	52794162	52794166	+	Frame_Shift_Del	DEL	CTGAC	CTGAC	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	CTGAC	CTGAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:52794162_52794166delCTGAC	ENST00000245457.5	+	2	1221_1225	c.1067_1071delCTGAC	c.(1066-1071)gctgacfs	p.AD356fs	PTGER2_ENST00000557436.1_Frame_Shift_Del_p.AD101fs	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	356					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AGTAAACAGGCTGACCTTTGAGGTC	0.376																																																	0								ENSG00000125384																																			PTGER2	SO:0001589	frameshift_variant	0				HGNC		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.1067_1071delCTGAC	14.37:g.52794162_52794166delCTGAC	ENSP00000245457:p.Ala356fs	Somatic	NA	NA	NA		0.5538374756952343	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DSC0|Q52LG8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.D357fs	ENST00000245457.5	37	c.1067_1071	CCDS9708.1	14																																																																																			-	NULL		0.376	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	protein_coding	OTTHUMT00000276890.1	CTGAC				52794166	+1	no_errors	ENST00000245457	ensembl	human	known	74_37	frame_shift_del	DEL	0.018:0.888:0.956:0.966:0.958	-
CDC42BPA	8476	genome.wustl.edu	37	1	227307591	227307591	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:227307591G>A	ENST00000366769.3	-	12	2852	c.1561C>T	c.(1561-1563)Caa>Taa	p.Q521*	CDC42BPA_ENST00000334218.5_Nonsense_Mutation_p.Q521*|CDC42BPA_ENST00000366767.3_Nonsense_Mutation_p.Q521*|CDC42BPA_ENST00000535525.1_Nonsense_Mutation_p.Q521*|CDC42BPA_ENST00000366766.2_Nonsense_Mutation_p.Q521*|CDC42BPA_ENST00000366765.3_Nonsense_Mutation_p.Q521*|CDC42BPA_ENST00000366764.2_Nonsense_Mutation_p.Q521*	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TCTAGTTCTTGCCTCACAGCA	0.303																																																	0								ENSG00000143776						123.0	113.0	116.0					1																	227307591		2200	4299	6499	CDC42BPA	SO:0001587	stop_gained	0			-	HGNC	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.1561C>T	1.37:g.227307591G>A	ENSP00000355731:p.Gln521*	Somatic	0	37	0.00		0.5538374756952343	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.Q521*	ENST00000366769.3	37	c.1561	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	G	49	15.631361	0.99840	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	.	.	.	5.47	3.52	0.40303	.	0.432330	0.26293	N	0.025207	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	12.1907	0.54270	0.0:0.1305:0.7337:0.1359	.	.	.	.	X	521	.	ENSP00000335341:Q521X	Q	-	1	0	CDC42BPA	225374214	0.110000	0.22057	0.788000	0.31933	0.993000	0.82548	2.443000	0.44881	0.602000	0.29896	0.650000	0.86243	CAA	-	NULL		0.303	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	protein_coding	OTTHUMT00000091696.1	G	NM_014826	-		227307591	-1	no_errors	ENST00000334218	ensembl	human	known	74_37	nonsense	SNP	0.972	A
TRIM39	56658	genome.wustl.edu	37	6	30294912	30294912	+	Intron	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:30294912G>A	ENST00000376656.4	+	1	152				HCG18_ENST00000412685.2_RNA|TRIM39_ENST00000540416.1_Intron|TRIM39_ENST00000396551.3_Intron|HCG18_ENST00000602498.1_RNA|HCG18_ENST00000449544.1_RNA|HCG18_ENST00000602290.1_RNA|HCG18_ENST00000426882.1_RNA|TRIM39_ENST00000396548.1_Intron|TRIM39-RPP21_ENST00000513556.1_5'Flank|HCG18_ENST00000444126.1_RNA|HCG18_ENST00000438412.1_RNA|HCG18_ENST00000454269.1_RNA|HCG18_ENST00000602550.1_RNA|TRIM39_ENST00000396547.1_5'Flank|HCG18_ENST00000454129.1_RNA|HCG17_ENST00000453558.1_lincRNA|TRIM39_ENST00000376659.5_5'Flank|HCG18_ENST00000413358.2_RNA	NM_021253.3	NP_067076.2	Q9HCM9	TRI39_HUMAN	tripartite motif containing 39						apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						CCTCGGGCCCGGGCGGACGTT	0.771																																																	0								ENSG00000231074																																			HCG18	SO:0001627	intron_variant	0			-	HGNC	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000376656.4:c.-161+140G>A	6.37:g.30294912G>A		Somatic	0	20	0.00		0.5538374756952343	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376656.4	37	NULL	CCDS34377.1	6																																																																																			-	-		0.771	TRIM39-201	KNOWN	basic|CCDS	protein_coding	HCG18	protein_coding		G	NM_172016	-		30294912	-1	no_errors	ENST00000426882	ensembl	human	known	74_37	rna	SNP	0.845	A
CDRT15L2	256223	genome.wustl.edu	37	17	20483823	20483823	+	Silent	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:20483823C>A	ENST00000399044.1	+	2	647	c.627C>A	c.(625-627)acC>acA	p.T209T	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	209						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						TCGCCGGAACCACAGCCCTGC	0.537																																																	0								ENSG00000214819																																			CDRT15L2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.627C>A	17.37:g.20483823C>A		Somatic	0	54	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	68	22.73		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T209	ENST00000399044.1	37	c.627	CCDS54096.1	17																																																																																			-	NULL		0.537	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT15L2	protein_coding	OTTHUMT00000132432.3	C	XM_170840	-		20483823	+1	no_errors	ENST00000399044	ensembl	human	known	74_37	silent	SNP	0.031	A
RGAG4	340526	genome.wustl.edu	37	X	71349949	71349949	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:71349949G>A	ENST00000545866.1	-	1	1809	c.1442C>T	c.(1441-1443)aCt>aTt	p.T481I	RGAG4_ENST00000609883.1_Missense_Mutation_p.T481I|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	481										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GGGGCCAGAAGTCTGGGATGA	0.547																																																	0								ENSG00000242732						92.0	92.0	92.0					X																	71349949		2128	4210	6338	RGAG4	SO:0001583	missense	0			-	HGNC	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1442C>T	X.37:g.71349949G>A	ENSP00000441366:p.Thr481Ile	Somatic	0	89	0.00		0.5538374756952343	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	41	43.84	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom	p.T481I	ENST00000545866.1	37	c.1442	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	G	11.27	1.590151	0.28357	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.21734	1.99;1.99	3.87	2.03	0.26663	.	.	.	.	.	T	0.10895	0.0266	N	0.19112	0.55	0.18873	N	0.999989	B	0.20550	0.046	B	0.14578	0.011	T	0.34329	-0.9833	8	.	.	.	-1.0359	3.9849	0.09511	0.1198:0.0:0.462:0.4182	.	481	Q5HYW3	RGAG4_HUMAN	I	481	ENSP00000441366:T481I;ENSP00000418667:T481I	.	T	-	2	0	RGAG4	71266674	0.997000	0.39634	0.248000	0.24265	0.051000	0.14879	1.325000	0.33724	0.395000	0.25257	0.500000	0.49745	ACT	-	NULL		0.547	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	protein_coding	OTTHUMT00000057171.1	G	NM_001024455	-		71349949	-1	no_errors	ENST00000479991	ensembl	human	known	74_37	missense	SNP	0.206	A
PPP1R9B	84687	genome.wustl.edu	37	17	48211791	48211791	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:48211791T>C	ENST00000316878.6	-	0	3355				AC002401.1_ENST00000451776.1_RNA|PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						GACCTGACTCTCCAGGGAGAA	0.622																																																	0								ENSG00000108819																																			PPP1R9B	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*905A>G	17.37:g.48211791T>C		Somatic	0	27	0.00		0.5538374756952343	93	6.06	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	17	39.29	Q8TCR9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000316878.6	37	NULL		17																																																																																			-	-		0.622	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	protein_coding		T	NM_032595	-		48211791	-1	no_errors	ENST00000501501	ensembl	human	known	74_37	rna	SNP	0.464	C
MKRN3	7681	genome.wustl.edu	37	15	23811311	23811311	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:23811311A>T	ENST00000314520.3	+	1	858	c.382A>T	c.(382-384)Act>Tct	p.T128S	MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	128					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GAAGATGGCCACTGAGGGTGG	0.612																																																	0								ENSG00000179455						48.0	51.0	50.0					15																	23811311		2203	4300	6503	MKRN3	SO:0001583	missense	0			-	HGNC	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.382A>T	15.37:g.23811311A>T	ENSP00000313881:p.Thr128Ser	Somatic	0	53	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.T128S	ENST00000314520.3	37	c.382	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	A	8.295	0.818543	0.16607	.	.	ENSG00000179455	ENST00000314520	T	0.29655	1.56	3.74	-5.23	0.02798	.	0.367003	0.27739	N	0.018054	T	0.15046	0.0363	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26538	-1.0100	10	0.15499	T	0.54	.	6.013	0.19586	0.2606:0.3092:0.4302:0.0	.	128	Q13064	MKRN3_HUMAN	S	128	ENSP00000313881:T128S	ENSP00000313881:T128S	T	+	1	0	MKRN3	21362404	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.353000	0.07691	-1.114000	0.02977	0.460000	0.39030	ACT	-	NULL		0.612	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	protein_coding	OTTHUMT00000251225.1	A	NM_005664	-		23811311	+1	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	SNP	0.000	T
KRTAP5-1	387264	genome.wustl.edu	37	11	1606345	1606345	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:1606345G>A	ENST00000382171.2	-	1	168	c.135C>T	c.(133-135)ccC>ccT	p.P45P	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	45	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.P45P(1)		endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGCAGCAGACGGGCACACAGC	0.687																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000205869						70.0	83.0	79.0					11																	1606345		2202	4298	6500	KRTAP5-1	SO:0001819	synonymous_variant	0			-	HGNC	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.135C>T	11.37:g.1606345G>A		Somatic	1	124	0.80		0.5538374756952343	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	75	10.71		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P45	ENST00000382171.2	37	c.135	CCDS31330.1	11																																																																																			-	NULL		0.687	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	protein_coding	OTTHUMT00000127922.1	G	NM_001005922	-		1606345	-1	no_errors	ENST00000382171	ensembl	human	known	74_37	silent	SNP	0.012	A
CCDC87	55231	genome.wustl.edu	37	11	66358959	66358959	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:66358959C>G	ENST00000333861.3	-	1	1595	c.1528G>C	c.(1528-1530)Gat>Cat	p.D510H	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	510					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGCCCTTGATCAAAATGTAAG	0.453																																																	0								ENSG00000182791						94.0	96.0	95.0					11																	66358959		2200	4295	6495	CCDC87	SO:0001583	missense	0			-	HGNC	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1528G>C	11.37:g.66358959C>G	ENSP00000328487:p.Asp510His	Somatic	0	96	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	46	36.99	Q8NE76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP65_Ase1_PRC1	p.D510H	ENST00000333861.3	37	c.1528	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641435	0.29157	.	.	ENSG00000182791	ENST00000333861	T	0.47528	0.84	5.3	4.39	0.52855	.	0.306069	0.23164	N	0.051208	T	0.59074	0.2167	M	0.66939	2.045	0.21064	N	0.999793	D	0.65815	0.995	P	0.57960	0.83	T	0.53844	-0.8381	10	0.72032	D	0.01	.	9.7672	0.40567	0.0:0.9077:0.0:0.0923	.	510	Q9NVE4	CCD87_HUMAN	H	510	ENSP00000328487:D510H	ENSP00000328487:D510H	D	-	1	0	CCDC87	66115535	0.999000	0.42202	0.090000	0.20809	0.053000	0.15095	2.526000	0.45607	1.478000	0.48253	0.563000	0.77884	GAT	-	NULL		0.453	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	protein_coding	OTTHUMT00000393825.1	C	NM_018219	-		66358959	-1	no_errors	ENST00000333861	ensembl	human	known	74_37	missense	SNP	0.358	G
SRGAP2B	647135	genome.wustl.edu	37	1	144013941	144013941	+	RNA	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:144013941C>G	ENST00000467933.1	+	0	956							P0DMP2	SRG2B_HUMAN	SLIT-ROBO Rho GTPase activating protein 2B						nervous system development (GO:0007399)												AATGCCTGGACCAGCAGTGTG	0.502																																																	0								ENSG00000196369																																			SRGAP2B			0			-	HGNC		CCDS72854.1	1q21.1	2014-07-10	2013-02-13	2012-05-08	ENSG00000196369	ENSG00000196369			35237	protein-coding gene	gene with protein product		614703	"""SLIT-ROBO Rho GTPase activating protein 2 pseudogene 2"", ""SLIT-ROBO Rho GTPase activating protein 2B (pseudogene)"""	SRGAP2P2		22559943, 22559944	Standard	NM_001271870		Approved		uc010oxm.1	P0DMP2	OTTHUMG00000041442		1.37:g.144013941C>G		Somatic	0	121	0.00		0.5538374756952343	39	4.88	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	104	10.34		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467933.1	37	NULL		1																																																																																			-	-		0.502	SRGAP2B-002	KNOWN	basic	processed_transcript	SRGAP2B	pseudogene	OTTHUMT00000352915.1	C	NM_001271870	-		144013941	+1	no_errors	ENST00000467933	ensembl	human	known	74_37	rna	SNP	1.000	G
FAM174B	400451	genome.wustl.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	TGGAGC	-	rs66488707|rs111725167|rs68056278	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	TGGAGC	TGGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:93198679_93198684delTGGAGC	ENST00000327355.5	-	1	504_509	c.206_211delGCTCCA	c.(205-213)agctccaac>aac	p.SS69del	FAM174B_ENST00000555748.1_5'Flank|FAM174B_ENST00000555696.1_5'Flank	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	69						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CCACTGCTGTTGGAGCTGGAGCTGCC	0.714														4884	0.97524	0.9092	0.9942	5008	,	,		6551	1.0		1.0	False		,,,				2504	1.0																0								ENSG00000185442			1931,417		927,77,170						2.2	1.0		dbSNP_130	8	5234,70		2614,6,32	no	coding	FAM174B	NM_207446.2		3541,83,202	A1A1,A1R,RR		1.3198,17.7598,6.3643				7165,487				FAM174B	SO:0001651	inframe_deletion	0				HGNC		CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.206_211delGCTCCA	15.37:g.93198685_93198690delTGGAGC	ENSP00000329040:p.Ser69_Ser70del	Somatic	NA	NA	NA		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q3ZCR9|Q8NBH7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF1180	p.SS69in_frame_del	ENST00000327355.5	37	c.211_206	CCDS45355.1	15																																																																																			-	pfam_DUF1180		0.714	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM174B	protein_coding	OTTHUMT00000414931.1	TGGAGC	NM_207446			93198684	-1	no_errors	ENST00000327355	ensembl	human	known	74_37	in_frame_del	DEL	0.997:0.996:0.995:0.994:0.994:0.995	-
ADAMTS20	80070	genome.wustl.edu	37	12	43826172	43826172	+	Nonsense_Mutation	SNP	G	G	A	rs200767698		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:43826172G>A	ENST00000389420.3	-	21	3030	c.3031C>T	c.(3031-3033)Cga>Tga	p.R1011*	ADAMTS20_ENST00000395541.2_Nonsense_Mutation_p.R165*|ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.R1011*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1011	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R1011R(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTCGTCACTCGGGACAGTTCT	0.443																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000173157	G	stop/ARG	0,4406		0,0,2203	121.0	116.0	118.0		3031	4.1	0.1	12		118	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	ADAMTS20	NM_025003.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1011/1911	43826172	1,13005	2203	4300	6503	ADAMTS20	SO:0001587	stop_gained	0			-	HGNC	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3031C>T	12.37:g.43826172G>A	ENSP00000374071:p.Arg1011*	Somatic	0	50	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	43	27.12	A6NNC9|J3QT00	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1011*	ENST00000389420.3	37	c.3031	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	40	8.237412	0.98719	0.0	1.16E-4	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	.	.	.	5.04	4.07	0.47477	.	0.303544	0.22113	N	0.064444	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	11.0308	0.47772	0.0:0.0:0.6377:0.3623	.	.	.	.	X	1011;177;165;1011;1011	.	ENSP00000374068:R1011X	R	-	1	2	ADAMTS20	42112439	0.096000	0.21769	0.067000	0.19924	0.892000	0.51952	2.439000	0.44846	2.706000	0.92434	0.655000	0.94253	CGA	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.443	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403643.1	G	NM_025003	rs200767698		43826172	-1	no_errors	ENST00000389420	ensembl	human	known	74_37	nonsense	SNP	0.669	A
UBQLNL	143630	genome.wustl.edu	37	11	5537632	5537632	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:5537632T>C	ENST00000380184.1	-	1	303	c.40A>G	c.(40-42)Agt>Ggt	p.S14G	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	14										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GGACATCCACTCTGGGACATC	0.532																																																	0								ENSG00000175518						78.0	77.0	78.0					11																	5537632		2201	4297	6498	UBQLNL	SO:0001583	missense	0			-	HGNC	AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.40A>G	11.37:g.5537632T>C	ENSP00000369531:p.Ser14Gly	Somatic	0	49	0.00		0.5538374756952343	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.S14G	ENST00000380184.1	37	c.40	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	T	3.786	-0.044715	0.07452	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.40476	1.03	4.94	1.05	0.20165	.	0.608853	0.15582	N	0.254825	T	0.27134	0.0665	L	0.42245	1.32	0.09310	N	1	B	0.33694	0.421	B	0.30646	0.118	T	0.13764	-1.0497	10	0.21014	T	0.42	.	4.8849	0.13697	0.3303:0.0:0.1716:0.4981	.	14	Q8IYU4	UBQLN_HUMAN	G	14	ENSP00000369531:S14G	ENSP00000369531:S14G	S	-	1	0	UBQLNL	5494208	0.008000	0.16893	0.022000	0.16811	0.023000	0.10783	-0.256000	0.08757	0.004000	0.14682	0.528000	0.53228	AGT	-	NULL		0.532	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	protein_coding	OTTHUMT00000143386.1	T	NM_145053	-		5537632	-1	no_errors	ENST00000380184	ensembl	human	putative	74_37	missense	SNP	0.138	C
DNAH8	1769	genome.wustl.edu	37	6	38738286	38738286	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:38738286A>G	ENST00000359357.3	+	10	1318	c.1064A>G	c.(1063-1065)gAa>gGa	p.E355G	DNAH8_ENST00000449981.2_Missense_Mutation_p.E572G|DNAH8_ENST00000441566.1_Missense_Mutation_p.E355G			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	355					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAGGTTTCAGAAATGTATATA	0.368																																																	0								ENSG00000124721						39.0	40.0	40.0					6																	38738286		2203	4299	6502	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1064A>G	6.37:g.38738286A>G	ENSP00000352312:p.Glu355Gly	Somatic	0	84	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E355G	ENST00000359357.3	37	c.1064		6	.	.	.	.	.	.	.	.	.	.	A	23.6	4.435116	0.83885	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.58060	0.36;0.36;0.36	5.45	5.45	0.79879	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.87097	2.86	0.58432	D	0.999999	D	0.69078	0.997	D	0.71414	0.973	T	0.75456	-0.3311	10	0.59425	D	0.04	.	14.0421	0.64681	1.0:0.0:0.0:0.0	.	355	Q96JB1	DYH8_HUMAN	G	560;560;355;355	ENSP00000333363:E560G;ENSP00000352312:E355G;ENSP00000402294:E355G	ENSP00000333363:E560G	E	+	2	0	DNAH8	38846264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.077000	0.76814	2.201000	0.70794	0.523000	0.50628	GAA	-	pfam_Dynein_heavy_dom-1		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	A	NM_001206927	-		38738286	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	1.000	G
KBTBD8	84541	genome.wustl.edu	37	3	67049586	67049586	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr3:67049586C>A	ENST00000417314.2	+	2	247	c.198C>A	c.(196-198)aaC>aaA	p.N66K	KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000295568.4_Missense_Mutation_p.N40K|KBTBD8_ENST00000469661.1_3'UTR			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	66	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GTCATAGAAACGTTCTTGCTG	0.438																																																	0								ENSG00000163376						185.0	172.0	177.0					3																	67049586		2203	4300	6503	KBTBD8	SO:0001583	missense	0			-	HGNC	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.198C>A	3.37:g.67049586C>A	ENSP00000401878:p.Asn66Lys	Somatic	0	131	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	58	37.63	B4DTW6|Q96JI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.N66K	ENST00000417314.2	37	c.198	CCDS2906.2	3	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702546	0.68501	.	.	ENSG00000163376	ENST00000295568;ENST00000417314;ENST00000460784	T;T;T	0.66815	-0.23;-0.23;-0.23	5.62	4.73	0.59995	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.136504	0.64402	D	0.000003	T	0.75361	0.3839	M	0.87971	2.92	0.48696	D	0.999697	P	0.48503	0.911	P	0.53722	0.733	T	0.78505	-0.2178	10	0.72032	D	0.01	.	4.796	0.13272	0.0:0.6311:0.2121:0.1569	.	66	Q8NFY9	KBTB8_HUMAN	K	40;66;40	ENSP00000295568:N40K;ENSP00000401878:N66K;ENSP00000418075:N40K	ENSP00000295568:N40K	N	+	3	2	KBTBD8	67132276	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.948000	0.56660	2.809000	0.96659	0.467000	0.42956	AAC	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.438	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD8	protein_coding	OTTHUMT00000352189.1	C	NM_032505	-		67049586	+1	no_errors	ENST00000417314	ensembl	human	known	74_37	missense	SNP	1.000	A
XAB2	56949	genome.wustl.edu	37	19	7691075	7691075	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:7691075T>C	ENST00000358368.4	-	5	641	c.604A>G	c.(604-606)Acc>Gcc	p.T202A	XAB2_ENST00000534844.1_Missense_Mutation_p.T199A	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	202					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TTCACCACGGTGGCCAGGCGC	0.657								Direct reversal of damage;Nucleotide excision repair (NER)																																									0								ENSG00000076924						103.0	110.0	107.0					19																	7691075		2203	4300	6503	XAB2	SO:0001583	missense	0			-	HGNC	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.604A>G	19.37:g.7691075T>C	ENSP00000351137:p.Thr202Ala	Somatic	0	41	0.00		0.5538374756952343	110	9.09	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T202A	ENST00000358368.4	37	c.604	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	T	2.267	-0.367913	0.05069	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.62498	0.02;0.02	4.82	3.8	0.43715	.	0.069101	0.64402	D	0.000017	T	0.30634	0.0771	N	0.03050	-0.425	0.33369	D	0.573286	B	0.02656	0.0	B	0.04013	0.001	T	0.24225	-1.0166	10	0.12766	T	0.61	-45.9179	6.4247	0.21764	0.0:0.1941:0.0:0.8059	.	202	Q9HCS7	SYF1_HUMAN	A	202;199	ENSP00000351137:T202A;ENSP00000438225:T199A	ENSP00000351137:T202A	T	-	1	0	XAB2	7597075	1.000000	0.71417	0.945000	0.38365	0.124000	0.20399	2.187000	0.42602	0.707000	0.31934	0.454000	0.30748	ACC	-	NULL		0.657	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	protein_coding	OTTHUMT00000461021.1	T	NM_020196	-		7691075	-1	no_errors	ENST00000358368	ensembl	human	known	74_37	missense	SNP	0.998	C
EIF4A1	1973	genome.wustl.edu	37	17	7481045	7481045	+	Intron	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:7481045C>T	ENST00000293831.8	+	8	922				SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000250092.6_5'Flank|SNORA67_ENST00000384423.1_RNA|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000582746.1_Intron|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000577269.1_Intron|EIF4A1_ENST00000581808.1_Intron|CD68_ENST00000380498.6_5'Flank	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						CCGCTGCCAGCCTGTTGTGGG	0.547																																					Melanoma(120;278 1668 15796 27423 46368)												0								ENSG00000264772						126.0	121.0	123.0					17																	7481045		2203	4300	6503	SNORA67	SO:0001627	intron_variant	0			-	HGNC	D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.906+21C>T	17.37:g.7481045C>T		Somatic	0	63	0.00		0.5538374756952343	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			-	-		0.547	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	protein_coding	OTTHUMT00000226952.6	C	NM_001416	-		7481045	+1	no_errors	ENST00000581621	ensembl	human	known	74_37	rna	SNP	0.000	T
DNAAF1	123872	genome.wustl.edu	37	16	84203706	84203706	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:84203706G>A	ENST00000378553.5	+	8	1396	c.1272G>A	c.(1270-1272)tcG>tcA	p.S424S	DNAAF1_ENST00000334315.5_Intron|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	424	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TGCTACTGTCGTCACCTGTGG	0.622																																																	0								ENSG00000154099						61.0	64.0	63.0					16																	84203706		2200	4300	6500	DNAAF1	SO:0001819	synonymous_variant	0			-	HGNC	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1272G>A	16.37:g.84203706G>A		Somatic	1	111	0.89		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	59	15.71	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S424	ENST00000378553.5	37	c.1272	CCDS10943.2	16																																																																																			-	NULL		0.622	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	protein_coding	OTTHUMT00000250328.3	G	NM_178452	-		84203706	+1	no_errors	ENST00000378553	ensembl	human	known	74_37	silent	SNP	0.000	A
ROBO3	64221	genome.wustl.edu	37	11	124750448	124750453	+	In_Frame_Del	DEL	CGGAGT	CGGAGT	-	rs55725290|rs56085444|rs71859853	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	CGGAGT	CGGAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:124750448_124750453delCGGAGT	ENST00000397801.1	+	27	4285_4290	c.4093_4098delCGGAGT	c.(4093-4098)cggagtdel	p.RS1367del	ROBO3_ENST00000543966.1_In_Frame_Del_p.RS130del|ROBO3_ENST00000538940.1_In_Frame_Del_p.RS1345del|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1367					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGgccggagccggagtcggagtcaga	0.66														2107	0.420727	0.6664	0.2392	5008	,	,		17575	0.378		0.2883	False		,,,				2504	0.3978																0								ENSG00000154134			2069,1609		709,651,479						2.4	1.0		dbSNP_130	17	1833,5925		332,1169,2378	no	coding	ROBO3	NM_022370.3		1041,1820,2857	A1A1,A1R,RR		23.6272,43.7466,34.1203				3902,7534				ROBO3	SO:0001651	inframe_deletion	0				HGNC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4093_4098delCGGAGT	11.37:g.124750454_124750459delCGGAGT	ENSP00000380903:p.Arg1367_Ser1368del	Somatic	NA	NA	NA		0.5538374756952343	140	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.RS1367in_frame_del	ENST00000397801.1	37	c.4093_4098	CCDS44755.1	11																																																																																			-	NULL		0.660	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	protein_coding	OTTHUMT00000387091.1	CGGAGT	XM_370663			124750453	+1	no_errors	ENST00000397801	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.988:0.987:1.000:0.999	-
PVRL2	5819	genome.wustl.edu	37	19	45381598	45381600	+	Intron	DEL	GAG	GAG	-	rs375813744		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:45381598_45381600delGAG	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.R391del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGCTgagggtgaggaggaggagg	0.665																																																	0								ENSG00000130202		,	4,172,3746		0,0,4,17,138,1802					,	-2.1	1.0			26	34,410,7168		2,1,29,23,363,3388	no	codingComplex,intron	PVRL2	NM_002856.2,NM_001042724.1	,	2,1,33,40,501,5190	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8329,4.4875,5.3754	,	,		38,582,10914				PVRL2	SO:0001627	intron_variant	0				HGNC	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3863GAG>-	19.37:g.45381607_45381609delGAG		Somatic	0	37	0.00		0.5538374756952343	72	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R391in_frame_del	ENST00000252483.5	37	c.1161_1163	CCDS42576.1	19																																																																																			-	NULL		0.665	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	protein_coding	OTTHUMT00000453231.1	GAG	NM_002856			45381600	+1	no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
ZNF671	79891	genome.wustl.edu	37	19	58232660	58232660	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:58232660C>T	ENST00000317398.6	-	4	889	c.794G>A	c.(793-795)aGc>aAc	p.S265N	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Missense_Mutation_p.S167N	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GGGCTTCATGCTGCTGAGAGA	0.527																																																	0								ENSG00000083814						74.0	69.0	71.0					19																	58232660		2203	4300	6503	ZNF671	SO:0001583	missense	0			-	HGNC		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.794G>A	19.37:g.58232660C>T	ENSP00000321848:p.Ser265Asn	Somatic	0	36	0.00		0.5538374756952343	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A6NF07|Q9H5E9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S265N	ENST00000317398.6	37	c.794	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	C	1.814	-0.473979	0.04414	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.11930	2.73;2.73	1.58	-3.15	0.05233	.	.	.	.	.	T	0.06600	0.0169	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33111	-0.9881	9	0.72032	D	0.01	.	3.8683	0.09025	0.19:0.2164:0.0:0.5936	.	265	Q8TAW3	ZN671_HUMAN	N	265;167	ENSP00000321848:S265N;ENSP00000338670:S167N	ENSP00000321848:S265N	S	-	2	0	ZNF671	62924472	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-1.181000	0.03085	-1.186000	0.02713	0.467000	0.42956	AGC	-	NULL		0.527	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	protein_coding	OTTHUMT00000466817.1	C	NM_024833	-		58232660	-1	no_errors	ENST00000317398	ensembl	human	known	74_37	missense	SNP	0.000	T
TRMT10C	54931	genome.wustl.edu	37	3	101283705	101283705	+	Missense_Mutation	SNP	A	A	T	rs185404702		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr3:101283705A>T	ENST00000309922.6	+	2	234	c.80A>T	c.(79-81)cAt>cTt	p.H27L		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	27					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										TTTACCCTTCATAGGAAGAGA	0.383																																																	0								ENSG00000174173						147.0	138.0	141.0					3																	101283705		1820	4076	5896	TRMT10C	SO:0001583	missense	0			-	HGNC	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.80A>T	3.37:g.101283705A>T	ENSP00000312356:p.His27Leu	Somatic	0	38	0.00		0.5538374756952343	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_tRNA_m1G_MeTrfase	p.H27L	ENST00000309922.6	37	c.80	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	A	5.716	0.316529	0.10845	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.26518	2.38;1.73	5.86	2.13	0.27403	.	1.466360	0.03751	N	0.256557	T	0.15565	0.0375	N	0.24115	0.695	0.09310	N	1	P	0.35433	0.501	B	0.25140	0.058	T	0.21621	-1.0240	10	0.22109	T	0.4	-0.28	6.9442	0.24510	0.6396:0.2873:0.0731:0.0	.	27	Q7L0Y3	MRRP1_HUMAN	L	27	ENSP00000312356:H27L;ENSP00000419389:H27L	ENSP00000312356:H27L	H	+	2	0	RG9MTD1	102766395	0.000000	0.05858	0.173000	0.22940	0.862000	0.49288	0.579000	0.23788	0.436000	0.26393	0.460000	0.39030	CAT	-	NULL		0.383	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	protein_coding	OTTHUMT00000353400.2	A	NM_017819	-		101283705	+1	no_errors	ENST00000309922	ensembl	human	known	74_37	missense	SNP	0.002	T
TM9SF2	9375	genome.wustl.edu	37	13	100192902	100192902	+	Intron	DEL	T	T	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:100192902delT	ENST00000376387.4	+	8	1018					NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2						transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TTGAATGGGATTTTTTTTTGT	0.348																																																	0								ENSG00000125304																																			TM9SF2	SO:0001627	intron_variant	0				HGNC	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.829-66T>-	13.37:g.100192902delT		Somatic	0	22	0.00		0.5538374756952343	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A8K399|Q2TAY5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376387.4	37	NULL	CCDS9493.1	13																																																																																			-	-		0.348	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF2	protein_coding	OTTHUMT00000045602.3	T				100192902	+1	no_errors	ENST00000466555	ensembl	human	known	74_37	rna	DEL	0.045	-
PTGER2	5732	genome.wustl.edu	37	14	52794155	52794155	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:52794155A>C	ENST00000245457.5	+	2	1214	c.1060A>C	c.(1060-1062)Aaa>Caa	p.K354Q	PTGER2_ENST00000557436.1_Missense_Mutation_p.K99Q	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	354					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AGATGCCAGTAAACAGGCTGA	0.388																																																	0								ENSG00000125384						72.0	69.0	70.0					14																	52794155		2203	4300	6503	PTGER2	SO:0001583	missense	0			-	HGNC		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.1060A>C	14.37:g.52794155A>C	ENSP00000245457:p.Lys354Gln	Somatic	0	50	0.00		0.5538374756952343	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	12	42.86	D3DSC0|Q52LG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.K354Q	ENST00000245457.5	37	c.1060	CCDS9708.1	14	.	.	.	.	.	.	.	.	.	.	A	12.59	1.983739	0.35036	.	.	ENSG00000125384	ENST00000557436;ENST00000245457	T;T	0.37584	1.19;1.19	4.17	4.17	0.49024	.	0.962638	0.08656	N	0.913219	T	0.30262	0.0759	L	0.43152	1.355	0.27051	N	0.96378	P	0.44877	0.845	B	0.39379	0.298	T	0.12889	-1.0530	10	0.41790	T	0.15	-5.4298	7.1891	0.25816	0.8017:0.0:0.0:0.1983	.	354	P43116	PE2R2_HUMAN	Q	99;354	ENSP00000450933:K99Q;ENSP00000245457:K354Q	ENSP00000245457:K354Q	K	+	1	0	PTGER2	51863905	0.482000	0.25948	0.970000	0.41538	0.988000	0.76386	2.621000	0.46418	2.112000	0.64535	0.533000	0.62120	AAA	-	NULL		0.388	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	protein_coding	OTTHUMT00000276890.1	A		-		52794155	+1	no_errors	ENST00000245457	ensembl	human	known	74_37	missense	SNP	0.956	C
NOBOX	135935	genome.wustl.edu	37	7	144101737	144101737	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:144101737C>A	ENST00000467773.1	-	2	121	c.122G>T	c.(121-123)gGa>gTa	p.G41V	NOBOX_ENST00000483238.1_Missense_Mutation_p.G41V|NOBOX_ENST00000223140.5_5'Flank	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	41					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CCGGTACAGTCCACACACAGG	0.537																																																	0								ENSG00000106410						106.0	114.0	111.0					7																	144101737		1977	4159	6136	NOBOX	SO:0001583	missense	0			-	HGNC			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.122G>T	7.37:g.144101737C>A	ENSP00000419457:p.Gly41Val	Somatic	0	74	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	60	34.07	A6NCD3|A8MZN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G41V	ENST00000467773.1	37	c.122		7	.	.	.	.	.	.	.	.	.	.	C	1.108	-0.658954	0.03454	.	.	ENSG00000106410	ENST00000483238;ENST00000467773	D;D	0.95171	-3.62;-3.63	1.37	-2.73	0.05950	.	.	.	.	.	D	0.83050	0.5170	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.64597	-0.6370	9	0.62326	D	0.03	.	0.5262	0.00620	0.1885:0.3134:0.1893:0.3088	.	41	O60393	NOBOX_HUMAN	V	41	ENSP00000419565:G41V;ENSP00000419457:G41V	ENSP00000419457:G41V	G	-	2	0	NOBOX	143732670	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.602000	0.02079	-2.469000	0.00531	-1.407000	0.01130	GGA	-	NULL		0.537	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	C	XM_001134420	-		144101737	-1	no_errors	ENST00000467773	ensembl	human	known	74_37	missense	SNP	0.000	A
ANKRD36BP2	645784	genome.wustl.edu	37	2	89073028	89073029	+	RNA	INS	-	-	ATGTGT	rs10687402		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:89073028_89073029insATGTGT	ENST00000393525.3	+	0	401									ankyrin repeat domain 36B pseudogene 2																		TGAGTTTCTGCATGTGTGTGTG	0.302																																																	0								ENSG00000230006																																			ANKRD36BP2			0				HGNC			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89073029_89073034dupATGTGT		Somatic	NA	NA	NA		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	-		0.302	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	pseudogene	OTTHUMT00000323523.1	-				89073029	+1	no_errors	ENST00000443770	ensembl	human	known	74_37	rna	INS	0.027:0.051	ATGTGT
MEF2C	4208	genome.wustl.edu	37	5	88178836	88178836	+	5'UTR	DEL	G	G	-	rs200560914		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:88178836delG	ENST00000437473.2	-	0	214				MEF2C-AS1_ENST00000514794.1_RNA|MEF2C_ENST00000514028.1_5'UTR|MEF2C_ENST00000510942.1_5'UTR|MEF2C_ENST00000508569.1_5'UTR|MEF2C-AS1_ENST00000512585.1_RNA|MEF2C_ENST00000506554.1_5'UTR|MEF2C_ENST00000340208.5_Intron|MEF2C-AS1_ENST00000511100.1_RNA|MEF2C_ENST00000504921.2_5'UTR|MEF2C_ENST00000424173.2_Intron|MEF2C_ENST00000514015.1_5'UTR	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GAGAGAGAGAGAAAAAAAAAA	0.408										HNSCC(66;0.2)																																							0								ENSG00000081189																																			MEF2C	SO:0001623	5_prime_UTR_variant	0				HGNC	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.-204C>-	5.37:g.88178836delG		Somatic	0	27	0.00		0.5538374756952343	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	C9JMZ0|D7F7N5|F8W7V7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000437473.2	37	NULL	CCDS47245.1	5																																																																																			-	-		0.408	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	protein_coding	OTTHUMT00000369817.1	G	NM_002397			88178836	-1	no_errors	ENST00000509349	ensembl	human	known	74_37	rna	DEL	0.001	-
FAM230A	653203	genome.wustl.edu	37	22	20709186	20709186	+	Silent	SNP	C	C	T	rs370050776		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr22:20709186C>T	ENST00000434783.3	+	8	1102	c.918C>T	c.(916-918)gcC>gcT	p.A306A	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		ACGAGGACGCCGCCCAGGGCA	0.672																																																	0								ENSG00000188280																																			FAM230A	SO:0001819	synonymous_variant	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.918C>T	22.37:g.20709186C>T		Somatic	0	83	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	67	12.82		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.A306	ENST00000434783.3	37	c.918		22																																																																																			-	superfamily_Kinase-like_dom		0.672	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	C		-		20709186	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	SNP	0.021	T
ARMS2	387715	genome.wustl.edu	37	10	124214445	124214445	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr10:124214445G>T	ENST00000528446.1	+	1	277	c.202G>T	c.(202-204)Gct>Tct	p.A68S		NM_001099667.1	NP_001093137.1	P0C7Q2	ARMS2_HUMAN	age-related maculopathy susceptibility 2	68					retina homeostasis (GO:0001895)	mitochondrion (GO:0005739)|photoreceptor inner segment (GO:0001917)				ovary(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CATGATCCCAGCTGCTAAAAT	0.542																																																	0								ENSG00000254636						101.0	99.0	100.0					10																	124214445		2012	4187	6199	ARMS2	SO:0001583	missense	0			-	HGNC	BC066349	CCDS53585.1	10q26.13	2013-01-23			ENSG00000254636	ENSG00000254636			32685	protein-coding gene	gene with protein product		611313				16080115, 16174643	Standard	NM_001099667		Approved	LOC387715, ARMD8	uc001lgi.3	P0C7Q2	OTTHUMG00000048232	ENST00000528446.1:c.202G>T	10.37:g.124214445G>T	ENSP00000436682:p.Ala68Ser	Somatic	0	44	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B2Y7I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A68S	ENST00000528446.1	37	c.202	CCDS53585.1	10	.	.	.	.	.	.	.	.	.	.	G	9.713	1.157638	0.21454	.	.	ENSG00000254636	ENST00000528446	T	0.38401	1.14	1.79	1.79	0.24919	.	.	.	.	.	T	0.27241	0.0668	N	0.08118	0	0.09310	N	1	P	0.48694	0.914	P	0.51945	0.685	T	0.09314	-1.0680	9	0.87932	D	0	.	7.0623	0.25133	0.0:0.0:1.0:0.0	.	68	P0C7Q2	ARMS2_HUMAN	S	68	ENSP00000436682:A68S	ENSP00000436682:A68S	A	+	1	0	ARMS2	124204435	0.001000	0.12720	0.003000	0.11579	0.069000	0.16628	0.602000	0.24134	1.323000	0.45263	0.491000	0.48974	GCT	-	NULL		0.542	ARMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMS2	protein_coding	OTTHUMT00000109727.2	G		-		124214445	+1	no_errors	ENST00000528446	ensembl	human	known	74_37	missense	SNP	0.003	T
PLK4	10733	genome.wustl.edu	37	4	128812805	128812805	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:128812805C>T	ENST00000270861.5	+	9	2281	c.2007C>T	c.(2005-2007)aaC>aaT	p.N669N	PLK4_ENST00000507249.1_Silent_p.N608N|PLK4_ENST00000513090.1_Silent_p.N637N|PLK4_ENST00000515069.1_Silent_p.N591N|PLK4_ENST00000514379.1_Silent_p.N628N|RNU6-583P_ENST00000516012.1_RNA	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	669					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CTACTGACAACATCAGTAGGT	0.318																																					Colon(135;508 1718 19061 31832 42879)												0								ENSG00000142731						89.0	97.0	94.0					4																	128812805		2203	4300	6503	PLK4	SO:0001819	synonymous_variant	0			-	HGNC	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2007C>T	4.37:g.128812805C>T		Somatic	0	260	0.00		0.5538374756952343	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	106	155	40.61	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.N669	ENST00000270861.5	37	c.2007	CCDS3735.1	4																																																																																			-	NULL		0.318	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK4	protein_coding	OTTHUMT00000257095.3	C		-		128812805	+1	no_errors	ENST00000270861	ensembl	human	known	74_37	silent	SNP	1.000	T
LOC100129434	100129434	genome.wustl.edu	37	2	56403091	56403091	+	RNA	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:56403091C>T	ENST00000596663.1	-	0	652				AC007743.1_ENST00000432793.1_RNA|AC007743.1_ENST00000447423.2_RNA|RP11-481J13.1_ENST00000606639.1_lincRNA|RP11-482H16.1_ENST00000607540.1_RNA																							CAGGAGTTTGCCTTGCAAGTC	0.498																																																	0								ENSG00000233251																																			AC007743.1			0			-	Clone_based_vega_gene																													2.37:g.56403091C>T		Somatic	0	32	0.00		0.5538374756952343	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596663.1	37	NULL		2																																																																																			-	-		0.498	AC007743.1-005	KNOWN	basic	antisense	LOC100129434	antisense	OTTHUMT00000470756.1	C		-		56403091	-1	no_errors	ENST00000432793	ensembl	human	known	74_37	rna	SNP	0.003	T
MUT	4594	genome.wustl.edu	37	6	49419297	49419297	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:49419297G>A	ENST00000274813.3	-	6	1341	c.1214C>T	c.(1213-1215)gCc>gTc	p.A405V		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	405					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTGTTCCTGGCAATTCGAGC	0.423																																																	0								ENSG00000146085						151.0	130.0	138.0					6																	49419297		2203	4300	6503	MUT	SO:0001583	missense	0			-	HGNC		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1214C>T	6.37:g.49419297G>A	ENSP00000274813:p.Ala405Val	Somatic	0	101	0.00		0.5538374756952343	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MeMalonylCoA_mutase_a/b_cat,pfam_Cobalamin-bd,superfamily_Cbl-dep_enz_cat,superfamily_Cobalamin-bd,tigrfam_MMCoA_mutase_a_cat,tigrfam_Acid_CoA_mut_C	p.A405V	ENST00000274813.3	37	c.1214	CCDS4924.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.329067	0.95733	.	.	ENSG00000146085	ENST00000274813	D	0.99418	-5.87	5.49	5.49	0.81192	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (2);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	H	0.99444	4.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96526	0.9389	10	0.87932	D	0	-8.66	18.3589	0.90368	0.0:0.0:1.0:0.0	.	405	P22033	MUTA_HUMAN	V	405	ENSP00000274813:A405V	ENSP00000274813:A405V	A	-	2	0	MUT	49527256	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.869000	0.99810	2.571000	0.86741	0.467000	0.42956	GCC	-	pfam_MeMalonylCoA_mutase_a/b_cat,superfamily_Cbl-dep_enz_cat,tigrfam_MMCoA_mutase_a_cat		0.423	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUT	protein_coding	OTTHUMT00000040854.1	G		-		49419297	-1	no_errors	ENST00000274813	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM230A	653203	genome.wustl.edu	37	22	20709232	20709232	+	Missense_Mutation	SNP	G	G	C	rs376485229|rs71186655		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr22:20709232G>C	ENST00000434783.3	+	8	1148	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		CATCGCGAACGAGGATGCCGC	0.667																																																	0								ENSG00000188280																																			FAM230A	SO:0001583	missense	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.964G>C	22.37:g.20709232G>C	ENSP00000463576:p.Glu322Gln	Somatic	0	73	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	63	11.27		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.E322Q	ENST00000434783.3	37	c.964		22																																																																																			-	superfamily_Kinase-like_dom		0.667	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	G		-		20709232	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	SNP	0.008	C
FLJ36000	284124	genome.wustl.edu	37	17	21911294	21911294	+	lincRNA	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:21911294C>G	ENST00000581223.2	+	0	2019					NR_027084.1																						gtgtgtgtCTCCTATtctctc	0.493																																																	0								ENSG00000266795																																			RP11-744K17.9			0			-	Clone_based_vega_gene																													17.37:g.21911294C>G		Somatic	0	11	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			-	-		0.493	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	lincRNA	OTTHUMT00000451067.1	C		-		21911294	+1	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	SNP	0.089	G
PADI2	11240	genome.wustl.edu	37	1	17445785	17445785	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:17445785C>T	ENST00000375486.4	-	1	145	c.82G>A	c.(82-84)Gat>Aat	p.D28N	PADI2_ENST00000444885.2_Missense_Mutation_p.D28N|PADI2_ENST00000375481.1_Missense_Mutation_p.D28N	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	28					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CTGTAGACATCGGTCCAGAGG	0.682																																																	0								ENSG00000117115						22.0	23.0	23.0					1																	17445785		2185	4264	6449	PADI2	SO:0001583	missense	0			-	HGNC	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.82G>A	1.37:g.17445785C>T	ENSP00000364635:p.Asp28Asn	Somatic	0	78	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q96DA7|Q9UPN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.D28N	ENST00000375486.4	37	c.82	CCDS177.1	1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490295	0.64074	.	.	ENSG00000117115	ENST00000375486;ENST00000444885;ENST00000375481	T;T;T	0.14640	2.49;2.49;2.49	4.5	4.5	0.54988	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.127542	0.51477	D	0.000083	T	0.30230	0.0758	L	0.55481	1.735	0.24949	N	0.9918	D;B	0.76494	0.999;0.268	D;B	0.77004	0.989;0.015	T	0.02539	-1.1144	10	0.46703	T	0.11	-19.6344	12.5581	0.56265	0.0:1.0:0.0:0.0	.	28;28	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	N	28	ENSP00000364635:D28N;ENSP00000405894:D28N;ENSP00000364630:D28N	ENSP00000364630:D28N	D	-	1	0	PADI2	17318372	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.624000	0.54231	2.327000	0.79052	0.462000	0.41574	GAT	-	pfam_PAD_N,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub		0.682	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	protein_coding	OTTHUMT00000006624.1	C		-		17445785	-1	no_errors	ENST00000375486	ensembl	human	known	74_37	missense	SNP	1.000	T
ZSCAN32	54925	genome.wustl.edu	37	16	3434294	3434294	+	Intron	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:3434294A>C	ENST00000396852.4	-	6	1542				ZSCAN32_ENST00000439568.2_Intron|ZSCAN32_ENST00000304926.3_Intron|NAA60_ENST00000576906.1_3'UTR|ZSCAN32_ENST00000396846.3_Intron|ZSCAN32_ENST00000574940.1_3'UTR|ZSCAN32_ENST00000422427.2_3'UTR	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										TGTAAAATGCAAGGGGAATAA	0.423																																																	0								ENSG00000262621																																			NAA60	SO:0001627	intron_variant	0			-	Uniprot_gn	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1234+164T>G	16.37:g.3434294A>C		Somatic	0	18	0.00		0.5538374756952343	5	61.54	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396852.4	37	NULL		16																																																																																			-	-		0.423	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	NAA60	protein_coding	OTTHUMT00000251509.2	A	NM_017810	-		3434294	+1	no_errors	ENST00000576906	ensembl	human	known	74_37	rna	SNP	0.002	C
PRDM7	11105	genome.wustl.edu	37	16	90128827	90128827	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:90128827G>A	ENST00000449207.2	-	6	611	c.592C>T	c.(592-594)Cag>Tag	p.Q198*	PRDM7_ENST00000407825.1_5'UTR|PRDM7_ENST00000325921.6_5'Flank	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	198					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TCATCATCCTGTGGCTCGCTG	0.458																																																	0								ENSG00000126856						175.0	181.0	179.0					16																	90128827		2012	4180	6192	PRDM7	SO:0001587	stop_gained	0			-	HGNC	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.592C>T	16.37:g.90128827G>A	ENSP00000396732:p.Gln198*	Somatic	0	83	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A4Q9G8|Q08EM4|Q9NQW4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_SET_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.Q198*	ENST00000449207.2	37	c.592	CCDS45557.1	16	.	.	.	.	.	.	.	.	.	.	.	11.88	1.771758	0.31320	.	.	ENSG00000126856	ENST00000449207	.	.	.	2.84	0.333	0.15943	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.1685	4.8471	0.13519	0.0:0.2064:0.3749:0.4187	.	.	.	.	X	198	.	.	Q	-	1	0	PRDM7	88656328	0.996000	0.38824	0.481000	0.27354	0.007000	0.05969	1.702000	0.37836	0.287000	0.22375	0.484000	0.47621	CAG	-	pfam_SSXRD_motif		0.458	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	protein_coding	OTTHUMT00000420560.1	G		-		90128827	-1	no_errors	ENST00000449207	ensembl	human	known	74_37	nonsense	SNP	0.524	A
SUPT20H	55578	genome.wustl.edu	37	13	37614582	37614582	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:37614582T>C	ENST00000350612.6	-	9	747	c.527A>G	c.(526-528)gAt>gGt	p.D176G	SUPT20H_ENST00000356185.3_Missense_Mutation_p.D177G|SUPT20H_ENST00000475892.1_Missense_Mutation_p.D176G|SUPT20H_ENST00000542180.1_Missense_Mutation_p.D164G|SUPT20H_ENST00000360252.4_Missense_Mutation_p.D177G|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000464744.1_Missense_Mutation_p.D177G	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	176					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TGAATGTACATCACAAATTAA	0.254																																																	0								ENSG00000102710						37.0	41.0	40.0					13																	37614582		2196	4290	6486	SUPT20H	SO:0001583	missense	0			-	HGNC	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.527A>G	13.37:g.37614582T>C	ENSP00000218894:p.Asp176Gly	Somatic	0	132	0.00		0.5538374756952343	6	50.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	58	23.68	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spt20	p.D176G	ENST00000350612.6	37	c.527	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	T	28.6	4.934359	0.92458	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29;0.29	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.996;0.999;1.0;1.0;1.0	D	0.84292	0.0500	10	0.87932	D	0	-21.1557	16.358	0.83243	0.0:0.0:0.0:1.0	.	164;176;176;177;177;176	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	G	177;176;176;177;176;177;164;177	ENSP00000353388:D177G;ENSP00000417510:D176G;ENSP00000218894:D176G;ENSP00000348512:D177G;ENSP00000419754:D177G;ENSP00000439000:D164G;ENSP00000420170:D177G	ENSP00000218894:D176G	D	-	2	0	FAM48A	36512582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.985000	0.88162	2.260000	0.74910	0.528000	0.53228	GAT	-	pfam_Spt20		0.254	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	protein_coding	OTTHUMT00000354766.1	T	NM_017569	-		37614582	-1	no_errors	ENST00000350612	ensembl	human	known	74_37	missense	SNP	1.000	C
CASZ1	54897	genome.wustl.edu	37	1	10719817	10719817	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:10719817G>T	ENST00000377022.3	-	6	1599	c.1282C>A	c.(1282-1284)Ctg>Atg	p.L428M	CASZ1_ENST00000478728.2_5'Flank|CASZ1_ENST00000344008.5_Missense_Mutation_p.L428M	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	428					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GTTGACTTCAGGTACTCGGGA	0.662																																																	0								ENSG00000130940						77.0	78.0	77.0					1																	10719817		2203	4300	6503	CASZ1	SO:0001583	missense	0			-	HGNC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1282C>A	1.37:g.10719817G>T	ENSP00000366221:p.Leu428Met	Somatic	0	53	0.00		0.5538374756952343	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L428M	ENST00000377022.3	37	c.1282	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	g	14.43	2.534481	0.45073	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	5.13	4.23	0.50019	.	0.074545	0.56097	D	0.000033	T	0.50274	0.1606	N	0.22421	0.69	0.40502	D	0.980658	P;P;P;P	0.52316	0.949;0.902;0.902;0.952	P;B;B;B	0.52881	0.712;0.439;0.439;0.357	T	0.54077	-0.8347	9	0.46703	T	0.11	-12.4922	14.2207	0.65826	0.0722:0.0:0.9278:0.0	.	452;428;428;428	B7Z1S3;B3KRV8;Q86V15-2;Q86V15	.;.;.;CASZ1_HUMAN	M	428	.	ENSP00000339445:L428M	L	-	1	2	CASZ1	10642404	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.245000	0.51407	1.326000	0.45319	-0.195000	0.12781	CTG	-	NULL		0.662	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	protein_coding	OTTHUMT00000005673.2	G	NM_017766	-		10719817	-1	no_errors	ENST00000377022	ensembl	human	known	74_37	missense	SNP	1.000	T
CROCC	9696	genome.wustl.edu	37	1	17263172	17263172	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:17263172C>T	ENST00000375541.5	+	9	1066	c.997C>T	c.(997-999)Cga>Tga	p.R333*	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCGGACATCACGAGCTGTCCA	0.662																																																	0								ENSG00000058453						8.0	9.0	8.0					1																	17263172		2116	4149	6265	CROCC	SO:0001587	stop_gained	0			-	HGNC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.997C>T	1.37:g.17263172C>T	ENSP00000364691:p.Arg333*	Somatic	0	83	0.00		0.5538374756952343	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_t-SNARE	p.R333*	ENST00000375541.5	37	c.997	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758184	0.89843	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	.	.	.	3.91	0.854	0.19007	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8443	0.23980	0.3246:0.5889:0.0:0.0865	.	.	.	.	X	333;214	.	ENSP00000364691:R333X	R	+	1	2	CROCC	17135759	0.623000	0.27094	0.002000	0.10522	0.389000	0.30415	1.194000	0.32174	0.075000	0.16796	-0.362000	0.07510	CGA	-	NULL		0.662	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	C	NM_014675	-		17263172	+1	no_errors	ENST00000375541	ensembl	human	known	74_37	nonsense	SNP	0.350	T
RFK	55312	genome.wustl.edu	37	9	79002634	79002637	+	Intron	DEL	GGCC	GGCC	-	rs138282433|rs562289612|rs374213106	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	GGCC	GGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:79002634_79002637delGGCC	ENST00000376736.1	-	4	671				RFK_ENST00000479197.1_5'UTR	NM_018339.5	NP_060809.3	Q969G6	RIFK_HUMAN	riboflavin kinase						apoptotic process (GO:0006915)|FMN biosynthetic process (GO:0009398)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|reactive oxygen species metabolic process (GO:0072593)|riboflavin biosynthetic process (GO:0009231)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|riboflavin kinase activity (GO:0008531)			pancreas(1)|prostate(1)|urinary_tract(1)	3					Riboflavin(DB00140)	TATGTCCCTAggccgggggcagtg	0.544														427	0.0852636	0.1172	0.0735	5008	,	,		18792	0.002		0.1083	False		,,,				2504	0.1125																0								ENSG00000135002																																			RFK	SO:0001627	intron_variant	0				HGNC	AK002011	CCDS35044.1, CCDS35044.2	9q21.31	2010-11-16			ENSG00000135002	ENSG00000135002			30324	protein-coding gene	gene with protein product		613010				14580199	Standard	NM_018339		Approved	FLJ11149, RIFK	uc004akd.2	Q969G6	OTTHUMG00000020040	ENST00000376736.1:c.338-189GGCC>-	9.37:g.79002634_79002637delGGCC		Somatic	0	9	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	Q5JSG9|Q9NUT7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376736.1	37	NULL	CCDS35044.2	9																																																																																			-	-		0.544	RFK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFK	protein_coding	OTTHUMT00000052720.1	GGCC	NM_018339			79002637	-1	no_errors	ENST00000479197	ensembl	human	known	74_37	rna	DEL	0.004:0.005:0.005:0.004	-
SPTAN1	6709	genome.wustl.edu	37	9	131378035	131378035	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:131378035C>T	ENST00000372731.4	+	40	5368	c.5258C>T	c.(5257-5259)gCg>gTg	p.A1753V	SPTAN1_ENST00000358161.5_Missense_Mutation_p.A1758V|SPTAN1_ENST00000372739.3_Missense_Mutation_p.A1758V	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1753					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AAGAGCATGGCGGCCTCCCGG	0.572																																					NSCLC(120;833 1744 2558 35612 37579)												0								ENSG00000197694						82.0	74.0	77.0					9																	131378035		2203	4300	6503	SPTAN1	SO:0001583	missense	0			-	HGNC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5258C>T	9.37:g.131378035C>T	ENSP00000361816:p.Ala1753Val	Somatic	0	49	0.00		0.5538374756952343	155	43.97	124	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	42	33.33	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.A1758V	ENST00000372731.4	37	c.5273	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831452	0.91036	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.51574	0.7;0.7;0.7	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.78314	0.883;0.985;0.991	T	0.74624	-0.3603	10	0.66056	D	0.02	.	19.8677	0.96824	0.0:1.0:0.0:0.0	.	1733;1758;1753	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	V	1758;1753;1758;1733;2	ENSP00000350882:A1758V;ENSP00000361816:A1753V;ENSP00000361824:A1758V	ENSP00000350882:A1758V	A	+	2	0	SPTAN1	130417856	1.000000	0.71417	0.964000	0.40570	0.957000	0.61999	7.429000	0.80309	2.709000	0.92574	0.655000	0.94253	GCG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.572	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	protein_coding	OTTHUMT00000054472.1	C	NM_003127	-		131378035	+1	no_errors	ENST00000358161	ensembl	human	known	74_37	missense	SNP	1.000	T
ATP1A2	477	genome.wustl.edu	37	1	160100061	160100061	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:160100061G>C	ENST00000361216.3	+	12	1720	c.1631G>C	c.(1630-1632)gGa>gCa	p.G544A	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G544A	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	544					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GAGCTGGGGGGACTTGGGGAG	0.617																																																	0								ENSG00000018625						57.0	58.0	58.0					1																	160100061		2203	4300	6503	ATP1A2	SO:0001583	missense	0			-	HGNC	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1631G>C	1.37:g.160100061G>C	ENSP00000354490:p.Gly544Ala	Somatic	0	91	0.00		0.5538374756952343	19	57.78	26	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	63	40.74	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.G544A	ENST00000361216.3	37	c.1631	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.25|18.25	3.583103|3.583103	0.65992|0.65992	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|T;T	.|0.79352	.|-1.26;-1.26	4.61|4.61	4.61|4.61	0.57282|0.57282	.|ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76399|0.76399	0.3982|0.3982	N|N	0.21373|0.21373	0.66|0.66	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.63880	.|0.993;0.992;0.993	.|D;D;D	.|0.71414	.|0.973;0.954;0.973	T|T	0.81618|0.81618	-0.0851|-0.0851	5|10	.|0.87932	.|D	.|0	.|.	16.564|16.564	0.84574|0.84574	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|544;444;544	.|B1AKY9;F5GXJ7;P50993	.|.;.;AT1A2_HUMAN	H|A	255|544;544;247	.|ENSP00000354490:G544A;ENSP00000376066:G544A	.|ENSP00000354490:G544A	D|G	+|+	1|2	0|0	ATP1A2|ATP1A2	158366685|158366685	1.000000|1.000000	0.71417|0.71417	0.870000|0.870000	0.34147|0.34147	0.853000|0.853000	0.48598|0.48598	9.614000|9.614000	0.98353|0.98353	2.283000|2.283000	0.76528|0.76528	0.511000|0.511000	0.50034|0.50034	GAC|GGA	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC		0.617	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	protein_coding	OTTHUMT00000060642.2	G	NM_000702	-		160100061	+1	no_errors	ENST00000361216	ensembl	human	known	74_37	missense	SNP	1.000	C
METTL13	51603	genome.wustl.edu	37	1	171755160	171755160	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:171755160C>G	ENST00000361735.3	+	3	1321	c.1055C>G	c.(1054-1056)gCt>gGt	p.A352G	METTL13_ENST00000458517.1_Missense_Mutation_p.A351G|METTL13_ENST00000362019.3_Missense_Mutation_p.A266G|METTL13_ENST00000367737.5_Missense_Mutation_p.A196G	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	352							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CACATCCAAGCTGAGCTGTCG	0.577																																																	0								ENSG00000010165						58.0	49.0	52.0					1																	171755160		2203	4300	6503	METTL13	SO:0001583	missense	0			-	HGNC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1055C>G	1.37:g.171755160C>G	ENSP00000354920:p.Ala352Gly	Somatic	0	58	0.00		0.5538374756952343	23	25.81	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	26	36.59	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.A352G	ENST00000361735.3	37	c.1055	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019075	0.54576	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.36	3.37	0.38596	.	0.425513	0.26321	N	0.025053	T	0.36441	0.0967	L	0.50333	1.59	0.35953	D	0.834052	B;D;P	0.57257	0.048;0.979;0.488	B;P;B	0.56434	0.02;0.798;0.114	T	0.13710	-1.0499	10	0.23891	T	0.37	-29.6773	13.5459	0.61705	0.2809:0.7191:0.0:0.0	.	351;196;352	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	G	351;266;196;352	ENSP00000401955:A351G;ENSP00000355393:A266G;ENSP00000356711:A196G;ENSP00000354920:A352G	ENSP00000354920:A352G	A	+	2	0	METTL13	170021783	0.998000	0.40836	0.896000	0.35187	0.917000	0.54804	3.762000	0.55250	1.448000	0.47680	0.561000	0.74099	GCT	-	NULL		0.577	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	protein_coding	OTTHUMT00000084528.5	C	NM_014955	-		171755160	+1	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	SNP	0.986	G
C10orf12	26148	genome.wustl.edu	37	10	98741336	98741336	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr10:98741336delA	ENST00000286067.2	+	1	296	c.189delA	c.(187-189)ccafs	p.P63fs		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	63										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TACAGTGTCCAAAAACACCTT	0.418																																																	0								ENSG00000155640						80.0	76.0	77.0					10																	98741336		2203	4300	6503	C10orf12	SO:0001589	frameshift_variant	0				HGNC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.189delA	10.37:g.98741336delA	ENSP00000286067:p.Pro63fs	Somatic	0	28	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	Q9H945|Q9Y457	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.T65fs	ENST00000286067.2	37	c.189	CCDS7452.1	10																																																																																			-	NULL		0.418	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	protein_coding	OTTHUMT00000049627.1	A	NM_015652			98741336	+1	no_errors	ENST00000286067	ensembl	human	known	74_37	frame_shift_del	DEL	0.992	-
KLHL10	317719	genome.wustl.edu	37	17	40004446	40004446	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:40004446G>T	ENST00000293303.4	+	5	1867	c.1714G>T	c.(1714-1716)Gta>Tta	p.V572L	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	572					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				CTGCTGTGTAGTACCAGGGCT	0.458																																																	0								ENSG00000161594						124.0	122.0	123.0					17																	40004446		2004	4185	6189	KLHL10	SO:0001583	missense	0			-	HGNC	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1714G>T	17.37:g.40004446G>T	ENSP00000293303:p.Val572Leu	Somatic	0	50	0.00		0.5538374756952343	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q6NW28|Q96MC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V572L	ENST00000293303.4	37	c.1714	CCDS42340.1	17	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041522	0.55003	.	.	ENSG00000161594	ENST00000293303	T	0.64991	-0.13	6.17	6.17	0.99709	Galactose oxidase, beta-propeller (1);	0.118400	0.56097	D	0.000026	T	0.51346	0.1669	L	0.27053	0.805	0.46011	D	0.99881	B	0.21520	0.057	B	0.16289	0.015	T	0.40496	-0.9560	9	.	.	.	.	19.4432	0.94831	0.0:0.0:1.0:0.0	.	572	Q6JEL2	KLH10_HUMAN	L	572	ENSP00000293303:V572L	.	V	+	1	0	KLHL10	37257972	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.136000	0.50554	2.941000	0.99782	0.655000	0.94253	GTA	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.458	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL10	protein_coding	OTTHUMT00000326535.1	G	NM_152467	-		40004446	+1	no_errors	ENST00000293303	ensembl	human	known	74_37	missense	SNP	1.000	T
PCGF3	10336	genome.wustl.edu	37	4	737278	737278	+	Missense_Mutation	SNP	G	G	T	rs538604823		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:737278G>T	ENST00000362003.5	+	7	674	c.279G>T	c.(277-279)caG>caT	p.Q93H	PCGF3_ENST00000470161.2_Missense_Mutation_p.Q93H|PCGF3_ENST00000521023.2_Missense_Mutation_p.Q59H|PCGF3_ENST00000505655.2_Missense_Mutation_p.Q93H	NM_006315.4	NP_006306.2	Q3KNV8	PCGF3_HUMAN	polycomb group ring finger 3	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(1)	7						TGAGAAAGCAGAGGGAGTTCT	0.448																																																	0								ENSG00000185619						84.0	90.0	88.0					4																	737278		1933	4139	6072	PCGF3	SO:0001583	missense	0			-	HGNC	AK093869	CCDS3339.2	4p16.3	2013-01-09	2005-01-17	2005-01-19	ENSG00000185619	ENSG00000185619		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	10066	protein-coding gene	gene with protein product			"""ring finger protein 3"""	RNF3			Standard	XM_005272250		Approved	FLJ36550, DONG1, RNF3A, MGC40413	uc003gbe.3	Q3KNV8	OTTHUMG00000119000	ENST00000362003.5:c.279G>T	4.37:g.737278G>T	ENSP00000354724:p.Gln93His	Somatic	0	66	0.00		0.5538374756952343	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	D3DVN1|O15262	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q93H	ENST00000362003.5	37	c.279	CCDS3339.2	4	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148303	0.78001	.	.	ENSG00000185619	ENST00000362003;ENST00000470161;ENST00000521023;ENST00000433814;ENST00000505655	T;T;T;T	0.44083	0.93;0.93;0.94;0.93	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.41673	0.1169	N	0.22421	0.69	0.54753	D	0.999985	B;D;P	0.54964	0.058;0.969;0.925	B;P;B	0.50970	0.086;0.655;0.326	T	0.37820	-0.9689	10	0.56958	D	0.05	-36.8576	16.2299	0.82323	0.0:0.0:1.0:0.0	.	59;59;93	B3KWT8;B3KQ06;Q3KNV8	.;.;PCGF3_HUMAN	H	93;93;59;93;93	ENSP00000354724:Q93H;ENSP00000420489:Q93H;ENSP00000398493:Q93H;ENSP00000423393:Q93H	ENSP00000354724:Q93H	Q	+	3	2	PCGF3	727278	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	5.701000	0.68325	2.434000	0.82447	0.655000	0.94253	CAG	-	NULL		0.448	PCGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF3	protein_coding	OTTHUMT00000239197.2	G	NM_006315	-		737278	+1	no_errors	ENST00000362003	ensembl	human	known	74_37	missense	SNP	1.000	T
RGMB	285704	genome.wustl.edu	37	5	98115446	98115446	+	Missense_Mutation	SNP	G	G	A	rs35699029		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:98115446G>A	ENST00000513185.1	+	2	735	c.299G>A	c.(298-300)cGt>cAt	p.R100H	RGMB_ENST00000308234.7_Missense_Mutation_p.R141H|RGMB_ENST00000504776.1_3'UTR			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	100					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		AAAGCCTGCCGTGGCAACCTG	0.537																																																	0								ENSG00000174136						72.0	74.0	73.0					5																	98115446		1961	4147	6108	RGMB	SO:0001583	missense	0			-	HGNC	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.299G>A	5.37:g.98115446G>A	ENSP00000423256:p.Arg100His	Somatic	0	43	0.00		0.5538374756952343	146	2.67	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	54	10.00	D6R9A0|Q8NC92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGM_C,pfam_RGM_N	p.R141H	ENST00000513185.1	37	c.422		5	.	.	.	.	.	.	.	.	.	.	G	33	5.288456	0.95517	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.98028	-4.67;-4.67	5.4	5.4	0.78164	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99053	1.0828	10	0.54805	T	0.06	-14.6506	19.5247	0.95199	0.0:0.0:1.0:0.0	rs35699029	100	Q6NW40	RGMB_HUMAN	H	141;100	ENSP00000308219:R141H;ENSP00000423256:R100H	ENSP00000308219:R141H	R	+	2	0	RGMB	98143346	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.420000	0.97426	2.689000	0.91719	0.563000	0.77884	CGT	-	pfam_RGM_N		0.537	RGMB-003	KNOWN	basic	protein_coding	RGMB	protein_coding	OTTHUMT00000370308.1	G	NM_173670	rs35699029		98115446	+1	no_errors	ENST00000308234	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF648	127665	genome.wustl.edu	37	1	182026873	182026873	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:182026873C>T	ENST00000339948.3	-	2	480	c.273G>A	c.(271-273)ggG>ggA	p.G91G		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CTGGTTTCTGCCCCATGCCCC	0.552																																					NSCLC(71;908 1374 5429 20458 35642)												0								ENSG00000179930						85.0	85.0	85.0					1																	182026873		2203	4300	6503	ZNF648	SO:0001819	synonymous_variant	0			-	HGNC	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.273G>A	1.37:g.182026873C>T		Somatic	0	56	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B2RP16	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G91	ENST00000339948.3	37	c.273	CCDS30952.1	1																																																																																			-	NULL		0.552	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	protein_coding	OTTHUMT00000090794.1	C	XM_060597	-		182026873	-1	no_errors	ENST00000339948	ensembl	human	novel	74_37	silent	SNP	0.098	T
COL22A1	169044	genome.wustl.edu	37	8	139767724	139767724	+	Splice_Site	DEL	C	C	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr8:139767724delC	ENST00000303045.6	-	20	2424		c.e20+1		COL22A1_ENST00000435777.1_Splice_Site	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTGCCTCTTACCTGTTCCCCT	0.507										HNSCC(7;0.00092)																																							0								ENSG00000169436						350.0	305.0	320.0					8																	139767724		2203	4300	6503	COL22A1	SO:0001630	splice_region_variant	0				HGNC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1977+1G>-	8.37:g.139767724delC		Somatic	0	89	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	56	25.33	B7ZMH0|C9K0G4|Q8IVT9	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e19+1	ENST00000303045.6	37	c.1977+1	CCDS6376.1	8																																																																																			-	-		0.507	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	protein_coding	OTTHUMT00000315905.2	C	XM_291257		Intron	139767724	-1	no_errors	ENST00000303045	ensembl	human	known	74_37	splice_site_del	DEL	1.000	-
TIAL1	7073	genome.wustl.edu	37	10	121341975	121341975	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr10:121341975C>T	ENST00000436547.2	-	3	268	c.224G>A	c.(223-225)gGa>gAa	p.G75E	TIAL1_ENST00000369093.2_Missense_Mutation_p.G92E|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	75	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TCTTACCTTTCCCAAAATTTT	0.368																																																	0								ENSG00000151923						133.0	146.0	141.0					10																	121341975		2202	4298	6500	TIAL1	SO:0001583	missense	0			-	HGNC	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.224G>A	10.37:g.121341975C>T	ENSP00000394902:p.Gly75Glu	Somatic	0	39	0.00		0.5538374756952343	60	10.45	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	A8K3T0|A8K4L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.G92E	ENST00000436547.2	37	c.275	CCDS7613.1	10	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512942	0.85389	.	.	ENSG00000151923	ENST00000369093;ENST00000436547;ENST00000412524;ENST00000369086	T;T;T;T	0.54866	2.65;0.55;2.65;2.65	6.02	6.02	0.97574	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	M	0.66560	2.04	0.80722	D	1	B;D	0.76494	0.278;0.999	B;D	0.77557	0.413;0.99	T	0.69154	-0.5220	10	0.44086	T	0.13	-16.0465	20.5373	0.99239	0.0:1.0:0.0:0.0	.	92;75	A8K4L9;Q01085	.;TIAR_HUMAN	E	92;75;36;36	ENSP00000358089:G92E;ENSP00000394902:G75E;ENSP00000403573:G36E;ENSP00000358082:G36E	ENSP00000358082:G36E	G	-	2	0	TIAL1	121331965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.656000	0.83736	2.857000	0.98124	0.650000	0.86243	GGA	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.368	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAL1	protein_coding	OTTHUMT00000050672.2	C	NM_022333, NM_003252	-		121341975	-1	no_errors	ENST00000369093	ensembl	human	known	74_37	missense	SNP	1.000	T
PHPT1	29085	genome.wustl.edu	37	9	139748197	139748197	+	IGR	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:139748197C>T	ENST00000247665.10	+	0	890				MAMDC4_ENST00000445819.1_Intron|MAMDC4_ENST00000317446.2_Intron|MAMDC4_ENST00000485732.1_3'UTR	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1						negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACAAGCAGGGCCGCAGCTGCC	0.697																																																	0								ENSG00000177943						13.0	17.0	15.0					9																	139748197		2165	4271	6436	MAMDC4	SO:0001628	intergenic_variant	0			-	HGNC	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950		9.37:g.139748197C>T		Somatic	0	75	0.00		0.5538374756952343	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	42	36.76	B1AMX0|B1AMX1|Q9H0Y3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000247665.10	37	NULL	CCDS7009.1	9																																																																																			-	-		0.697	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC4	protein_coding	OTTHUMT00000055150.1	C	NM_014172	-		139748197	+1	no_errors	ENST00000485732	ensembl	human	known	74_37	rna	SNP	0.007	T
EEF2K	29904	genome.wustl.edu	37	16	22274469	22274469	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:22274469G>A	ENST00000263026.5	+	12	1812	c.1338G>A	c.(1336-1338)gaG>gaA	p.E446E		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	446					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		ACCCCAGTGAGAAGCGGGGTG	0.557																																					NSCLC(195;1411 2157 20319 27471 51856)												0								ENSG00000103319						81.0	66.0	71.0					16																	22274469		2197	4300	6497	EEF2K	SO:0001819	synonymous_variant	0			-	HGNC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1338G>A	16.37:g.22274469G>A		Somatic	0	100	0.00		0.5538374756952343	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	62	8.82	Q8N588	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.E446	ENST00000263026.5	37	c.1338	CCDS10604.1	16																																																																																			-	pirsf_Elongation_factor_2_kinase		0.557	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	protein_coding	OTTHUMT00000211580.2	G	NM_013302	-		22274469	+1	no_errors	ENST00000263026	ensembl	human	known	74_37	silent	SNP	1.000	A
LONRF3	79836	genome.wustl.edu	37	X	118124458	118124458	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:118124458A>T	ENST00000371628.3	+	5	1381	c.1350A>T	c.(1348-1350)aaA>aaT	p.K450N	LONRF3_ENST00000422289.2_Missense_Mutation_p.K194N|LONRF3_ENST00000304778.7_Missense_Mutation_p.K409N|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	450							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						AGGGGGACAAACCTGCTCTCA	0.463																																																	0								ENSG00000175556						301.0	197.0	232.0					X																	118124458		2203	4300	6503	LONRF3	SO:0001583	missense	0			-	HGNC	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1350A>T	X.37:g.118124458A>T	ENSP00000360690:p.Lys450Asn	Somatic	0	38	0.00		0.5538374756952343	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	56	11.11	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.K450N	ENST00000371628.3	37	c.1350	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.950|3.950	-0.012430|-0.012430	0.07727|0.07727	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;D|.	0.84944|.	-1.48;-1.48;-1.28;-1.92|.	5.3|5.3	-7.84|-7.84	0.01196|0.01196	.|.	0.923976|.	0.09337|.	N|.	0.816066|.	T|T	0.23094|0.23094	0.0558|0.0558	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.09022|.	0.001;0.002;0.001|.	B;B;B|.	0.13407|.	0.002;0.009;0.002|.	T|T	0.30534|0.30534	-0.9975|-0.9975	10|5	0.18710|.	T|.	0.47|.	-3.9896|-3.9896	8.6628|8.6628	0.34103|0.34103	0.1446:0.0976:0.605:0.1528|0.1446:0.0976:0.605:0.1528	.|.	194;409;450|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	N|S	409;409;450;194|216	ENSP00000360691:K409N;ENSP00000307732:K409N;ENSP00000360690:K450N;ENSP00000408894:K194N|.	ENSP00000307732:K409N|.	K|T	+|+	3|1	2|0	LONRF3|LONRF3	118008486|118008486	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.036000|0.036000	0.12997|0.12997	-0.130000|-0.130000	0.10498|0.10498	-1.394000|-1.394000	0.02077|0.02077	0.486000|0.486000	0.48141|0.48141	AAA|ACC	-	NULL		0.463	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	protein_coding	OTTHUMT00000355124.2	A	NM_024778	-		118124458	+1	no_errors	ENST00000371628	ensembl	human	known	74_37	missense	SNP	0.000	T
NBPF22P	285622	genome.wustl.edu	37	5	85581534	85581534	+	RNA	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:85581534T>A	ENST00000590707.1	+	0	554					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AGGGGACCACTGAGAGTAGAC	0.507																																																	0								ENSG00000205449																																			NBPF22P			0			-	HGNC	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85581534T>A		Somatic	0	237	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	190	17.03		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			-	-		0.507	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	pseudogene	OTTHUMT00000453100.1	T	XM_208333	-		85581534	+1	no_errors	ENST00000590707	ensembl	human	known	74_37	rna	SNP	0.000	A
NOBOX	135935	genome.wustl.edu	37	7	144101743	144101743	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:144101743A>G	ENST00000467773.1	-	2	115	c.116T>C	c.(115-117)gTg>gCg	p.V39A	NOBOX_ENST00000483238.1_Missense_Mutation_p.V39A|NOBOX_ENST00000223140.5_5'Flank	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	39					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CAGTCCACACACAGGAAATTC	0.517																																																	0								ENSG00000106410						107.0	115.0	112.0					7																	144101743		1971	4157	6128	NOBOX	SO:0001583	missense	0			-	HGNC			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.116T>C	7.37:g.144101743A>G	ENSP00000419457:p.Val39Ala	Somatic	0	71	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	64	32.63	A6NCD3|A8MZN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V39A	ENST00000467773.1	37	c.116		7	.	.	.	.	.	.	.	.	.	.	A	6.825	0.521398	0.13005	.	.	ENSG00000106410	ENST00000483238;ENST00000467773	D;D	0.94497	-3.3;-3.44	2.28	-2.44	0.06502	.	.	.	.	.	D	0.85617	0.5738	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.73300	-0.4026	9	0.87932	D	0	.	4.3668	0.11228	0.5387:0.3295:0.0:0.1318	.	39	O60393	NOBOX_HUMAN	A	39	ENSP00000419565:V39A;ENSP00000419457:V39A	ENSP00000419457:V39A	V	-	2	0	NOBOX	143732676	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.932000	0.01554	-0.655000	0.05387	-1.627000	0.00785	GTG	-	NULL		0.517	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	A	XM_001134420	-		144101743	-1	no_errors	ENST00000467773	ensembl	human	known	74_37	missense	SNP	0.000	G
DNAH7	56171	genome.wustl.edu	37	2	196642547	196642547	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:196642547A>T	ENST00000312428.6	-	59	11141	c.11041T>A	c.(11041-11043)Tat>Aat	p.Y3681N	DNAH7_ENST00000409063.1_Missense_Mutation_p.Y164N	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3681					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GGAACAAAATAGATGCCACTT	0.378																																																	0								ENSG00000118997						118.0	112.0	114.0					2																	196642547		1961	4151	6112	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11041T>A	2.37:g.196642547A>T	ENSP00000311273:p.Tyr3681Asn	Somatic	0	44	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	29	53.97	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.Y3681N	ENST00000312428.6	37	c.11041	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093925	0.76870	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.08370	3.1;3.1	4.98	4.98	0.66077	Dynein heavy chain (1);	1.798840	0.02983	N	0.145827	T	0.53126	0.1777	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.41662	-0.9496	10	0.87932	D	0	.	14.4951	0.67680	1.0:0.0:0.0:0.0	.	3681	Q8WXX0	DYH7_HUMAN	N	3681;164	ENSP00000311273:Y3681N;ENSP00000386912:Y164N	ENSP00000311273:Y3681N	Y	-	1	0	DNAH7	196350792	1.000000	0.71417	0.997000	0.53966	0.816000	0.46133	8.590000	0.90821	2.088000	0.63022	0.533000	0.62120	TAT	-	pfam_Dynein_heavy_dom		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	A	NM_018897	-		196642547	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	T
LDB1	8861	genome.wustl.edu	37	10	103871022	103871022	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr10:103871022G>T	ENST00000425280.1	-	3	506	c.164C>A	c.(163-165)cCa>cAa	p.P55Q	LDB1_ENST00000361198.5_Missense_Mutation_p.P19Q|LDB1_ENST00000490751.1_5'UTR	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	55					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		CCCAATCCCTGGCTCCAGGTA	0.572																																																	0								ENSG00000198728						97.0	98.0	98.0					10																	103871022		2203	4300	6503	LDB1	SO:0001583	missense	0			-	HGNC	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.164C>A	10.37:g.103871022G>T	ENSP00000392466:p.Pro55Gln	Somatic	0	80	0.00		0.5538374756952343	82	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P55Q	ENST00000425280.1	37	c.164	CCDS44472.1	10	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304871	0.60305	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.73	4.82	0.62117	.	0.050753	0.85682	D	0.000000	T	0.42966	0.1226	L	0.32530	0.975	0.58432	D	0.999999	P;B	0.48911	0.917;0.025	B;B	0.40329	0.326;0.06	T	0.29397	-1.0013	9	0.29301	T	0.29	-9.6987	16.4634	0.84071	0.0:0.1314:0.8686:0.0	.	55;19	Q86U70;Q86U70-3	LDB1_HUMAN;.	Q	19;55	.	ENSP00000354616:P19Q	P	-	2	0	LDB1	103861012	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.300000	0.96151	1.425000	0.47237	0.561000	0.74099	CCA	-	NULL		0.572	LDB1-201	KNOWN	basic|CCDS	protein_coding	LDB1	protein_coding		G	NM_001113407	-		103871022	-1	no_errors	ENST00000425280	ensembl	human	known	74_37	missense	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100655696	100655696	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:100655696G>A	ENST00000379442.3	+	9	15800	c.15800G>A	c.(15799-15801)aGa>aAa	p.R5267K	RP11-395B7.4_ENST00000448513.1_RNA|RP11-395B7.4_ENST00000441882.1_RNA|MUC12_ENST00000536621.1_Missense_Mutation_p.R5124K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5267	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AATGAAACTAGAACAACTCTT	0.453																																																	0								ENSG00000205277						140.0	118.0	125.0					7																	100655696		692	1591	2283	MUC12	SO:0001583	missense	0			-	HGNC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.15800G>A	7.37:g.100655696G>A	ENSP00000368755:p.Arg5267Lys	Somatic	0	78	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	52	26.76	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom	p.R5124K	ENST00000379442.3	37	c.15371		7	.	.	.	.	.	.	.	.	.	.	G	4.697	0.129592	0.08981	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.38722	1.12;1.12	2.43	-3.64	0.04515	.	2.114760	0.02970	N	0.144283	T	0.15782	0.0380	N	0.01576	-0.805	0.09310	N	1	.	.	.	.	.	.	T	0.19679	-1.0298	8	0.13108	T	0.6	.	8.3242	0.32147	0.3667:0.0:0.6333:0.0	.	.	.	.	K	5267;5124	ENSP00000368755:R5267K;ENSP00000441929:R5124K	ENSP00000368755:R5267K	R	+	2	0	MUC12	100442416	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.409000	0.02483	-0.821000	0.04312	-1.130000	0.01982	AGA	-	pfam_SEA_dom		0.453	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	G	XM_379904	-		100655696	+1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	SNP	0.000	A
LRRC45	201255	genome.wustl.edu	37	17	79986369	79986369	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:79986369G>A	ENST00000306688.3	+	11	1564	c.1222G>A	c.(1222-1224)Gcc>Acc	p.A408T		NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	408						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GAAGATGCGGGCCATCCAGGC	0.657																																																	0								ENSG00000169683						29.0	32.0	31.0					17																	79986369		2190	4295	6485	LRRC45	SO:0001583	missense	0			-	HGNC	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1222G>A	17.37:g.79986369G>A	ENSP00000306760:p.Ala408Thr	Somatic	0	31	0.00		0.5538374756952343	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.A408T	ENST00000306688.3	37	c.1222	CCDS11797.1	17	.	.	.	.	.	.	.	.	.	.	G	4.922	0.171277	0.09391	.	.	ENSG00000169683	ENST00000306688	T	0.42131	0.98	3.83	1.61	0.23674	.	0.670897	0.14404	N	0.321719	T	0.38108	0.1028	M	0.65975	2.015	0.09310	N	0.999999	B	0.10296	0.003	B	0.12156	0.007	T	0.28681	-1.0036	9	.	.	.	-1.9855	8.9988	0.36069	0.0909:0.0:0.7522:0.157	.	408	Q96CN5	LRC45_HUMAN	T	408	ENSP00000306760:A408T	.	A	+	1	0	LRRC45	77579658	0.934000	0.31675	0.312000	0.25196	0.085000	0.17905	2.738000	0.47401	0.816000	0.34421	0.491000	0.48974	GCC	-	NULL		0.657	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC45	protein_coding	OTTHUMT00000442058.1	G	NM_144999	-		79986369	+1	no_errors	ENST00000306688	ensembl	human	known	74_37	missense	SNP	0.077	A
ABCA4	24	genome.wustl.edu	37	1	94544976	94544976	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:94544976G>A	ENST00000370225.3	-	9	1227	c.1141C>T	c.(1141-1143)Cct>Tct	p.P381S	ABCA4_ENST00000535735.1_Missense_Mutation_p.P381S	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	381					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTGGTTAAAGGATTTGACTCC	0.448																																																	0								ENSG00000198691						85.0	82.0	83.0					1																	94544976		2203	4300	6503	ABCA4	SO:0001583	missense	0			-	HGNC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1141C>T	1.37:g.94544976G>A	ENSP00000359245:p.Pro381Ser	Somatic	0	86	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	56	40.43	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.P381S	ENST00000370225.3	37	c.1141	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855822	0.51376	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.89617	-2.54;-2.54	5.36	3.46	0.39613	.	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	M	0.77313	2.365	0.53688	D	0.999974	D;B	0.71674	0.998;0.36	D;B	0.74348	0.983;0.143	D	0.90574	0.4524	10	0.56958	D	0.05	.	8.8152	0.34991	0.0699:0.0:0.6631:0.267	.	381;381	F5H6E5;P78363	.;ABCA4_HUMAN	S	381	ENSP00000359245:P381S;ENSP00000437682:P381S	ENSP00000359245:P381S	P	-	1	0	ABCA4	94317564	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.070000	0.71220	0.813000	0.34350	0.561000	0.74099	CCT	-	tigrfam_Rim_ABC_transpt		0.448	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350	-		94544976	-1	no_errors	ENST00000370225	ensembl	human	known	74_37	missense	SNP	1.000	A
MYH11	4629	genome.wustl.edu	37	16	15876309	15876309	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:15876309T>C	ENST00000300036.5	-	6	768	c.659A>G	c.(658-660)cAa>cGa	p.Q220R	MYH11_ENST00000576790.2_Missense_Mutation_p.Q220R|MYH11_ENST00000452625.2_Missense_Mutation_p.Q227R|MYH11_ENST00000396324.3_Missense_Mutation_p.Q227R	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	220	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGGGTTTGCTTGTAGAAGCTG	0.448			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0								ENSG00000133392						138.0	128.0	131.0					16																	15876309		2197	4300	6497	MYH11	SO:0001583	missense	0			-	HGNC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.659A>G	16.37:g.15876309T>C	ENSP00000300036:p.Gln220Arg	Somatic	0	20	0.00		0.5538374756952343	2811	0.11	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q227R	ENST00000300036.5	37	c.680	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	T	29.4	5.003741	0.93287	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.23	5.23	0.72850	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93475	0.7918	M	0.86097	2.795	0.80722	D	1	P;D;D;D;D	0.61080	0.939;0.989;0.989;0.989;0.989	D;D;D;D;D	0.68192	0.956;0.941;0.941;0.941;0.941	D	0.94440	0.7657	10	0.87932	D	0	.	14.2442	0.65978	0.0:0.0:0.0:1.0	.	227;220;227;220;227	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	R	220;220;227;227;227	ENSP00000300036:Q220R;ENSP00000345136:Q220R;ENSP00000379616:Q227R;ENSP00000407821:Q227R	ENSP00000300036:Q220R	Q	-	2	0	MYH11	15783810	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.724000	0.84798	2.094000	0.63399	0.459000	0.35465	CAA	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.448	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	T	NM_001040113	-		15876309	-1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	SNP	1.000	C
ABCA7	10347	genome.wustl.edu	37	19	1057962	1057962	+	Silent	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:1057962G>T	ENST00000263094.6	+	36	5160	c.4929G>T	c.(4927-4929)gtG>gtT	p.V1643V	ABCA7_ENST00000433129.1_Silent_p.V1643V|ABCA7_ENST00000435683.2_Silent_p.V1505V	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1643					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTCTCCGTGCCCAGCACAG	0.527																																																	0								ENSG00000064687						158.0	142.0	148.0					19																	1057962		2203	4300	6503	ABCA7	SO:0001819	synonymous_variant	0			-	HGNC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.4929G>T	19.37:g.1057962G>T		Somatic	0	25	0.00		0.5538374756952343	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V1643	ENST00000263094.6	37	c.4929	CCDS12055.1	19																																																																																			-	NULL		0.527	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	protein_coding	OTTHUMT00000394993.1	G	NM_019112	-		1057962	+1	no_errors	ENST00000263094	ensembl	human	known	74_37	silent	SNP	1.000	T
FAM53A	152877	genome.wustl.edu	37	4	1670402	1670402	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:1670402C>T	ENST00000308132.6	-	2	259	c.67G>A	c.(67-69)Gct>Act	p.A23T	FAM53A_ENST00000489363.1_Missense_Mutation_p.A23T|FAM53A_ENST00000461064.1_Missense_Mutation_p.A23T|FAM53A_ENST00000472884.2_Missense_Mutation_p.A23T	NM_001174070.1	NP_001167541.1	Q6NSI3	FA53A_HUMAN	family with sequence similarity 53, member A	23						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			ACCGGGCCAGCCTCCGCCTTG	0.657																																																	0								ENSG00000174137						75.0	67.0	70.0					4																	1670402		2203	4300	6503	FAM53A	SO:0001583	missense	0			-	HGNC	BC070112	CCDS33939.1, CCDS75091.1	4p16.3	2005-08-09			ENSG00000174137	ENSG00000174137			31860	protein-coding gene	gene with protein product							Standard	NM_001013622		Approved	DNTNP	uc021xkl.1	Q6NSI3	OTTHUMG00000159855	ENST00000308132.6:c.67G>A	4.37:g.1670402C>T	ENSP00000310057:p.Ala23Thr	Somatic	0	47	0.00		0.5538374756952343	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	20	52.38	Q6ZUL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A23T	ENST00000308132.6	37	c.67	CCDS33939.1	4	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745920	0.30955	.	.	ENSG00000174137	ENST00000308132;ENST00000489363;ENST00000461064;ENST00000472884;ENST00000463238	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	3.97	2.8	0.32819	.	0.920676	0.08943	U	0.871313	T	0.49321	0.1550	L	0.54323	1.7	0.24983	N	0.991581	D;D	0.65815	0.995;0.993	P;D	0.63033	0.894;0.91	T	0.41520	-0.9504	10	0.17832	T	0.49	-1.7239	4.0168	0.09647	0.0:0.714:0.0:0.286	.	23;23	Q6NSI3;C9JYQ7	FA53A_HUMAN;.	T	23	ENSP00000310057:A23T;ENSP00000419044:A23T;ENSP00000418243:A23T;ENSP00000426260:A23T;ENSP00000417615:A23T	ENSP00000310057:A23T	A	-	1	0	FAM53A	1640200	0.455000	0.25736	0.937000	0.37676	0.154000	0.21943	0.547000	0.23299	1.932000	0.55993	0.462000	0.41574	GCT	-	NULL		0.657	FAM53A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53A	protein_coding	OTTHUMT00000359224.1	C	NM_001013622	-		1670402	-1	no_errors	ENST00000308132	ensembl	human	known	74_37	missense	SNP	0.946	T
CRMP1	1400	genome.wustl.edu	37	4	5857892	5857892	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:5857892C>T	ENST00000397890.2	-	4	670	c.456G>A	c.(454-456)ctG>ctA	p.L152L	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Silent_p.L266L|CRMP1_ENST00000512574.1_Silent_p.L150L	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	152					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCAGCACCTCCAGCTCCTCCC	0.512																																																	0								ENSG00000072832						109.0	94.0	99.0					4																	5857892		2203	4300	6503	CRMP1	SO:0001819	synonymous_variant	0			-	HGNC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.456G>A	4.37:g.5857892C>T		Somatic	0	62	0.00		0.5538374756952343	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	37	33.93	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.L266	ENST00000397890.2	37	c.798	CCDS43207.1	4																																																																																			-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.512	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	protein_coding	OTTHUMT00000358871.1	C	NM_001313	-		5857892	-1	no_errors	ENST00000324989	ensembl	human	known	74_37	silent	SNP	1.000	T
MYO5B	4645	genome.wustl.edu	37	18	47463703	47463703	+	Missense_Mutation	SNP	T	T	A	rs199813207		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:47463703T>A	ENST00000285039.7	-	15	2116	c.1817A>T	c.(1816-1818)aAg>aTg	p.K606M		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	606	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGATGACCCCTTCCCAGGGGT	0.527																																																	0								ENSG00000167306						80.0	79.0	79.0					18																	47463703		1965	4159	6124	MYO5B	SO:0001583	missense	0			-	HGNC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1817A>T	18.37:g.47463703T>A	ENSP00000285039:p.Lys606Met	Somatic	0	76	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	54	37.21	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K606M	ENST00000285039.7	37	c.1817	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	T	13.54	2.266528	0.40095	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.88124	-2.34	5.01	3.81	0.43845	Myosin head, motor domain (2);	0.542264	0.16677	N	0.204134	D	0.84880	0.5570	L	0.28192	0.835	0.80722	D	1	P;B	0.48834	0.916;0.075	P;B	0.53450	0.726;0.139	T	0.81984	-0.0682	10	0.46703	T	0.11	.	10.0152	0.42010	0.0:0.0829:0.0:0.9171	.	605;606	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	M	606;605	ENSP00000285039:K606M	ENSP00000285039:K606M	K	-	2	0	MYO5B	45717701	1.000000	0.71417	0.391000	0.26233	0.060000	0.15804	3.024000	0.49674	0.726000	0.32339	0.454000	0.30748	AAG	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.527	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	T		-		47463703	-1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	SNP	1.000	A
MESP2	145873	genome.wustl.edu	37	15	90320135	90320146	+	In_Frame_Del	DEL	GGGCAGGGGCAG	GGGCAGGGGCAG	-	rs56192595|rs28546919|rs200021459|rs199821487	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	GGGCAGGGGCAG	GGGCAGGGGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:90320135_90320146delGGGCAGGGGCAG	ENST00000341735.3	+	1	547_558	c.547_558delGGGCAGGGGCAG	c.(547-558)gggcaggggcagdel	p.GQGQ199del	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	199	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			gcaggggcaagggcaggggcaggggcaggggc	0.783																																																	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)						ENSG00000188095																																			MESP2	SO:0001651	inframe_deletion	0				HGNC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.547_558delGGGCAGGGGCAG	15.37:g.90320135_90320146delGGGCAGGGGCAG	ENSP00000342392:p.Gly199_Gln202del	Somatic	NA	NA	NA		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7RTU2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.QGQG186in_frame_del	ENST00000341735.3	37	c.547_558	CCDS42078.1	15																																																																																			-	NULL		0.783	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESP2	protein_coding	OTTHUMT00000416421.1	GGGCAGGGGCAG	XM_085261			90320146	+1	no_errors	ENST00000341735	ensembl	human	known	74_37	in_frame_del	DEL	0.011:0.012:0.038:0.072:0.086:0.084:0.039:0.015:0.014:0.010:0.001:0.000	-
SYNGAP1	8831	genome.wustl.edu	37	6	33410801	33410801	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:33410801C>T	ENST00000418600.2	+	15	2573	c.2472C>T	c.(2470-2472)agC>agT	p.S824S	SYNGAP1_ENST00000293748.5_Silent_p.S824S|SYNGAP1_ENST00000428982.2_Silent_p.S765S|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	824					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GCACGAGCAGCTCGGACATCA	0.582																																																	0								ENSG00000197283						110.0	94.0	99.0					6																	33410801		2203	4300	6503	SYNGAP1	SO:0001819	synonymous_variant	0			-	HGNC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2472C>T	6.37:g.33410801C>T		Somatic	0	39	0.00		0.5538374756952343	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.S824	ENST00000418600.2	37	c.2472	CCDS34434.2	6																																																																																			-	pfam_DUF3498		0.582	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	C	XM_166407	-		33410801	+1	no_errors	ENST00000418600	ensembl	human	known	74_37	silent	SNP	1.000	T
PIGN	23556	genome.wustl.edu	37	18	59739931	59739931	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:59739931C>T	ENST00000357637.5	-	30	3062	c.2647G>A	c.(2647-2649)Ggc>Agc	p.G883S	PIGN_ENST00000400334.3_Missense_Mutation_p.G883S	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	883					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				AGCCAGCTGCCATAATCCTTG	0.318																																																	0								ENSG00000197563						36.0	37.0	37.0					18																	59739931		1810	4074	5884	PIGN	SO:0001583	missense	0			-	HGNC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2647G>A	18.37:g.59739931C>T	ENSP00000350263:p.Gly883Ser	Somatic	0	112	0.00		0.5538374756952343	8	46.67	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	58	33.33	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.G883S	ENST00000357637.5	37	c.2647	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	C	33	5.247546	0.95305	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	D;D	0.91237	-2.81;-2.81	5.97	5.97	0.96955	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.115209	0.64402	D	0.000016	D	0.96661	0.8910	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96638	0.9472	10	0.59425	D	0.04	-11.3808	19.2039	0.93722	0.0:1.0:0.0:0.0	.	883;883	B2RCI8;O95427	.;PIGN_HUMAN	S	883	ENSP00000350263:G883S;ENSP00000383188:G883S	ENSP00000350263:G883S	G	-	1	0	PIGN	57890911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.178000	0.71968	2.833000	0.97629	0.585000	0.79938	GGC	-	pfam_GPI_EtnP_transferase_1_C		0.318	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	protein_coding	OTTHUMT00000449757.2	C	NM_176787	-		59739931	-1	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE5A	8654	genome.wustl.edu	37	4	120549677	120549677	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:120549677G>A	ENST00000354960.3	-	1	469	c.150C>T	c.(148-150)acC>acT	p.T50T	PDE5A_ENST00000264805.5_5'Flank|PDE5A_ENST00000394439.1_5'Flank	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	50					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CTTCTTACCTGGTGGCTTTTC	0.542											OREG0016307	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000138735						86.0	81.0	83.0					4																	120549677		2203	4300	6503	PDE5A	SO:0001819	synonymous_variant	0			-	HGNC	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.150C>T	4.37:g.120549677G>A		Somatic	1	116	0.85	1504	0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	48	42.17	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.T50	ENST00000354960.3	37	c.150	CCDS3713.1	4																																																																																			-	NULL		0.542	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	protein_coding	OTTHUMT00000256529.1	G	NM_001083	-		120549677	-1	no_errors	ENST00000354960	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNF700	90592	genome.wustl.edu	37	19	12060266	12060266	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:12060266G>A	ENST00000254321.5	+	4	1570	c.1427G>A	c.(1426-1428)tGt>tAt	p.C476Y	ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.C458Y|ZNF763_ENST00000590798.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CCCTATGAATGTAAGGAATGT	0.418																																																	0								ENSG00000196757						74.0	75.0	75.0					19																	12060266		2203	4300	6503	ZNF700	SO:0001583	missense	0			-	HGNC	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1427G>A	19.37:g.12060266G>A	ENSP00000254321:p.Cys476Tyr	Somatic	0	54	0.00		0.5538374756952343	7	68.18	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	11	52.17	B9EGU4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C476Y	ENST00000254321.5	37	c.1427	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	g	14.86	2.662913	0.47572	.	.	ENSG00000196757	ENST00000254321	D	0.85088	-1.94	0.606	0.606	0.17559	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93651	0.7972	H	0.96333	3.805	0.25831	N	0.984169	D	0.89917	1.0	D	0.97110	1.0	D	0.84245	0.0474	9	0.87932	D	0	.	8.6677	0.34132	0.0:0.0:1.0:0.0	.	476	Q9H0M5	ZN700_HUMAN	Y	476	ENSP00000254321:C476Y	ENSP00000254321:C476Y	C	+	2	0	ZNF700	11921266	1.000000	0.71417	0.343000	0.25615	0.312000	0.27988	4.193000	0.58385	0.577000	0.29470	0.195000	0.17529	TGT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	protein_coding	OTTHUMT00000344126.2	G	NM_144566	-		12060266	+1	no_errors	ENST00000254321	ensembl	human	known	74_37	missense	SNP	0.514	A
SYCP3	50511	genome.wustl.edu	37	12	102122900	102122901	+	Frame_Shift_Ins	INS	-	-	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:102122900_102122901insT	ENST00000392927.3	-	8	774_775	c.643_644insA	c.(643-645)attfs	p.I215fs	SYCP3_ENST00000392924.1_Frame_Shift_Ins_p.I215fs|SYCP3_ENST00000266743.2_Frame_Shift_Ins_p.I215fs	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	215	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TTCCATCATAATTTTTTTTTGC	0.257																																																	0			GRCh37	CD035010	SYCP3	D		ENSG00000139351																																			SYCP3	SO:0001589	frameshift_variant	0				HGNC	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.644dupA	12.37:g.102122909_102122909dupT	ENSP00000376658:p.Ile215fs	Somatic	0	32	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cor1/Xlr/Xmr	p.I215fs	ENST00000392927.3	37	c.644_643	CCDS9087.1	12																																																																																			-	NULL		0.257	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	SYCP3	protein_coding	OTTHUMT00000316478.2	-	NM_153694			102122901	-1	no_errors	ENST00000266743	ensembl	human	known	74_37	frame_shift_ins	INS	0.999:0.988	T
ZNF436	80818	genome.wustl.edu	37	1	23695985	23695985	+	5'Flank	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:23695985C>G	ENST00000314011.4	-	0	0				C1orf213_ENST00000454117.1_Silent_p.V65V|ZNF436_ENST00000374608.3_5'Flank|Y_RNA_ENST00000364535.1_RNA|C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000437367.2_Silent_p.V65V|C1orf213_ENST00000335648.3_Silent_p.V65V|C1orf213_ENST00000458053.1_Intron	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ACGGGCAGGTCCCGGAGGTCT	0.567																																																	0								ENSG00000249087						58.0	62.0	61.0					1																	23695985		2203	4300	6503	C1orf213	SO:0001631	upstream_gene_variant	0			-	HGNC	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23695985C>G	Exception_encountered	Somatic	0	72	0.00		0.5538374756952343	11	29.41	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	47	36.49	Q658I9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V65	ENST00000314011.4	37	c.195	CCDS233.1	1																																																																																			-	NULL		0.567	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf213	protein_coding	OTTHUMT00000008908.1	C	NM_030634	-		23695985	+1	no_errors	ENST00000335648	ensembl	human	known	74_37	silent	SNP	0.009	G
NCOR2	9612	genome.wustl.edu	37	12	124885127	124885127	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:124885127C>T	ENST00000405201.1	-	15	1733	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H	NCOR2_ENST00000404621.1_Missense_Mutation_p.R577H|NCOR2_ENST00000404121.2_Missense_Mutation_p.R148H|NCOR2_ENST00000429285.2_Missense_Mutation_p.R577H|NCOR2_ENST00000356219.3_Missense_Mutation_p.R578H|NCOR2_ENST00000397355.1_Missense_Mutation_p.R578H			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	578					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCGGCCTTTGCGTCTTCCCTG	0.632																																																	0								ENSG00000196498						169.0	148.0	155.0					12																	124885127		1968	4163	6131	NCOR2	SO:0001583	missense	0			-	HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1733G>A	12.37:g.124885127C>T	ENSP00000384018:p.Arg578His	Somatic	0	46	0.00		0.5538374756952343	56	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R578H	ENST00000405201.1	37	c.1733	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338859	0.60963	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	T	0.60271	-0.7296	10	0.87932	D	0	-33.2244	18.5739	0.91147	0.0:1.0:0.0:0.0	.	577;578;578	C9J0Q5;C9J239;C9JFD3	.;.;.	H	578;577;578;578;578;148;577;578	ENSP00000384018:R578H;ENSP00000384202:R577H;ENSP00000348551:R578H;ENSP00000380513:R578H;ENSP00000385618:R148H;ENSP00000400281:R577H;ENSP00000402808:R578H	ENSP00000348551:R578H	R	-	2	0	NCOR2	123451080	1.000000	0.71417	0.996000	0.52242	0.921000	0.55340	7.286000	0.78671	2.382000	0.81193	0.491000	0.48974	CGC	-	NULL		0.632	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	C	NM_006312	-		124885127	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	SNP	1.000	T
MEDAG	84935	genome.wustl.edu	37	13	31491582	31491582	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:31491582G>T	ENST00000380482.4	+	2	646	c.321G>T	c.(319-321)agG>agT	p.R107S	TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000451495.2_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000590344.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	107					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											AAGACTACAGGGAAACTATAT	0.348																																																	0								ENSG00000102802						140.0	137.0	138.0					13																	31491582		2203	4300	6503	MEDAG	SO:0001583	missense	0			-	HGNC	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.321G>T	13.37:g.31491582G>T	ENSP00000369849:p.Arg107Ser	Somatic	0	89	0.00		0.5538374756952343	5	44.44	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	30	37.50	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R107S	ENST00000380482.4	37	c.321	CCDS9338.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.10|18.10	3.549304|3.549304	0.65311|0.65311	.|.	.|.	ENSG00000102802|ENSG00000102802	ENST00000428944|ENST00000380482	.|T	.|0.58060	.|0.36	5.56|5.56	4.58|4.58	0.56647|0.56647	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57607|0.57607	0.2065|0.2065	L|L	0.32530|0.32530	0.975|0.975	0.34415|0.34415	D|D	0.6968|0.6968	.|D	.|0.61080	.|0.989	.|D	.|0.75020	.|0.985	T|T	0.68135|0.68135	-0.5489|-0.5489	5|10	.|0.72032	.|D	.|0.01	-11.8896|-11.8896	7.2181|7.2181	0.25971|0.25971	0.2324:0.0:0.7676:0.0|0.2324:0.0:0.7676:0.0	.|.	.|107	.|Q5VYS4	.|CM033_HUMAN	V|S	44|107	.|ENSP00000369849:R107S	.|ENSP00000369849:R107S	G|R	+|+	2|3	0|2	C13orf33|C13orf33	30389582|30389582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	2.485000|2.485000	0.45250|0.45250	1.095000|1.095000	0.41419|0.41419	0.563000|0.563000	0.77884|0.77884	GGG|AGG	-	NULL		0.348	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEDAG	protein_coding	OTTHUMT00000044375.1	G	NM_032849	-		31491582	+1	no_errors	ENST00000380482	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH4	1002	genome.wustl.edu	37	20	60294000	60294000	+	Intron	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr20:60294000G>T	ENST00000360469.5	+	3	257				CDH4_ENST00000543233.1_Intron|RP11-429E11.3_ENST00000317652.1_Missense_Mutation_p.A76D	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGTGGGTGAAGCAGGGGTCTT	0.567																																																	0								ENSG00000179253																																			RP11-429E11.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.170-24619G>T	20.37:g.60294000G>T		Somatic	0	47	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A76D	ENST00000360469.5	37	c.227	CCDS13488.1	20	.	.	.	.	.	.	.	.	.	.	G	9.095	1.002629	0.19121	.	.	ENSG00000179253	ENST00000317652	.	.	.	1.64	0.669	0.17918	.	.	.	.	.	T	0.23846	0.0577	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23833	-1.0177	4	.	.	.	.	4.0365	0.09731	0.2277:0.0:0.7723:0.0	.	.	.	.	D	76	.	.	A	-	2	0	RP11-429E11.3	59727395	0.213000	0.23551	0.001000	0.08648	0.034000	0.12701	0.702000	0.25631	0.262000	0.21774	0.305000	0.20034	GCT	-	NULL		0.567	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000179253	protein_coding	OTTHUMT00000079965.2	G	NM_001794	-		60294000	-1	no_errors	ENST00000317652	ensembl	human	known	74_37	missense	SNP	0.001	T
GMIP	51291	genome.wustl.edu	37	19	19746284	19746292	+	In_Frame_Del	DEL	CCGCAGTCG	CCGCAGTCG	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	CCGCAGTCG	CCGCAGTCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:19746284_19746292delCCGCAGTCG	ENST00000203556.4	-	15	1629_1637	c.1492_1500delCGACTGCGG	c.(1492-1500)cgactgcggdel	p.RLR498del	GMIP_ENST00000587238.1_In_Frame_Del_p.RLR472del|GMIP_ENST00000586269.1_5'UTR|GMIP_ENST00000445806.2_In_Frame_Del_p.RLR469del	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	498					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TGGCTGGGCCCCGCAGTCGCCGCAGCTGG	0.651																																																	0								ENSG00000089639																																			GMIP	SO:0001651	inframe_deletion	0				HGNC	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1492_1500delCGACTGCGG	19.37:g.19746284_19746292delCCGCAGTCG	ENSP00000203556:p.Arg498_Arg500del	Somatic	NA	NA	NA		0.5538374756952343	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0AVN9|B7ZLZ0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.RLR498in_frame_del	ENST00000203556.4	37	c.1500_1492	CCDS12408.1	19																																																																																			-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd		0.651	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	protein_coding	OTTHUMT00000460551.1	CCGCAGTCG	NM_016573			19746292	-1	no_errors	ENST00000203556	ensembl	human	known	74_37	in_frame_del	DEL	0.979:1.000:1.000:1.000:1.000:1.000:0.983:0.995:0.997	-
CRMP1	1400	genome.wustl.edu	37	4	5857870	5857870	+	Splice_Site	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:5857870C>G	ENST00000397890.2	-	4	692	c.478G>C	c.(478-480)Ggc>Cgc	p.G160R	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Splice_Site_p.G274R|CRMP1_ENST00000512574.1_Splice_Site_p.G158R	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	160					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TTTAACTGACCTTTGTCCTGC	0.512																																																	0								ENSG00000072832						100.0	87.0	91.0					4																	5857870		2203	4300	6503	CRMP1	SO:0001630	splice_region_variant	0			-	HGNC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.478+1G>C	4.37:g.5857870C>G		Somatic	0	57	0.00		0.5538374756952343	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	34	35.85	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.G274R	ENST00000397890.2	37	c.820	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	c	19.91	3.913958	0.72983	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.94650	-3.48;-3.48;-3.48	3.09	3.09	0.35607	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.119994	0.56097	D	0.000027	D	0.98172	0.9396	H	0.97983	4.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98860	1.0762	9	.	.	.	-14.7024	13.358	0.60640	0.0:1.0:0.0:0.0	.	274;158;160;97	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	R	274;160;160;158	ENSP00000321606:G274R;ENSP00000380987:G160R;ENSP00000425742:G158R	.	G	-	1	0	CRMP1	5908771	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.118000	0.77137	1.577000	0.49804	0.537000	0.68136	GGC	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.512	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	protein_coding	OTTHUMT00000358871.1	C	NM_001313	-	Missense_Mutation	5857870	-1	no_errors	ENST00000324989	ensembl	human	known	74_37	missense	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M		ENSG00000141510						132.0	103.0	113.0					17																	7577568		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr	Somatic	0	52	0.00		0.5538374756952343	16	72.88	43	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577568	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
C9orf3	84909	genome.wustl.edu	37	9	97522564	97522564	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:97522564C>T	ENST00000375315.2	+	1	499	c.499C>T	c.(499-501)Ctg>Ttg	p.L167L	C9orf3_ENST00000297979.5_Silent_p.L167L|C9orf3_ENST00000277198.2_Silent_p.L167L	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	167					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGTGCCAGGTCTGGAAAAATT	0.458																																																	0								ENSG00000148120						138.0	136.0	137.0					9																	97522564		2203	4300	6503	C9orf3	SO:0001819	synonymous_variant	0			-	HGNC	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.499C>T	9.37:g.97522564C>T		Somatic	0	73	0.00		0.5538374756952343	2	71.43	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	32	43.86	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.L167	ENST00000375315.2	37	c.499	CCDS55328.1	9																																																																																			-	NULL		0.458	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	protein_coding		C	NM_032823	-		97522564	+1	no_errors	ENST00000375315	ensembl	human	known	74_37	silent	SNP	0.998	T
SLTM	79811	genome.wustl.edu	37	15	59186310	59186310	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:59186310delT	ENST00000380516.2	-	11	1547	c.1460delA	c.(1459-1461)aatfs	p.N487fs	SLTM_ENST00000536328.1_Frame_Shift_Del_p.N56fs|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	487					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						ATCACTCGTATTTTTTTTATC	0.299																																																	0								ENSG00000137776						108.0	100.0	103.0					15																	59186310		2190	4290	6480	SLTM	SO:0001589	frameshift_variant	0				HGNC	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1460delA	15.37:g.59186310delT	ENSP00000369887:p.Asn487fs	Somatic	0	54	0.00		0.5538374756952343	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.N487fs	ENST00000380516.2	37	c.1460	CCDS10168.2	15																																																																																			-	NULL		0.299	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	protein_coding	OTTHUMT00000157124.1	T	NM_024755			59186310	-1	no_errors	ENST00000380516	ensembl	human	known	74_37	frame_shift_del	DEL	0.076	-
GOLGA8I	283796	genome.wustl.edu	37	15	23264792	23264792	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:23264792A>G	ENST00000450802.3	+	16	1494	c.1396A>G	c.(1396-1398)Aag>Gag	p.K466E	RN7SL495P_ENST00000461817.2_RNA|AC091565.1_ENST00000459619.1_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	466						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											CCTGGAGGAGAAGGCAGACCT	0.547																																																	0								ENSG00000153666																																			GOLGA8I	SO:0001583	missense	0			-	HGNC	AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1396A>G	15.37:g.23264792A>G	ENSP00000399637:p.Lys466Glu	Somatic	0	100	0.00		0.5538374756952343	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	41	44.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K466E	ENST00000450802.3	37	c.1396		15	.	.	.	.	.	.	.	.	.	.	.	11.22	1.574318	0.28092	.	.	ENSG00000153666	ENST00000450802	D	0.90004	-2.6	0.829	0.829	0.18847	.	.	.	.	.	D	0.83903	0.5355	.	.	.	.	.	.	.	.	.	.	.	.	T	0.79804	-0.1649	5	0.30078	T	0.28	.	5.9935	0.19480	1.0:0.0:0.0:0.0	.	.	.	.	E	466	ENSP00000399637:K466E	ENSP00000399637:K466E	K	+	1	0	GOLGA8IP	20816233	1.000000	0.71417	0.029000	0.17559	0.254000	0.26022	4.588000	0.60999	0.652000	0.30806	0.092000	0.15492	AAG	-	NULL		0.547	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	protein_coding	OTTHUMT00000251213.2	A	NR_024074	-		23264792	+1	no_errors	ENST00000450802	ensembl	human	known	74_37	missense	SNP	1.000	G
POLE2	5427	genome.wustl.edu	37	14	50117072	50117072	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:50117072T>A	ENST00000216367.5	-	17	1507	c.1408A>T	c.(1408-1410)Aga>Tga	p.R470*	POLE2_ENST00000554396.1_Nonsense_Mutation_p.R470*|POLE2_ENST00000539565.2_Nonsense_Mutation_p.R444*|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	470					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	GGATACACTCTCAAAGCATAG	0.418																																																	0								ENSG00000100479						150.0	143.0	145.0					14																	50117072		2203	4300	6503	POLE2	SO:0001587	stop_gained	0			-	HGNC	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1408A>T	14.37:g.50117072T>A	ENSP00000216367:p.Arg470*	Somatic	0	46	0.00		0.5538374756952343	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.00	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_alpha/epsilon_bsu,pfam_DNA_pol_e_bsu_N,pirsf_DNA_pol_e_bsu	p.R470*	ENST00000216367.5	37	c.1408	CCDS32073.1	14	.	.	.	.	.	.	.	.	.	.	T	36	5.947237	0.97134	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	.	.	.	5.88	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.6787	13.2701	0.60155	0.0:0.0:0.3377:0.6622	.	.	.	.	X	470;444;470	.	ENSP00000216367:R470X	R	-	1	2	POLE2	49186822	0.997000	0.39634	0.994000	0.49952	0.734000	0.41952	0.667000	0.25112	0.998000	0.38996	0.528000	0.53228	AGA	-	pfam_DNA_pol_alpha/epsilon_bsu,pirsf_DNA_pol_e_bsu		0.418	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	POLE2	protein_coding	OTTHUMT00000410512.1	T	NM_002692	-		50117072	-1	no_errors	ENST00000216367	ensembl	human	known	74_37	nonsense	SNP	1.000	A
FRMD6	122786	genome.wustl.edu	37	14	52174840	52174840	+	Silent	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:52174840A>G	ENST00000344768.5	+	7	799	c.603A>G	c.(601-603)ccA>ccG	p.P201P	FRMD6_ENST00000356218.4_Silent_p.P193P|FRMD6_ENST00000395718.2_Silent_p.P193P|FRMD6_ENST00000554167.1_Silent_p.P124P			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	201	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					AGCACATTCCAAACATGCACA	0.438																																																	0								ENSG00000139926						125.0	105.0	112.0					14																	52174840		2203	4300	6503	FRMD6	SO:0001819	synonymous_variant	0			-	HGNC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.603A>G	14.37:g.52174840A>G		Somatic	0	75	0.00		0.5538374756952343	31	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.P201	ENST00000344768.5	37	c.603	CCDS58318.1	14																																																																																			-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.438	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	protein_coding	OTTHUMT00000276881.1	A	NM_152330	-		52174840	+1	no_errors	ENST00000344768	ensembl	human	known	74_37	silent	SNP	0.977	G
KIAA2012	100652824	genome.wustl.edu	37	2	202965106	202965106	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:202965106C>T	ENST00000541917.1	+	7	1462	c.1089C>T	c.(1087-1089)ctC>ctT	p.L363L	AC079354.1_ENST00000409515.3_3'UTR|AC079354.1_ENST00000295844.3_Silent_p.L419L																							AAAGAAGCCTCTTCCCTCCTG	0.453																																																	0								ENSG00000182329																																			AC079354.1	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000541917.1:c.1089C>T	2.37:g.202965106C>T		Somatic	0	24	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	13	55.17		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L363	ENST00000541917.1	37	c.1089		2																																																																																			-	NULL		0.453	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	protein_coding		C		-		202965106	+1	no_errors	ENST00000541917	ensembl	human	known	74_37	silent	SNP	0.516	T
BCL6B	255877	genome.wustl.edu	37	17	6928037	6928038	+	In_Frame_Ins	INS	-	-	CAA	rs386385553		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:6928037_6928038insCAA	ENST00000293805.5	+	4	811_812	c.719_720insCAA	c.(718-723)agcagc>agCAAcagc	p.240_241SS>SNS		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	240	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						agcagcagcagcagcagcagca	0.589																																																	0								ENSG00000161940																																			BCL6B	SO:0001652	inframe_insertion	0				HGNC	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	Exception_encountered	17.37:g.6928037_6928038insCAA	ENSP00000293805:p.Ser240_Ser241insAsn	Somatic	0	68	0.00		0.5538374756952343	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q6PCB4	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.241in_frame_insN	ENST00000293805.5	37	c.719_720	CCDS42248.1	17																																																																																			-	NULL		0.589	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	protein_coding	OTTHUMT00000439455.2	-	NM_181844			6928038	+1	no_errors	ENST00000293805	ensembl	human	known	74_37	in_frame_ins	INS	0.967:0.974	CAA
NRXN1	9378	genome.wustl.edu	37	2	50280726	50280726	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:50280726G>A	ENST00000406316.2	-	20	5197	c.3721C>T	c.(3721-3723)Cgt>Tgt	p.R1241C	NRXN1_ENST00000401669.2_Missense_Mutation_p.R1271C|NRXN1_ENST00000404971.1_Missense_Mutation_p.R1311C|NRXN1_ENST00000405472.3_Missense_Mutation_p.R1263C|NRXN1_ENST00000406859.3_Missense_Mutation_p.R1241C|NRXN1_ENST00000402717.3_Missense_Mutation_p.R1263C|NRXN1_ENST00000342183.5_Missense_Mutation_p.R206C|NRXN1_ENST00000401710.1_Missense_Mutation_p.R259C	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1241	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GTGAGCTGACGCCCTGTAAAA	0.413																																																	0								ENSG00000179915						56.0	58.0	57.0					2																	50280726		2203	4300	6503	NRXN1	SO:0001583	missense	0			-	HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3721C>T	2.37:g.50280726G>A	ENSP00000384311:p.Arg1241Cys	Somatic	0	50	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	20	41.18	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.R1263C	ENST00000406316.2	37	c.3787	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489993	0.64074	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.79352	0.91;-1.17;-1.26;-1.17;-1.26;-1.26;-1.26;-1.17	5.65	5.65	0.86999	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	U	0.000077	D	0.90431	0.7004	M	0.88310	2.945	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.993;0.997	P;D;P;P	0.79784	0.803;0.993;0.808;0.802	D	0.91626	0.5315	10	0.87932	D	0	.	19.7195	0.96136	0.0:0.0:1.0:0.0	.	1311;206;1241;1263	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	C	206;160;259;1311;1241;1263;1271;1312;1263;1241	ENSP00000341184:R206C;ENSP00000385580:R259C;ENSP00000385142:R1311C;ENSP00000384311:R1241C;ENSP00000434015:R1263C;ENSP00000385017:R1271C;ENSP00000385434:R1263C;ENSP00000385681:R1241C	ENSP00000341184:R206C	R	-	1	0	NRXN1	50134230	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.663000	0.90544	0.655000	0.94253	CGT	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.413	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	G		-		50280726	-1	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	SNP	1.000	A
BAHCC1	57597	genome.wustl.edu	37	17	79411747	79411747	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:79411747G>A	ENST00000307745.7	+	12	2566	c.2566G>A	c.(2566-2568)Gtg>Atg	p.V856M																								CCCCGCCTCCGTGGCTGGCCC	0.726																																																	0								ENSG00000171282						28.0	36.0	34.0					17																	79411747		1998	4149	6147	RP11-1055B8.7	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000307745.7:c.2566G>A	17.37:g.79411747G>A	ENSP00000303486:p.Val856Met	Somatic	0	13	0.00		0.5538374756952343	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	5	54.55		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.V856M	ENST00000307745.7	37	c.2566		17	.	.	.	.	.	.	.	.	.	.	G	5.074	0.199331	0.09652	.	.	ENSG00000171282	ENST00000307745	T	0.54279	0.58	4.63	3.58	0.41010	.	0.492500	0.16564	N	0.208921	T	0.23688	0.0573	N	0.11724	0.165	0.35090	D	0.764245	B;P	0.38729	0.269;0.644	B;B	0.26693	0.019;0.072	T	0.21586	-1.0241	10	0.32370	T	0.25	.	3.9825	0.09501	0.3243:0.0:0.6757:0.0	.	856;856	Q9P281;F8WBW8	BAHC1_HUMAN;.	M	856	ENSP00000303486:V856M	ENSP00000303486:V856M	V	+	1	0	AC110285.1	77026342	1.000000	0.71417	0.937000	0.37676	0.109000	0.19521	5.566000	0.67372	2.381000	0.81170	0.491000	0.48974	GTG	-	NULL		0.726	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	protein_coding		G		-		79411747	+1	no_errors	ENST00000307745	ensembl	human	known	74_37	missense	SNP	0.993	A
PTPRQ	374462	genome.wustl.edu	37	12	81015850	81015850	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:81015850A>G	ENST00000266688.5	+	38	5611	c.5611A>G	c.(5611-5613)Aga>Gga	p.R1871G				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1917					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						ATTTAAATTTAGAGCTACAAA	0.239																																																	0								ENSG00000139304						47.0	44.0	45.0					12																	81015850		687	1535	2222	PTPRQ	SO:0001583	missense	0			-	HGNC	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5611A>G	12.37:g.81015850A>G	ENSP00000266688:p.Arg1871Gly	Somatic	0	81	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1871G	ENST00000266688.5	37	c.5611		12	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137743	0.56936	.	.	ENSG00000139304	ENST00000266688	T	0.58210	0.35	4.81	3.68	0.42216	.	.	.	.	.	T	0.69708	0.3141	.	.	.	0.49051	D	0.999749	D	0.89917	1.0	D	0.73708	0.981	T	0.71108	-0.4688	8	0.59425	D	0.04	.	10.8445	0.46735	0.6535:0.3465:0.0:0.0	.	1917	Q9UMZ3	PTPRQ_HUMAN	G	1871	ENSP00000266688:R1871G	ENSP00000266688:R1871G	R	+	1	2	PTPRQ	79539981	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.151000	0.42263	0.812000	0.34326	0.482000	0.46254	AGA	-	NULL		0.239	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	protein_coding		A	NM_001145026	-		81015850	+1	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	SNP	1.000	G
POLE	5426	genome.wustl.edu	37	12	133252732	133252732	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:133252732G>C	ENST00000320574.5	-	10	1011	c.968C>G	c.(967-969)aCc>aGc	p.T323S	POLE_ENST00000535270.1_Missense_Mutation_p.T296S	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	323					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TGGCTTGGGGGTGAACTCAAA	0.468								DNA polymerases (catalytic subunits)																																									0								ENSG00000177084						93.0	95.0	95.0					12																	133252732		2203	4300	6503	POLE	SO:0001583	missense	0			-	HGNC		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.968C>G	12.37:g.133252732G>C	ENSP00000322570:p.Thr323Ser	Somatic	0	67	0.00		0.5538374756952343	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	36	35.71	Q13533|Q86VH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.T323S	ENST00000320574.5	37	c.968	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002679	0.93227	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.81	5.81	0.92471	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.72982	0.979;0.951	T	0.01940	-1.1243	10	0.59425	D	0.04	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	296;323	F5H1D6;Q07864	.;DPOE1_HUMAN	S	323;334;296;103;258	ENSP00000322570:T323S;ENSP00000406383:T334S;ENSP00000445753:T296S;ENSP00000442519:T103S	ENSP00000322570:T323S	T	-	2	0	POLE	131762805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.762000	0.98944	2.738000	0.93877	0.655000	0.94253	ACC	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B		0.468	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	protein_coding	OTTHUMT00000397689.2	G	NM_006231	-		133252732	-1	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	SNP	1.000	C
PADI1	29943	genome.wustl.edu	37	1	17566158	17566158	+	Intron	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:17566158C>T	ENST00000375471.4	+	14	1644				PADI1_ENST00000536552.1_Intron|PADI1_ENST00000537499.1_Intron|PADI1_ENST00000460293.1_3'UTR|PADI1_ENST00000413717.2_Intron	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I						protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GGCCTCCAGGCAGTGCTCCCT	0.527																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0								ENSG00000142623						40.0	39.0	40.0					1																	17566158		2203	4300	6503	PADI1	SO:0001627	intron_variant	0			-	HGNC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1553-41C>T	1.37:g.17566158C>T		Somatic	0	75	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A1L4K6|Q70SX6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375471.4	37	NULL	CCDS178.1	1																																																																																			-	-		0.527	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	protein_coding	OTTHUMT00000006621.1	C	NM_013358	-		17566158	+1	no_errors	ENST00000460293	ensembl	human	known	74_37	rna	SNP	0.000	T
AKNA	80709	genome.wustl.edu	37	9	117122049	117122049	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:117122049C>G	ENST00000307564.4	-	11	2478	c.2317G>C	c.(2317-2319)Gaa>Caa	p.E773Q	AKNA_ENST00000374088.3_Missense_Mutation_p.E773Q|AKNA_ENST00000374075.5_Missense_Mutation_p.E692Q|AKNA_ENST00000223791.3_Missense_Mutation_p.E233Q|AKNA_ENST00000312033.3_Missense_Mutation_p.E773Q	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	773	PEST.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CTCATGGCTTCTGGGAGAGAC	0.592																																																	0								ENSG00000106948						37.0	35.0	36.0					9																	117122049		2203	4300	6503	AKNA	SO:0001583	missense	0			-	HGNC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2317G>C	9.37:g.117122049C>G	ENSP00000303769:p.Glu773Gln	Somatic	0	36	0.00		0.5538374756952343	31	16.22	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AT-hook	p.E773Q	ENST00000307564.4	37	c.2317	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	c	12.22	1.871551	0.33069	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.38240	2.39;2.39;2.18;2.4;1.15	3.85	2.95	0.34219	.	0.377610	0.22835	N	0.055056	T	0.38799	0.1054	L	0.34521	1.04	0.50171	D	0.999852	D;D	0.61697	0.984;0.99	P;P	0.58266	0.69;0.836	T	0.20009	-1.0288	10	0.62326	D	0.03	-11.416	7.2542	0.26166	0.0:0.8818:0.0:0.1182	.	773;692	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	Q	773;614;773;233;692;773	ENSP00000303769:E773Q;ENSP00000363201:E773Q;ENSP00000223791:E233Q;ENSP00000363188:E692Q;ENSP00000309222:E773Q	ENSP00000223791:E233Q	E	-	1	0	AKNA	116161870	0.914000	0.31030	0.653000	0.29593	0.118000	0.20060	1.705000	0.37867	1.213000	0.43380	0.450000	0.29827	GAA	-	NULL		0.592	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	protein_coding	OTTHUMT00000053767.2	C	NM_030767	-		117122049	-1	no_errors	ENST00000307564	ensembl	human	known	74_37	missense	SNP	0.706	G
STK10	6793	genome.wustl.edu	37	5	171583763	171583763	+	Silent	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:171583763A>G	ENST00000176763.5	-	2	529	c.186T>C	c.(184-186)gcT>gcC	p.A62A		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			A -> V (in Ref. 5; AAH70077). {ECO:0000305}.	cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTGGCCGCAGCCAAAGCAC	0.552																																																	0								ENSG00000072786						162.0	126.0	138.0					5																	171583763		2203	4300	6503	STK10	SO:0001819	synonymous_variant	0			-	HGNC	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.186T>C	5.37:g.171583763A>G		Somatic	0	33	0.00		0.5538374756952343	11	8.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	4	71.43	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A62	ENST00000176763.5	37	c.186	CCDS34290.1	5																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.552	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	protein_coding	OTTHUMT00000372374.2	A	NM_005990	-		171583763	-1	no_errors	ENST00000176763	ensembl	human	known	74_37	silent	SNP	0.024	G
FNBP4	23360	genome.wustl.edu	37	11	47776104	47776104	+	Silent	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:47776104A>G	ENST00000263773.5	-	3	438	c.426T>C	c.(424-426)gaT>gaC	p.D142D	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	142						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CCAATGTACTATCAATATCAG	0.423																																																	0								ENSG00000109920						272.0	267.0	268.0					11																	47776104		2030	4173	6203	FNBP4	SO:0001819	synonymous_variant	0			-	HGNC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.426T>C	11.37:g.47776104A>G		Somatic	0	87	0.00		0.5538374756952343	24	25.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	36	41.94	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.D142	ENST00000263773.5	37	c.426	CCDS41644.1	11																																																																																			-	NULL		0.423	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP4	protein_coding	OTTHUMT00000390237.3	A		-		47776104	-1	no_errors	ENST00000263773	ensembl	human	known	74_37	silent	SNP	0.998	G
CTNNA2	1496	genome.wustl.edu	37	2	80101392	80101392	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:80101392A>C	ENST00000402739.4	+	5	781	c.776A>C	c.(775-777)cAa>cCa	p.Q259P	CTNNA2_ENST00000541047.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000496558.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000361291.4_Missense_Mutation_p.Q293P|CTNNA2_ENST00000540488.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000466387.1_Missense_Mutation_p.Q259P	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	259					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AATGCTGCTCAAGCTACCTCG	0.577																																																	0								ENSG00000066032						45.0	49.0	48.0					2																	80101392		2073	4204	6277	CTNNA2	SO:0001583	missense	0			-	HGNC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.776A>C	2.37:g.80101392A>C	ENSP00000384638:p.Gln259Pro	Somatic	0	74	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	28	50.88	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.Q293P	ENST00000402739.4	37	c.878		2	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719406	0.89205	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	M	0.86502	2.82	0.80722	D	1	D;D;D	0.61697	0.985;0.99;0.99	D;D;D	0.66716	0.946;0.939;0.939	T	0.77613	-0.2522	10	0.66056	D	0.02	.	15.9971	0.80260	1.0:0.0:0.0:0.0	.	259;259;259	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	P	259;259;293;259;259;259	ENSP00000418191:Q259P;ENSP00000419295:Q259P;ENSP00000355398:Q293P;ENSP00000384638:Q259P;ENSP00000444675:Q259P;ENSP00000441705:Q259P	ENSP00000355398:Q293P	Q	+	2	0	CTNNA2	79954900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.175000	0.68902	0.528000	0.53228	CAA	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.577	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	protein_coding	OTTHUMT00000328511.4	A	NM_004389	-		80101392	+1	no_errors	ENST00000361291	ensembl	human	known	74_37	missense	SNP	1.000	C
OR11H6	122748	genome.wustl.edu	37	14	20692715	20692715	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:20692715G>T	ENST00000315519.2	+	1	925	c.847G>T	c.(847-849)Ggg>Tgg	p.G283W		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		CCCAACATCAGGGAACCCAGC	0.443																																																	0								ENSG00000176219						117.0	108.0	111.0					14																	20692715		2203	4300	6503	OR11H6	SO:0001583	missense	0			-	HGNC		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.847G>T	14.37:g.20692715G>T	ENSP00000319071:p.Gly283Trp	Somatic	0	68	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6IF08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G283W	ENST00000315519.2	37	c.847	CCDS32033.1	14	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439793	0.43326	.	.	ENSG00000176219	ENST00000315519	T	0.00164	8.64	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000062	T	0.00384	0.0012	M	0.72576	2.205	0.19945	N	0.999947	D	0.71674	0.998	D	0.81914	0.995	T	0.50197	-0.8856	10	0.87932	D	0	.	9.2608	0.37612	0.0963:0.0:0.9037:0.0	.	283	Q8NGC7	O11H6_HUMAN	W	283	ENSP00000319071:G283W	ENSP00000319071:G283W	G	+	1	0	OR11H6	19762555	0.218000	0.23608	0.956000	0.39512	0.843000	0.47879	2.065000	0.41442	2.592000	0.87571	0.471000	0.43371	GGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H6	protein_coding	OTTHUMT00000410676.1	G		-		20692715	+1	no_errors	ENST00000315519	ensembl	human	known	74_37	missense	SNP	0.392	T
EFTUD1	79631	genome.wustl.edu	37	15	82450161	82450161	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:82450161G>A	ENST00000268206.7	-	17	2091	c.1923C>T	c.(1921-1923)aaC>aaT	p.N641N	EFTUD1_ENST00000359445.3_Silent_p.N590N	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	641					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GATCAGCCTGGTTTAACAGTT	0.398																																																	0								ENSG00000140598						111.0	106.0	107.0					15																	82450161		1884	4105	5989	EFTUD1	SO:0001819	synonymous_variant	0			-	HGNC	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1923C>T	15.37:g.82450161G>A		Somatic	0	81	0.00		0.5538374756952343	13	31.58	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	94	22.95	A6NKY5|B7Z6I0|Q9H8Z6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_GTP-bd_dom,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_EFG_III-V,superfamily_Transl_B-barrel,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.N641	ENST00000268206.7	37	c.1923	CCDS42071.1	15																																																																																			-	superfamily_EFG_III-V		0.398	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	protein_coding	OTTHUMT00000419252.1	G	NM_024580	-		82450161	-1	no_errors	ENST00000268206	ensembl	human	known	74_37	silent	SNP	1.000	A
ALPL	249	genome.wustl.edu	37	1	21887130	21887130	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:21887130G>A	ENST00000374840.3	+	3	323	c.73G>A	c.(73-75)Gac>Aac	p.D25N	ALPL_ENST00000540617.1_5'UTR|ALPL_ENST00000425315.2_Missense_Mutation_p.D25N|ALPL_ENST00000468526.1_3'UTR|ALPL_ENST00000374832.1_Missense_Mutation_p.D25N|ALPL_ENST00000539907.1_5'UTR	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	25					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	GAAAGAGAAAGACCCCAAGTA	0.502																																																	0								ENSG00000162551						89.0	89.0	89.0					1																	21887130		2203	4300	6503	ALPL	SO:0001583	missense	0			-	HGNC	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.73G>A	1.37:g.21887130G>A	ENSP00000363973:p.Asp25Asn	Somatic	0	60	0.00		0.5538374756952343	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	57	12.31	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.D25N	ENST00000374840.3	37	c.73	CCDS217.1	1	.	.	.	.	.	.	.	.	.	.	G	5.935	0.356616	0.11239	.	.	ENSG00000162551	ENST00000374840;ENST00000374832;ENST00000425315	D;D;D	0.95821	-3.82;-3.82;-3.82	5.71	4.7	0.59300	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.307211	0.40064	N	0.001200	D	0.88991	0.6588	N	0.20610	0.595	0.80722	D	1	B	0.16802	0.019	B	0.12837	0.008	D	0.83381	0.0012	10	0.11485	T	0.65	-13.4106	11.5449	0.50688	0.118:0.0:0.882:0.0	.	25	P05186	PPBT_HUMAN	N	25	ENSP00000363973:D25N;ENSP00000363965:D25N;ENSP00000394765:D25N	ENSP00000363965:D25N	D	+	1	0	ALPL	21759717	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	0.729000	0.26028	2.698000	0.92095	0.561000	0.74099	GAC	-	superfamily_Alkaline_phosphatase_core		0.502	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALPL	protein_coding	OTTHUMT00000008202.1	G	NM_000478	-		21887130	+1	no_errors	ENST00000374832	ensembl	human	known	74_37	missense	SNP	1.000	A
LPPR2	64748	genome.wustl.edu	37	19	11470240	11470240	+	Silent	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:11470240T>C	ENST00000251473.5	+	4	475	c.99T>C	c.(97-99)gcT>gcC	p.A33A	DKFZP761J1410_ENST00000586431.1_3'UTR|DKFZP761J1410_ENST00000591608.1_Intron	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					TCCTGCTTGCTTACCGCCTGG	0.617																																																	0								ENSG00000105520						121.0	89.0	100.0					19																	11470240		2203	4300	6503	DKFZP761J1410	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000251473.5:c.99T>C	19.37:g.11470240T>C		Somatic	0	22	0.00		0.5538374756952343	78	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A33	ENST00000251473.5	37	c.99	CCDS12258.1	19																																																																																			-	NULL		0.617	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	protein_coding	OTTHUMT00000458779.1	T		-		11470240	+1	no_errors	ENST00000251473	ensembl	human	known	74_37	silent	SNP	0.706	C
IFNL1	282618	genome.wustl.edu	37	19	39789057	39789057	+	Silent	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:39789057T>A	ENST00000333625.2	+	5	601	c.504T>A	c.(502-504)tcT>tcA	p.S168S		NM_172140.1	NP_742152.1	Q8IU54	IFNL1_HUMAN	interferon, lambda 1	168					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of cell proliferation (GO:0008285)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of memory T cell differentiation (GO:0043381)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of immune response (GO:0050778)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-28 receptor complex (GO:0032002)	interleukin-28 receptor binding (GO:0032003)|receptor binding (GO:0005102)										TGGAGGCATCTGTCACCTTCA	0.617																																																	0								ENSG00000182393						108.0	107.0	107.0					19																	39789057		2203	4300	6503	IFNL1	SO:0001819	synonymous_variant	0			-	HGNC	AY129150	CCDS12531.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000182393	ENSG00000182393		"""Interferons"""	18363	protein-coding gene	gene with protein product		607403	"""interleukin 29"", ""interleukin 29 (interferon, lambda 1)"""	IL29			Standard	NM_172140		Approved	IL-29	uc002okv.3	Q8IU54		ENST00000333625.2:c.504T>A	19.37:g.39789057T>A		Somatic	0	158	0.00		0.5538374756952343	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	54	47.66	A0AV25|Q17R34	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S168	ENST00000333625.2	37	c.504	CCDS12531.1	19																																																																																			-	NULL		0.617	IFNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNL1	protein_coding	OTTHUMT00000463834.1	T	NM_172140	-		39789057	+1	no_errors	ENST00000333625	ensembl	human	known	74_37	silent	SNP	0.881	A
