#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HERC1	8925	genome.wustl.edu	37	15	63928318	63928318	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr15:63928318T>C	ENST00000443617.2	-	65	12343	c.12256A>G	c.(12256-12258)Act>Gct	p.T4086A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4086					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CCACAGGAAGTCACCAGCTGG	0.493																																																	0								ENSG00000103657						112.0	111.0	112.0					15																	63928318		2022	4178	6200	HERC1	SO:0001583	missense	0			-	HGNC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.12256A>G	15.37:g.63928318T>C	ENSP00000390158:p.Thr4086Ala	Somatic	0	67	0.00		0.5443053923928768	37	51.95	40	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	34	52.11	Q8IW65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.T4086A	ENST00000443617.2	37	c.12256	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178435	0.57692	.	.	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.58	4.44	0.53790	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	N	0.12471	0.22	0.58432	D	0.999994	B	0.26363	0.147	B	0.25405	0.06	T	0.05099	-1.0906	10	0.48119	T	0.1	.	12.1782	0.54198	0.1283:0.0:0.0:0.8717	.	4086	Q15751	HERC1_HUMAN	A	4086	ENSP00000390158:T4086A	ENSP00000390158:T4086A	T	-	1	0	HERC1	61715371	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.997000	0.88414	1.024000	0.39682	-0.333000	0.08304	ACT	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.493	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	protein_coding	OTTHUMT00000418523.1	T	NM_003922	-		63928318	-1	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	SNP	1.000	C
MAML2	84441	genome.wustl.edu	37	11	95826234	95826234	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr11:95826234T>A	ENST00000524717.1	-	2	2245	c.961A>T	c.(961-963)Atg>Ttg	p.M321L		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	321					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				AGGTCACTCATGGGAGGCACA	0.468			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0								ENSG00000184384						149.0	141.0	144.0					11																	95826234		2048	4205	6253	MAML2	SO:0001583	missense	0			-	HGNC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.961A>T	11.37:g.95826234T>A	ENSP00000434552:p.Met321Leu	Somatic	0	48	0.00		0.5443053923928768	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neuroggenic_mastermind-like_N	p.M321L	ENST00000524717.1	37	c.961	CCDS44714.1	11	.	.	.	.	.	.	.	.	.	.	T	3.670	-0.067767	0.07228	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.38077	1.16;1.16	5.42	2.95	0.34219	.	0.061986	0.64402	N	0.000004	T	0.24314	0.0589	N	0.25647	0.755	0.35502	D	0.799891	B	0.12013	0.005	B	0.09377	0.004	T	0.14811	-1.0459	10	0.25751	T	0.34	-9.7513	11.9432	0.52913	0.0:0.0:0.2759:0.7241	.	321	Q8IZL2	MAML2_HUMAN	L	321	ENSP00000434552:M321L;ENSP00000412394:M321L	ENSP00000412394:M321L	M	-	1	0	MAML2	95465882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.711000	0.54868	0.298000	0.22638	0.374000	0.22700	ATG	-	NULL		0.468	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	protein_coding	OTTHUMT00000395540.1	T		-		95826234	-1	no_errors	ENST00000524717	ensembl	human	known	74_37	missense	SNP	0.997	A
LRRD1	401387	genome.wustl.edu	37	7	91771742	91771742	+	IGR	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr7:91771742C>T	ENST00000458448.1	-	0	2830				CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000343318.5_3'UTR|LRRD1_ENST00000422722.1_Intron			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1						signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						ACACACTGTGCATGATATACC	0.428																																																	0								ENSG00000188693																																			CTB-161K23.1	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861		7.37:g.91771742C>T		Somatic	0	27	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B7ZMM9|Q49AT9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000458448.1	37	NULL	CCDS55124.1	7																																																																																			-	-		0.428	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000188693	protein_coding	OTTHUMT00000342027.2	C	NM_001045475	-		91771742	+1	no_errors	ENST00000453068	ensembl	human	known	74_37	rna	SNP	0.005	T
DTX1	1840	genome.wustl.edu	37	12	113532615	113532615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:113532615C>T	ENST00000257600.3	+	6	1752	c.1249C>T	c.(1249-1251)Cga>Tga	p.R417*	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	417					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CTGCATGGAGCGACTGGTCAC	0.667																																																	0								ENSG00000135144						38.0	35.0	36.0					12																	113532615		2203	4300	6503	DTX1	SO:0001587	stop_gained	0			-	HGNC	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1249C>T	12.37:g.113532615C>T	ENSP00000257600:p.Arg417*	Somatic	0	33	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	O60630|Q9BS04	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.R417*	ENST00000257600.3	37	c.1249	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	C	41	8.833927	0.98970	.	.	ENSG00000135144	ENST00000257600	.	.	.	4.14	2.28	0.28536	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8401	7.5747	0.27928	0.1637:0.7445:0.0:0.0917	.	.	.	.	X	417	.	ENSP00000257600:R417X	R	+	1	2	DTX1	112016998	1.000000	0.71417	0.976000	0.42696	0.813000	0.45954	1.095000	0.30964	0.225000	0.20959	-0.493000	0.04662	CGA	-	smart_Znf_RING,pfscan_Znf_RING		0.667	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	protein_coding	OTTHUMT00000405045.2	C		-		113532615	+1	no_errors	ENST00000257600	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TRDN	10345	genome.wustl.edu	37	6	123869712	123869712	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr6:123869712C>T	ENST00000398178.3	-	3	299	c.278G>A	c.(277-279)cGt>cAt	p.R93H	TRDN_ENST00000542443.1_Missense_Mutation_p.R93H|TRDN_ENST00000334268.4_Missense_Mutation_p.R93H|TRDN_ENST00000546248.1_Missense_Mutation_p.R93H	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	93					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CATAGCATCACGTACCAGTTT	0.348																																																	0								ENSG00000186439						51.0	50.0	51.0					6																	123869712		1838	4088	5926	TRDN	SO:0001583	missense	0			-	HGNC	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.278G>A	6.37:g.123869712C>T	ENSP00000381240:p.Arg93His	Somatic	0	51	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom	p.R93H	ENST00000398178.3	37	c.278	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	3.283	-0.146547	0.06627	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.62105	1.28;1.28;1.21;0.05	5.29	4.12	0.48240	Aspartyl beta-hydroxylase/Triadin domain (1);	0.526840	0.20624	N	0.088713	T	0.05090	0.0136	N	0.00082	-2.215	0.21220	N	0.999756	B;B;B;B;B	0.17667	0.0;0.023;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.42965	-0.9420	10	0.02654	T	1	-3.3496	9.6367	0.39811	0.0:0.0799:0.0:0.9201	.	93;93;93;93;93	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	H	93	ENSP00000381240:R93H;ENSP00000333984:R93H;ENSP00000439281:R93H;ENSP00000437684:R93H	ENSP00000333984:R93H	R	-	2	0	TRDN	123911411	1.000000	0.71417	0.947000	0.38551	0.729000	0.41735	3.264000	0.51553	0.845000	0.35118	-0.238000	0.12139	CGT	-	pfam_Asp-B-hydro/Triadin_dom		0.348	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	protein_coding		C		-		123869712	-1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	SNP	0.983	T
A3GALT2	127550	genome.wustl.edu	37	1	33777708	33777708	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:33777708G>T	ENST00000442999.3	-	4	279	c.280C>A	c.(280-282)Caa>Aaa	p.Q94K	RP11-415J8.3_ENST00000587696.1_RNA|RP11-415J8.3_ENST00000457957.2_RNA|RP11-415J8.3_ENST00000588828.1_RNA|A3GALT2_ENST00000330379.5_Missense_Mutation_p.Q39K	NM_001080438.1	NP_001073907.1			alpha 1,3-galactosyltransferase 2														Myeloproliferative disorder(586;0.0393)				CTAGCCTCTTGCTTGGCCACA	0.592																																																	0								ENSG00000184389						51.0	56.0	55.0					1																	33777708		1979	4150	6129	A3GALT2	SO:0001583	missense	0			-	HGNC		CCDS60080.1	1p35.1	2013-09-05	2013-03-11	2013-03-11	ENSG00000184389	ENSG00000184389		"""Glycosyltransferase family 6 domain containing"""	30005	protein-coding gene	gene with protein product	"""iGb3 synthase"", ""isoglobotriaosylceramide synthase"""		"""alpha 1,3-galactosyltransferase 2, pseudogene"""	A3GALT2P		10854427, 18630988	Standard	NM_001080438		Approved	IGBS3S	uc031plq.1		OTTHUMG00000004125	ENST00000442999.3:c.280C>A	1.37:g.33777708G>T	ENSP00000475261:p.Gln94Lys	Somatic	0	84	0.00		0.5443053923928768	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_6	p.Q94K	ENST00000442999.3	37	c.280		1																																																																																			-	pfam_Glyco_trans_6		0.592	A3GALT2-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	A3GALT2	protein_coding	OTTHUMT00000011861.3	G	NM_001080438	-		33777708	-1	no_errors	ENST00000442999	ensembl	human	novel	74_37	missense	SNP	0.001	T
SWAP70	23075	genome.wustl.edu	37	11	9769442	9769442	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr11:9769442G>T	ENST00000318950.6	+	10	1496	c.1393G>T	c.(1393-1395)Gaa>Taa	p.E465*	SWAP70_ENST00000447399.2_Nonsense_Mutation_p.E407*	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	465					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		GGCTGAACTAGAAAAGTGGCA	0.552																																																	0								ENSG00000133789						98.0	99.0	98.0					11																	9769442		2201	4294	6495	SWAP70	SO:0001587	stop_gained	0			-	HGNC	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1393G>T	11.37:g.9769442G>T	ENSP00000315630:p.Glu465*	Somatic	0	83	0.00		0.5443053923928768	103	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_EF_hand_dom,pfscan_Pleckstrin_homology	p.E465*	ENST00000318950.6	37	c.1393	CCDS31426.1	11	.	.	.	.	.	.	.	.	.	.	G	38	7.114442	0.98074	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-22.9032	19.8834	0.96906	0.0:0.0:1.0:0.0	.	.	.	.	X	407;465	.	ENSP00000315630:E465X	E	+	1	0	SWAP70	9726018	1.000000	0.71417	0.966000	0.40874	0.991000	0.79684	9.352000	0.97076	2.694000	0.91930	0.655000	0.94253	GAA	-	NULL		0.552	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWAP70	protein_coding	OTTHUMT00000386766.2	G	NM_015055	-		9769442	+1	no_errors	ENST00000318950	ensembl	human	known	74_37	nonsense	SNP	1.000	T
COPE	11316	genome.wustl.edu	37	19	19021743	19021748	+	Intron	DEL	CCCGCG	CCCGCG	-	rs370096329|rs375855893		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	CCCGCG	CCCGCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:19021743_19021748delCCCGCG	ENST00000262812.4	-	3	339				COPE_ENST00000600932.1_Intron|COPE_ENST00000349893.4_Intron|COPE_ENST00000598969.1_5'UTR|COPE_ENST00000351079.4_Intron|AC002985.3_ENST00000596918.1_Intron	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon						COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						TGAAGATGGCCCCGCGCCTCAGGCCA	0.66																																																	0								ENSG00000105669																																			COPE	SO:0001627	intron_variant	0				HGNC	AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.290+31CGCGGG>-	19.37:g.19021743_19021748delCCCGCG		Somatic	NA	NA	NA		0.5443053923928768	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262812.4	37	NULL	CCDS12387.1	19																																																																																			-	-		0.660	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPE	protein_coding	OTTHUMT00000464801.1	CCCGCG	NM_007263			19021748	-1	no_errors	ENST00000597646	ensembl	human	known	74_37	rna	DEL	0.003:0.001:0.002:0.002:0.015:0.028	-
FAR2P1	440905	genome.wustl.edu	37	2	130807905	130807905	+	RNA	SNP	G	G	T	rs201541587	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:130807905G>T	ENST00000325390.3	-	0	799					NR_026758.1																						ATGGAAGAGTGCTCAGTGAGA	0.562													.|||	2719	0.542931	0.4523	0.6671	5008	,	,		21515	0.5208		0.5845	False		,,,				2504	0.5573																0								ENSG00000180178																																			AC018865.8			0			-	Clone_based_vega_gene																													2.37:g.130807905G>T		Somatic	0	32	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			-	-		0.562	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	pseudogene	OTTHUMT00000331630.3	G		rs201541587		130807905	-1	no_errors	ENST00000325390	ensembl	human	known	74_37	rna	SNP	0.233	T
PTCHD1	139411	genome.wustl.edu	37	X	23398042	23398042	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chrX:23398042G>T	ENST00000379361.4	+	2	1546	c.686G>T	c.(685-687)tGg>tTg	p.W229L		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	229					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GCTGAGAGGTGGGAGTCCAGC	0.502																																																	0								ENSG00000165186						211.0	196.0	201.0					X																	23398042		2203	4300	6503	PTCHD1	SO:0001583	missense	0			-	HGNC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.686G>T	X.37:g.23398042G>T	ENSP00000368666:p.Trp229Leu	Somatic	0	77	0.00		0.5443053923928768	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.W229L	ENST00000379361.4	37	c.686	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622891	0.87460	.	.	ENSG00000165186	ENST00000379361	D	0.87103	-2.21	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.92916	0.7746	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;0.989	D;D	0.97110	1.0;0.978	D	0.93378	0.6741	10	0.66056	D	0.02	.	18.4327	0.90632	0.0:0.0:1.0:0.0	.	124;229	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	L	229	ENSP00000368666:W229L	ENSP00000368666:W229L	W	+	2	0	PTCHD1	23307963	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.420000	0.97426	2.381000	0.81170	0.600000	0.82982	TGG	-	pfam_Patched		0.502	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	protein_coding	OTTHUMT00000056047.2	G	NM_173495	-		23398042	+1	no_errors	ENST00000379361	ensembl	human	known	74_37	missense	SNP	1.000	T
C20orf96	140680	genome.wustl.edu	37	20	257695	257695	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr20:257695G>T	ENST00000360321.2	-	8	953	c.815C>A	c.(814-816)tCt>tAt	p.S272Y	C20orf96_ENST00000400269.3_Missense_Mutation_p.S214Y|C20orf96_ENST00000382369.5_Missense_Mutation_p.S237Y	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	272										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CGCCACCACAGAACTCAGAAT	0.572																																																	0								ENSG00000196476						127.0	142.0	137.0					20																	257695		2203	4300	6503	C20orf96	SO:0001583	missense	0			-	HGNC	AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.815C>A	20.37:g.257695G>T	ENSP00000353470:p.Ser272Tyr	Somatic	0	38	0.00		0.5443053923928768	117	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S272Y	ENST00000360321.2	37	c.815	CCDS12994.1	20	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373354	0.42105	.	.	ENSG00000196476	ENST00000382369;ENST00000360321;ENST00000400269	T;T;T	0.49432	0.78;0.78;0.78	4.52	0.058	0.14326	.	1.057790	0.07345	N	0.881393	T	0.57403	0.2051	L	0.53249	1.67	0.09310	N	1	D;D;D;D	0.76494	0.995;0.999;0.998;0.998	P;D;D;D	0.63381	0.885;0.914;0.914;0.914	T	0.46707	-0.9172	10	0.87932	D	0	7.8269	6.1059	0.20073	0.4852:0.0:0.5148:0.0	.	214;237;272;237	F5GZA9;B7Z971;Q9NUD7;Q5JYC3	.;.;CT096_HUMAN;.	Y	237;272;214	ENSP00000371806:S237Y;ENSP00000353470:S272Y;ENSP00000383128:S214Y	ENSP00000353470:S272Y	S	-	2	0	C20orf96	205695	0.004000	0.15560	0.011000	0.14972	0.149000	0.21700	0.877000	0.28106	0.177000	0.19895	0.313000	0.20887	TCT	-	NULL		0.572	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf96	protein_coding	OTTHUMT00000077439.2	G	NM_153269	-		257695	-1	no_errors	ENST00000360321	ensembl	human	known	74_37	missense	SNP	0.001	T
TRAPPC13	80006	genome.wustl.edu	37	5	64954317	64954317	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:64954317A>T	ENST00000399438.3	+	9	1032	c.687A>T	c.(685-687)caA>caT	p.Q229H	TRAPPC13_ENST00000505553.1_Missense_Mutation_p.Q223H|TRAPPC13_ENST00000438419.2_Missense_Mutation_p.Q229H|TRAPPC13_ENST00000231526.4_Missense_Mutation_p.Q223H|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.Q230H	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	229																	CAGTCAGCCAAGCTGGAGAAT	0.333																																																	0								ENSG00000113597						52.0	46.0	48.0					5																	64954317		1801	4067	5868	TRAPPC13	SO:0001583	missense	0			-	HGNC		CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.687A>T	5.37:g.64954317A>T	ENSP00000382367:p.Gln229His	Somatic	0	40	0.00		0.5443053923928768	97	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF974	p.Q230H	ENST00000399438.3	37	c.690	CCDS47222.1	5	.	.	.	.	.	.	.	.	.	.	A	13.16	2.153119	0.38021	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.52	1.44	0.22558	.	0.414518	0.26711	N	0.022883	T	0.19604	0.0471	N	0.08118	0	0.28704	N	0.903904	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.10800	-1.0614	9	0.48119	T	0.1	-0.1798	6.4855	0.22087	0.6384:0.2254:0.1362:0.0	.	223;223;229;229	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	H	229;229;223;223;230	.	ENSP00000231526:Q223H	Q	+	3	2	C5orf44	64990073	0.039000	0.19947	1.000000	0.80357	0.962000	0.63368	0.362000	0.20284	0.440000	0.26502	0.528000	0.53228	CAA	-	pfam_DUF974		0.333	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRAPPC13	protein_coding	OTTHUMT00000370113.1	A	NM_024941	-		64954317	+1	no_errors	ENST00000545191	ensembl	human	known	74_37	missense	SNP	0.991	T
C14orf182	283551	genome.wustl.edu	37	14	50470549	50470550	+	5'UTR	INS	-	-	TT	rs59311143|rs561143441|rs397713302	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr14:50470549_50470550insTT	ENST00000529902.1	-	0	2687_2688				C14orf182_ENST00000399206.1_Intron			A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182											large_intestine(2)|urinary_tract(1)	3						AGGGAAGTGGCTTTTTTTTTTT	0.45																																																	0								ENSG00000214900																																			C14orf182	SO:0001623	5_prime_UTR_variant	0				HGNC	AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000529902.1:c.-1592->AA	14.37:g.50470558_50470559dupTT		Somatic	0	37	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A8MYX4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000529902.1	37	NULL		14																																																																																			-	-		0.450	C14orf182-004	KNOWN	basic	processed_transcript	C14orf182	protein_coding	OTTHUMT00000395721.1	-	NM_001012706			50470550	-1	no_errors	ENST00000529902	ensembl	human	known	74_37	rna	INS	0.000:0.000	TT
ZEB2	9839	genome.wustl.edu	37	2	145277515	145277515	+	5'UTR	SNP	C	C	G			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:145277515C>G	ENST00000558170.2	-	0	1106				ZEB2-AS1_ENST00000610265.1_RNA|ZEB2-AS1_ENST00000609842.1_RNA|ZEB2-AS1_ENST00000609376.1_RNA|ZEB2-AS1_ENST00000421083.1_RNA|ZEB2_ENST00000539609.3_5'UTR|ZEB2_ENST00000409487.3_5'Flank|ZEB2_ENST00000465070.1_5'UTR|ZEB2-AS1_ENST00000609819.1_RNA|ZEB2_ENST00000303660.4_5'UTR|ZEB2-AS1_ENST00000428623.1_RNA|ZEB2-AS1_ENST00000595109.1_RNA|ZEB2_ENST00000470879.1_5'Flank|ZEB2-AS1_ENST00000602006.1_RNA|ZEB2-AS1_ENST00000608361.1_RNA|ZEB2_ENST00000462355.1_5'Flank|ZEB2-AS1_ENST00000595449.1_RNA|ZEB2_ENST00000493689.1_5'Flank|ZEB2-AS1_ENST00000427278.3_RNA	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2						cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCTGCGAAGTCTTGTTTGTAG	0.443											OREG0015003	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(33;1235 1264 5755 16332)												0								ENSG00000238057																																			ZEB2-AS1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.-79G>C	2.37:g.145277515C>G		Somatic	0	81	0.00	1693	0.5443053923928768	18	40.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	34	38.18	A0JP09|B7Z2P2|F5H814|Q9UED1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000558170.2	37	NULL	CCDS2186.1	2																																																																																			-	-		0.443	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2-AS1	protein_coding	OTTHUMT00000254778.5	C	NM_014795	-		145277515	+1	no_errors	ENST00000421083	ensembl	human	known	74_37	rna	SNP	1.000	G
ASUN	55726	genome.wustl.edu	37	12	27078722	27078722	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:27078722C>T	ENST00000261191.7	-	6	1183	c.647G>A	c.(646-648)aGc>aAc	p.S216N	ASUN_ENST00000539625.1_Missense_Mutation_p.S115N	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	216					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											AGATACAAGGCTGTCTTCACC	0.318																																																	0								ENSG00000064102						111.0	109.0	109.0					12																	27078722		2203	4300	6503	ASUN	SO:0001583	missense	0			-	HGNC	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.647G>A	12.37:g.27078722C>T	ENSP00000261191:p.Ser216Asn	Somatic	0	46	0.00		0.5443053923928768	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_cycle_regulator_Mat89Bb	p.S216N	ENST00000261191.7	37	c.647	CCDS8708.1	12	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253235	0.59212	.	.	ENSG00000064102	ENST00000261191;ENST00000539625;ENST00000538727;ENST00000544548	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.65	5.65	0.86999	.	0.043099	0.85682	D	0.000000	T	0.43322	0.1242	N	0.21448	0.665	0.58432	D	0.999998	P	0.37914	0.611	B	0.41036	0.346	T	0.36456	-0.9747	10	0.51188	T	0.08	-13.4314	20.1002	0.97872	0.0:1.0:0.0:0.0	.	216	Q9NVM9	M89BB_HUMAN	N	216;115;115;216	ENSP00000261191:S216N;ENSP00000443724:S115N;ENSP00000448467:S115N;ENSP00000446183:S216N	ENSP00000261191:S216N	S	-	2	0	C12orf11	26969989	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.743000	0.68655	2.833000	0.97629	0.585000	0.79938	AGC	-	pfam_Cell_cycle_regulator_Mat89Bb		0.318	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASUN	protein_coding	OTTHUMT00000402819.1	C	NM_018164	-		27078722	-1	no_errors	ENST00000261191	ensembl	human	known	74_37	missense	SNP	1.000	T
PM20D1	148811	genome.wustl.edu	37	1	205819093	205819093	+	Silent	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:205819093C>T	ENST00000367136.4	-	1	152	c.108G>A	c.(106-108)gcG>gcA	p.A36A	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	36					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GGATTCGCGACGCCCTTTGAT	0.592																																																	0								ENSG00000162877						89.0	91.0	90.0					1																	205819093		2203	4300	6503	PM20D1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.108G>A	1.37:g.205819093C>T		Somatic	0	63	0.00		0.5443053923928768	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	Q6P4E3|Q96DM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer	p.A36	ENST00000367136.4	37	c.108	CCDS1460.1	1																																																																																			-	NULL		0.592	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D1	protein_coding	OTTHUMT00000087736.1	C	NM_152491	-		205819093	-1	no_errors	ENST00000367136	ensembl	human	known	74_37	silent	SNP	0.000	T
A2ML1	144568	genome.wustl.edu	37	12	8997981	8997981	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:8997981T>C	ENST00000540049.1	+	0	103				A2ML1_ENST00000299698.7_Intron|A2ML1_ENST00000539547.1_Intron					alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGGAAGTTGGTCCAAGGTGAA	0.448																																																	0								ENSG00000166535						57.0	55.0	56.0					12																	8997981		692	1591	2283	A2ML1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000540049.1:c.*100T>C	12.37:g.8997981T>C		Somatic	0	44	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000540049.1	37	NULL		12																																																																																			-	-		0.448	A2ML1-010	KNOWN	upstream_uORF|basic	processed_transcript	A2ML1	protein_coding	OTTHUMT00000395960.1	T	NM_144670	-		8997981	+1	no_errors	ENST00000540049	ensembl	human	known	74_37	rna	SNP	0.000	C
GPR141	353345	genome.wustl.edu	37	7	37780183	37780183	+	Missense_Mutation	SNP	G	G	T	rs372117075		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr7:37780183G>T	ENST00000447769.1	+	4	477	c.188G>T	c.(187-189)aGc>aTc	p.S63I	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.S63I|GPR141_ENST00000461610.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTGGTCCACAGCGTTTTTCTG	0.517																																																	0								ENSG00000187037						99.0	93.0	95.0					7																	37780183		2203	4300	6503	GPR141	SO:0001583	missense	0			-	HGNC	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.188G>T	7.37:g.37780183G>T	ENSP00000390410:p.Ser63Ile	Somatic	0	31	0.00		0.5443053923928768	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S63I	ENST00000447769.1	37	c.188	CCDS5451.1	7	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292236	0.23564	.	.	ENSG00000187037	ENST00000450180;ENST00000447769;ENST00000334425	T;T;T	0.32023	1.47;1.47;1.47	5.27	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.257927	0.41097	D	0.000949	T	0.29028	0.0721	L	0.46157	1.445	0.80722	D	1	P	0.40681	0.727	B	0.39503	0.301	T	0.03193	-1.1062	10	0.25106	T	0.35	-3.7436	15.3383	0.74277	0.0:0.1403:0.8597:0.0	.	63	Q7Z602	GP141_HUMAN	I	63	ENSP00000396300:S63I;ENSP00000390410:S63I;ENSP00000334540:S63I	ENSP00000334540:S63I	S	+	2	0	GPR141	37746708	1.000000	0.71417	0.119000	0.21687	0.964000	0.63967	5.791000	0.69045	1.334000	0.45468	0.650000	0.86243	AGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.517	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	protein_coding	OTTHUMT00000219943.2	G	NM_181791	-		37780183	+1	no_errors	ENST00000334425	ensembl	human	known	74_37	missense	SNP	0.946	T
MIR3687-2	103504728	genome.wustl.edu	37	21	9825966	9825966	+	RNA	SNP	A	A	C	rs544334327		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr21:9825966A>C	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						GCCGCGCTCGAGGGGTCCCCG	0.816																																																	0								ENSG00000264462																																			MIR3648			0			-	HGNC																													21.37:g.9825966A>C		Somatic	0	17	0.00		0.5443053923928768	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			-	-		0.816	MIR3687-201	KNOWN	basic	miRNA	MIR3648	miRNA		A		rs1796672		9825966	+1	no_errors	ENST00000581792	ensembl	human	known	74_37	rna	SNP	0.050	C
EXOC6	54536	genome.wustl.edu	37	10	94773974	94773974	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr10:94773974C>T	ENST00000260762.6	+	20	2133	c.2119C>T	c.(2119-2121)Cca>Tca	p.P707S	EXOC6_ENST00000443748.2_Missense_Mutation_p.P604S|EXOC6_ENST00000371552.4_Missense_Mutation_p.P702S|EXOC6_ENST00000371547.4_Missense_Mutation_p.P723S	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	707					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				TGAGCCTGTGCCAGGATTCCA	0.363																																																	0								ENSG00000138190						84.0	85.0	85.0					10																	94773974		2203	4300	6503	EXOC6	SO:0001583	missense	0			-	HGNC	BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.2119C>T	10.37:g.94773974C>T	ENSP00000260762:p.Pro707Ser	Somatic	0	47	0.00		0.5443053923928768	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec15,pirsf_Sec15	p.P723S	ENST00000260762.6	37	c.2167	CCDS7424.2	10	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035868	0.75617	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762;ENST00000458552	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.51	4.59	0.56863	.	0.117723	0.64402	D	0.000015	T	0.53417	0.1795	M	0.78801	2.425	0.80722	D	1	P;D;P;P;P;P	0.55172	0.83;0.97;0.633;0.633;0.763;0.902	P;P;P;P;P;P	0.60068	0.573;0.868;0.507;0.61;0.507;0.643	T	0.58741	-0.7583	10	0.52906	T	0.07	-9.4594	15.6428	0.77020	0.1386:0.8614:0.0:0.0	.	723;604;699;660;707;702	F2Z2Q3;E7EW84;B4DEZ1;B2RDH5;Q8TAG9;E9PHI3	.;.;.;.;EXOC6_HUMAN;.	S	723;702;604;707;56	ENSP00000360602:P723S;ENSP00000360607:P702S;ENSP00000396206:P604S;ENSP00000260762:P707S;ENSP00000398982:P56S	ENSP00000260762:P707S	P	+	1	0	EXOC6	94763954	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.238000	0.78173	1.295000	0.44724	-0.321000	0.08615	CCA	-	pfam_Sec15,pirsf_Sec15		0.363	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	protein_coding	OTTHUMT00000049410.2	C	NM_019053	-		94773974	+1	no_errors	ENST00000371547	ensembl	human	known	74_37	missense	SNP	1.000	T
USP32	84669	genome.wustl.edu	37	17	58379033	58379033	+	Silent	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr17:58379033T>C	ENST00000300896.4	-	3	413	c.219A>G	c.(217-219)aaA>aaG	p.K73K	USP32_ENST00000586881.1_5'UTR|USP32_ENST00000393003.3_Silent_p.K73K	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	73					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AGTGCAGCCCTTTGGATGTTC	0.368																																																	0								ENSG00000170832						85.0	83.0	84.0					17																	58379033		2203	4300	6503	USP32	SO:0001819	synonymous_variant	0			-	HGNC	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.219A>G	17.37:g.58379033T>C		Somatic	0	64	0.00		0.5443053923928768	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_EF_hand_dom,smart_Pept_C19_DUSP,pfscan_EF_hand_dom,pfscan_Peptidase_C19/C67,prints_Recoverin	p.K73	ENST00000300896.4	37	c.219	CCDS32697.1	17																																																																																			-	NULL		0.368	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	protein_coding	OTTHUMT00000449235.2	T	NM_032582	-		58379033	-1	no_errors	ENST00000300896	ensembl	human	known	74_37	silent	SNP	1.000	C
SLC6A20	54716	genome.wustl.edu	37	3	45807258	45807258	+	Intron	DEL	T	T	-			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr3:45807258delT	ENST00000358525.4	-	8	1214				SLC6A20_ENST00000456124.2_Intron|SLC6A20_ENST00000353278.4_Intron|SLC6A20_ENST00000493980.1_5'UTR	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		AAGACACCAGTTACATGCAAG	0.527																																																	0								ENSG00000163817						79.0	68.0	71.0					3																	45807258		2203	4300	6503	SLC6A20	SO:0001627	intron_variant	0				HGNC	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.1099-25A>-	3.37:g.45807258delT		Somatic	0	42	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358525.4	37	NULL	CCDS43077.1	3																																																																																			-	-		0.527	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A20	protein_coding	OTTHUMT00000257318.3	T	NM_020208			45807258	-1	no_errors	ENST00000493980	ensembl	human	putative	74_37	rna	DEL	0.231	-
ACSM3	6296	genome.wustl.edu	37	16	20803613	20803613	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr16:20803613G>A	ENST00000289416.5	+	12	1985	c.1510G>A	c.(1510-1512)Gca>Aca	p.A504T	ACSM3_ENST00000567387.1_3'UTR|ACSM3_ENST00000450120.2_Missense_Mutation_p.A496T|ERI2_ENST00000300005.3_Intron	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	504					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						CCCTTCAGTTGCAGAGTCAGC	0.423																																																	0								ENSG00000005187						249.0	255.0	253.0					16																	20803613		2201	4300	6501	ACSM3	SO:0001583	missense	0			-	HGNC	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.1510G>A	16.37:g.20803613G>A	ENSP00000289416:p.Ala504Thr	Somatic	0	58	0.00		0.5443053923928768	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.A504T	ENST00000289416.5	37	c.1510	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639091	0.47153	.	.	ENSG00000005187	ENST00000289416;ENST00000450120	T;T	0.62105	0.05;0.05	5.5	0.937	0.19494	AMP-dependent synthetase/ligase (1);	0.815509	0.11196	N	0.589382	T	0.63510	0.2517	M	0.74467	2.265	0.09310	N	0.999999	P;P	0.35307	0.494;0.494	B;B	0.43155	0.41;0.297	T	0.57476	-0.7805	10	0.49607	T	0.09	-31.662	5.0029	0.14273	0.0645:0.2099:0.4003:0.3254	.	496;504	E7ETR5;Q53FZ2	.;ACSM3_HUMAN	T	504;496	ENSP00000289416:A504T;ENSP00000395297:A496T	ENSP00000289416:A504T	A	+	1	0	ACSM3	20711114	0.001000	0.12720	0.612000	0.29024	0.993000	0.82548	0.996000	0.29719	0.626000	0.30322	0.555000	0.69702	GCA	-	pfam_AMP-dep_Synth/Lig		0.423	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	protein_coding	OTTHUMT00000254414.2	G	NM_005622	-		20803613	+1	no_errors	ENST00000289416	ensembl	human	known	74_37	missense	SNP	0.005	A
PC	5091	genome.wustl.edu	37	11	66617484	66617484	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr11:66617484G>T	ENST00000393958.2	-	19	2915	c.2822C>A	c.(2821-2823)cCc>cAc	p.P941H	PC_ENST00000393955.2_Missense_Mutation_p.P941H|PC_ENST00000529047.1_Missense_Mutation_p.P61H|PC_ENST00000393960.1_Missense_Mutation_p.P941H|PC_ENST00000528224.1_5'Flank	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	941					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CACGGAGCGGGGAAAGGACAG	0.627																																																	0								ENSG00000173599						64.0	62.0	63.0					11																	66617484		2200	4295	6495	PC	SO:0001583	missense	0			-	HGNC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2822C>A	11.37:g.66617484G>T	ENSP00000377530:p.Pro941His	Somatic	0	74	0.00		0.5443053923928768	47	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4DN00|Q16705	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.P941H	ENST00000393958.2	37	c.2822	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773958	0.49786	.	.	ENSG00000173599	ENST00000529047;ENST00000393955;ENST00000393958;ENST00000393960	D;D;D;D	0.96885	-2.27;-4.16;-4.16;-4.16	5.19	5.19	0.71726	Carboxylase, conserved domain (1);	0.108642	0.64402	D	0.000005	D	0.98988	0.9655	H	0.98951	4.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99041	1.0824	10	0.87932	D	0	-35.4721	16.2578	0.82526	0.0:0.0:1.0:0.0	.	941	P11498	PYC_HUMAN	H	61;941;941;941	ENSP00000435905:P61H;ENSP00000377527:P941H;ENSP00000377530:P941H;ENSP00000377532:P941H	ENSP00000377527:P941H	P	-	2	0	PC	66374060	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	9.285000	0.95894	2.705000	0.92388	0.462000	0.41574	CCC	-	pfam_Carboxylase_cons_dom,pirsf_Pyruv_COase,tigrfam_Pyruv_COase		0.627	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	protein_coding	OTTHUMT00000393115.1	G	NM_001040716	-		66617484	-1	no_errors	ENST00000393958	ensembl	human	known	74_37	missense	SNP	1.000	T
EFCAB3	146779	genome.wustl.edu	37	17	60483901	60483901	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr17:60483901G>T	ENST00000305286.3	+	7	627	c.549G>T	c.(547-549)atG>atT	p.M183I	EFCAB3_ENST00000450662.2_Missense_Mutation_p.M235I	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	183							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CCTACACTATGGGCTATGGAA	0.408																																																	0								ENSG00000172421						61.0	56.0	58.0					17																	60483901		2203	4300	6503	EFCAB3	SO:0001583	missense	0			-	HGNC	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.549G>T	17.37:g.60483901G>T	ENSP00000302649:p.Met183Ile	Somatic	0	70	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	J3KQM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_EF_hand_dom	p.M235I	ENST00000305286.3	37	c.705	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	G	4.044	0.005742	0.07866	.	.	ENSG00000172421	ENST00000450662;ENST00000305286	T;T	0.57107	0.42;0.44	4.95	-0.636	0.11508	.	0.812426	0.11371	N	0.570877	T	0.25494	0.0620	N	0.14661	0.345	0.09310	N	1	B	0.22276	0.067	B	0.17433	0.018	T	0.14282	-1.0478	10	0.20046	T	0.44	.	1.0105	0.01496	0.2738:0.1547:0.4126:0.159	.	183	Q8N7B9	EFCB3_HUMAN	I	235;183	ENSP00000403932:M235I;ENSP00000302649:M183I	ENSP00000302649:M183I	M	+	3	0	EFCAB3	57837633	0.021000	0.18746	0.051000	0.19133	0.026000	0.11368	0.008000	0.13197	0.294000	0.22547	0.591000	0.81541	ATG	-	NULL		0.408	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	protein_coding	OTTHUMT00000379114.1	G	NM_173503	-		60483901	+1	no_errors	ENST00000450662	ensembl	human	known	74_37	missense	SNP	0.017	T
POU2F2	5452	genome.wustl.edu	37	19	42626729	42626729	+	Splice_Site	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:42626729C>T	ENST00000526816.2	-	2	44		c.e2-1		POU2F2_ENST00000529952.1_Splice_Site|POU2F2_ENST00000342301.4_Splice_Site|POU2F2_ENST00000529067.1_Splice_Site|POU2F2_ENST00000560558.1_Splice_Site|POU2F2_ENST00000524801.2_Splice_Site|POU2F2_ENST00000389341.5_Splice_Site|POU2F2_ENST00000560398.1_Splice_Site|POU2F2_ENST00000533720.1_Splice_Site			P09086	PO2F2_HUMAN	POU class 2 homeobox 2						cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	ATTCTTATTTCTGGGGACAGA	0.612																																																	0								ENSG00000028277						44.0	45.0	44.0					19																	42626729		2203	4300	6503	POU2F2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.29-1G>A	19.37:g.42626729C>T		Somatic	0	103	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	66	26.67	Q16648|Q7M4M8|Q9BRS4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000526816.2	37	c.29-1	CCDS56095.1	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828167	0.50845	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	.	.	.	3.69	2.62	0.31277	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2156	0.54404	0.0:0.8259:0.1741:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POU2F2	47318569	1.000000	0.71417	0.950000	0.38849	0.985000	0.73830	5.345000	0.65987	0.871000	0.35750	0.484000	0.47621	.	-	-		0.612	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POU2F2	protein_coding	OTTHUMT00000387329.3	C		-	Intron	42626729	-1	no_errors	ENST00000342301	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ZNF608	57507	genome.wustl.edu	37	5	123983157	123983157	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:123983157T>A	ENST00000306315.5	-	4	3355	c.2920A>T	c.(2920-2922)Agt>Tgt	p.S974C	ZNF608_ENST00000504926.1_Missense_Mutation_p.S547C	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	974	Ser-rich.						metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTTACAACACTGTCCTTACTA	0.433																																																	0								ENSG00000168916						178.0	178.0	178.0					5																	123983157		2203	4300	6503	ZNF608	SO:0001583	missense	0			-	HGNC	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2920A>T	5.37:g.123983157T>A	ENSP00000307746:p.Ser974Cys	Somatic	0	47	0.00		0.5443053923928768	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S974C	ENST00000306315.5	37	c.2920	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	T	2.474	-0.321168	0.05386	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.46819	0.86;0.86	5.9	1.46	0.22682	.	0.382752	0.32120	N	0.006550	T	0.42268	0.1195	L	0.44542	1.39	0.09310	N	1	P	0.35481	0.504	B	0.42386	0.386	T	0.35151	-0.9800	10	0.56958	D	0.05	-7.0372	8.381	0.32472	0.0:0.4617:0.0:0.5383	.	974	Q9ULD9	ZN608_HUMAN	C	547;974	ENSP00000427657:S547C;ENSP00000307746:S974C	ENSP00000307746:S974C	S	-	1	0	ZNF608	124011056	0.551000	0.26497	0.008000	0.14137	0.054000	0.15201	1.041000	0.30291	0.402000	0.25451	-0.187000	0.12897	AGT	-	NULL		0.433	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	protein_coding	OTTHUMT00000371300.1	T	XM_114432	-		123983157	-1	no_errors	ENST00000306315	ensembl	human	known	74_37	missense	SNP	0.011	A
DBN1	1627	genome.wustl.edu	37	5	176885489	176885490	+	Frame_Shift_Ins	INS	-	-	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:176885489_176885490insC	ENST00000309007.5	-	12	1564_1565	c.1345_1346insG	c.(1345-1347)gcafs	p.A449fs	DBN1_ENST00000292385.5_Frame_Shift_Ins_p.A451fs|DBN1_ENST00000512501.1_Frame_Shift_Ins_p.A181fs|DBN1_ENST00000393563.4_Frame_Shift_Ins_p.A181fs|DBN1_ENST00000393565.1_Frame_Shift_Ins_p.A495fs	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	449					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGTCAGCTGCATCGTGGATC	0.604																																																	0								ENSG00000113758																																			DBN1	SO:0001589	frameshift_variant	0				HGNC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1346dupG	5.37:g.176885490_176885490dupC	ENSP00000308532:p.Ala449fs	Somatic	0	68	0.00		0.5443053923928768	299	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	A8MV58|B2RBG0|Q9UFZ5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.A451fs	ENST00000309007.5	37	c.1352_1351	CCDS4420.1	5																																																																																			-	NULL		0.604	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	protein_coding	OTTHUMT00000253429.2	-	NM_080881			176885490	-1	no_errors	ENST00000292385	ensembl	human	known	74_37	frame_shift_ins	INS	0.212:0.018	C
FADS1	3992	genome.wustl.edu	37	11	61571200	61571200	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr11:61571200G>A	ENST00000350997.7	-	8	1325	c.1093C>T	c.(1093-1095)Ctc>Ttc	p.L365F	FADS1_ENST00000460649.1_Missense_Mutation_p.L10F|FADS1_ENST00000542506.1_Missense_Mutation_p.L224F|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000433932.1_Missense_Mutation_p.L224F|FADS1_ENST00000536991.1_Missense_Mutation_p.L56F	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	308					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACATAAGTGAGGAAGAAGCGG	0.498																																																	0								ENSG00000149485						92.0	92.0	92.0					11																	61571200		1963	4145	6108	FADS1	SO:0001583	missense	0			-	HGNC		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.1093C>T	11.37:g.61571200G>A	ENSP00000322229:p.Leu365Phe	Somatic	0	46	0.00		0.5443053923928768	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.00	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.L365F	ENST00000350997.7	37	c.1093	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	G	3.776	-0.046613	0.07407	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000536991;ENST00000433932;ENST00000460649;ENST00000542506;ENST00000539999	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.65	1.09	0.20402	Fatty acid desaturase, type 1 (1);	1.605890	0.04366	U	0.358316	T	0.70850	0.3271	L	0.46885	1.475	0.37078	D	0.89884	B	0.06786	0.001	B	0.14578	0.011	T	0.58601	-0.7608	10	0.34782	T	0.22	-11.2382	6.2725	0.20963	0.2174:0.0:0.6387:0.1439	.	308	O60427	FADS1_HUMAN	F	241;365;224;56;224;10;224;94	ENSP00000322229:L365F;ENSP00000439097:L56F;ENSP00000405087:L224F;ENSP00000445253:L10F;ENSP00000441403:L224F;ENSP00000443587:L94F	ENSP00000322229:L365F	L	-	1	0	FADS1	61327776	0.934000	0.31675	0.816000	0.32577	0.050000	0.14768	1.475000	0.35409	0.483000	0.27608	0.650000	0.86243	CTC	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase		0.498	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	protein_coding	OTTHUMT00000347648.2	G	NM_013402	-		61571200	-1	no_errors	ENST00000350997	ensembl	human	known	74_37	missense	SNP	0.631	A
VPS33B	26276	genome.wustl.edu	37	15	91548939	91548939	+	Missense_Mutation	SNP	G	G	A	rs140237411	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr15:91548939G>A	ENST00000333371.3	-	13	1368	c.1015C>T	c.(1015-1017)Cgc>Tgc	p.R339C	VPS33B_ENST00000535843.1_Missense_Mutation_p.R248C|VPS33B_ENST00000535906.1_Missense_Mutation_p.R312C	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	339					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)		p.R339S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTCAGCAGGCGGTGCTCCTGT	0.562																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000184056						94.0	86.0	89.0					15																	91548939		2198	4298	6496	VPS33B	SO:0001583	missense	0			-	HGNC	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1015C>T	15.37:g.91548939G>A	ENSP00000327650:p.Arg339Cys	Somatic	0	42	0.00		0.5443053923928768	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec1-like,superfamily_Sec1-like	p.R339C	ENST00000333371.3	37	c.1015	CCDS10369.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.144741	0.94603	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.81078	-1.45;-1.45;-1.45	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.89019	0.6596	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.967;0.981	D	0.88995	0.3417	10	0.66056	D	0.02	-26.4873	19.2223	0.93803	0.0:0.0:1.0:0.0	.	312;339	F5H008;Q9H267	.;VP33B_HUMAN	C	339;312;248;294	ENSP00000327650:R339C;ENSP00000444053:R312C;ENSP00000446267:R248C	ENSP00000327650:R339C	R	-	1	0	VPS33B	89349943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.654000	0.91092	2.873000	0.98535	0.563000	0.77884	CGC	-	pfam_Sec1-like,superfamily_Sec1-like		0.562	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33B	protein_coding	OTTHUMT00000313496.1	G	NM_018668	-		91548939	-1	no_errors	ENST00000333371	ensembl	human	known	74_37	missense	SNP	1.000	A
TBC1D3P3	653017	genome.wustl.edu	37	17	20451293	20451293	+	lincRNA	SNP	A	A	G	rs374159131		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr17:20451293A>G	ENST00000591705.1	+	0	2610																											GAAGGAAGGAAAGAAGGAAGG	0.542																																																	0								ENSG00000267075																																			RP11-434D2.3			0			-	Clone_based_vega_gene																													17.37:g.20451293A>G		Somatic	0	24	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			-	-		0.542	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	lincRNA	OTTHUMT00000441761.2	A		-		20451293	+1	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	SNP	0.033	G
TPM3	7170	genome.wustl.edu	37	1	154144673	154144674	+	Intron	INS	-	-	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:154144673_154144674insA	ENST00000368530.2	-	5	759				TPM3_ENST00000323144.7_Intron|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000302206.5_Intron|TPM3_ENST00000341372.3_Intron|TPM3_ENST00000328159.4_Intron|TPM3_ENST00000368531.2_Intron|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000330188.9_Intron|TPM3_ENST00000341485.5_Intron|TPM3_ENST00000368533.3_Intron	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					GCAGCAAAACGAAAAAAAAAAA	0.441			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																			Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0								ENSG00000143549																																			TPM3	SO:0001627	intron_variant	0				HGNC	BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.566+709->T	1.37:g.154144684_154144684dupA		Somatic	0	64	0.00		0.5443053923928768	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368530.2	37	NULL	CCDS41403.1	1																																																																																			-	-		0.441	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	protein_coding	OTTHUMT00000087271.2	-	NM_152263			154144674	-1	no_errors	ENST00000469717	ensembl	human	known	74_37	rna	INS	0.012:0.000	A
CAMSAP2	23271	genome.wustl.edu	37	1	200821711	200821711	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:200821711G>T	ENST00000236925.4	+	13	3590	c.3541G>T	c.(3541-3543)Gct>Tct	p.A1181S	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.A1170S|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.A1154S			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1181					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										GAAACGGGCAGCTTTGTTGGA	0.368																																																	0								ENSG00000118200						101.0	97.0	98.0					1																	200821711		2203	4300	6503	CAMSAP2	SO:0001583	missense	0			-	HGNC	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.3541G>T	1.37:g.200821711G>T	ENSP00000236925:p.Ala1181Ser	Somatic	0	37	0.00		0.5443053923928768	114	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.A1181S	ENST00000236925.4	37	c.3541		1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656352	0.88056	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.17528	2.29;2.27;2.28	5.53	5.53	0.82687	.	0.047858	0.85682	D	0.000000	T	0.32346	0.0826	L	0.48174	1.505	0.80722	D	1	P;D;D	0.59357	0.929;0.974;0.985	P;P;P	0.57846	0.666;0.677;0.828	T	0.00465	-1.1723	10	0.33940	T	0.23	-22.9316	19.4697	0.94958	0.0:0.0:1.0:0.0	.	1154;1181;1170	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	S	1170;1154;1181	ENSP00000351684:A1170S;ENSP00000416800:A1154S;ENSP00000236925:A1181S	ENSP00000236925:A1181S	A	+	1	0	CAMSAP1L1	199088334	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.340000	0.79292	2.579000	0.87056	0.650000	0.86243	GCT	-	NULL		0.368	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	protein_coding	OTTHUMT00000086956.2	G	NM_203459	-		200821711	+1	no_errors	ENST00000236925	ensembl	human	known	74_37	missense	SNP	1.000	T
YTHDC2	64848	genome.wustl.edu	37	5	112868613	112868613	+	Missense_Mutation	SNP	G	G	T	rs148801229		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:112868613G>T	ENST00000161863.4	+	5	926	c.713G>T	c.(712-714)gGt>gTt	p.G238V	YTHDC2_ENST00000515883.1_Missense_Mutation_p.G238V	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	238	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TTTAAAAATGGTATCCCCTGC	0.383																																																	0								ENSG00000047188						108.0	115.0	113.0					5																	112868613		2202	4300	6502	YTHDC2	SO:0001583	missense	0			-	HGNC	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.713G>T	5.37:g.112868613G>T	ENSP00000161863:p.Gly238Val	Somatic	0	56	0.00		0.5443053923928768	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B2RP66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G238V	ENST00000161863.4	37	c.713	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581102	0.46006	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.39229	1.09;1.09	5.63	4.75	0.60458	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.583756	0.18332	N	0.144444	T	0.67420	0.2891	M	0.91090	3.175	0.80722	D	1	D	0.64830	0.994	P	0.61658	0.892	T	0.73701	-0.3900	10	0.72032	D	0.01	.	12.2683	0.54691	0.078:0.0:0.922:0.0	.	238	Q9H6S0	YTDC2_HUMAN	V	238;238;148	ENSP00000161863:G238V;ENSP00000423101:G238V	ENSP00000161863:G238V	G	+	2	0	YTHDC2	112896512	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.133000	0.50531	2.656000	0.90262	0.460000	0.39030	GGT	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.383	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	protein_coding	OTTHUMT00000250776.2	G	NM_022828	-		112868613	+1	no_errors	ENST00000161863	ensembl	human	known	74_37	missense	SNP	0.916	T
STAB1	23166	genome.wustl.edu	37	3	52540712	52540712	+	Missense_Mutation	SNP	G	G	T	rs201076394	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr3:52540712G>T	ENST00000321725.6	+	18	1911	c.1835G>T	c.(1834-1836)cGc>cTc	p.R612L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	612	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.R612L(1)|p.R612H(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCGCAGGGGCGCATCCTGCTG	0.692																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)						ENSG00000010327						22.0	25.0	24.0					3																	52540712		2197	4296	6493	STAB1	SO:0001583	missense	0			-	HGNC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1835G>T	3.37:g.52540712G>T	ENSP00000312946:p.Arg612Leu	Somatic	0	30	0.00		0.5443053923928768	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.R612L	ENST00000321725.6	37	c.1835	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147965	0.78001	.	.	ENSG00000010327	ENST00000321725	D	0.91068	-2.78	4.81	4.81	0.61882	FAS1 domain (5);	0.160917	0.41001	D	0.000976	D	0.92407	0.7590	L	0.38175	1.15	0.45427	D	0.998408	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.92672	0.6151	10	0.51188	T	0.08	.	14.8072	0.69965	0.0:0.0:1.0:0.0	.	612;612	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	L	612	ENSP00000312946:R612L	ENSP00000312946:R612L	R	+	2	0	STAB1	52515752	0.986000	0.35501	1.000000	0.80357	0.835000	0.47333	3.123000	0.50453	2.215000	0.71742	0.462000	0.41574	CGC	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain		0.692	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	protein_coding	OTTHUMT00000351380.2	G	NM_015136	-		52540712	+1	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	SNP	1.000	T
DUSP27	92235	genome.wustl.edu	37	1	167096608	167096608	+	Missense_Mutation	SNP	G	G	A	rs200160038		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:167096608G>A	ENST00000361200.2	+	6	2406	c.2240G>A	c.(2239-2241)cGc>cAc	p.R747H	DUSP27_ENST00000271385.5_Missense_Mutation_p.R747H|DUSP27_ENST00000443333.1_Missense_Mutation_p.R747H|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	747					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CTGTTGTCCCGCTCACCGTCT	0.532																																																	0								ENSG00000198842	G	HIS/ARG	0,4406		0,0,2203	97.0	80.0	86.0		2240	3.9	0.2	1		86	1,8599	1.2+/-3.3	0,1,4299	yes	missense	DUSP27	NM_001080426.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	747/1159	167096608	1,13005	2203	4300	6503	DUSP27	SO:0001583	missense	0			-	HGNC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2240G>A	1.37:g.167096608G>A	ENSP00000354483:p.Arg747His	Somatic	0	37	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	10.26	A0AUM4|Q9C074	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.R747H	ENST00000361200.2	37	c.2240	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635565	0.29068	0.0	1.16E-4	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03951	3.75;3.75;3.75	4.82	3.91	0.45181	.	1.602850	0.03625	N	0.236972	T	0.12561	0.0305	M	0.69823	2.125	0.31770	N	0.632267	D	0.89917	1.0	D	0.68621	0.959	T	0.02275	-1.1184	10	0.72032	D	0.01	-13.8117	13.1225	0.59336	0.0772:0.0:0.9228:0.0	.	747	Q5VZP5	DUS27_HUMAN	H	747	ENSP00000354483:R747H;ENSP00000271385:R747H;ENSP00000404874:R747H	ENSP00000271385:R747H	R	+	2	0	DUSP27	165363232	0.979000	0.34478	0.152000	0.22495	0.038000	0.13279	2.591000	0.46163	1.242000	0.43836	-0.148000	0.13756	CGC	-	NULL		0.532	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	protein_coding	OTTHUMT00000083244.1	G	NM_001080426	rs200160038		167096608	+1	no_errors	ENST00000271385	ensembl	human	known	74_37	missense	SNP	0.840	A
PRR14	78994	genome.wustl.edu	37	16	30666296	30666296	+	Silent	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr16:30666296T>C	ENST00000542965.2	+	7	1461	c.1005T>C	c.(1003-1005)ccT>ccC	p.P335P	PRR14_ENST00000571654.1_3'UTR|PRR14_ENST00000300835.4_Silent_p.P335P			Q9BWN1	PRR14_HUMAN	proline rich 14	335	Pro-rich.									breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			ACTCCTGCCCTGATCTGGGGC	0.677																																																	0								ENSG00000156858						45.0	49.0	47.0					16																	30666296		2197	4300	6497	PRR14	SO:0001819	synonymous_variant	0			-	HGNC	AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.1005T>C	16.37:g.30666296T>C		Somatic	0	57	0.00		0.5443053923928768	153	0.65	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q8WTX2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P335	ENST00000542965.2	37	c.1005	CCDS10687.1	16																																																																																			-	NULL		0.677	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR14	protein_coding	OTTHUMT00000434433.1	T	NM_024031	-		30666296	+1	no_errors	ENST00000300835	ensembl	human	known	74_37	silent	SNP	1.000	C
TTLL11	158135	genome.wustl.edu	37	9	124801570	124801570	+	Silent	SNP	A	A	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr9:124801570A>T	ENST00000373776.3	-	2	997	c.810T>A	c.(808-810)ggT>ggA	p.G270G	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_Silent_p.G270G	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	270	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						TGTTCACTTGACCGGAGAATA	0.413																																																	0								ENSG00000175764						105.0	96.0	99.0					9																	124801570		2203	4300	6503	TTLL11	SO:0001819	synonymous_variant	0			-	HGNC	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.810T>A	9.37:g.124801570A>T		Somatic	0	97	0.00		0.5443053923928768	14	6.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	62	11.43		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.G270	ENST00000373776.3	37	c.810	CCDS6834.2	9																																																																																			-	pfam_TTL/TTLL_fam		0.413	TTLL11-004	KNOWN	basic|CCDS	protein_coding	TTLL11	protein_coding	OTTHUMT00000053907.1	A	XM_088486	-		124801570	-1	no_errors	ENST00000321582	ensembl	human	known	74_37	silent	SNP	1.000	T
RPL13A	23521	genome.wustl.edu	37	19	49993810	49993810	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:49993810G>A	ENST00000391857.4	+	4	309	c.233G>A	c.(232-234)cGc>cAc	p.R78H	SNORD34_ENST00000365633.1_RNA|CTD-3148I10.15_ENST00000595815.1_RNA|SNORD33_ENST00000362761.1_RNA|SNORD32A_ENST00000364805.1_RNA|RPL13A_ENST00000477613.2_3'UTR|SNORD35A_ENST00000363389.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	78					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		GCCCCCAGCCGCATCTTCTGG	0.632																																																	0								ENSG00000142541						29.0	34.0	33.0					19																	49993810		2200	4298	6498	RPL13A	SO:0001583	missense	0			-	HGNC	X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.233G>A	19.37:g.49993810G>A	ENSP00000375730:p.Arg78His	Somatic	0	50	0.00		0.5443053923928768	4926	0.22	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K505	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	p.R78H	ENST00000391857.4	37	c.233	CCDS12768.1	19	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083625	0.76642	.	.	ENSG00000142541	ENST00000391857;ENST00000396949	.	.	.	5.46	4.41	0.53225	Ribosomal protein L13 domain (2);	0.000000	0.64402	U	0.000001	T	0.60340	0.2261	M	0.69523	2.12	0.58432	D	0.999999	B;B	0.31485	0.325;0.046	B;B	0.26416	0.069;0.01	T	0.64334	-0.6432	9	0.87932	D	0	.	13.508	0.61495	0.0:0.0:0.8431:0.1569	.	78;78	Q5QTS3;P40429	.;RL13A_HUMAN	H	78	.	ENSP00000375730:R78H	R	+	2	0	RPL13A	54685622	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.115000	0.71566	1.272000	0.44329	0.655000	0.94253	CGC	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc		0.632	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL13A	protein_coding	OTTHUMT00000258989.1	G		-		49993810	+1	no_errors	ENST00000391857	ensembl	human	known	74_37	missense	SNP	1.000	A
EML4	27436	genome.wustl.edu	37	2	42530460	42530460	+	Silent	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:42530460T>C	ENST00000318522.5	+	16	2035	c.1773T>C	c.(1771-1773)caT>caC	p.H591H	EML4_ENST00000402711.2_Silent_p.H533H|EML4_ENST00000401738.3_Silent_p.H602H|EML4_ENST00000453191.2_5'UTR	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	591					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TTCAGGGTCATACAGATGAGC	0.403			T	ALK	NSCLC																																			Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0								ENSG00000143924						165.0	161.0	162.0					2																	42530460		2203	4300	6503	EML4	SO:0001819	synonymous_variant	0			-	HGNC	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.1773T>C	2.37:g.42530460T>C		Somatic	0	40	0.00		0.5443053923928768	152	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H591	ENST00000318522.5	37	c.1773	CCDS1807.1	2																																																																																			-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.403	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	protein_coding	OTTHUMT00000250463.3	T	NM_019063	-		42530460	+1	no_errors	ENST00000318522	ensembl	human	known	74_37	silent	SNP	0.997	C
CYLC2	1539	genome.wustl.edu	37	9	105767704	105767704	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr9:105767704C>T	ENST00000374798.3	+	5	861	c.791C>T	c.(790-792)gCa>gTa	p.A264V	CYLC2_ENST00000487798.1_Missense_Mutation_p.A264V	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	264	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AAGAAAGATGCAAAGGAGATT	0.393																																																	0								ENSG00000155833						116.0	111.0	112.0					9																	105767704		2203	4300	6503	CYLC2	SO:0001583	missense	0			-	HGNC	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.791C>T	9.37:g.105767704C>T	ENSP00000420256:p.Ala264Val	Somatic	0	48	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A264V	ENST00000374798.3	37	c.791	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	C	9.972	1.225864	0.22542	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.14144	2.53;2.53	3.68	-1.75	0.08031	.	3.279410	0.00991	N	0.003520	T	0.09158	0.0226	L	0.27053	0.805	0.09310	N	1	B	0.25312	0.123	B	0.22152	0.038	T	0.24905	-1.0147	10	0.48119	T	0.1	0.8836	0.7431	0.00977	0.3163:0.3342:0.1547:0.1948	.	264	Q14093	CYLC2_HUMAN	V	264	ENSP00000420256:A264V;ENSP00000417674:A264V	ENSP00000420256:A264V	A	+	2	0	CYLC2	104807525	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.419000	0.02460	-0.356000	0.08187	-0.291000	0.09656	GCA	-	NULL		0.393	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	protein_coding	OTTHUMT00000053463.3	C	NM_001340	-		105767704	+1	no_errors	ENST00000374798	ensembl	human	known	74_37	missense	SNP	0.000	T
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:118604652_118604653insACAC	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000419821.2_Intron|TAOK3_ENST00000537952.1_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGT	12.37:g.118604657_118604660dupACAC		Somatic	0	19	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	-	NM_016281			118604653	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	INS	0.002:0.000	ACAC
ATG16L1	55054	genome.wustl.edu	37	2	234173536	234173536	+	Splice_Site	SNP	A	A	G			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:234173536A>G	ENST00000392017.4	+	5	646		c.e5-1		ATG16L1_ENST00000392018.1_Splice_Site|ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392020.4_Splice_Site|ATG16L1_ENST00000347464.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)						autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TCATGCTTCCAGAATTGCAGA	0.512																																																	0								ENSG00000085978						95.0	84.0	87.0					2																	234173536		2203	4300	6503	ATG16L1	SO:0001630	splice_region_variant	0			-	HGNC	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.390-1A>G	2.37:g.234173536A>G		Somatic	0	54	0.00		0.5443053923928768	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	26	35.00	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5-2	ENST00000392017.4	37	c.390-2	CCDS2503.2	2	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214960	0.58452	.	.	ENSG00000085978	ENST00000431917;ENST00000392017;ENST00000392020;ENST00000392018	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3245	0.82970	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATG16L1	233838275	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	7.993000	0.88291	2.254000	0.74563	0.460000	0.39030	.	-	-		0.512	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG16L1	protein_coding	OTTHUMT00000257069.2	A	NM_017974	-	Intron	234173536	+1	no_errors	ENST00000392017	ensembl	human	known	74_37	splice_site	SNP	1.000	G
PAMR1	25891	genome.wustl.edu	37	11	35454442	35454442	+	Splice_Site	DEL	T	T	-			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr11:35454442delT	ENST00000378880.2	-	11	2072		c.e11-2		PAMR1_ENST00000378878.3_Splice_Site|PAMR1_ENST00000532848.1_Splice_Site|PAMR1_ENST00000278360.3_Splice_Site	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						AGCAGAAATCTACAAATGCAA	0.483																																																	0								ENSG00000149090						41.0	42.0	42.0					11																	35454442		2202	4298	6500	PAMR1	SO:0001630	splice_region_variant	0				HGNC		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1627-2A>-	11.37:g.35454442delT		Somatic	0	51	0.00		0.5443053923928768	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e12-2	ENST00000378880.2	37	c.1678-2	CCDS31460.1	11																																																																																			-	-		0.483	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	protein_coding	OTTHUMT00000389177.1	T	NM_015430		Intron	35454442	-1	no_errors	ENST00000278360	ensembl	human	known	74_37	splice_site_del	DEL	1.000	-
XPO1	7514	genome.wustl.edu	37	2	61726050	61726051	+	Splice_Site	INS	-	-	A	rs372688892		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:61726050_61726051insA	ENST00000401558.2	-	8	1318		c.e8-2		XPO1_ENST00000404992.2_Splice_Site|XPO1_ENST00000406957.1_Splice_Site	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1						gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TTGCACATGCTAAAAAAAAAAA	0.262			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0								ENSG00000082898																																			XPO1	SO:0001630	splice_region_variant	0				HGNC	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.591-2->T	2.37:g.61726061_61726061dupA		Somatic	0	35	0.00		0.5443053923928768	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e7-2	ENST00000401558.2	37	c.591-3_591-2	CCDS33205.1	2																																																																																			-	-		0.262	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	protein_coding	OTTHUMT00000325872.3	-	NM_003400		Intron	61726051	-1	no_errors	ENST00000401558	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.996	A
KARS	3735	genome.wustl.edu	37	16	75665341	75665341	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr16:75665341G>A	ENST00000302445.3	-	9	1264	c.1225C>T	c.(1225-1227)Cca>Tca	p.P409S	KARS_ENST00000568378.1_Intron|KARS_ENST00000319410.5_Missense_Mutation_p.P437S	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	409					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	TTCGTTTCTGGCAGCTTCATC	0.512																																																	0								ENSG00000065427						139.0	117.0	124.0					16																	75665341		2198	4300	6498	KARS	SO:0001583	missense	0			-	HGNC	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.1225C>T	16.37:g.75665341G>A	ENSP00000303043:p.Pro409Ser	Somatic	0	44	0.00		0.5443053923928768	402	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pfscan_aa-tRNA-synth_II,prints_Lys-tRNA-synth_II_C,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Lys-tRNA-ligase_II	p.P437S	ENST00000302445.3	37	c.1309	CCDS10923.1	16	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181772	0.78677	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.81247	-1.47;-1.47	5.91	5.91	0.95273	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.88403	0.6427	L	0.58510	1.815	0.80722	D	1	B;D	0.89917	0.197;1.0	B;D	0.80764	0.041;0.994	D	0.87899	0.2689	10	0.56958	D	0.05	-32.6318	18.8766	0.92338	0.0:0.0:1.0:0.0	.	437;409	Q15046-2;Q15046	.;SYK_HUMAN	S	437;409	ENSP00000325448:P437S;ENSP00000303043:P409S	ENSP00000303043:P409S	P	-	1	0	KARS	74222842	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	CCA	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Lys-tRNA-ligase_II		0.512	KARS-001	KNOWN	basic|CCDS	protein_coding	KARS	protein_coding	OTTHUMT00000269023.1	G	NM_005548	-		75665341	-1	no_errors	ENST00000319410	ensembl	human	known	74_37	missense	SNP	1.000	A
NUTM2E	283008	genome.wustl.edu	37	10	81606700	81606700	+	Silent	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr10:81606700C>T	ENST00000429984.3	+	3	1580	c.1197C>T	c.(1195-1197)taC>taT	p.Y399Y	NUTM2E_ENST00000602967.1_Silent_p.Y399Y			B1AL46	NTM2E_HUMAN	NUT family member 2E	399																	TGATCTTCTACGAGATGGCGG	0.647																																																	0								ENSG00000228570																																			NUTM2E	SO:0001819	synonymous_variant	0			-	HGNC			10q22.3	2013-03-14	2013-03-14	2013-03-14	ENSG00000228570	ENSG00000228570			23448	other	unknown			"""family with sequence similarity 22, member E"""	FAM22E			Standard	NG_012781		Approved			B1AL46	OTTHUMG00000018586	ENST00000429984.3:c.1197C>T	10.37:g.81606700C>T		Somatic	0	17	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	3	62.50	A6NHL0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y399	ENST00000429984.3	37	c.1197		10																																																																																			-	NULL		0.647	NUTM2E-201	KNOWN	basic|appris_principal	protein_coding	NUTM2E	protein_coding		C	NG_012781	-		81606700	+1	no_errors	ENST00000429984	ensembl	human	known	74_37	silent	SNP	0.069	T
ZNF532	55205	genome.wustl.edu	37	18	56601781	56601781	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr18:56601781G>T	ENST00000336078.4	+	5	3239	c.2463G>T	c.(2461-2463)agG>agT	p.R821S	ZNF532_ENST00000591230.1_Missense_Mutation_p.R821S|ZNF532_ENST00000589288.1_Missense_Mutation_p.R821S|ZNF532_ENST00000591808.1_Missense_Mutation_p.R821S|ZNF532_ENST00000591083.1_Missense_Mutation_p.R821S	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	821					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CCATCTGCAGGTCGGTGCACT	0.502																																																	0								ENSG00000074657						143.0	122.0	129.0					18																	56601781		2203	4300	6503	ZNF532	SO:0001583	missense	0			-	HGNC	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2463G>T	18.37:g.56601781G>T	ENSP00000338217:p.Arg821Ser	Somatic	0	60	0.00		0.5443053923928768	307	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R821S	ENST00000336078.4	37	c.2463	CCDS11969.1	18	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912993	0.72983	.	.	ENSG00000074657	ENST00000336078	T	0.28666	1.6	5.32	3.08	0.35506	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.18676	0.0448	N	0.21448	0.665	0.53688	D	0.999973	P	0.46395	0.877	B	0.40636	0.335	T	0.02232	-1.1191	10	0.56958	D	0.05	-13.6375	6.875	0.24141	0.3698:0.0:0.6302:0.0	.	821	Q9HCE3	ZN532_HUMAN	S	821	ENSP00000338217:R821S	ENSP00000338217:R821S	R	+	3	2	ZNF532	54752761	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.265000	0.43311	1.308000	0.44962	0.561000	0.74099	AGG	-	smart_Znf_C2H2-like		0.502	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	protein_coding	OTTHUMT00000256130.1	G	NM_018181	-		56601781	+1	no_errors	ENST00000336078	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC6A16	28968	genome.wustl.edu	37	19	49796572	49796572	+	Silent	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:49796572G>T	ENST00000335875.4	-	10	1927	c.1686C>A	c.(1684-1686)atC>atA	p.I562I	SLC6A16_ENST00000454748.3_Silent_p.I562I	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	562					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		TCAGCAGTCTGATGAAGTAGC	0.502																																																	0								ENSG00000063127						81.0	86.0	84.0					19																	49796572		2014	4183	6197	SLC6A16	SO:0001819	synonymous_variant	0			-	HGNC	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1686C>A	19.37:g.49796572G>T		Somatic	0	81	0.00		0.5443053923928768	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q8IYV4|Q9Y5I9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.I562	ENST00000335875.4	37	c.1686	CCDS42590.1	19																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.502	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	protein_coding	OTTHUMT00000465503.2	G	NM_014037	-		49796572	-1	no_errors	ENST00000335875	ensembl	human	known	74_37	silent	SNP	0.002	T
MKI67	4288	genome.wustl.edu	37	10	129906760	129906760	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr10:129906760G>T	ENST00000368654.3	-	13	3719	c.3344C>A	c.(3343-3345)tCt>tAt	p.S1115Y	MKI67_ENST00000368653.3_Missense_Mutation_p.S755Y	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1115	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGATTCCTCAGAGGGACCTGG	0.488																																																	0								ENSG00000148773						226.0	225.0	225.0					10																	129906760		2203	4300	6503	MKI67	SO:0001583	missense	0			-	HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3344C>A	10.37:g.129906760G>T	ENSP00000357643:p.Ser1115Tyr	Somatic	0	45	0.00		0.5443053923928768	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5VWH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S1115Y	ENST00000368654.3	37	c.3344	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	8.136	0.784080	0.16189	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01323	5.05;5.01	3.71	-3.3	0.05003	.	32.290900	0.00166	N	0.000002	T	0.01353	0.0044	N	0.24115	0.695	0.09310	N	1	B;B;B	0.22541	0.071;0.053;0.003	B;B;B	0.26770	0.055;0.073;0.002	T	0.46456	-0.9190	10	0.62326	D	0.03	.	2.1265	0.03740	0.4942:0.1465:0.2267:0.1326	.	1114;755;1115	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Y	1115;755;1114	ENSP00000357643:S1115Y;ENSP00000357642:S755Y	ENSP00000357642:S755Y	S	-	2	0	MKI67	129796750	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.930000	0.03752	-0.311000	0.09066	TCT	-	NULL		0.488	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417	-		129906760	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	SNP	0.000	T
NHSL1	57224	genome.wustl.edu	37	6	138752872	138752872	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr6:138752872delT	ENST00000427025.2	-	5	3250	c.2622delA	c.(2620-2622)aaafs	p.K874fs	NHSL1_ENST00000343505.5_Frame_Shift_Del_p.K870fs	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	874										breast(2)|endometrium(4)|kidney(1)	7						GTGACACTGATTTTAAAAACA	0.493																																																	0								ENSG00000135540						176.0	152.0	159.0					6																	138752872		692	1591	2283	NHSL1	SO:0001589	frameshift_variant	0				HGNC	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.2622delA	6.37:g.138752872delT	ENSP00000394546:p.Lys874fs	Somatic	0	38	0.00		0.5443053923928768	40	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	Q3ZCS5|Q5SYE8|Q9P2J0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K874fs	ENST00000427025.2	37	c.2622	CCDS55063.1	6																																																																																			-	NULL		0.493	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	protein_coding	OTTHUMT00000043700.2	T	XM_050421			138752872	-1	no_errors	ENST00000427025	ensembl	human	known	74_37	frame_shift_del	DEL	0.260	-
ATXN7L1	222255	genome.wustl.edu	37	7	105254802	105254804	+	In_Frame_Del	DEL	GAG	GAG	-	rs150182467		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr7:105254802_105254804delGAG	ENST00000419735.3	-	10	2022_2024	c.1977_1979delCTC	c.(1975-1980)tcctct>tct	p.659_660SS>S	ATXN7L1_ENST00000388807.4_In_Frame_Del_p.319_320SS>S|ATXN7L1_ENST00000477775.1_In_Frame_Del_p.535_536SS>S	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	659	Ser-rich.									endometrium(1)|large_intestine(4)|lung(5)	10						CTGCAaggaagaggaggaggagg	0.517																																																	0								ENSG00000146776																																			ATXN7L1	SO:0001651	inframe_deletion	0				HGNC	AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.1977_1979delCTC	7.37:g.105254811_105254813delGAG	ENSP00000410759:p.Ser661del	Somatic	0	53	0.00		0.5443053923928768	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	46	13.21	A4D0Q2|B4DTS1|Q8N2T0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SCA7_dom	p.S661in_frame_del	ENST00000419735.3	37	c.1979_1977	CCDS47682.1	7																																																																																			-	NULL		0.517	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	protein_coding	OTTHUMT00000349037.2	GAG				105254804	-1	no_errors	ENST00000419735	ensembl	human	known	74_37	in_frame_del	DEL	0.098:0.098:0.097	-
LRRK1	79705	genome.wustl.edu	37	15	101555577	101555577	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr15:101555577A>G	ENST00000388948.3	+	12	1938	c.1579A>G	c.(1579-1581)Aga>Gga	p.R527G	LRRK1_ENST00000284395.5_Missense_Mutation_p.R524G	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTTCACCACCAGAGGTCGCCA	0.532											OREG0011796|OREG0023522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model																																					0								ENSG00000154237						54.0	57.0	56.0					15																	101555577		2072	4211	6283	LRRK1	SO:0001583	missense	0			-	HGNC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1579A>G	15.37:g.101555577A>G	ENSP00000373600:p.Arg527Gly	Somatic	0	66	0.00	1359	0.5443053923928768	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.R527G	ENST00000388948.3	37	c.1579	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	A	15.58	2.875594	0.51695	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.73681	-0.75;-0.77	5.43	4.26	0.50523	.	0.195077	0.45361	D	0.000370	T	0.52565	0.1742	N	0.08118	0	0.39537	D	0.968764	B	0.26672	0.156	B	0.21917	0.037	T	0.47086	-0.9144	10	0.25751	T	0.34	.	11.6225	0.51126	0.851:0.149:0.0:0.0	.	527	Q38SD2	LRRK1_HUMAN	G	527;524	ENSP00000373600:R527G;ENSP00000284395:R524G	ENSP00000284395:R524G	R	+	1	2	LRRK1	99373100	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.543000	0.67225	0.831000	0.34780	0.448000	0.29417	AGA	-	NULL		0.532	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	protein_coding	OTTHUMT00000384567.2	A	NM_024652	-		101555577	+1	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	SNP	1.000	G
PAPPA2	60676	genome.wustl.edu	37	1	176564689	176564689	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:176564689C>T	ENST00000367662.3	+	3	3113	c.1949C>T	c.(1948-1950)gCt>gTt	p.A650V	PAPPA2_ENST00000367661.3_Missense_Mutation_p.A650V	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	650	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCCAGGTGGCTGATGTGCGC	0.537																																																	0								ENSG00000116183						52.0	57.0	55.0					1																	176564689		2165	4266	6431	PAPPA2	SO:0001583	missense	0			-	HGNC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1949C>T	1.37:g.176564689C>T	ENSP00000356634:p.Ala650Val	Somatic	0	50	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.00	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.A650V	ENST00000367662.3	37	c.1949	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696535	0.48202	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.32272	4.7;1.46	5.42	5.42	0.78866	.	0.455547	0.24815	N	0.035363	T	0.20495	0.0493	N	0.22421	0.69	0.31423	N	0.674115	B;P	0.36222	0.129;0.544	B;B	0.27170	0.045;0.077	T	0.24764	-1.0151	10	0.72032	D	0.01	-3.4059	14.4588	0.67435	0.0:0.853:0.147:0.0	.	650;650	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	V	650	ENSP00000356634:A650V;ENSP00000356633:A650V	ENSP00000356633:A650V	A	+	2	0	PAPPA2	174831312	0.619000	0.27059	0.741000	0.31004	0.400000	0.30750	5.874000	0.69652	2.542000	0.85734	0.650000	0.86243	GCT	-	NULL		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	C		-		176564689	+1	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	SNP	0.998	T
BCAR1	9564	genome.wustl.edu	37	16	75298316	75298316	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr16:75298316C>T	ENST00000418647.3	-	2	366	c.83G>A	c.(82-84)gGc>gAc	p.G28D	BCAR1_ENST00000535626.2_Intron|BCAR1_ENST00000420641.3_Intron|BCAR1_ENST00000538440.2_Intron|BCAR1_ENST00000546196.1_5'UTR|BCAR1_ENST00000393422.2_Intron	NM_001170714.1	NP_001164185.1	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	619	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCAGGGCTGGCCAGTCCCCTG	0.597																																																	0								ENSG00000050820						18.0	21.0	20.0					16																	75298316		692	1591	2283	BCAR1	SO:0001583	missense	0			-	HGNC	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000418647.3:c.83G>A	16.37:g.75298316C>T	ENSP00000391669:p.Gly28Asp	Somatic	0	54	0.00		0.5443053923928768	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.G28D	ENST00000418647.3	37	c.83	CCDS54040.1	16	.	.	.	.	.	.	.	.	.	.	C	9.970	1.225175	0.22457	.	.	ENSG00000050820	ENST00000418647	T	0.32753	1.44	4.2	-4.99	0.03010	.	.	.	.	.	T	0.11324	0.0276	N	0.08118	0	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.34104	-0.9842	9	0.14656	T	0.56	.	6.1126	0.20110	0.0:0.2832:0.4466:0.2701	.	28	E9PCL5	.	D	28	ENSP00000391669:G28D	ENSP00000391669:G28D	G	-	2	0	BCAR1	73855817	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.129000	0.00591	-1.172000	0.02762	-0.367000	0.07326	GGC	-	NULL		0.597	BCAR1-005	KNOWN	basic|CCDS	protein_coding	BCAR1	protein_coding	OTTHUMT00000434666.1	C	NM_014567	-		75298316	-1	no_errors	ENST00000418647	ensembl	human	known	74_37	missense	SNP	0.000	T
RNF216	54476	genome.wustl.edu	37	7	5765071	5765071	+	Splice_Site	SNP	T	T	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr7:5765071T>A	ENST00000425013.2	-	8	1443		c.e8-2		RNF216_ENST00000389902.3_Splice_Site	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216						apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		AGACAAGGCCTAAAAATTGAG	0.373																																																	0								ENSG00000011275						91.0	83.0	85.0					7																	5765071		2203	4300	6503	RNF216	SO:0001630	splice_region_variant	0			-	HGNC	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1219-2A>T	7.37:g.5765071T>A		Somatic	0	63	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-2	ENST00000425013.2	37	c.1390-2	CCDS34595.1	7	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212326	0.79240	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0138	0.71567	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RNF216	5731597	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.776000	0.75023	2.146000	0.66826	0.482000	0.46254	.	-	-		0.373	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF216	protein_coding	OTTHUMT00000340374.1	T	NM_207111	-	Intron	5765071	-1	no_errors	ENST00000389902	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140223169	140223169	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:140223169C>T	ENST00000531613.1	+	1	2263	c.2263C>T	c.(2263-2265)Ccg>Tcg	p.P755S	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.P755S|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	755					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAACAACAGCCGCAGAGGGT	0.647																																																	0								ENSG00000204962						57.0	57.0	57.0					5																	140223169		2196	4264	6460	PCDHA8	SO:0001583	missense	0			-	HGNC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2263C>T	5.37:g.140223169C>T	ENSP00000434655:p.Pro755Ser	Somatic	0	83	0.00		0.5443053923928768	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B9EGT7|O75281	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P755S	ENST00000531613.1	37	c.2263	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	C	0.061	-1.223689	0.01530	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.10573	2.86;2.86	3.06	-3.83	0.04269	.	0.235211	0.19883	U	0.103940	T	0.01940	0.0061	N	0.00729	-1.24	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.0;0.007	T	0.42032	-0.9475	10	0.07813	T	0.8	.	6.4274	0.21778	0.5404:0.3579:0.0:0.1016	.	755;755	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	S	755	ENSP00000434655:P755S;ENSP00000367363:P755S	ENSP00000367363:P755S	P	+	1	0	PCDHA8	140203353	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-1.418000	0.02462	-0.598000	0.05806	-0.366000	0.07423	CCG	-	NULL		0.647	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	protein_coding	OTTHUMT00000372830.2	C	NM_018911	-		140223169	+1	no_errors	ENST00000531613	ensembl	human	known	74_37	missense	SNP	0.001	T
BNIP3L	665	genome.wustl.edu	37	8	26237768	26237768	+	5'Flank	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr8:26237768T>C	ENST00000380629.2	+	0	0				SDAD1P1_ENST00000519902.1_RNA	NM_004331.2	NP_004322.1	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3-like						defense response to virus (GO:0051607)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		CTGTTGTCTCTTTTACAGCAT	0.408																																																	0								ENSG00000228451																																			SDAD1P1	SO:0001631	upstream_gene_variant	0			-	HGNC	AB004788	CCDS6050.1	8p21	2014-05-13	2002-08-29		ENSG00000104765	ENSG00000104765			1085	protein-coding gene	gene with protein product		605368	"""BCL2/adenovirus E1B 19kD-interacting protein 3-like"""			9523198, 9973195	Standard	NM_004331		Approved	Nix, BNIP3a	uc003xex.1	O60238	OTTHUMG00000099433		8.37:g.26237768T>C	Exception_encountered	Somatic	0	49	0.00		0.5443053923928768	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B0AZS9|Q5JW63|Q8NF87	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380629.2	37	NULL	CCDS6050.1	8																																																																																			-	-		0.408	BNIP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDAD1P1	protein_coding	OTTHUMT00000216895.1	T	NM_004331	-		26237768	-1	no_errors	ENST00000519902	ensembl	human	known	74_37	rna	SNP	1.000	C
RNF14	9604	genome.wustl.edu	37	5	141353195	141353195	+	Silent	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:141353195G>T	ENST00000394520.2	+	3	351	c.42G>T	c.(40-42)ctG>ctT	p.L14L	RNF14_ENST00000502341.1_3'UTR|RNF14_ENST00000394514.2_5'UTR|RNF14_ENST00000356143.1_Silent_p.L14L|RNF14_ENST00000394519.1_Silent_p.L14L|RNF14_ENST00000347642.3_Silent_p.L14L|AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000394515.3_Silent_p.L14L|RNF14_ENST00000540015.1_Silent_p.L14L	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	14	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		ATGAATTGCTGGCCCTGGCAA	0.433																																																	0								ENSG00000013561						96.0	98.0	97.0					5																	141353195		2203	4300	6503	RNF14	SO:0001819	synonymous_variant	0			-	HGNC	AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.42G>T	5.37:g.141353195G>T		Somatic	0	58	0.00		0.5443053923928768	130	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RWD-domain,pfam_Znf_C6HC,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,smart_Znf_C6HC,pfscan_RWD-domain,pfscan_Znf_RING	p.L14	ENST00000394520.2	37	c.42	CCDS4270.1	5																																																																																			-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain		0.433	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF14	protein_coding	OTTHUMT00000251860.2	G	NM_004290	-		141353195	+1	no_errors	ENST00000347642	ensembl	human	known	74_37	silent	SNP	1.000	T
C1orf137	388667	genome.wustl.edu	37	1	117237401	117237401	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr1:117237401G>T	ENST00000369482.1	+	2	107	c.89G>T	c.(88-90)gGc>gTc	p.G30V		NM_001013643.1	NP_001013665.1	Q5JT78	CA137_HUMAN	chromosome 1 open reading frame 137	30																	ACTTGCGTAGGCTCATGGAGT	0.453																																																	0								ENSG00000203864																																			C1orf137	SO:0001583	missense	0			-	HGNC		CCDS60233.1	1p13.1	2013-01-14			ENSG00000203864	ENSG00000203864			32040	protein-coding gene	gene with protein product							Standard	NM_001013643		Approved			Q5JT78	OTTHUMG00000022754	ENST00000369482.1:c.89G>T	1.37:g.117237401G>T	ENSP00000358494:p.Gly30Val	Somatic	0	74	0.00		0.5443053923928768	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G30V	ENST00000369482.1	37	c.89		1	.	.	.	.	.	.	.	.	.	.	G	4.506	0.093819	0.08632	.	.	ENSG00000203864	ENST00000369482	.	.	.	2.49	-4.78	0.03209	.	.	.	.	.	T	0.18173	0.0436	.	.	.	.	.	.	.	.	.	.	.	.	T	0.30149	-0.9988	4	0.87932	D	0	.	5.3702	0.16134	0.339:0.2861:0.3749:0.0	.	.	.	.	V	30	.	ENSP00000358494:G30V	G	+	2	0	C1orf137	117038924	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.018000	0.12568	-1.762000	0.01308	-0.921000	0.02739	GGC	-	NULL		0.453	C1orf137-001	KNOWN	basic|appris_principal	protein_coding	C1orf137	protein_coding	OTTHUMT00000059045.1	G	NM_001013643	-		117237401	+1	no_errors	ENST00000369482	ensembl	human	known	74_37	missense	SNP	0.000	T
