#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GRP	2922	genome.wustl.edu	37	18	56892836	56892836	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr18:56892836G>T	ENST00000256857.2	+	2	350	c.252G>T	c.(250-252)ttG>ttT	p.L84F	GRP_ENST00000420468.2_Missense_Mutation_p.L84F|GRP_ENST00000529320.2_Missense_Mutation_p.L84F	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	84					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				CAAGGAATTTGCTGGGTCTCA	0.527																																																	0								ENSG00000134443						104.0	100.0	102.0					18																	56892836		2203	4300	6503	GRP	SO:0001583	missense	0			-	HGNC		CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.252G>T	18.37:g.56892836G>T	ENSP00000256857:p.Leu84Phe	Somatic	0	82	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	39	35.00	P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bombesin	p.L84F	ENST00000256857.2	37	c.252	CCDS11971.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.807091|2.807091	0.50421|0.50421	.|.	.|.	ENSG00000134443|ENSG00000134443	ENST00000456142|ENST00000256857;ENST00000529320;ENST00000420468	.|T;T;T	.|0.52754	.|0.65;0.69;0.67	5.03|5.03	2.07|2.07	0.26955|0.26955	.|.	.|0.107610	.|0.38164	.|N	.|0.001789	T|T	0.51873|0.51873	0.1700|0.1700	L|L	0.43152|0.43152	1.355|1.355	0.37966|0.37966	D|D	0.93311|0.93311	.|D;D;B	.|0.89917	.|1.0;0.999;0.356	.|D;D;B	.|0.91635	.|0.999;0.997;0.342	T|T	0.57093|0.57093	-0.7870|-0.7870	5|10	.|0.87932	.|D	.|0	-10.5092|-10.5092	2.6477|2.6477	0.04990|0.04990	0.1771:0.1453:0.5286:0.1491|0.1771:0.1453:0.5286:0.1491	.|.	.|84;84;84	.|P07492-3;P07492;P07492-2	.|.;GRP_HUMAN;.	F|F	40|84	.|ENSP00000256857:L84F;ENSP00000434101:L84F;ENSP00000389696:L84F	.|ENSP00000256857:L84F	C|L	+|+	2|3	0|2	GRP|GRP	55043816|55043816	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.798000|0.798000	0.45092|0.45092	0.838000|0.838000	0.27572|0.27572	1.114000|1.114000	0.41781|0.41781	0.655000|0.655000	0.94253|0.94253	TGC|TTG	-	NULL		0.527	GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRP	protein_coding	OTTHUMT00000256131.2	G	NM_002091	-		56892836	+1	no_errors	ENST00000256857	ensembl	human	known	74_37	missense	SNP	0.994	T
GPX8	493869	genome.wustl.edu	37	5	54460113	54460113	+	3'UTR	DEL	T	T	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:54460113delT	ENST00000503787.1	+	0	772				CDC20B_ENST00000296733.1_Intron|CDC20B_ENST00000322374.6_Intron|GPX8_ENST00000506123.1_3'UTR|CDC20B_ENST00000381375.2_Intron|CDC20B_ENST00000334206.5_Intron|GPX8_ENST00000515370.1_3'UTR|GPX8_ENST00000296734.6_3'UTR|CDC20B_ENST00000331730.3_Intron	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)						response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	ATTTTAAACAttttttttttg	0.393																																																	0								ENSG00000164294																																			GPX8	SO:0001624	3_prime_UTR_variant	0				HGNC	BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.*67T>-	5.37:g.54460113delT		Somatic	0	30	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000503787.1	37	NULL	CCDS34156.1	5																																																																																			-	-		0.393	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX8	protein_coding	OTTHUMT00000369717.1	T	NM_001008397			54460113	+1	no_errors	ENST00000506123	ensembl	human	known	74_37	rna	DEL	0.000	-
FANCD2	2177	genome.wustl.edu	37	3	10108898	10108898	+	Silent	SNP	A	A	G	rs77246387		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:10108898A>G	ENST00000419585.1	+	26	2552	c.2391A>G	c.(2389-2391)gtA>gtG	p.V797V	FANCD2_ENST00000383806.1_Silent_p.V797V|FANCD2_ENST00000287647.3_Silent_p.V797V|FANCD2_ENST00000383807.1_Silent_p.V797V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	797					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.V797V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	1	Substitution - coding silent(1)	prostate(1)						ENSG00000144554						72.0	63.0	66.0					3																	10108898		2203	4300	6503	FANCD2	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2391A>G	3.37:g.10108898A>G		Somatic	0	41	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	69	8.00	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.V797	ENST00000419585.1	37	c.2391	CCDS33696.1	3																																																																																			-	NULL		0.368	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	protein_coding	OTTHUMT00000339873.1	A		rs77246387		10108898	+1	no_errors	ENST00000287647	ensembl	human	known	74_37	silent	SNP	0.998	G
PTPRK	5796	genome.wustl.edu	37	6	128321225	128321225	+	Intron	DEL	A	A	-	rs202179145|rs78615852	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr6:128321225delA	ENST00000368215.3	-	16	2491				PTPRK_ENST00000368213.5_Intron|PTPRK_ENST00000532331.1_Intron|PTPRK_ENST00000368226.4_Intron|PTPRK_ENST00000368207.3_Intron|PTPRK_ENST00000368227.3_Intron|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368210.3_Intron			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTTACCACTTAAAAAAAAAAA	0.299													|||unknown(HR)	242	0.0483227	0.0303	0.0245	5008	,	,		17261	0.0714		0.0328	False		,,,				2504	0.0818																0								ENSG00000152894																																			PTPRK	SO:0001627	intron_variant	0				HGNC	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2492-1176T>-	6.37:g.128321225delA		Somatic	0	13	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368215.3	37	NULL		6																																																																																			-	-		0.299	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	A				128321225	-1	no_errors	ENST00000524481	ensembl	human	known	74_37	rna	DEL	0.625	-
ZNF217	7764	genome.wustl.edu	37	20	52192497	52192497	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:52192497delA	ENST00000371471.2	-	4	3231	c.2806delT	c.(2806-2808)tacfs	p.Y936fs	RP4-724E16.2_ENST00000424252.1_RNA|ZNF217_ENST00000302342.3_Frame_Shift_Del_p.Y936fs			O75362	ZN217_HUMAN	zinc finger protein 217	936					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CCTCTTCTGTAATTGGCCCCG	0.547																																																	0								ENSG00000171940						117.0	96.0	103.0					20																	52192497		2203	4300	6503	ZNF217	SO:0001589	frameshift_variant	0				HGNC	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2806delT	20.37:g.52192497delA	ENSP00000360526:p.Tyr936fs	Somatic	0	68	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	E1P5Y6|Q14DB8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y936fs	ENST00000371471.2	37	c.2806	CCDS13443.1	20																																																																																			-	NULL		0.547	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF217	protein_coding	OTTHUMT00000079757.2	A	NM_006526			52192497	-1	no_errors	ENST00000302342	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
SYCP2	10388	genome.wustl.edu	37	20	58496452	58496452	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:58496452T>A	ENST00000357552.3	-	4	306	c.81A>T	c.(79-81)aaA>aaT	p.K27N	SYCP2_ENST00000371001.2_Missense_Mutation_p.K27N|SYCP2_ENST00000476314.1_5'UTR			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	27					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GCAAAAGTGTTTTCAAAGGTT	0.303																																																	0								ENSG00000196074						52.0	49.0	50.0					20																	58496452		2198	4291	6489	SYCP2	SO:0001583	missense	0			-	HGNC	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.81A>T	20.37:g.58496452T>A	ENSP00000350162:p.Lys27Asn	Somatic	0	75	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	12	79.69	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K27N	ENST00000357552.3	37	c.81	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	T	11.34	1.608603	0.28623	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834;ENST00000425931	T;T;T;T	0.46451	2.45;2.45;2.19;0.87	5.04	2.7	0.31948	.	0.685143	0.14295	N	0.328675	T	0.33469	0.0864	L	0.47716	1.5	0.09310	N	1	P	0.36909	0.573	B	0.36186	0.219	T	0.12372	-1.0550	10	0.40728	T	0.16	-1.0514	7.2584	0.26189	0.0:0.0778:0.1462:0.776	.	27	Q9BX26	SYCP2_HUMAN	N	27;27;27;26	ENSP00000360040:K27N;ENSP00000350162:K27N;ENSP00000402456:K27N;ENSP00000399300:K26N	ENSP00000350162:K27N	K	-	3	2	SYCP2	57929847	0.399000	0.25287	0.204000	0.23530	0.738000	0.42128	0.872000	0.28037	0.335000	0.23614	0.383000	0.25322	AAA	-	NULL		0.303	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	T	NM_014258	-		58496452	-1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	SNP	0.064	A
ETNPPL	64850	genome.wustl.edu	37	4	109683976	109683976	+	Intron	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:109683976C>T	ENST00000296486.3	-	1	211				ETNPPL_ENST00000512646.1_Splice_Site|ETNPPL_ENST00000411864.2_Intron|ETNPPL_ENST00000510706.1_Splice_Site	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase							mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										TCTGCACTTACTTCCGGGCCA	0.637																																																	0								ENSG00000164089						134.0	124.0	127.0					4																	109683976		2203	4300	6503	ETNPPL	SO:0001627	intron_variant	0			-	HGNC	AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.56+22G>A	4.37:g.109683976C>T		Somatic	0	72	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	25.00	B7Z1Y0|E9PBY0|Q9H174	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e0+1	ENST00000296486.3	37	c.1+1	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	C	2.593	-0.294732	0.05568	.	.	ENSG00000164089	ENST00000512646	.	.	.	2.91	-2.67	0.06059	.	.	.	.	.	.	.	.	.	.	.	0.34783	D	0.734913	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.526	0.02526	0.1372:0.3744:0.136:0.3523	.	.	.	.	.	-1	.	.	.	-	.	.	AGXT2L1	109903425	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.457000	0.06745	-0.391000	0.07763	0.460000	0.39030	.	-	-		0.637	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETNPPL	protein_coding	OTTHUMT00000363508.1	C	NM_031279	-		109683976	-1	no_errors	ENST00000510706	ensembl	human	putative	74_37	splice_site	SNP	0.000	T
FMN1	342184	genome.wustl.edu	37	15	33446037	33446037	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr15:33446037G>T	ENST00000559047.1	-	1	1078	c.1079C>A	c.(1078-1080)gCc>gAc	p.A360D	FMN1_ENST00000320930.7_Missense_Mutation_p.A360D|FMN1_ENST00000561249.1_Missense_Mutation_p.A360D			Q68DA7	FMN1_HUMAN	formin 1	360	Microtubule-binding. {ECO:0000250}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTCAGCGTGGGCTGCTGGGCG	0.582																																																	0								ENSG00000248905																																			FMN1	SO:0001583	missense	0			-	HGNC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.1079C>A	15.37:g.33446037G>T	ENSP00000454047:p.Ala360Asp	Somatic	0	85	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A360D	ENST00000559047.1	37	c.1079		15	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489766	0.44249	.	.	ENSG00000186031	ENST00000320930	.	.	.	5.26	2.14	0.27477	.	0.779761	0.11256	N	0.583111	T	0.27798	0.0684	L	0.29908	0.895	0.27209	N	0.959969	B	0.24368	0.102	B	0.24155	0.051	T	0.27872	-1.0061	8	0.41790	T	0.15	.	4.3965	0.11365	0.2147:0.0:0.4734:0.3119	.	360	C9JFW6	.	D	360	.	ENSP00000325166:A360D	A	-	2	0	AC090098.1	31233329	0.207000	0.23482	0.145000	0.22337	0.052000	0.14988	0.668000	0.25127	0.768000	0.33290	0.655000	0.94253	GCC	-	NULL		0.582	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	protein_coding	OTTHUMT00000417414.1	G	NM_001103184	-		33446037	-1	no_errors	ENST00000320930	ensembl	human	known	74_37	missense	SNP	0.056	T
ZNF354B	117608	genome.wustl.edu	37	5	178310890	178310890	+	Silent	SNP	C	C	T	rs143278265	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:178310890C>T	ENST00000322434.3	+	5	1663	c.1437C>T	c.(1435-1437)tcC>tcT	p.S479S	ZNF354B_ENST00000522714.1_3'UTR|RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACAGAGTTCCGCTCTCATTC	0.393																																																	0								ENSG00000178338						116.0	115.0	115.0					5																	178310890		2203	4300	6503	ZNF354B	SO:0001819	synonymous_variant	0			-	HGNC	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.1437C>T	5.37:g.178310890C>T		Somatic	0	64	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	A8K0V2|Q5U5Z4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S479	ENST00000322434.3	37	c.1437	CCDS4439.1	5																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354B	protein_coding	OTTHUMT00000253482.1	C	NM_058230	-		178310890	+1	no_errors	ENST00000322434	ensembl	human	known	74_37	silent	SNP	0.127	T
UCKL1	54963	genome.wustl.edu	37	20	62587648	62587648	+	Silent	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:62587648C>T	ENST00000354216.6	-	1	120	c.78G>A	c.(76-78)cgG>cgA	p.R26R	UCKL1_ENST00000369892.3_Silent_p.R26R|UCKL1_ENST00000358711.3_Silent_p.R26R	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	26					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCTCAGCCTGCCGGCCTGGTG	0.726																																																	0								ENSG00000198276						23.0	23.0	23.0					20																	62587648		2193	4284	6477	UCKL1	SO:0001819	synonymous_variant	0			-	HGNC	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.78G>A	20.37:g.62587648C>T		Somatic	0	104	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PRK/URK,pfam_CPT,superfamily_P-loop_NTPase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.R26	ENST00000354216.6	37	c.78	CCDS13547.1	20																																																																																			-	NULL		0.726	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	protein_coding	OTTHUMT00000080236.1	C	NM_017859	-		62587648	-1	no_errors	ENST00000354216	ensembl	human	known	74_37	silent	SNP	0.005	T
SPATA31E1	286234	genome.wustl.edu	37	9	90500171	90500171	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr9:90500171C>A	ENST00000325643.5	+	4	835	c.769C>A	c.(769-771)Cct>Act	p.P257T		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	257	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTCCTCTCCACCTCCACCCGA	0.622																																																	0								ENSG00000177992						68.0	73.0	71.0					9																	90500171		2203	4300	6503	SPATA31E1	SO:0001583	missense	0			-	HGNC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.769C>A	9.37:g.90500171C>A	ENSP00000322640:p.Pro257Thr	Somatic	0	70	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P257T	ENST00000325643.5	37	c.769	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	0.397	-0.920279	0.02396	.	.	ENSG00000177992	ENST00000325643	T	0.05382	3.45	1.26	-1.17	0.09648	.	.	.	.	.	T	0.04272	0.0118	L	0.33485	1.01	0.09310	N	1	B	0.23442	0.085	B	0.23574	0.047	T	0.44081	-0.9351	9	0.32370	T	0.25	.	1.7714	0.03012	0.3261:0.43:0.0:0.2439	.	257	Q6ZUB1	CI079_HUMAN	T	257	ENSP00000322640:P257T	ENSP00000322640:P257T	P	+	1	0	C9orf79	89689991	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.369000	0.07533	-0.382000	0.07870	0.305000	0.20034	CCT	-	NULL		0.622	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	protein_coding	OTTHUMT00000052954.2	C	NM_178828	-		90500171	+1	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	SNP	0.000	A
KCNA1	3736	genome.wustl.edu	37	12	5020795	5020795	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:5020795G>A	ENST00000382545.3	+	2	1358	c.251G>A	c.(250-252)cGc>cAc	p.R84H	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	84					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TTCTTCGACCGCAACCGGCCC	0.627																																																	0								ENSG00000111262						63.0	65.0	65.0					12																	5020795		2203	4298	6501	KCNA1	SO:0001583	missense	0			-	HGNC	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.251G>A	12.37:g.5020795G>A	ENSP00000371985:p.Arg84His	Somatic	0	212	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	97	16.95	A6NM83|Q3MIQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.R84H	ENST00000382545.3	37	c.251	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578422	0.86645	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.90261	-2.64	4.34	4.34	0.51931	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.97390	0.9146	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98994	1.0809	10	0.87932	D	0	.	16.3898	0.83531	0.0:0.0:1.0:0.0	.	84	Q09470	KCNA1_HUMAN	H	84	ENSP00000371985:R84H	ENSP00000228858:R84H	R	+	2	0	KCNA1	4891056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.531000	0.98054	2.410000	0.81850	0.650000	0.86243	CGC	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	protein_coding	OTTHUMT00000103343.2	G	NM_000217	-		5020795	+1	no_errors	ENST00000382545	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC35A4	113829	genome.wustl.edu	37	5	139947189	139947191	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:139947189_139947191delGCT	ENST00000514199.1	+	2	2121_2123	c.435_437delGCT	c.(433-438)gcgctg>gcg	p.L149del	APBB3_ENST00000507279.1_Intron|APBB3_ENST00000357560.4_5'Flank|SLC35A4_ENST00000323146.3_In_Frame_Del_p.L149del			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	149	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGGTTAGCGCTGCTGCTGCTG	0.635																																																	0								ENSG00000176087																																			SLC35A4	SO:0001651	inframe_deletion	0				HGNC	AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.435_437delGCT	5.37:g.139947198_139947200delGCT	ENSP00000424566:p.Leu149del	Somatic	0	47	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A8K013	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Nuc_sug_transpt,pfam_DMT,pirsf_UDP/CMP-sugar_transptr	p.L149in_frame_del	ENST00000514199.1	37	c.435_437	CCDS4231.1	5																																																																																			-	pfam_Nuc_sug_transpt,pfam_DMT,pirsf_UDP/CMP-sugar_transptr		0.635	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35A4	protein_coding	OTTHUMT00000372815.1	GCT	NM_080670			139947191	+1	no_errors	ENST00000323146	ensembl	human	known	74_37	in_frame_del	DEL	0.375:0.638:0.998	-
SORBS1	10580	genome.wustl.edu	37	10	97116159	97116159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:97116159delG	ENST00000607232.1	-	18	2299	c.2133delC	c.(2131-2133)cccfs	p.P711fs	SORBS1_ENST00000371247.2_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371227.4_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000361941.3_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000277982.5_Intron|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000371246.2_Intron					sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GCACAGGTGTGGGAGACTTGC	0.607																																																	0								ENSG00000095637																																			SORBS1	SO:0001589	frameshift_variant	0				HGNC	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000607232.1:c.2133delC	10.37:g.97116159delG	ENSP00000475901:p.Pro711fs	Somatic	0	69	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.T712fs	ENST00000607232.1	37	c.2133		10																																																																																			-	NULL		0.607	SORBS1-017	KNOWN	not_organism_supported|basic	protein_coding	SORBS1	protein_coding	OTTHUMT00000468280.1	G				97116159	-1	no_errors	ENST00000607232	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
EDEM1	9695	genome.wustl.edu	37	3	5257568	5257568	+	Missense_Mutation	SNP	A	A	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:5257568A>G	ENST00000256497.4	+	12	2072	c.1939A>G	c.(1939-1941)Atg>Gtg	p.M647V		NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	647					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GAGCATCTACATGCGACAGAT	0.448																																																	0								ENSG00000134109						227.0	175.0	193.0					3																	5257568		2203	4300	6503	EDEM1	SO:0001583	missense	0			-	HGNC	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1939A>G	3.37:g.5257568A>G	ENSP00000256497:p.Met647Val	Somatic	0	115	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30	A8K9C8|B4DXP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.M647V	ENST00000256497.4	37	c.1939	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	A	17.61	3.433290	0.62844	.	.	ENSG00000134109	ENST00000256497	D	0.82433	-1.61	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	M	0.64997	1.995	0.80722	D	1	P	0.35383	0.498	B	0.33454	0.164	T	0.81206	-0.1038	10	0.46703	T	0.11	-33.0056	15.1853	0.72996	1.0:0.0:0.0:0.0	.	647	Q92611	EDEM1_HUMAN	V	647	ENSP00000256497:M647V	ENSP00000256497:M647V	M	+	1	0	EDEM1	5232568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.772000	0.91757	1.984000	0.57885	0.533000	0.62120	ATG	-	NULL		0.448	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	protein_coding	OTTHUMT00000337566.2	A	NM_014674	-		5257568	+1	no_errors	ENST00000256497	ensembl	human	known	74_37	missense	SNP	1.000	G
HSF2BP	11077	genome.wustl.edu	37	21	44949764	44949764	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr21:44949764G>A	ENST00000291560.2	-	9	1206	c.875C>T	c.(874-876)tCg>tTg	p.S292L	HSF2BP_ENST00000542962.1_Missense_Mutation_p.S217L	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	292					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CTCAGAGGCCGACTTGGAGAA	0.572																																																	0								ENSG00000160207						65.0	66.0	66.0					21																	44949764		2203	4300	6503	HSF2BP	SO:0001583	missense	0			-	HGNC	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.875C>T	21.37:g.44949764G>A	ENSP00000291560:p.Ser292Leu	Somatic	0	67	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	41	50.00	B4DX36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.S292L	ENST00000291560.2	37	c.875	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	G	5.382	0.255646	0.10185	.	.	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.66099	-0.19;0.86	5.57	-0.0836	0.13693	Armadillo-like helical (1);Armadillo-type fold (1);	0.873444	0.10300	N	0.691241	T	0.34629	0.0904	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	10	0.10111	T	0.7	-19.4038	10.8313	0.46663	0.5355:0.0:0.4645:0.0	.	292	O75031	HSF2B_HUMAN	L	292;217	ENSP00000291560:S292L;ENSP00000443367:S217L	ENSP00000291560:S292L	S	-	2	0	HSF2BP	43774192	0.009000	0.17119	0.000000	0.03702	0.890000	0.51754	0.839000	0.27586	0.042000	0.15717	0.563000	0.77884	TCG	-	superfamily_ARM-type_fold		0.572	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	protein_coding	OTTHUMT00000195620.1	G	NM_007031	-		44949764	-1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	SNP	0.000	A
SRGAP3	9901	genome.wustl.edu	37	3	9106121	9106121	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:9106121G>A	ENST00000383836.3	-	5	1058	c.631C>T	c.(631-633)Cgc>Tgc	p.R211C	SRGAP3_ENST00000360413.3_Missense_Mutation_p.R211C|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	211	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GAGCTGCGGCGCTGGGGCCGG	0.597			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0								ENSG00000196220						124.0	113.0	117.0					3																	9106121		2203	4300	6503	SRGAP3	SO:0001583	missense	0			-	HGNC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.631C>T	3.37:g.9106121G>A	ENSP00000373347:p.Arg211Cys	Somatic	0	62	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	15	48.28	Q8IX13|Q8IZV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R211C	ENST00000383836.3	37	c.631	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184619	0.78677	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.55413	0.52;0.52	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;0.999	D;P;D;D	0.79784	0.993;0.742;0.978;0.952	T	0.77403	-0.2601	10	0.87932	D	0	.	13.1447	0.59454	0.0:0.0:0.8399:0.1601	.	211;80;211;211	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	C	211;211;91	ENSP00000373347:R211C;ENSP00000353587:R211C	ENSP00000353587:R211C	R	-	1	0	SRGAP3	9081121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.257000	0.32932	2.452000	0.82932	0.411000	0.27672	CGC	-	NULL		0.597	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	protein_coding	OTTHUMT00000207137.3	G		-		9106121	-1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	SNP	1.000	A
GTPBP2	54676	genome.wustl.edu	37	6	43593082	43593082	+	Intron	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr6:43593082C>A	ENST00000307126.5	-	5	705				GTPBP2_ENST00000476510.1_Intron|GTPBP2_ENST00000307114.7_Intron	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CCCATTGGGTCCCATTGATCC	0.512																																					GBM(116;405 1620 28302 32150 44768)												0								ENSG00000172432						133.0	136.0	135.0					6																	43593082		2203	4300	6503	GTPBP2	SO:0001627	intron_variant	0			-	HGNC	AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.705+17G>T	6.37:g.43593082C>A		Somatic	0	67	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000307126.5	37	NULL	CCDS4903.1	6																																																																																			-	-		0.512	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP2	protein_coding	OTTHUMT00000040679.1	C		-		43593082	-1	no_errors	ENST00000480263	ensembl	human	known	74_37	rna	SNP	0.997	A
TNC	3371	genome.wustl.edu	37	9	117808688	117808688	+	Splice_Site	SNP	C	C	G	rs111797890		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr9:117808688C>G	ENST00000350763.4	-	17	5537		c.e17+1		TNC_ENST00000423613.2_Intron|TNC_ENST00000346706.3_Splice_Site|TNC_ENST00000340094.3_Splice_Site|TNC_ENST00000341037.4_Splice_Site|TNC_ENST00000535648.1_Splice_Site|TNC_ENST00000542877.1_Splice_Site|TNC_ENST00000345230.3_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000481475.1_5'Flank	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C						bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ATTTACAGTACCTGTTGTTGC	0.458																																																	0								ENSG00000041982						229.0	217.0	221.0					9																	117808688		2203	4300	6503	TNC	SO:0001630	splice_region_variant	0			-	HGNC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5125+1G>C	9.37:g.117808688C>G		Somatic	0	100	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e16+1	ENST00000350763.4	37	c.5125+1	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680337	0.88542	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877;ENST00000544972	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0674	0.97707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNC	116848509	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.409000	0.80053	2.735000	0.93741	0.563000	0.77884	.	-	-		0.458	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	C	NM_002160	rs111797890	Intron	117808688	-1	no_errors	ENST00000350763	ensembl	human	known	74_37	splice_site	SNP	1.000	G
THSD7A	221981	genome.wustl.edu	37	7	11514099	11514099	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:11514099delC	ENST00000423059.4	-	8	2365	c.2114delG	c.(2113-2115)ggcfs	p.G705fs	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	705	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AATGCACTGGCCCCAGGGACC	0.507										HNSCC(18;0.044)																																							0								ENSG00000005108						82.0	81.0	81.0					7																	11514099		2020	4183	6203	THSD7A	SO:0001589	frameshift_variant	0				HGNC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2114delG	7.37:g.11514099delC	ENSP00000406482:p.Gly705fs	Somatic	0	81	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G705fs	ENST00000423059.4	37	c.2114	CCDS47543.1	7																																																																																			-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.507	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	protein_coding	OTTHUMT00000325944.4	C	XM_928187.2			11514099	-1	no_errors	ENST00000423059	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SLC35F4	341880	genome.wustl.edu	37	14	58030878	58030878	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr14:58030878C>T	ENST00000339762.6	-	8	1540	c.1541G>A	c.(1540-1542)gGg>gAg	p.G514E	SLC35F4_ENST00000554729.1_Missense_Mutation_p.G355E|SLC35F4_ENST00000556826.1_Missense_Mutation_p.G478E			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	514					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGACACTGTCCCATTGGCTCT	0.453																																																	0								ENSG00000151812						79.0	78.0	78.0					14																	58030878		1987	4173	6160	SLC35F4	SO:0001583	missense	0			-	HGNC			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.1541G>A	14.37:g.58030878C>T	ENSP00000342518:p.Gly514Glu	Somatic	0	54	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A6NDQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMT,pfam_SLC35_F1/F2/F6	p.G514E	ENST00000339762.6	37	c.1541		14	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730571	0.89390	.	.	ENSG00000151812	ENST00000556826;ENST00000339762;ENST00000554729	T;T;T	0.55413	0.66;0.52;0.87	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.69196	0.3084	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71813	-0.4479	10	0.87932	D	0	-11.8453	18.9565	0.92661	0.0:1.0:0.0:0.0	.	514	A4IF30	S35F4_HUMAN	E	478;514;355	ENSP00000452086:G478E;ENSP00000342518:G514E;ENSP00000451990:G355E	ENSP00000342518:G514E	G	-	2	0	SLC35F4	57100631	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.532000	0.85374	0.563000	0.77884	GGG	-	NULL		0.453	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	protein_coding		C	XM_292260	-		58030878	-1	no_errors	ENST00000339762	ensembl	human	known	74_37	missense	SNP	1.000	T
ANXA8L1	728113	genome.wustl.edu	37	10	47754779	47754779	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:47754779G>A	ENST00000374277.5	+	5	508	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	ANXA8L2_ENST00000449464.2_Missense_Mutation_p.R129Q|ANXA8L2_ENST00000340243.6_Intron|ANXA8L2_ENST00000538825.1_Missense_Mutation_p.R67Q|AL603965.1_ENST00000335083.5_Intron	NM_001630.2	NP_001621.2														endometrium(1)|pancreas(1)	2						AACCAGCTGCGGGAGATAATG	0.567																																																	0								ENSG00000186807						6.0	6.0	6.0					10																	47754779		1932	4036	5968	ANXA8L2	SO:0001583	missense	0			-	HGNC																												ENST00000374277.5:c.386G>A	10.37:g.47754779G>A	ENSP00000363395:p.Arg129Gln	Somatic	0	82	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	8	57.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVIII,prints_AnnexinIII	p.R129Q	ENST00000374277.5	37	c.386	CCDS7216.1	10	.	.	.	.	.	.	.	.	.	.	.	6.665	0.491230	0.12702	.	.	ENSG00000186807	ENST00000374277;ENST00000449464;ENST00000538825	T;T;T	0.03124	4.04;4.04;4.04	2.12	-1.4	0.08968	Annexin repeat, conserved site (1);	1.266630	0.05483	N	0.555198	T	0.02767	0.0083	N	0.13299	0.325	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.47736	-0.9094	10	0.39692	T	0.17	.	7.4882	0.27445	0.3637:0.0:0.6363:0.0	.	129	Q5VT79	AXA82_HUMAN	Q	129;129;67	ENSP00000363395:R129Q;ENSP00000407079:R129Q;ENSP00000440742:R67Q	ENSP00000363395:R129Q	R	+	2	0	ANXA8L2	47224785	0.000000	0.05858	0.683000	0.30040	0.553000	0.35397	-0.650000	0.05378	-0.760000	0.04677	-0.974000	0.02594	CGG	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinIII		0.567	ANXA8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA8L2	protein_coding	OTTHUMT00000047866.1	G		-		47754779	+1	no_errors	ENST00000374277	ensembl	human	known	74_37	missense	SNP	0.524	A
DCSTAMP	81501	genome.wustl.edu	37	8	105367322	105367322	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:105367322G>A	ENST00000297581.2	+	3	1296	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H	DCSTAMP_ENST00000517991.1_Intron|DCSTAMP_ENST00000520080.1_3'UTR|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	416					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GAGAGGAAGCGCATCCAATAT	0.443																																																	0								ENSG00000164935						121.0	120.0	120.0					8																	105367322		2203	4300	6503	DCSTAMP	SO:0001583	missense	0			-	HGNC	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1247G>A	8.37:g.105367322G>A	ENSP00000297581:p.Arg416His	Somatic	0	54	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	p.R416H	ENST00000297581.2	37	c.1247	CCDS6301.1	8	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649229	0.67358	.	.	ENSG00000164935	ENST00000297581	T	0.78364	-1.17	5.44	5.44	0.79542	Dendritic cell-specific transmembrane protein-like (1);	0.000000	0.85682	D	0.000000	D	0.88808	0.6537	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89834	0.3998	10	0.87932	D	0	-17.4	17.7975	0.88577	0.0:0.0:1.0:0.0	.	416	Q9H295	TM7S4_HUMAN	H	416	ENSP00000297581:R416H	ENSP00000297581:R416H	R	+	2	0	TM7SF4	105436498	0.997000	0.39634	0.132000	0.22025	0.185000	0.23345	7.776000	0.85560	2.700000	0.92200	0.655000	0.94253	CGC	-	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom		0.443	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	protein_coding	OTTHUMT00000380810.1	G	NM_030788	-		105367322	+1	no_errors	ENST00000297581	ensembl	human	known	74_37	missense	SNP	0.903	A
FAM198A	729085	genome.wustl.edu	37	3	43074191	43074191	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:43074191C>T	ENST00000430121.2	+	2	531	c.436C>T	c.(436-438)Cca>Tca	p.P146S	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	146						extracellular region (GO:0005576)				endometrium(1)	1						GGTTGGAGATCCAGGAACCAA	0.572																																																	0								ENSG00000144649						83.0	78.0	80.0					3																	43074191		692	1591	2283	FAM198A	SO:0001583	missense	0			-	HGNC	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.436C>T	3.37:g.43074191C>T	ENSP00000407301:p.Pro146Ser	Somatic	0	71	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	30	33.33	B3KR48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P146S	ENST00000430121.2	37	c.436	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	C	6.996	0.553967	0.13374	.	.	ENSG00000144649	ENST00000430121	T	0.27720	1.65	4.39	2.47	0.30058	.	0.312477	0.23185	N	0.050967	T	0.21062	0.0507	L	0.32530	0.975	0.09310	N	1	B	0.24368	0.102	B	0.21151	0.033	T	0.16867	-1.0388	9	.	.	.	-15.1449	10.7186	0.46028	0.0:0.6057:0.3943:0.0	.	146	Q9UFP1	F198A_HUMAN	S	146	ENSP00000407301:P146S	.	P	+	1	0	FAM198A	43049195	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.325000	0.07976	0.356000	0.24157	-0.282000	0.10007	CCA	-	NULL		0.572	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	protein_coding	OTTHUMT00000344240.3	C	NM_001129908	-		43074191	+1	no_errors	ENST00000273146	ensembl	human	known	74_37	missense	SNP	0.000	T
ASPM	259266	genome.wustl.edu	37	1	197073160	197073160	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:197073160C>T	ENST00000367409.4	-	18	5477	c.5221G>A	c.(5221-5223)Gga>Aga	p.G1741R	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1741	IQ 6. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACAAGGTATCCTCTAACAAAT	0.378																																																	0								ENSG00000066279						120.0	122.0	121.0					1																	197073160		2203	4299	6502	ASPM	SO:0001583	missense	0			-	HGNC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5221G>A	1.37:g.197073160C>T	ENSP00000356379:p.Gly1741Arg	Somatic	0	87	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.G1741R	ENST00000367409.4	37	c.5221	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043951	0.55110	.	.	ENSG00000066279	ENST00000367409	T	0.41065	1.01	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77332	-0.2627	10	0.41790	T	0.15	.	14.5745	0.68235	0.0:0.9305:0.0:0.0694	.	1741	Q8IZT6	ASPM_HUMAN	R	1741	ENSP00000356379:G1741R	ENSP00000356379:G1741R	G	-	1	0	ASPM	195339783	1.000000	0.71417	0.940000	0.37924	0.402000	0.30811	5.617000	0.67716	2.843000	0.97960	0.585000	0.79938	GGA	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.378	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	protein_coding	OTTHUMT00000088256.1	C	NM_018136	-		197073160	-1	no_errors	ENST00000367409	ensembl	human	known	74_37	missense	SNP	1.000	T
NFATC2	4773	genome.wustl.edu	37	20	50092070	50092070	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:50092070G>T	ENST00000396009.3	-	4	1679	c.1460C>A	c.(1459-1461)aCc>aAc	p.T487N	NFATC2_ENST00000609943.1_Missense_Mutation_p.T467N|NFATC2_ENST00000610033.1_Missense_Mutation_p.T268N|NFATC2_ENST00000371564.3_Missense_Mutation_p.T487N|NFATC2_ENST00000609507.1_Missense_Mutation_p.T268N|NFATC2_ENST00000414705.1_Missense_Mutation_p.T467N	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	487	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CTCATAGCTGGTGGTGGTGAC	0.552																																																	0								ENSG00000101096						230.0	224.0	226.0					20																	50092070		2203	4300	6503	NFATC2	SO:0001583	missense	0			-	HGNC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1460C>A	20.37:g.50092070G>T	ENSP00000379330:p.Thr487Asn	Somatic	0	171	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.T487N	ENST00000396009.3	37	c.1460	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872204	0.72180	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.41065	1.01;1.01;1.01	5.26	4.3	0.51218	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.100497	0.64402	D	0.000002	T	0.49064	0.1535	N	0.16478	0.41	0.47621	D	0.999477	P;D;P;P	0.76494	0.868;0.999;0.787;0.787	P;D;P;P	0.83275	0.678;0.996;0.678;0.678	T	0.56968	-0.7891	10	0.87932	D	0	-34.584	15.3026	0.73966	0.0:0.0:0.8589:0.1411	.	467;467;487;487	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	N	487;487;268;467	ENSP00000360619:T487N;ENSP00000379330:T487N;ENSP00000396471:T467N	ENSP00000360619:T487N	T	-	2	0	NFATC2	49525477	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.930000	0.87610	1.197000	0.43143	-0.175000	0.13238	ACC	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD		0.552	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	protein_coding	OTTHUMT00000079730.2	G	NM_012340	-		50092070	-1	no_errors	ENST00000396009	ensembl	human	known	74_37	missense	SNP	1.000	T
SYCP2	10388	genome.wustl.edu	37	20	58476847	58476847	+	Missense_Mutation	SNP	A	A	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:58476847A>G	ENST00000357552.3	-	16	1277	c.1052T>C	c.(1051-1053)cTa>cCa	p.L351P	SYCP2_ENST00000371001.2_Missense_Mutation_p.L351P			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	351					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATTGTCAGTAGCTTCTTTGA	0.308																																																	0								ENSG00000196074						67.0	65.0	66.0					20																	58476847		2199	4281	6480	SYCP2	SO:0001583	missense	0			-	HGNC	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1052T>C	20.37:g.58476847A>G	ENSP00000350162:p.Leu351Pro	Somatic	0	86	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	4	87.10	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L351P	ENST00000357552.3	37	c.1052	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471882	0.63737	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.22336	2.2;2.2;1.96	5.78	5.78	0.91487	.	0.121018	0.37393	N	0.002118	T	0.44117	0.1278	M	0.65975	2.015	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.71870	0.944;0.975	T	0.39396	-0.9616	10	0.87932	D	0	-2.9631	13.6269	0.62170	1.0:0.0:0.0:0.0	.	351;351	A2A341;Q9BX26	.;SYCP2_HUMAN	P	351	ENSP00000360040:L351P;ENSP00000350162:L351P;ENSP00000402456:L351P	ENSP00000350162:L351P	L	-	2	0	SYCP2	57910242	1.000000	0.71417	0.942000	0.38095	0.816000	0.46133	6.124000	0.71620	2.191000	0.70037	0.528000	0.53228	CTA	-	NULL		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	A	NM_014258	-		58476847	-1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	SNP	0.996	G
RAD51AP2	729475	genome.wustl.edu	37	2	17696723	17696723	+	Missense_Mutation	SNP	A	A	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr2:17696723A>T	ENST00000399080.2	-	1	2983	c.2960T>A	c.(2959-2961)cTt>cAt	p.L987H		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	987										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGTGCTTAGAAGTTCATTTTC	0.318																																																	0								ENSG00000214842						98.0	93.0	94.0					2																	17696723		1811	4076	5887	RAD51AP2	SO:0001583	missense	0			-	HGNC	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2960T>A	2.37:g.17696723A>T	ENSP00000382030:p.Leu987His	Somatic	0	22	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L987H	ENST00000399080.2	37	c.2960	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	A	10.49	1.364708	0.24684	.	.	ENSG00000214842	ENST00000399080	T	0.27402	1.67	5.17	-3.37	0.04898	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23904	-1.0175	9	0.87932	D	0	-0.4452	1.4532	0.02380	0.2718:0.1036:0.3264:0.2982	.	987	Q09MP3	R51A2_HUMAN	H	987	ENSP00000382030:L987H	ENSP00000382030:L987H	L	-	2	0	RAD51AP2	17560204	0.995000	0.38212	0.459000	0.27081	0.788000	0.44548	0.930000	0.28858	-0.486000	0.06744	-0.290000	0.09829	CTT	-	NULL		0.318	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	protein_coding	OTTHUMT00000323801.3	A	NM_001099218	-		17696723	-1	no_errors	ENST00000399080	ensembl	human	known	74_37	missense	SNP	0.007	T
HAS2	3037	genome.wustl.edu	37	8	122629430	122629430	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:122629430G>T	ENST00000303924.4	-	3	1181	c.644C>A	c.(643-645)aCt>aAt	p.T215N		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	215					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			GTCAAGCATAGTGTCTGAATC	0.398																																																	0								ENSG00000170961						120.0	109.0	113.0					8																	122629430		2203	4300	6503	HAS2	SO:0001583	missense	0			-	HGNC	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.644C>A	8.37:g.122629430G>T	ENSP00000306991:p.Thr215Asn	Somatic	0	57	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q32MM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chitin_synth_fng	p.T215N	ENST00000303924.4	37	c.644	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888336	0.91814	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.60299	0.2	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.82999	0.5159	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.87324	0.2320	10	0.87932	D	0	-16.4652	19.3687	0.94475	0.0:0.0:1.0:0.0	.	215	Q92819	HAS2_HUMAN	N	215	ENSP00000306991:T215N	ENSP00000306991:T215N	T	-	2	0	HAS2	122698611	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.471000	0.97696	2.573000	0.86826	0.561000	0.74099	ACT	-	pfam_Chitin_synth_fng		0.398	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	protein_coding	OTTHUMT00000381150.2	G	NM_005328	-		122629430	-1	no_errors	ENST00000303924	ensembl	human	known	74_37	missense	SNP	1.000	T
INSC	387755	genome.wustl.edu	37	11	15267818	15267818	+	3'UTR	SNP	G	G	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr11:15267818G>C	ENST00000379554.3	+	0	2018				INSC_ENST00000528567.1_3'UTR|INSC_ENST00000379556.3_3'UTR|INSC_ENST00000424273.1_3'UTR	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)						establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TTCAGTTGCAGATGTTGAAAT	0.323																																																	0								ENSG00000188487																																			INSC	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.*232G>C	11.37:g.15267818G>C		Somatic	0	59	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379554.3	37	NULL	CCDS41621.1	11																																																																																			-	-		0.323	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	protein_coding	OTTHUMT00000386590.1	G	NM_001031853	-		15267818	+1	no_errors	ENST00000526102	ensembl	human	known	74_37	rna	SNP	0.999	C
FAM81B	153643	genome.wustl.edu	37	5	94728590	94728590	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:94728590C>G	ENST00000283357.5	+	2	263	c.217C>G	c.(217-219)Caa>Gaa	p.Q73E	FAM81B_ENST00000506418.1_3'UTR	NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	73						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		AGACAATAACCAAGAAAAGAA	0.388																																																	0								ENSG00000153347						43.0	42.0	43.0					5																	94728590		1831	4085	5916	FAM81B	SO:0001583	missense	0			-	HGNC		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.217C>G	5.37:g.94728590C>G	ENSP00000283357:p.Gln73Glu	Somatic	0	99	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	102	23.31		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q73E	ENST00000283357.5	37	c.217	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947883	0.34377	.	.	ENSG00000153347	ENST00000283357	T	0.18960	2.18	5.69	0.617	0.17619	.	0.772034	0.11825	N	0.525818	T	0.17450	0.0419	M	0.62723	1.935	0.21473	N	0.999677	B	0.09022	0.002	B	0.09377	0.004	T	0.25537	-1.0129	10	0.30078	T	0.28	-1.333	3.0158	0.06059	0.2369:0.3903:0.2849:0.0879	.	73	Q96LP2	FA81B_HUMAN	E	73	ENSP00000283357:Q73E	ENSP00000283357:Q73E	Q	+	1	0	FAM81B	94754346	0.995000	0.38212	0.998000	0.56505	0.831000	0.47069	0.390000	0.20768	0.704000	0.31869	0.563000	0.77884	CAA	-	NULL		0.388	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	protein_coding	OTTHUMT00000370690.1	C	NM_152548	-		94728590	+1	no_errors	ENST00000283357	ensembl	human	known	74_37	missense	SNP	0.848	G
CFDP1	10428	genome.wustl.edu	37	16	75327731	75327732	+	3'UTR	INS	-	-	A	rs149574560		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:75327731_75327732insA	ENST00000283882.3	-	0	1150_1151					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CTTCAATGTAGAAAAAAAAAAG	0.307																																																	0								ENSG00000153774																																			CFDP1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*119->T	16.37:g.75327741_75327741dupA		Somatic	0	48	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	61	8.96	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																			-	-		0.307	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	protein_coding	OTTHUMT00000269031.2	-	NM_006324			75327732	-1	no_errors	ENST00000570103	ensembl	human	known	74_37	rna	INS	0.904:0.940	A
KDM4B	23030	genome.wustl.edu	37	19	5077423	5077423	+	Missense_Mutation	SNP	A	A	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:5077423A>C	ENST00000159111.4	+	8	940	c.722A>C	c.(721-723)cAt>cCt	p.H241P	KDM4B_ENST00000381759.4_Missense_Mutation_p.H241P|KDM4B_ENST00000536461.1_Missense_Mutation_p.H241P|KDM4B_ENST00000592175.1_3'UTR	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	241	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TTCCTGCGGCATAAGATGACC	0.652																																																	0								ENSG00000127663						135.0	137.0	137.0					19																	5077423		2203	4300	6503	KDM4B	SO:0001583	missense	0			-	HGNC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.722A>C	19.37:g.5077423A>C	ENSP00000159111:p.His241Pro	Somatic	0	116	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	116	10.77	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.H241P	ENST00000159111.4	37	c.722	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	A	23.9	4.475045	0.84640	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.70986	-0.53;-0.53;-0.53	4.52	4.52	0.55395	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.89245	0.6660	H	0.97340	3.985	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.92759	0.6222	10	0.87932	D	0	-45.6696	13.8579	0.63540	1.0:0.0:0.0:0.0	.	241;241;241	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	P	241	ENSP00000159111:H241P;ENSP00000371178:H241P;ENSP00000440495:H241P	ENSP00000159111:H241P	H	+	2	0	KDM4B	5028423	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.172000	0.94808	1.679000	0.50963	0.379000	0.24179	CAT	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	protein_coding	OTTHUMT00000450558.1	A	NM_015015	-		5077423	+1	no_errors	ENST00000159111	ensembl	human	known	74_37	missense	SNP	1.000	C
SPTBN2	6712	genome.wustl.edu	37	11	66475241	66475241	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr11:66475241G>T	ENST00000533211.1	-	13	1730	c.1399C>A	c.(1399-1401)Cac>Aac	p.H467N	SPTBN2_ENST00000529997.1_Missense_Mutation_p.H467N|SPTBN2_ENST00000309996.2_Missense_Mutation_p.H467N			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	467					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						ATGGCTTCGTGCTTCCGTACT	0.652																																																	0								ENSG00000173898						57.0	50.0	53.0					11																	66475241		2200	4295	6495	SPTBN2	SO:0001583	missense	0			-	HGNC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1399C>A	11.37:g.66475241G>T	ENSP00000432568:p.His467Asn	Somatic	0	74	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	O14872|O14873	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.H467N	ENST00000533211.1	37	c.1399	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900800	0.92035	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.58652	0.32;0.32;0.32	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.81522	0.4840	H	0.94886	3.595	0.80722	D	1	D	0.60160	0.987	D	0.67231	0.95	D	0.87465	0.2410	10	0.87932	D	0	.	15.8632	0.79040	0.0:0.0:1.0:0.0	.	467	O15020	SPTN2_HUMAN	N	467	ENSP00000432568:H467N;ENSP00000311489:H467N;ENSP00000433593:H467N	ENSP00000311489:H467N	H	-	1	0	SPTBN2	66231817	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.510000	0.98004	2.258000	0.74832	0.462000	0.41574	CAC	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.652	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	protein_coding	OTTHUMT00000393892.2	G	NM_006946	-		66475241	-1	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDH20	64881	genome.wustl.edu	37	13	61986224	61986224	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr13:61986224G>A	ENST00000409186.1	-	5	4113	c.2008C>T	c.(2008-2010)Cga>Tga	p.R670*	PCDH20_ENST00000409204.4_Nonsense_Mutation_p.R670*			Q8N6Y1	PCD20_HUMAN	protocadherin 20	670	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CATCCATTTCGTCCAGCGTCA	0.448																																																	0								ENSG00000197991						93.0	91.0	91.0					13																	61986224		2203	4300	6503	PCDH20	SO:0001587	stop_gained	0			-	HGNC	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2008C>T	13.37:g.61986224G>A	ENSP00000386653:p.Arg670*	Somatic	0	33	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R670*	ENST00000409186.1	37	c.2008	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	G	39	7.657066	0.98415	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	.	.	.	5.94	3.09	0.35607	.	0.527931	0.17356	N	0.177208	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	14.8811	0.70534	0.0:0.0:0.6245:0.3755	.	.	.	.	X	670;670;416	.	ENSP00000351500:R416X	R	-	1	2	PCDH20	60884225	0.035000	0.19736	0.206000	0.23566	0.717000	0.41224	1.392000	0.34486	0.316000	0.23135	0.557000	0.71058	CGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.448	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	protein_coding	OTTHUMT00000333054.2	G	NM_022843	-		61986224	-1	no_errors	ENST00000409186	ensembl	human	known	74_37	nonsense	SNP	0.907	A
MYH11	4629	genome.wustl.edu	37	16	15850274	15850274	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:15850274C>T	ENST00000300036.5	-	14	1782	c.1673G>A	c.(1672-1674)gGc>gAc	p.G558D	MYH11_ENST00000396324.3_Missense_Mutation_p.G565D|MYH11_ENST00000576790.2_Missense_Mutation_p.G558D|MYH11_ENST00000452625.2_Missense_Mutation_p.G565D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	558	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.G558D(1)|p.Q557_S559delQGS(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGGGTGGCTGCCCTGCTCCGT	0.587			T	CBFB	AML						OREG0023636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(1)|Deletion - In frame(1)	prostate(2)						ENSG00000133392						123.0	97.0	106.0					16																	15850274		2197	4300	6497	MYH11	SO:0001583	missense	0			-	HGNC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1673G>A	16.37:g.15850274C>T	ENSP00000300036:p.Gly558Asp	Somatic	0	141	0.00	705	0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	72	12.05	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.G565D	ENST00000300036.5	37	c.1694	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272246	0.80580	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.37	4.35	0.52113	Myosin head, motor domain (2);	0.286130	0.32655	N	0.005818	D	0.91503	0.7317	L	0.59436	1.845	0.80722	D	1	P;P;P;B;D;B	0.57899	0.892;0.756;0.756;0.348;0.981;0.348	P;P;P;P;D;D	0.74023	0.758;0.768;0.768;0.768;0.947;0.982	D	0.92193	0.5761	10	0.87932	D	0	.	14.6177	0.68560	0.0:0.8537:0.1463:0.0	.	565;558;558;565;558;565	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	D	558;558;565;565;565	ENSP00000300036:G558D;ENSP00000345136:G558D;ENSP00000379616:G565D;ENSP00000407821:G565D	ENSP00000300036:G558D	G	-	2	0	MYH11	15757775	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.754000	0.62191	2.518000	0.84900	0.555000	0.69702	GGC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.587	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	C	NM_001040113	-		15850274	-1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	SNP	1.000	T
CENPC	1060	genome.wustl.edu	37	4	68338334	68338334	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:68338334T>A	ENST00000273853.6	-	19	3071	c.2821A>T	c.(2821-2823)Ata>Tta	p.I941L		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	941	MIF2 homology domain III.				chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										CATCTTTTTATCTGAGTAAAA	0.239																																																	0								ENSG00000145241						26.0	24.0	25.0					4																	68338334		1684	3895	5579	CENPC	SO:0001583	missense	0			-	HGNC	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2821A>T	4.37:g.68338334T>A	ENSP00000273853:p.Ile941Leu	Somatic	0	184	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	113	60	64.94	Q8IW27|Q9P0M5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mif2/CENP-C_cupin,pfam_Cupin_2,superfamily_RmlC_Cupin	p.I941L	ENST00000273853.6	37	c.2821	CCDS47063.1	4	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059418	0.36373	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.45	4.45	0.53987	.	0.116384	0.37715	N	0.001962	T	0.29524	0.0736	N	0.20986	0.625	0.32107	N	0.589801	B	0.26708	0.157	B	0.15870	0.014	T	0.31998	-0.9923	9	0.23891	T	0.37	-19.5767	10.0283	0.42085	0.0:0.0:0.0:1.0	.	941	Q03188	CENPC_HUMAN	L	941	.	ENSP00000273853:I941L	I	-	1	0	CENPC1	68020929	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.559000	0.45888	1.853000	0.53794	0.402000	0.26972	ATA	-	NULL		0.239	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPC	protein_coding	OTTHUMT00000362001.2	T		-		68338334	-1	no_errors	ENST00000273853	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF536	9745	genome.wustl.edu	37	19	31038939	31038939	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:31038939C>T	ENST00000355537.3	+	4	2560	c.2413C>T	c.(2413-2415)Cgg>Tgg	p.R805W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	805					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCATCGGGAGCGGCAGAACGG	0.537																																																	0								ENSG00000198597						67.0	73.0	71.0					19																	31038939		2203	4300	6503	ZNF536	SO:0001583	missense	0			-	HGNC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2413C>T	19.37:g.31038939C>T	ENSP00000347730:p.Arg805Trp	Somatic	0	54	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	A2RU18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R805W	ENST00000355537.3	37	c.2413	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200011	0.38905	.	.	ENSG00000198597	ENST00000355537	T	0.08984	3.03	5.98	2.55	0.30701	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.17789	0.0427	L	0.32530	0.975	0.45172	D	0.998183	D;D	0.89917	1.0;1.0	D;D	0.65987	0.94;0.94	T	0.00617	-1.1642	10	0.87932	D	0	-19.5882	15.7677	0.78141	0.5855:0.4145:0.0:0.0	.	805;805	A7E228;O15090	.;ZN536_HUMAN	W	805	ENSP00000347730:R805W	ENSP00000347730:R805W	R	+	1	2	ZNF536	35730779	1.000000	0.71417	0.993000	0.49108	0.690000	0.40134	2.364000	0.44187	0.364000	0.24374	0.591000	0.81541	CGG	-	pfscan_Znf_C2H2		0.537	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717	-		31038939	+1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM230A	653203	genome.wustl.edu	37	22	20709420	20709420	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr22:20709420C>G	ENST00000434783.3	+	8	1336	c.1152C>G	c.(1150-1152)aaC>aaG	p.N384K	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		GCATCGCTAACGAGGACGCCG	0.706																																																	0								ENSG00000188280																																			FAM230A	SO:0001583	missense	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1152C>G	22.37:g.20709420C>G	ENSP00000463576:p.Asn384Lys	Somatic	1	111	0.89		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	79	8.14		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.N384K	ENST00000434783.3	37	c.1152		22																																																																																			-	superfamily_Kinase-like_dom		0.706	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	C		-		20709420	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	SNP	0.000	G
CALML6	163688	genome.wustl.edu	37	1	1848446	1848446	+	Silent	SNP	C	C	T	rs375295754		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:1848446C>T	ENST00000307786.3	+	5	886	c.432C>T	c.(430-432)aaC>aaT	p.N144N	CALML6_ENST00000462293.1_3'UTR	NM_138705.2	NP_619650.2	Q8TD86	CALL6_HUMAN	calmodulin-like 6	144	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		AGCCCCTCAACGAGGTGGAGG	0.672																																																	0								ENSG00000169885	C		0,4406		0,0,2203	72.0	61.0	65.0		432	-6.0	0.0	1		65	1,8595		0,1,4297	no	coding-synonymous	CALML6	NM_138705.2		0,1,6500	TT,TC,CC		0.0116,0.0,0.0077		144/182	1848446	1,13001	2203	4298	6501	CALML6	SO:0001819	synonymous_variant	0			-	HGNC	AF490905	CCDS30566.1	1p36.33	2013-01-10			ENSG00000169885	ENSG00000169885		"""EF-hand domain containing"""	24193	protein-coding gene	gene with protein product		610171					Standard	NM_138705		Approved	CAGLP	uc001aih.1	Q8TD86	OTTHUMG00000000943	ENST00000307786.3:c.432C>T	1.37:g.1848446C>T		Somatic	0	196	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	72	28.71	A2A2M3|Q6Q2C4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.N144	ENST00000307786.3	37	c.432	CCDS30566.1	1																																																																																			-	pfscan_EF_hand_dom		0.672	CALML6-004	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	CALML6	protein_coding	OTTHUMT00000276929.1	C	NM_138705	-		1848446	+1	no_errors	ENST00000307786	ensembl	human	known	74_37	silent	SNP	0.011	T
TARS2	80222	genome.wustl.edu	37	1	150469344	150469344	+	Missense_Mutation	SNP	G	G	A	rs367984492		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:150469344G>A	ENST00000369064.3	+	9	1014	c.980G>A	c.(979-981)cGa>cAa	p.R327Q	TARS2_ENST00000369054.2_Intron|TARS2_ENST00000463555.1_Intron|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	327					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TTCCTGCCACGAGGGACAAGG	0.537																																																	0								ENSG00000143374						77.0	68.0	71.0					1																	150469344		2203	4300	6503	TARS2	SO:0001583	missense	0			-	HGNC	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.980G>A	1.37:g.150469344G>A	ENSP00000358060:p.Arg327Gln	Somatic	0	88	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.R327Q	ENST00000369064.3	37	c.980	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013717	0.93404	.	.	ENSG00000143374	ENST00000369064	.	.	.	5.38	5.38	0.77491	.	0.252179	0.33290	N	0.005061	T	0.60508	0.2274	M	0.73319	2.225	0.80722	D	1	D	0.69078	0.997	P	0.53954	0.738	T	0.64918	-0.6294	9	0.62326	D	0.03	-18.1837	13.2495	0.60043	0.0768:0.0:0.9232:0.0	.	327	Q9BW92	SYTM_HUMAN	Q	327	.	ENSP00000358060:R327Q	R	+	2	0	TARS2	148735968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.867000	0.63013	2.801000	0.96364	0.655000	0.94253	CGA	-	tigrfam_Thr-tRNA-ligase_IIa		0.537	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	protein_coding	OTTHUMT00000035847.1	G	NM_025150	-		150469344	+1	no_errors	ENST00000369064	ensembl	human	known	74_37	missense	SNP	1.000	A
PCNT	5116	genome.wustl.edu	37	21	47852034	47852034	+	Missense_Mutation	SNP	G	G	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr21:47852034G>C	ENST00000359568.5	+	38	8763	c.8656G>C	c.(8656-8658)Gaa>Caa	p.E2886Q	PCNT_ENST00000480896.1_Intron	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2886					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GAAAGAGCAAGAAGGACGCAA	0.592																																																	0								ENSG00000160299						59.0	53.0	55.0					21																	47852034		2203	4300	6503	PCNT	SO:0001583	missense	0			-	HGNC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8656G>C	21.37:g.47852034G>C	ENSP00000352572:p.Glu2886Gln	Somatic	0	20	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	O43152|Q7Z7C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PACT_domain	p.E2886Q	ENST00000359568.5	37	c.8656	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339984	0.41398	.	.	ENSG00000160299	ENST00000359568	T	0.01484	4.84	5.15	4.27	0.50696	.	.	.	.	.	T	0.02418	0.0074	N	0.19112	0.55	0.09310	N	1	D	0.56035	0.974	P	0.49140	0.601	T	0.56147	-0.8027	9	0.27785	T	0.31	.	12.9147	0.58199	0.0786:0.0:0.9214:0.0	.	2886	O95613	PCNT_HUMAN	Q	2886	ENSP00000352572:E2886Q	ENSP00000352572:E2886Q	E	+	1	0	PCNT	46676462	0.777000	0.28628	0.002000	0.10522	0.008000	0.06430	2.254000	0.43214	1.316000	0.45131	0.655000	0.94253	GAA	-	NULL		0.592	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	protein_coding	OTTHUMT00000207336.1	G	NM_006031	-		47852034	+1	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	SNP	0.022	C
ITGA3	3675	genome.wustl.edu	37	17	48153819	48153819	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr17:48153819G>A	ENST00000320031.8	+	13	2134	c.1804G>A	c.(1804-1806)Gct>Act	p.A602T	ITGA3_ENST00000544892.1_3'UTR|ITGA3_ENST00000007722.7_Missense_Mutation_p.A602T	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	602					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CCAGGCACAGGCTCTGGAGAA	0.662																																																	0								ENSG00000005884						90.0	102.0	98.0					17																	48153819		2203	4299	6502	ITGA3	SO:0001583	missense	0			-	HGNC	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.1804G>A	17.37:g.48153819G>A	ENSP00000315190:p.Ala602Thr	Somatic	0	36	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.A602T	ENST00000320031.8	37	c.1804	CCDS11558.1	17	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152638	0.57259	.	.	ENSG00000005884	ENST00000007722;ENST00000538917;ENST00000320031	T;T	0.45668	0.89;0.89	5.3	-2.11	0.07187	Integrin alpha-2 (1);	0.835419	0.11174	N	0.591671	T	0.29288	0.0729	L	0.53249	1.67	0.80722	D	1	B;B	0.12013	0.001;0.005	B;B	0.14023	0.003;0.01	T	0.33675	-0.9859	10	0.44086	T	0.13	.	0.3707	0.00379	0.2523:0.1826:0.3218:0.2433	.	602;602	P26006-1;P26006	.;ITA3_HUMAN	T	602;588;602	ENSP00000007722:A602T;ENSP00000315190:A602T	ENSP00000007722:A602T	A	+	1	0	ITGA3	45508818	0.052000	0.20516	0.978000	0.43139	0.932000	0.56968	0.046000	0.14035	-0.112000	0.11979	-0.824000	0.03097	GCT	-	pfam_Integrin_alpha-2		0.662	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	protein_coding	OTTHUMT00000366298.1	G	NM_005501	-		48153819	+1	no_errors	ENST00000320031	ensembl	human	known	74_37	missense	SNP	0.818	A
UBXN10	127733	genome.wustl.edu	37	1	20517707	20517707	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:20517707C>A	ENST00000375099.3	+	2	737	c.653C>A	c.(652-654)aCa>aAa	p.T218K		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	218	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						TTCCGGCCAACAGATGATTTG	0.498																																																	0								ENSG00000162543						102.0	98.0	100.0					1																	20517707		2203	4300	6503	UBXN10	SO:0001583	missense	0			-	HGNC	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.653C>A	1.37:g.20517707C>A	ENSP00000364240:p.Thr218Lys	Somatic	0	45	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	Q5R386	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,smart_UBX,pfscan_UBX	p.T218K	ENST00000375099.3	37	c.653	CCDS205.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947595	0.73787	.	.	ENSG00000162543	ENST00000375099	.	.	.	5.03	4.1	0.47936	UBX (3);	0.306644	0.26931	N	0.021767	T	0.69584	0.3127	M	0.62723	1.935	0.38663	D	0.952113	D	0.63880	0.993	P	0.61070	0.883	T	0.75671	-0.3237	9	0.72032	D	0.01	-9.4547	13.914	0.63885	0.0:0.8403:0.1596:0.0	.	218	Q96LJ8	UBX10_HUMAN	K	218	.	ENSP00000364240:T218K	T	+	2	0	UBXN10	20390294	0.977000	0.34250	0.722000	0.30670	0.991000	0.79684	4.088000	0.57678	1.306000	0.44926	0.591000	0.81541	ACA	-	pfam_UBX,smart_UBX,pfscan_UBX		0.498	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN10	protein_coding	OTTHUMT00000007693.1	C	NM_152376	-		20517707	+1	no_errors	ENST00000375099	ensembl	human	known	74_37	missense	SNP	0.962	A
MAST1	22983	genome.wustl.edu	37	19	12977542	12977542	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:12977542G>T	ENST00000251472.4	+	18	2144	c.2105G>T	c.(2104-2106)cGc>cTc	p.R702L		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GTGGAAATCCGCCAGTTCTCT	0.622																																																	0								ENSG00000105613						85.0	56.0	66.0					19																	12977542		2203	4300	6503	MAST1	SO:0001583	missense	0			-	HGNC	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2105G>T	19.37:g.12977542G>T	ENSP00000251472:p.Arg702Leu	Somatic	0	32	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.R702L	ENST00000251472.4	37	c.2105	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401575	0.83120	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.22743	1.94	4.84	4.84	0.62591	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.162179	0.41097	D	0.000952	T	0.38081	0.1027	M	0.79805	2.47	0.41587	D	0.988773	P	0.49253	0.921	P	0.49752	0.621	T	0.34453	-0.9828	10	0.45353	T	0.12	-28.4494	15.8057	0.78506	0.0:0.0:1.0:0.0	.	702	Q9Y2H9	MAST1_HUMAN	L	702	ENSP00000251472:R702L	ENSP00000251472:R702L	R	+	2	0	MAST1	12838542	0.886000	0.30341	1.000000	0.80357	0.997000	0.91878	3.803000	0.55560	2.405000	0.81733	0.557000	0.71058	CGC	-	superfamily_Kinase-like_dom		0.622	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	protein_coding	OTTHUMT00000451733.2	G	NM_014975	-		12977542	+1	no_errors	ENST00000251472	ensembl	human	known	74_37	missense	SNP	1.000	T
PARP2	10038	genome.wustl.edu	37	14	20822373	20822373	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr14:20822373G>A	ENST00000250416.5	+	8	796	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K	PARP2_ENST00000429687.3_Missense_Mutation_p.E244K|PARP2_ENST00000527915.1_Missense_Mutation_p.E257K	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	257	PARP alpha-helical. {ECO:0000255|PROSITE- ProRule:PRU00398}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		AATGATGATGGAAATGAAGTA	0.383								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0								ENSG00000129484						118.0	114.0	116.0					14																	20822373		1878	4094	5972	PARP2	SO:0001583	missense	0			-	HGNC	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.769G>A	14.37:g.20822373G>A	ENSP00000250416:p.Glu257Lys	Somatic	0	76	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	68	21.84	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.E257K	ENST00000250416.5	37	c.769	CCDS41910.1	14	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653401	0.88056	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.15487	2.42;2.42;2.42	5.29	4.36	0.52297	Poly(ADP-ribose) polymerase, regulatory domain (4);	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	M	0.89214	3.015	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.78314	0.991;0.925;0.955	T	0.47873	-0.9083	10	0.41790	T	0.15	-23.7972	14.3747	0.66865	0.0:0.0:0.8518:0.1482	.	170;244;257	B4DV82;Q9UGN5-2;Q9UGN5	.;.;PARP2_HUMAN	K	244;257;257	ENSP00000392972:E244K;ENSP00000250416:E257K;ENSP00000432283:E257K	ENSP00000250416:E257K	E	+	1	0	PARP2	19892213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.115000	0.71566	2.752000	0.94435	0.585000	0.79938	GAA	-	pfam_Poly(ADP-ribose)pol_reg_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,pfscan_Poly(ADP-ribose)pol_reg_dom		0.383	PARP2-002	KNOWN	basic|CCDS	protein_coding	PARP2	protein_coding	OTTHUMT00000387847.2	G		-		20822373	+1	no_errors	ENST00000250416	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC22A14	9389	genome.wustl.edu	37	3	38357847	38357847	+	Missense_Mutation	SNP	C	C	T	rs114208565	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:38357847C>T	ENST00000273173.4	+	9	1656	c.1565C>T	c.(1564-1566)tCg>tTg	p.S522L	SLC22A14_ENST00000448498.1_Missense_Mutation_p.S522L	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	522					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		TCTCTGGCCTCGGTGGCTGGA	0.627													C|||	2	0.000399361	0.0	0.0	5008	,	,		17943	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000144671	C	LEU/SER	0,4406		0,0,2203	102.0	82.0	89.0		1565	-7.2	0.0	3	dbSNP_132	89	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLC22A14	NM_004803.3	145	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	522/595	38357847	2,13004	2203	4300	6503	SLC22A14	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.1565C>T	3.37:g.38357847C>T	ENSP00000273173:p.Ser522Leu	Somatic	0	112	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S522L	ENST00000273173.4	37	c.1565	CCDS2677.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	3.036	-0.198501	0.06219	0.0	2.33E-4	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.74737	-0.87;-0.87	4.2	-7.15	0.01521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.717397	0.12855	N	0.433562	T	0.54398	0.1856	L	0.27053	0.805	0.09310	N	1	B	0.24533	0.105	B	0.26969	0.075	T	0.41538	-0.9503	10	0.51188	T	0.08	.	8.3481	0.32286	0.0:0.2372:0.4199:0.343	.	522	Q9Y267	S22AE_HUMAN	L	522;507;522	ENSP00000396283:S522L;ENSP00000273173:S522L	ENSP00000273173:S522L	S	+	2	0	SLC22A14	38332851	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.241000	0.08940	-1.571000	0.01663	-1.114000	0.02060	TCG	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.627	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	protein_coding	OTTHUMT00000253742.3	C	NM_004803	rs114208565		38357847	+1	no_errors	ENST00000273173	ensembl	human	known	74_37	missense	SNP	0.000	T
ADAMTS18	170692	genome.wustl.edu	37	16	77356258	77356258	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:77356258T>A	ENST00000282849.5	-	14	2556	c.2138A>T	c.(2137-2139)gAt>gTt	p.D713V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	713	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AATACAAACATCATTTTTGTT	0.418																																																	0								ENSG00000140873						175.0	158.0	164.0					16																	77356258		2198	4300	6498	ADAMTS18	SO:0001583	missense	0			-	HGNC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2138A>T	16.37:g.77356258T>A	ENSP00000282849:p.Asp713Val	Somatic	0	104	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	33	54.17	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D713V	ENST00000282849.5	37	c.2138	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203963	0.79127	.	.	ENSG00000140873	ENST00000282849	T	0.73681	-0.77	5.93	5.93	0.95920	.	0.107652	0.64402	D	0.000010	D	0.89914	0.6853	H	0.94847	3.59	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.76575	0.988;0.944	D	0.92540	0.6041	10	0.87932	D	0	.	15.5755	0.76380	0.0:0.0:0.0:1.0	.	713;713	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	713	ENSP00000282849:D713V	ENSP00000282849:D713V	D	-	2	0	ADAMTS18	75913759	1.000000	0.71417	0.776000	0.31678	0.972000	0.66771	4.813000	0.62620	2.281000	0.76405	0.533000	0.62120	GAT	-	prints_Peptidase_M12B_ADAM-TS		0.418	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	T		-		77356258	-1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	SNP	0.993	A
LRRK2	120892	genome.wustl.edu	37	12	40714914	40714914	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:40714914delT	ENST00000298910.7	+	35	5152	c.5094delT	c.(5092-5094)cctfs	p.P1698fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1698					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATGAAATGCCTTATTTTCCAA	0.378																																																	0								ENSG00000188906						168.0	162.0	164.0					12																	40714914		2203	4300	6503	LRRK2	SO:0001589	frameshift_variant	0				HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5094delT	12.37:g.40714914delT	ENSP00000298910:p.Pro1698fs	Somatic	0	113	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	33	49.23	A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.Y1699fs	ENST00000298910.7	37	c.5094	CCDS31774.1	12																																																																																			-	NULL		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	T	XM_058513			40714914	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	frame_shift_del	DEL	0.822	-
SKIV2L	6499	genome.wustl.edu	37	6	31934559	31934559	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr6:31934559C>T	ENST00000375394.2	+	19	2389	c.2276C>T	c.(2275-2277)gCc>gTc	p.A759V	SKIV2L_ENST00000544581.1_Missense_Mutation_p.A566V	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	759					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CGAGTGGATGCCCTCAGGGTG	0.567																																																	0								ENSG00000204351						114.0	101.0	106.0					6																	31934559		2203	4300	6503	SKIV2L	SO:0001583	missense	0			-	HGNC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2276C>T	6.37:g.31934559C>T	ENSP00000364543:p.Ala759Val	Somatic	0	87	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A759V	ENST00000375394.2	37	c.2276	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	C	27.2	4.806953	0.90623	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.51574	0.82;0.7	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.39436	0.1078	M	0.72894	2.215	0.80722	D	1	P	0.50943	0.94	B	0.40329	0.326	T	0.40232	-0.9574	10	0.37606	T	0.19	-23.7467	18.5346	0.91006	0.0:1.0:0.0:0.0	.	759	Q15477	SKIV2_HUMAN	V	759;601;566	ENSP00000364543:A759V;ENSP00000442645:A566V	ENSP00000364543:A759V	A	+	2	0	SKIV2L	32042538	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.757000	0.55212	2.755000	0.94549	0.655000	0.94253	GCC	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1		0.567	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	protein_coding	OTTHUMT00000076264.3	C		-		31934559	+1	no_errors	ENST00000375394	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRK	5796	genome.wustl.edu	37	6	128321224	128321225	+	Intron	INS	-	-	A	rs202179145|rs78615852	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr6:128321224_128321225insA	ENST00000368215.3	-	16	2491				PTPRK_ENST00000368213.5_Intron|PTPRK_ENST00000532331.1_Intron|PTPRK_ENST00000368226.4_Intron|PTPRK_ENST00000368207.3_Intron|PTPRK_ENST00000368227.3_Intron|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368210.3_Intron			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ACTTACCACTTAAAAAAAAAAA	0.297																																																	0								ENSG00000152894																																			PTPRK	SO:0001627	intron_variant	0				HGNC	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2492-1175->T	6.37:g.128321235_128321235dupA		Somatic	0	13	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368215.3	37	NULL		6																																																																																			-	-		0.297	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	-				128321225	-1	no_errors	ENST00000524481	ensembl	human	known	74_37	rna	INS	0.341:0.625	A
GPR25	2848	genome.wustl.edu	37	1	200842925	200842925	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:200842925G>T	ENST00000304244.2	+	1	843	c.760G>T	c.(760-762)Gtg>Ttg	p.V254L		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	254					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						GAGCACGTTTGTGGGCTCCTG	0.731																																																	0								ENSG00000170128						27.0	30.0	29.0					1																	200842925		2202	4297	6499	GPR25	SO:0001583	missense	0			-	HGNC	U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.760G>T	1.37:g.200842925G>T	ENSP00000301917:p.Val254Leu	Somatic	0	117	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A0AVJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V254L	ENST00000304244.2	37	c.760	CCDS1405.1	1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947945	0.34377	.	.	ENSG00000170128	ENST00000304244	T	0.73152	-0.72	4.66	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30101	U	0.010409	T	0.49355	0.1552	N	0.17764	0.52	0.29651	N	0.843993	B	0.25048	0.117	B	0.32393	0.145	T	0.43669	-0.9377	10	0.02654	T	1	-15.2964	8.6926	0.34275	0.2933:0.0:0.7067:0.0	.	254	O00155	GPR25_HUMAN	L	254	ENSP00000301917:V254L	ENSP00000301917:V254L	V	+	1	0	GPR25	199109548	0.018000	0.18449	1.000000	0.80357	0.919000	0.55068	0.758000	0.26447	0.949000	0.37715	0.462000	0.41574	GTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.731	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR25	protein_coding	OTTHUMT00000087056.1	G	NM_005298	-		200842925	+1	no_errors	ENST00000304244	ensembl	human	known	74_37	missense	SNP	0.998	T
NOTCH3	4854	genome.wustl.edu	37	19	15281256	15281256	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:15281256C>G	ENST00000263388.2	-	27	5075	c.5000G>C	c.(4999-5001)cGc>cCc	p.R1667P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1667					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CTCGCGCTTGCGCCGGGCCAC	0.672																																																	0								ENSG00000074181						38.0	44.0	42.0					19																	15281256		2203	4298	6501	NOTCH3	SO:0001583	missense	0			-	HGNC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5000G>C	19.37:g.15281256C>G	ENSP00000263388:p.Arg1667Pro	Somatic	0	47	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1667P	ENST00000263388.2	37	c.5000	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992491	0.93167	.	.	ENSG00000074181	ENST00000263388	D	0.89681	-2.55	3.69	3.69	0.42338	.	.	.	.	.	D	0.94785	0.8316	M	0.88241	2.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	D	0.95745	0.8787	9	0.87932	D	0	.	14.3463	0.66665	0.0:1.0:0.0:0.0	.	1667	Q9UM47	NOTC3_HUMAN	P	1667	ENSP00000263388:R1667P	ENSP00000263388:R1667P	R	-	2	0	NOTCH3	15142256	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.571000	0.82399	1.906000	0.55180	0.491000	0.48974	CGC	-	pirsf_Notch		0.672	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	C	NM_000435	-		15281256	-1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	SNP	0.998	G
DAGLA	747	genome.wustl.edu	37	11	61511829	61511829	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr11:61511829G>T	ENST00000257215.5	+	20	3113	c.2997G>T	c.(2995-2997)gaG>gaT	p.E999D	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	999					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCTCGGGTGAGCTCATGGACC	0.682																																																	0								ENSG00000134780						50.0	55.0	53.0					11																	61511829		2202	4299	6501	DAGLA	SO:0001583	missense	0			-	HGNC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2997G>T	11.37:g.61511829G>T	ENSP00000257215:p.Glu999Asp	Somatic	0	45	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A7E233|Q6WQJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipase_3	p.E999D	ENST00000257215.5	37	c.2997	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834480	0.71373	.	.	ENSG00000134780	ENST00000257215	T	0.37411	1.2	4.03	2.13	0.27403	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	L	0.27053	0.805	0.45822	D	0.998698	D	0.58970	0.984	D	0.68192	0.956	T	0.20638	-1.0269	10	0.66056	D	0.02	-24.4313	8.854	0.35217	0.3262:0.0:0.6738:0.0	.	999	Q9Y4D2	DGLA_HUMAN	D	999	ENSP00000257215:E999D	ENSP00000257215:E999D	E	+	3	2	DAGLA	61268405	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	2.160000	0.42348	0.310000	0.22990	0.462000	0.41574	GAG	-	NULL		0.682	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	protein_coding	OTTHUMT00000398516.1	G	NM_006133	-		61511829	+1	no_errors	ENST00000257215	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC9A5	6553	genome.wustl.edu	37	16	67300017	67300019	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:67300017_67300019delGAG	ENST00000299798.11	+	15	2172_2174	c.2107_2109delGAG	c.(2107-2109)gagdel	p.E708del	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	708					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CGTGGAGTCTGAGGAGGAGGAGG	0.571																																																	0								ENSG00000135740																																			SLC9A5	SO:0001651	inframe_deletion	0				HGNC		CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.2107_2109delGAG	16.37:g.67300026_67300028delGAG	ENSP00000299798:p.Glu708del	Somatic	0	84	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00	A5PKY7|Q9Y626	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.E706in_frame_del	ENST00000299798.11	37	c.2107_2109	CCDS42178.1	16																																																																																			-	NULL		0.571	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	protein_coding	OTTHUMT00000421386.1	GAG				67300019	+1	no_errors	ENST00000299798	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CCNL2	81669	genome.wustl.edu	37	1	1334664	1334666	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:1334664_1334666delGCC	ENST00000400809.3	-	1	26_28	c.21_23delGGC	c.(19-24)gcggct>gct	p.7_8AA>A	RP4-758J18.2_ENST00000448629.2_5'Flank|CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|RP4-758J18.2_ENST00000576232.1_5'Flank|CCNL2_ENST00000408918.4_In_Frame_Del_p.7_8AA>A|MRPL20_ENST00000493287.1_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	7					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A8S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		TGCAGCACCAgccgccgccgccg	0.773																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000221978																																			CCNL2	SO:0001651	inframe_deletion	0				HGNC	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.21_23delGGC	1.37:g.1334673_1334675delGCC	ENSP00000383611:p.Ala8del	Somatic	0	30	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.A8in_frame_del	ENST00000400809.3	37	c.23_21	CCDS30557.1	1																																																																																			-	pirsf_Cyclin_L		0.773	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	protein_coding	OTTHUMT00000008146.2	GCC	NM_030937			1334666	-1	no_errors	ENST00000400809	ensembl	human	known	74_37	in_frame_del	DEL	0.005:0.003:0.058	-
HAPLN4	404037	genome.wustl.edu	37	19	19371776	19371776	+	Silent	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:19371776G>T	ENST00000291481.7	-	3	393	c.330C>A	c.(328-330)ggC>ggA	p.G110G	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	110	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	CACGGTAGCTGCCGAATGCCC	0.682																																																	0								ENSG00000187664						43.0	46.0	45.0					19																	19371776		2203	4299	6502	HAPLN4	SO:0001819	synonymous_variant	0			-	HGNC	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.330C>A	19.37:g.19371776G>T		Somatic	0	44	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A5PKW5|Q96PW2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.G110	ENST00000291481.7	37	c.330	CCDS12398.1	19																																																																																			-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.682	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	protein_coding	OTTHUMT00000460117.2	G	NM_023002	-		19371776	-1	no_errors	ENST00000291481	ensembl	human	known	74_37	silent	SNP	0.978	T
FN1	2335	genome.wustl.edu	37	2	216243906	216243906	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr2:216243906T>C	ENST00000359671.1	-	33	5561	c.5296A>G	c.(5296-5298)Aaa>Gaa	p.K1766E	FN1_ENST00000336916.4_Missense_Mutation_p.K1766E|FN1_ENST00000432072.2_Missense_Mutation_p.K1767E|FN1_ENST00000323926.6_Missense_Mutation_p.K1857E|FN1_ENST00000490833.1_5'Flank|FN1_ENST00000346544.3_Missense_Mutation_p.K1766E|FN1_ENST00000357009.2_Missense_Mutation_p.K1766E|FN1_ENST00000421182.1_Missense_Mutation_p.K1676E|FN1_ENST00000345488.5_Missense_Mutation_p.K1766E|FN1_ENST00000357867.4_Missense_Mutation_p.K1676E|FN1_ENST00000446046.1_Missense_Mutation_p.K1766E|FN1_ENST00000443816.1_Missense_Mutation_p.K1676E|FN1_ENST00000356005.4_Missense_Mutation_p.K1676E|FN1_ENST00000354785.4_Missense_Mutation_p.K1857E			P02751	FINC_HUMAN	fibronectin 1	1766	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TTGATTTCTTTCATTGGTCCG	0.507																																																	0								ENSG00000115414						148.0	136.0	140.0					2																	216243906		2203	4300	6503	FN1	SO:0001583	missense	0			-	HGNC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5296A>G	2.37:g.216243906T>C	ENSP00000352696:p.Lys1766Glu	Somatic	0	80	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.K1857E	ENST00000359671.1	37	c.5569		2	.	.	.	.	.	.	.	.	.	.	T	26.1	4.703358	0.88924	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.78049	2.395	0.30923	N	0.727807	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.974;0.986;1.0;0.995;0.998;0.998;1.0;0.998;0.986;0.986;0.995;0.991	D;D;D;D;D;D;D;D;D;D;D;D	0.83275	0.964;0.972;0.996;0.992;0.989;0.993;0.996;0.993;0.972;0.972;0.989;0.984	T	0.75964	-0.3132	10	0.28530	T	0.3	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1766;1767;1857;1676;1676;1766;1766;1767;1676;1676;1857;1766	F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	E	1676;1857;1766;1676;1857;1767;1766;1766;1766;1766;1766;1676;1767;1676;483	ENSP00000394423:K1676E;ENSP00000323534:K1857E;ENSP00000338200:K1766E;ENSP00000350534:K1676E;ENSP00000346839:K1857E;ENSP00000352696:K1766E;ENSP00000265312:K1766E;ENSP00000273049:K1766E;ENSP00000349509:K1766E;ENSP00000410422:K1766E;ENSP00000415018:K1676E;ENSP00000399538:K1767E;ENSP00000348285:K1676E;ENSP00000416139:K483E	ENSP00000265313:K1767E	K	-	1	0	FN1	215952151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.856000	0.62932	2.371000	0.80710	0.533000	0.62120	AAA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.507	FN1-204	KNOWN	basic	protein_coding	FN1	protein_coding		T	NM_212476	-		216243906	-1	no_errors	ENST00000354785	ensembl	human	known	74_37	missense	SNP	1.000	C
STEAP2	261729	genome.wustl.edu	37	7	89856742	89856742	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:89856742T>C	ENST00000287908.3	+	3	1343	c.950T>C	c.(949-951)gTt>gCt	p.V317A	STEAP2_ENST00000402625.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394632.1_Missense_Mutation_p.V317A|STEAP2_ENST00000394621.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394626.1_Missense_Mutation_p.V317A|STEAP2_ENST00000394629.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394622.2_Missense_Mutation_p.V317A	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	317	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					ATGGTCCATGTTGCCTACAGC	0.418																																																	0								ENSG00000157214						73.0	74.0	74.0					7																	89856742		2202	4298	6500	STEAP2	SO:0001583	missense	0			-	HGNC	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.950T>C	7.37:g.89856742T>C	ENSP00000287908:p.Val317Ala	Somatic	0	87	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	56	15.15	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe3_Rdtase_TM_dom	p.V317A	ENST00000287908.3	37	c.950	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	T	7.682	0.689303	0.14973	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	D;D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	6.04	6.04	0.98038	Flavoprotein transmembrane component (1);	0.057921	0.64402	D	0.000002	T	0.81898	0.4920	N	0.02142	-0.665	0.50632	D	0.99988	B;B;B;B	0.30851	0.137;0.297;0.03;0.03	B;B;B;B	0.41646	0.059;0.362;0.03;0.02	T	0.80301	-0.1440	9	.	.	.	-29.9211	16.5885	0.84745	0.0:0.0:0.0:1.0	.	317;317;317;317	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	A	317	ENSP00000287908:V317A;ENSP00000378123:V317A;ENSP00000378120:V317A;ENSP00000378128:V317A;ENSP00000378119:V317A;ENSP00000384191:V317A;ENSP00000378125:V317A	.	V	+	2	0	STEAP2	89694678	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.192000	0.58378	2.317000	0.78254	0.460000	0.39030	GTT	-	pfam_Fe3_Rdtase_TM_dom		0.418	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	protein_coding	OTTHUMT00000059662.4	T	NM_152999	-		89856742	+1	no_errors	ENST00000287908	ensembl	human	known	74_37	missense	SNP	1.000	C
HDC	3067	genome.wustl.edu	37	15	50534531	50534531	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr15:50534531C>T	ENST00000267845.3	-	12	2317	c.1915G>A	c.(1915-1917)Gtc>Atc	p.V639I	RN7SL494P_ENST00000461517.2_RNA|HDC_ENST00000543581.1_Missense_Mutation_p.V606I	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.V639F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		AAGCTGGGGACGCTGTAGAAT	0.507																																					GBM(95;1627 1936 6910 9570)												1	Substitution - Missense(1)	lung(1)						ENSG00000140287						81.0	82.0	82.0					15																	50534531		2196	4295	6491	HDC	SO:0001583	missense	0			-	HGNC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1915G>A	15.37:g.50534531C>T	ENSP00000267845:p.Val639Ile	Somatic	0	117	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.V639I	ENST00000267845.3	37	c.1915	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533889	0.85812	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.17370	2.67;2.28	5.61	5.61	0.85477	.	0.000000	0.51477	D	0.000088	T	0.32466	0.0830	L	0.27053	0.805	0.50171	D	0.999853	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.06661	-1.0814	10	0.87932	D	0	-40.8107	19.6299	0.95698	0.0:1.0:0.0:0.0	.	606;639	B7ZM01;P19113	.;DCHS_HUMAN	I	639;606	ENSP00000267845:V639I;ENSP00000440252:V606I	ENSP00000267845:V639I	V	-	1	0	HDC	48321823	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.949000	0.75971	2.639000	0.89480	0.655000	0.94253	GTC	-	NULL		0.507	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	protein_coding	OTTHUMT00000254540.1	C		-		50534531	-1	no_errors	ENST00000267845	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH11	8701	genome.wustl.edu	37	7	21775267	21775267	+	Missense_Mutation	SNP	G	G	A	rs572118148		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:21775267G>A	ENST00000409508.3	+	46	7481	c.7450G>A	c.(7450-7452)Gtt>Att	p.V2484I	DNAH11_ENST00000328843.6_Missense_Mutation_p.V2491I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2491	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GACAGTTCTCGTTCACACAAC	0.418									Kartagener syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		20664	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000105877						55.0	52.0	53.0					7																	21775267		1865	4108	5973	DNAH11	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7450G>A	7.37:g.21775267G>A	ENSP00000475939:p.Val2484Ile	Somatic	0	65	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q9UJ82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V2491I	ENST00000409508.3	37	c.7471		7	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711695	0.89112	.	.	ENSG00000105877	ENST00000328843	T	0.44881	0.91	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	.	.	.	0.58432	D	0.999996	D	0.89917	1.0	D	0.68192	0.956	T	0.65307	-0.6200	9	0.44086	T	0.13	.	18.3434	0.90313	0.0:0.0:1.0:0.0	.	2491	Q96DT5	DYH11_HUMAN	I	2491	ENSP00000330671:V2491I	ENSP00000330671:V2491I	V	+	1	0	DNAH11	21741792	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.454000	0.80714	2.498000	0.84270	0.655000	0.94253	GTT	-	superfamily_P-loop_NTPase		0.418	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	G	NM_003777	-		21775267	+1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1211	57482	genome.wustl.edu	37	4	57193907	57193907	+	Silent	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:57193907C>A	ENST00000504228.1	+	9	3744	c.3639C>A	c.(3637-3639)gcC>gcA	p.A1213A	KIAA1211_ENST00000264229.6_Silent_p.A1213A|KIAA1211_ENST00000541073.1_Silent_p.A1206A			Q6ZU35	K1211_HUMAN	KIAA1211	1213										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAGAACCAGCCTGGCTGGCTT	0.547																																																	0								ENSG00000109265						101.0	106.0	105.0					4																	57193907		1868	4088	5956	KIAA1211	SO:0001819	synonymous_variant	0			-	HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3639C>A	4.37:g.57193907C>A		Somatic	1	127	0.78		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	70	30.00	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A1213	ENST00000504228.1	37	c.3639	CCDS43230.1	4																																																																																			-	NULL		0.547	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	C	NM_020722	-		57193907	+1	no_errors	ENST00000504228	ensembl	human	known	74_37	silent	SNP	1.000	A
ZBED6CL	113763	genome.wustl.edu	37	7	150027518	150027518	+	Missense_Mutation	SNP	G	G	A	rs369443062		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:150027518G>A	ENST00000343855.4	+	1	581	c.25G>A	c.(25-27)Gca>Aca	p.A9T	LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000323078.7_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	9																	GGCGAGTGCGGCACAGGCCTC	0.627																																																	0								ENSG00000188707	G	,,THR/ALA	0,4406		0,0,2203	69.0	75.0	73.0		,,25	1.2	0.0	7		73	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense	LRRC61,C7orf29	NM_001142928.1,NM_023942.2,NM_138434.2	,,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,benign	,,9/237	150027518	1,13005	2203	4300	6503	ZBED6CL	SO:0001583	missense	0			-	HGNC	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.25G>A	7.37:g.150027518G>A	ENSP00000343242:p.Ala9Thr	Somatic	0	77	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A9T	ENST00000343855.4	37	c.25	CCDS5900.1	7	.	.	.	.	.	.	.	.	.	.	G	1.159	-0.644303	0.03531	0.0	1.16E-4	ENSG00000188707	ENST00000343855	.	.	.	4.25	1.18	0.20946	.	35.889500	0.02416	U	0.082137	T	0.30166	0.0756	N	0.24115	0.695	0.09310	N	1	B	0.30281	0.275	B	0.27715	0.082	T	0.16247	-1.0409	9	0.27082	T	0.32	.	7.6652	0.28426	0.0965:0.502:0.4015:0.0	.	9	Q96FA7	CG029_HUMAN	T	9	.	ENSP00000343242:A9T	A	+	1	0	C7orf29	149658451	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.289000	0.08365	-0.066000	0.12998	0.558000	0.71614	GCA	-	NULL		0.627	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED6CL	protein_coding	OTTHUMT00000350702.1	G	NM_138434	-		150027518	+1	no_errors	ENST00000343855	ensembl	human	known	74_37	missense	SNP	0.000	A
CDHR1	92211	genome.wustl.edu	37	10	85968029	85968029	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:85968029delG	ENST00000372117.3	+	11	1166	c.1063delG	c.(1063-1065)ggafs	p.G355fs	CDHR1_ENST00000440770.2_Frame_Shift_Del_p.G114fs|CDHR1_ENST00000332904.3_Frame_Shift_Del_p.G355fs	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	355					cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						AACATTCTATGGAGAGAGCGG	0.592																																																	0								ENSG00000148600						72.0	71.0	71.0					10																	85968029		2203	4300	6503	CDHR1	SO:0001589	frameshift_variant	0				HGNC	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1063delG	10.37:g.85968029delG	ENSP00000361189:p.Gly355fs	Somatic	0	55	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q69YZ8|Q8IXY5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G355fs	ENST00000372117.3	37	c.1063	CCDS7372.1	10																																																																																			-	superfamily_Cadherin-like		0.592	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	protein_coding	OTTHUMT00000049111.1	G	NM_033100			85968029	+1	no_errors	ENST00000372117	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MFSD2A	84879	genome.wustl.edu	37	1	40430569	40430569	+	Intron	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:40430569C>T	ENST00000372809.5	+	4	535				MFSD2A_ENST00000480630.1_3'UTR|MFSD2A_ENST00000420632.2_Intron|MFSD2A_ENST00000372811.5_Intron	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A						establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CTTGCCCAGGCACCTGAGGTC	0.562																																																	0								ENSG00000168389																																			MFSD2A	SO:0001627	intron_variant	0			-	HGNC	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.393-314C>T	1.37:g.40430569C>T		Somatic	0	67	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	13	60.61	A8K675|Q6UWU5|Q96F59|Q9BRC8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372809.5	37	NULL	CCDS44118.1	1																																																																																			-	-		0.562	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2A	protein_coding	OTTHUMT00000025756.1	C	NM_032793	-		40430569	+1	no_errors	ENST00000480630	ensembl	human	known	74_37	rna	SNP	0.001	T
PLCD3	113026	genome.wustl.edu	37	17	43192760	43192762	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr17:43192760_43192762delTCC	ENST00000322765.5	-	9	1622_1624	c.1509_1511delGGA	c.(1507-1512)gaggat>gat	p.E503del	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	503					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.E503D(2)		breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						ctcctcgtcatcctcctcctcct	0.67																																																	2	Substitution - Missense(2)	prostate(2)						ENSG00000161714			316,3576		28,260,1658						-0.9	0.0			15	741,7257		61,619,3319	no	coding	PLCD3	NM_133373.3		89,879,4977	A1A1,A1R,RR		9.2648,8.1192,8.8898				1057,10833				PLCD3	SO:0001651	inframe_deletion	0				HGNC	AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.1509_1511delGGA	17.37:g.43192769_43192771delTCC	ENSP00000313731:p.Glu503del	Somatic	0	95	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q8TEC1|Q8TF37|Q96FL6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E503in_frame_del	ENST00000322765.5	37	c.1511_1509		17																																																																																			-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.670	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	protein_coding		TCC	NM_133373			43192762	-1	no_errors	ENST00000322765	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.003:0.000	-
ZSWIM5	57643	genome.wustl.edu	37	1	45671800	45671800	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:45671800C>T	ENST00000359600.5	-	1	428	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	ZSWIM5_ENST00000464588.1_Intron	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	75						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCCCACTTTTCCGCCACCGTC	0.701																																																	0								ENSG00000162415						14.0	16.0	15.0					1																	45671800		1925	4110	6035	ZSWIM5	SO:0001583	missense	0			-	HGNC	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.223G>A	1.37:g.45671800C>T	ENSP00000352614:p.Glu75Lys	Somatic	0	59	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	32	37.25	Q5SXQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_Znf_SWIM	p.E75K	ENST00000359600.5	37	c.223	CCDS41319.1	1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662097	0.67700	.	.	ENSG00000162415	ENST00000359600	T	0.33654	1.4	2.68	1.72	0.24424	.	0.000000	0.64402	U	0.000004	T	0.26738	0.0654	L	0.45352	1.415	0.45250	D	0.998258	B	0.26445	0.149	B	0.25405	0.06	T	0.05178	-1.0901	10	0.25751	T	0.34	-3.5717	9.4427	0.38679	0.0:0.8809:0.0:0.1191	.	75	Q9P217	ZSWM5_HUMAN	K	75	ENSP00000352614:E75K	ENSP00000352614:E75K	E	-	1	0	ZSWIM5	45444387	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.583000	0.60964	0.426000	0.26116	0.442000	0.29010	GAA	-	NULL		0.701	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	protein_coding	OTTHUMT00000024823.2	C	XM_046581	-		45671800	-1	no_errors	ENST00000359600	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMA5	3911	genome.wustl.edu	37	20	60905970	60905970	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:60905970delC	ENST00000252999.3	-	30	3747	c.3681delG	c.(3679-3681)aagfs	p.K1227fs	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1227	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTGGGGCGGCTTTGGGAAGC	0.726																																																	0								ENSG00000130702						15.0	20.0	18.0					20																	60905970		2092	4099	6191	LAMA5	SO:0001589	frameshift_variant	0				HGNC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3681delG	20.37:g.60905970delC	ENSP00000252999:p.Lys1227fs	Somatic	0	79	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	Q8TDF8|Q8WZA7|Q9H1P1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.K1227fs	ENST00000252999.3	37	c.3681	CCDS33502.1	20																																																																																			-	NULL		0.726	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	C	NM_005560			60905970	-1	no_errors	ENST00000252999	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
XIST	7503	genome.wustl.edu	37	X	73068944	73068944	+	lincRNA	DEL	A	A	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chrX:73068944delA	ENST00000429829.1	-	0	3644					NR_001564.2				X inactive specific transcript (non-protein coding)																		AATCTCAGGTAGTCAGCGCTG	0.373																																																	0								ENSG00000229807						70.0	69.0	70.0					X																	73068944		876	1991	2867	XIST			0				HGNC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73068944delA		Somatic	0	53	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.373	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	A	NR_001564			73068944	-1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	DEL	0.001	-
AC021218.2	0	genome.wustl.edu	37	7	155755885	155755885	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:155755885delG	ENST00000377722.2	+	1	560	c.362delG	c.(361-363)cggfs	p.R121fs																								CGTCAGAGCCGGGGGGACGGG	0.612																																																	0								ENSG00000204876																																			AC021218.2	SO:0001589	frameshift_variant	0				Clone_based_vega_gene																												ENST00000377722.2:c.362delG	7.37:g.155755885delG	ENSP00000366951:p.Arg121fs	Somatic	0	49	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D123fs	ENST00000377722.2	37	c.362		7																																																																																			-	NULL		0.612	AC021218.2-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000204876	protein_coding	OTTHUMT00000322334.1	G				155755885	+1	no_errors	ENST00000377722	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000	-
SMPD2	6610	genome.wustl.edu	37	6	109762653	109762653	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr6:109762653G>T	ENST00000258052.3	+	2	503	c.144G>T	c.(142-144)gaG>gaT	p.E48D	PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	48					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		CTTTGCTGGAGGAGGTGAGAT	0.617																																																	0								ENSG00000135587						104.0	112.0	109.0					6																	109762653		2203	4300	6503	SMPD2	SO:0001583	missense	0			-	HGNC	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.144G>T	6.37:g.109762653G>T	ENSP00000258052:p.Glu48Asp	Somatic	0	65	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q5TED1|Q9BWR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.E48D	ENST00000258052.3	37	c.144	CCDS5075.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092674	0.76756	.	.	ENSG00000135587	ENST00000258052	T	0.80393	-1.37	5.59	3.82	0.43975	Endonuclease/exonuclease/phosphatase (2);	0.213181	0.49916	D	0.000125	T	0.52256	0.1723	N	0.14661	0.345	0.36271	D	0.855197	B;P	0.38711	0.263;0.643	B;B	0.39935	0.314;0.301	T	0.59080	-0.7521	10	0.72032	D	0.01	-17.6559	8.5419	0.33397	0.1771:0.0:0.8229:0.0	.	48;48	B2R8U8;O60906	.;NSMA_HUMAN	D	48	ENSP00000258052:E48D	ENSP00000258052:E48D	E	+	3	2	SMPD2	109869346	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.300000	0.33436	0.740000	0.32651	0.655000	0.94253	GAG	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase		0.617	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD2	protein_coding	OTTHUMT00000041755.1	G		-		109762653	+1	no_errors	ENST00000258052	ensembl	human	known	74_37	missense	SNP	1.000	T
PIP4K2A	5305	genome.wustl.edu	37	10	22825871	22825871	+	3'UTR	SNP	C	C	T	rs561315773		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:22825871C>T	ENST00000376573.4	-	0	1708				PIP4K2A_ENST00000323883.7_3'UTR	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha						megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						AAAATGcacacgcgcgcacac	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		15482	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000150867																																			PIP4K2A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.*259G>A	10.37:g.22825871C>T		Somatic	0	25	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	1	91.67	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376573.4	37	NULL	CCDS7141.1	10																																																																																			-	-		0.438	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2A	protein_coding	OTTHUMT00000047193.1	C	NM_005028	-		22825871	-1	no_errors	ENST00000474335	ensembl	human	known	74_37	rna	SNP	0.750	T
LIG1	3978	genome.wustl.edu	37	19	48630701	48630702	+	Intron	DEL	CC	CC	-	rs61230848	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:48630701_48630702delCC	ENST00000263274.7	-	21	2352				LIG1_ENST00000427526.2_Intron|CTC-453G23.5_ENST00000596839.1_RNA|LIG1_ENST00000536218.1_Intron|CTC-453G23.5_ENST00000596563.1_RNA	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent						anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CTCCCTCTCGCCCCACCTAACT	0.609								Nucleotide excision repair (NER)						3527	0.704273	0.8434	0.562	5008	,	,		18933	0.875		0.5616	False		,,,				2504	0.5879																0								ENSG00000269534																																			CTC-453G23.5	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1933-96GG>-	19.37:g.48630703_48630704delCC		Somatic	0	9	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	B2RAI8|Q2TB12|Q32P23	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263274.7	37	NULL	CCDS12711.1	19																																																																																			-	-		0.609	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269534	protein_coding	OTTHUMT00000465575.1	CC	NM_000234			48630702	+1	no_errors	ENST00000596563	ensembl	human	known	74_37	rna	DEL	0.000:0.001	-
SZT2	23334	genome.wustl.edu	37	1	43891314	43891314	+	Splice_Site	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:43891314G>T	ENST00000562955.1	+	19	2814		c.e19+1		SZT2_ENST00000372442.1_Splice_Site	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)						central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCCGCAAGCTGTGAGTGTCCT	0.577																																																	0								ENSG00000198198						80.0	83.0	82.0					1																	43891314		2203	4300	6503	SZT2	SO:0001630	splice_region_variant	0			-	HGNC	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2814+1G>T	1.37:g.43891314G>T		Somatic	0	58	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	37.50	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e19+1	ENST00000562955.1	37	c.2814+1	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717112	0.89205	.	.	ENSG00000198198	ENST00000372442	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SZT2	43663901	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.366000	0.97143	2.941000	0.99782	0.655000	0.94253	.	-	-		0.577	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	protein_coding	OTTHUMT00000019517.3	G	NM_015284	-	Intron	43891314	+1	no_errors	ENST00000562955	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ADCK5	203054	genome.wustl.edu	37	8	145616475	145616475	+	Splice_Site	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:145616475G>T	ENST00000308860.6	+	6	728		c.e6+1		MIR939_ENST00000401314.1_RNA|ADCK5_ENST00000526231.2_Splice_Site|CPSF1_ENST00000531727.1_5'Flank	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GGCTGTGAAGGTATATGGGGG	0.627																																																	0								ENSG00000173137						58.0	59.0	58.0					8																	145616475		2203	4300	6503	ADCK5	SO:0001630	splice_region_variant	0			-	HGNC	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.684+1G>T	8.37:g.145616475G>T		Somatic	0	120	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6+1	ENST00000308860.6	37	c.684+1	CCDS34965.1	8	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075195	0.36662	.	.	ENSG00000173137	ENST00000308860	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.196	0.65672	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADCK5	145587283	1.000000	0.71417	0.997000	0.53966	0.146000	0.21551	8.853000	0.92222	2.419000	0.82065	0.462000	0.41574	.	-	-		0.627	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	protein_coding	OTTHUMT00000382556.2	G	NM_174922	-	Intron	145616475	+1	no_errors	ENST00000308860	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ANKLE2	23141	genome.wustl.edu	37	12	133313590	133313590	+	Silent	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:133313590C>A	ENST00000357997.5	-	8	1571	c.1482G>T	c.(1480-1482)ctG>ctT	p.L494L	ANKLE2_ENST00000542374.1_5'Flank|ANKLE2_ENST00000337516.5_Silent_p.L494L|ANKLE2_ENST00000539605.1_Silent_p.L432L	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	494					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CTGGGGACCACAGCTCCCCGA	0.652																																																	0								ENSG00000176915						56.0	66.0	63.0					12																	133313590		1964	4153	6117	ANKLE2	SO:0001819	synonymous_variant	0			-	HGNC	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1482G>T	12.37:g.133313590C>A		Somatic	0	43	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	12	53.85	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM_dom	p.L494	ENST00000357997.5	37	c.1482	CCDS41869.1	12																																																																																			-	NULL		0.652	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	protein_coding	OTTHUMT00000397712.1	C		-		133313590	-1	no_errors	ENST00000357997	ensembl	human	known	74_37	silent	SNP	0.999	A
ZEB1	6935	genome.wustl.edu	37	10	31816010	31816012	+	In_Frame_Del	DEL	GAG	GAG	-	rs369270839		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:31816010_31816012delGAG	ENST00000320985.10	+	9	3303_3305	c.3193_3195delGAG	c.(3193-3195)gagdel	p.E1071del	ZEB1_ENST00000361642.5_In_Frame_Del_p.E1072del|ZEB1_ENST00000446923.2_In_Frame_Del_p.E1055del|ZEB1_ENST00000560721.2_In_Frame_Del_p.E1051del|ZEB1_ENST00000542815.3_In_Frame_Del_p.E1004del			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	1071	Glu-rich (acidic).				cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ggatgaggaagaggaggaggagg	0.453																																					Ovarian(40;423 959 14296 36701 49589)												0								ENSG00000148516		,,,,,	7,56,4199		0,0,7,6,44,2074					,,,,,	-8.9	0.2			98	6,89,8153		0,0,6,10,69,4039	no	codingComplex,codingComplex,codingComplex,codingComplex,codingComplex,codingComplex	ZEB1	NM_030751.5,NM_001174096.1,NM_001174095.1,NM_001174094.1,NM_001174093.1,NM_001128128.2	,,,,,	0,0,13,16,113,6113	A1A1,A1A2,A1R,A2A2,A2R,RR		1.1518,1.4782,1.263	,,,,,	,,,,,		13,145,12352				ZEB1	SO:0001651	inframe_deletion	0				HGNC	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.3193_3195delGAG	10.37:g.31816019_31816021delGAG	ENSP00000319248:p.Glu1071del	Somatic	0	35	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.E1069in_frame_del	ENST00000320985.10	37	c.3196_3198	CCDS7169.1	10																																																																																			-	NULL		0.453	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	protein_coding	OTTHUMT00000419083.2	GAG	NM_030751			31816012	+1	no_errors	ENST00000361642	ensembl	human	known	74_37	in_frame_del	DEL	0.998:1.000:1.000	-
NOBOX	135935	genome.wustl.edu	37	7	144098176	144098176	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:144098176G>T	ENST00000467773.1	-	4	806	c.807C>A	c.(805-807)tgC>tgA	p.C269*	NOBOX_ENST00000223140.5_Nonsense_Mutation_p.C184*|NOBOX_ENST00000483238.1_Nonsense_Mutation_p.C269*	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	269					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TCCTAATTTGGCAGGTCACTT	0.572																																																	0								ENSG00000106410						75.0	73.0	74.0					7																	144098176		1846	4086	5932	NOBOX	SO:0001587	stop_gained	0			-	HGNC			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.807C>A	7.37:g.144098176G>T	ENSP00000419457:p.Cys269*	Somatic	0	106	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6NCD3|A8MZN5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.C269*	ENST00000467773.1	37	c.807		7	.	.	.	.	.	.	.	.	.	.	G	24.5	4.532968	0.85812	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	.	.	.	5.13	2.07	0.26955	.	0.435143	0.22871	N	0.054626	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-24.8929	3.5859	0.07970	0.2121:0.0:0.577:0.2109	.	.	.	.	X	269;269;184;58	.	ENSP00000223140:C184X	C	-	3	2	NOBOX	143729109	0.988000	0.35896	0.941000	0.38009	0.475000	0.33008	0.448000	0.21726	0.722000	0.32252	0.555000	0.69702	TGC	-	NULL		0.572	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	G	XM_001134420	-		144098176	-1	no_errors	ENST00000467773	ensembl	human	known	74_37	nonsense	SNP	0.790	T
ATRX	546	genome.wustl.edu	37	X	76939662	76939662	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chrX:76939662delG	ENST00000373344.5	-	9	1300	c.1086delC	c.(1084-1086)accfs	p.T363fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.T325fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	363					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGTTGGCTGTGGTCTCAATCA	0.363			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						107.0	104.0	105.0					X																	76939662		2203	4295	6498	ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1086delC	X.37:g.76939662delG	ENSP00000362441:p.Thr363fs	Somatic	0	60	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T363fs	ENST00000373344.5	37	c.1086	CCDS14434.1	X																																																																																			-	NULL		0.363	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489			76939662	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	0.468	-
MTMR7	9108	genome.wustl.edu	37	8	17230662	17230662	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:17230662C>T	ENST00000180173.5	-	2	146	c.112G>A	c.(112-114)Gtg>Atg	p.V38M	MTMR7_ENST00000521857.1_Missense_Mutation_p.V38M	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	38					inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		GAATTTTCCACGAATATGACA	0.403																																																	0								ENSG00000003987						86.0	80.0	82.0					8																	17230662		2203	4300	6503	MTMR7	SO:0001583	missense	0			-	HGNC	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.112G>A	8.37:g.17230662C>T	ENSP00000180173:p.Val38Met	Somatic	0	106	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	77	20.41	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myotubularin-like_Pase_dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.V38M	ENST00000180173.5	37	c.112	CCDS34851.1	8	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677262	0.88445	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.83250	-1.7;-1.7	5.46	5.46	0.80206	.	0.057935	0.64402	D	0.000002	D	0.86456	0.5937	M	0.84948	2.725	0.80722	D	1	P	0.48407	0.91	B	0.42916	0.402	D	0.87083	0.2167	10	0.39692	T	0.17	.	19.6884	0.95987	0.0:1.0:0.0:0.0	.	38	Q9Y216	MTMR7_HUMAN	M	38	ENSP00000180173:V38M;ENSP00000429733:V38M	ENSP00000180173:V38M	V	-	1	0	MTMR7	17275033	1.000000	0.71417	0.999000	0.59377	0.679000	0.39708	7.159000	0.77483	2.739000	0.93911	0.563000	0.77884	GTG	-	NULL		0.403	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR7	protein_coding	OTTHUMT00000375311.1	C	NM_004686	-		17230662	-1	no_errors	ENST00000180173	ensembl	human	known	74_37	missense	SNP	1.000	T
EPHB6	2051	genome.wustl.edu	37	7	142563919	142563919	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:142563919G>A	ENST00000392957.2	+	9	2094	c.1307G>A	c.(1306-1308)cGc>cAc	p.R436H	EPHB6_ENST00000411471.2_Missense_Mutation_p.R159H|EPHB6_ENST00000442129.1_Missense_Mutation_p.R436H	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	436	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					TTCGACCCTCGCCAGAGAGGC	0.607																																																	0								ENSG00000106123						45.0	40.0	42.0					7																	142563919		2203	4300	6503	EPHB6	SO:0001583	missense	0			-	HGNC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1307G>A	7.37:g.142563919G>A	ENSP00000376684:p.Arg436His	Somatic	0	87	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	27	37.21	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R436H	ENST00000392957.2	37	c.1307	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	G	35	5.538864	0.96474	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.58060	0.36;0.36;0.36	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000190	T	0.72771	0.3502	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.75196	-0.3403	10	0.72032	D	0.01	.	18.344	0.90315	0.0:0.0:1.0:0.0	.	436	O15197	EPHB6_HUMAN	H	436;436;159	ENSP00000376684:R436H;ENSP00000410789:R436H;ENSP00000409061:R159H	ENSP00000376684:R436H	R	+	2	0	EPHB6	142274041	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.808000	0.99193	2.560000	0.86352	0.561000	0.74099	CGC	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.607	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	protein_coding	OTTHUMT00000341329.1	G		-		142563919	+1	no_errors	ENST00000392957	ensembl	human	known	74_37	missense	SNP	1.000	A
CACNA1D	776	genome.wustl.edu	37	3	53785793	53785793	+	Silent	SNP	C	C	T	rs148248303		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:53785793C>T	ENST00000350061.5	+	28	4045	c.3534C>T	c.(3532-3534)taC>taT	p.Y1178Y	CACNA1D_ENST00000540742.1_Silent_p.Y85Y|CACNA1D_ENST00000288139.4_Silent_p.Y1198Y|CACNA1D_ENST00000422281.2_Silent_p.Y1178Y	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1178					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGTTGAATACGCCTTGAAAG	0.517																																																	0								ENSG00000157388	C	,,	1,4405	2.1+/-5.4	0,1,2202	189.0	167.0	174.0		3594,3534,3534	0.3	1.0	3	dbSNP_134	174	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CACNA1D	NM_000720.2,NM_001128839.1,NM_001128840.1	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	1198/2182,1178/2138,1178/2162	53785793	1,13005	2203	4300	6503	CACNA1D	SO:0001819	synonymous_variant	0			-	HGNC	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3534C>T	3.37:g.53785793C>T		Somatic	0	80	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.Y1198	ENST00000350061.5	37	c.3594	CCDS46848.1	3																																																																																			-	NULL		0.517	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	protein_coding	OTTHUMT00000350557.1	C	NM_000720	rs148248303		53785793	+1	no_errors	ENST00000288139	ensembl	human	known	74_37	silent	SNP	1.000	T
PVRL2	5819	genome.wustl.edu	37	19	45381749	45381751	+	Intron	DEL	GAG	GAG	-	rs558397688	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:45381749_45381751delGAG	ENST00000252483.5	+	6	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.E445del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGGCAaggatgaggaggaggagg	0.591														41	0.0081869	0.0197	0.0014	5008	,	,		15541	0.003		0.003	False		,,,				2504	0.0082																0								ENSG00000130202		,	121,4143		6,109,2017					,	-4.6	0.1			51	244,8010		12,220,3895	no	coding,intron	PVRL2	NM_002856.2,NM_001042724.1	,	18,329,5912	A1A1,A1R,RR		2.9561,2.8377,2.9158	,	,		365,12153				PVRL2	SO:0001627	intron_variant	0				HGNC	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1043-3717GAG>-	19.37:g.45381758_45381760delGAG		Somatic	0	44	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E441in_frame_del	ENST00000252483.5	37	c.1312_1314	CCDS42576.1	19																																																																																			-	NULL		0.591	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	protein_coding	OTTHUMT00000453231.1	GAG	NM_002856			45381751	+1	no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	DEL	0.686:0.659:0.301	-
ANAPC2	29882	genome.wustl.edu	37	9	140080911	140080912	+	Intron	DEL	CA	CA	-	rs148147354|rs372896343		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr9:140080911_140080912delCA	ENST00000323927.2	-	3	745				SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGCATGCAGcacacacacaca	0.624																																																	0								ENSG00000176248																																			ANAPC2	SO:0001627	intron_variant	0				HGNC	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.741-103TG>-	9.37:g.140080921_140080922delCA		Somatic	0	28	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																			-	-		0.624	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	protein_coding	OTTHUMT00000055315.1	CA	NM_013366			140080912	-1	no_errors	ENST00000495611	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
PCDH17	27253	genome.wustl.edu	37	13	58299074	58299074	+	Silent	SNP	G	G	A	rs534412507		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr13:58299074G>A	ENST00000377918.3	+	4	3152	c.3126G>A	c.(3124-3126)gcG>gcA	p.A1042A		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1042					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAACCAAGGCGTGCATCGAGC	0.532													g|||	1	0.000199681	0.0	0.0	5008	,	,		18288	0.001		0.0	False		,,,				2504	0.0				Melanoma(72;952 1291 1619 12849 33676)												0								ENSG00000118946						85.0	84.0	84.0					13																	58299074		2203	4300	6503	PCDH17	SO:0001819	synonymous_variant	0			-	HGNC	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3126G>A	13.37:g.58299074G>A		Somatic	0	60	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A1042	ENST00000377918.3	37	c.3126	CCDS31986.1	13																																																																																			-	NULL		0.532	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	protein_coding	OTTHUMT00000045139.1	G	NM_001040429	-		58299074	+1	no_errors	ENST00000377918	ensembl	human	known	74_37	silent	SNP	0.971	A
COL17A1	1308	genome.wustl.edu	37	10	105807844	105807844	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:105807844delC	ENST00000353479.5	-	30	2536	c.2246delG	c.(2245-2247)ggafs	p.G749fs	COL17A1_ENST00000369733.3_Frame_Shift_Del_p.G749fs|MIR936_ENST00000401264.1_RNA	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	749	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GCCTTGGTGTCCGTCTGGGCC	0.577																																																	0								ENSG00000065618						241.0	220.0	227.0					10																	105807844		2203	4300	6503	COL17A1	SO:0001589	frameshift_variant	0				HGNC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2246delG	10.37:g.105807844delC	ENSP00000340937:p.Gly749fs	Somatic	0	62	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.G749fs	ENST00000353479.5	37	c.2246	CCDS7554.1	10																																																																																			-	pfam_Collagen		0.577	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	protein_coding	OTTHUMT00000050181.1	C	NM_130778, NM_000494			105807844	-1	no_errors	ENST00000353479	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DNAH2	146754	genome.wustl.edu	37	17	7710493	7710493	+	Silent	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr17:7710493G>T	ENST00000572933.1	+	62	10928	c.9468G>T	c.(9466-9468)ctG>ctT	p.L3156L	DNAH2_ENST00000389173.2_Silent_p.L3156L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3156	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAAGTCACTGATCAACTTTG	0.488																																																	0								ENSG00000183914						115.0	114.0	114.0					17																	7710493		2203	4300	6503	DNAH2	SO:0001819	synonymous_variant	0			-	HGNC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9468G>T	17.37:g.7710493G>T		Somatic	0	71	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3156	ENST00000572933.1	37	c.9468	CCDS32551.1	17																																																																																			-	NULL		0.488	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	G	NM_020877	-		7710493	+1	no_errors	ENST00000389173	ensembl	human	known	74_37	silent	SNP	1.000	T
MROH7	374977	genome.wustl.edu	37	1	55139736	55139736	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:55139736C>G	ENST00000421030.2	+	10	2133	c.1848C>G	c.(1846-1848)atC>atG	p.I616M	MROH7_ENST00000409996.1_Missense_Mutation_p.I184M|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.I616M|MROH7_ENST00000545244.1_Missense_Mutation_p.I184M|MROH7_ENST00000395690.2_Missense_Mutation_p.I616M|MROH7_ENST00000454855.2_Missense_Mutation_p.I134M|MROH7_ENST00000339553.5_Missense_Mutation_p.I616M	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	616						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GGAGACTCATCCTTCACATTG	0.493																																																	0								ENSG00000271723						127.0	134.0	131.0					1																	55139736		1924	4151	6075	MROH7-TTC4	SO:0001583	missense	0			-	HGNC	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.1848C>G	1.37:g.55139736C>G	ENSP00000396622:p.Ile616Met	Somatic	0	98	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.I616M	ENST00000421030.2	37	c.1848	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.686974	0.48097	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.05447	3.44;3.44;3.44;3.44;3.44;3.44	4.65	1.79	0.24919	.	0.132353	0.33309	N	0.005046	T	0.08358	0.0208	L	0.54323	1.7	0.24354	N	0.994907	P;P;P	0.44380	0.815;0.834;0.834	B;P;B	0.46208	0.41;0.507;0.118	T	0.12760	-1.0535	10	0.56958	D	0.05	-9.9636	4.6333	0.12513	0.0:0.5167:0.0:0.4833	.	616;616;184	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	M	616;184;645;616;184;134;616	ENSP00000396622:I616M;ENSP00000442333:I184M;ENSP00000343211:I616M;ENSP00000387048:I184M;ENSP00000401130:I134M;ENSP00000379044:I616M	ENSP00000343211:I616M	I	+	3	3	HEATR8	54912324	0.987000	0.35691	0.995000	0.50966	0.980000	0.70556	0.051000	0.14141	0.629000	0.30376	0.558000	0.71614	ATC	-	superfamily_ARM-type_fold		0.493	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	protein_coding	OTTHUMT00000346978.1	C	NM_198547	-		55139736	+1	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	SNP	0.993	G
SLC25A2	83884	genome.wustl.edu	37	5	140683011	140683011	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:140683011T>C	ENST00000239451.4	-	1	601	c.422A>G	c.(421-423)gAg>gGg	p.E141G		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	141					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CCCTGACATCTCCATTTCATA	0.522																																																	0								ENSG00000120329						99.0	107.0	104.0					5																	140683011		2203	4300	6503	SLC25A2	SO:0001583	missense	0			-	HGNC	AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.422A>G	5.37:g.140683011T>C	ENSP00000239451:p.Glu141Gly	Somatic	0	76	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.E141G	ENST00000239451.4	37	c.422	CCDS4258.1	5	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542055	0.27563	.	.	ENSG00000120329	ENST00000239451	T	0.79749	-1.3	3.78	2.57	0.30868	Mitochondrial carrier domain (2);	0.415220	0.23904	U	0.043404	T	0.66086	0.2754	L	0.37800	1.135	0.31099	N	0.710615	B	0.09022	0.002	B	0.10450	0.005	T	0.56444	-0.7978	10	0.24483	T	0.36	-11.8776	4.2678	0.10771	0.0:0.1088:0.2036:0.6875	.	141	Q9BXI2	ORNT2_HUMAN	G	141	ENSP00000239451:E141G	ENSP00000239451:E141G	E	-	2	0	SLC25A2	140663195	0.999000	0.42202	0.525000	0.27900	0.823000	0.46562	2.662000	0.46766	0.777000	0.33496	0.528000	0.53228	GAG	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.522	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A2	protein_coding	OTTHUMT00000251799.2	T	NM_031947	-		140683011	-1	no_errors	ENST00000239451	ensembl	human	known	74_37	missense	SNP	0.891	C
LRRK2	120892	genome.wustl.edu	37	12	40714915	40714915	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:40714915T>A	ENST00000298910.7	+	35	5153	c.5095T>A	c.(5095-5097)Tat>Aat	p.Y1699N		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1699			Y -> C (in PARK8; shows no progressive reduction in neurite length and branching; dbSNP:rs35801418). {ECO:0000269|PubMed:15541308, ECO:0000269|PubMed:15541309, ECO:0000269|PubMed:16172858, ECO:0000269|PubMed:16272164}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGAAATGCCTTATTTTCCAAT	0.373																																																	0								ENSG00000188906						166.0	160.0	162.0					12																	40714915		2203	4300	6503	LRRK2	SO:0001583	missense	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5095T>A	12.37:g.40714915T>A	ENSP00000298910:p.Tyr1699Asn	Somatic	0	114	0.00		0.5976523635994885	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	30	53.85	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.Y1699N	ENST00000298910.7	37	c.5095	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	25.8	4.673183	0.88445	.	.	ENSG00000188906	ENST00000298910	T	0.76968	-1.06	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.983	D	0.88617	0.3160	10	0.72032	D	0.01	.	16.1562	0.81670	0.0:0.0:0.0:1.0	.	1699;1699	Q17RV3;Q5S007	.;LRRK2_HUMAN	N	1699	ENSP00000298910:Y1699N	ENSP00000298910:Y1699N	Y	+	1	0	LRRK2	39001182	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.431000	0.80335	2.210000	0.71456	0.533000	0.62120	TAT	-	NULL		0.373	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	T	XM_058513	-		40714915	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	SNP	1.000	A
