#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
KIAA1211	57482	genome.wustl.edu	37	4	57180907	57180907	+	Silent	SNP	G	G	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:57180907G>A	ENST00000504228.1	+	6	1344	c.1239G>A	c.(1237-1239)gaG>gaA	p.E413E	KIAA1211_ENST00000264229.6_Silent_p.E413E|KIAA1211_ENST00000541073.1_Silent_p.E406E			Q6ZU35	K1211_HUMAN	KIAA1211	413	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CGCACCTGGAGGACTGGAGGG	0.662																																																	0								ENSG00000109265						16.0	20.0	18.0					4																	57180907		2004	4149	6153	KIAA1211	SO:0001819	synonymous_variant	0			-	HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1239G>A	4.37:g.57180907G>A		Somatic	0	131	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	31	68.04	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E413	ENST00000504228.1	37	c.1239	CCDS43230.1	4																																																																																			-	NULL		0.662	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	G	NM_020722	-		57180907	+1	no_errors	ENST00000504228	ensembl	human	known	74_37	silent	SNP	0.000	A
DUSP1	1843	genome.wustl.edu	37	5	172195849	172195849	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr5:172195849G>T	ENST00000239223.3	-	4	1262	c.1020C>A	c.(1018-1020)aaC>aaA	p.N340K	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	340	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		AGACGGGGAAGTTGAACACGG	0.632																																																	0								ENSG00000120129						112.0	107.0	109.0					5																	172195849		2203	4300	6503	DUSP1	SO:0001583	missense	0			-	HGNC	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.1020C>A	5.37:g.172195849G>T	ENSP00000239223:p.Asn340Lys	Somatic	0	66	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	D3DQL9|Q2V508	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.N340K	ENST00000239223.3	37	c.1020	CCDS4380.1	5	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419195	0.62622	.	.	ENSG00000120129	ENST00000239223;ENST00000457103;ENST00000434080	T	0.02121	4.44	5.1	4.21	0.49690	.	0.092877	0.64402	D	0.000001	T	0.04272	0.0118	L	0.36672	1.1	0.52501	D	0.999958	D;D	0.54964	0.969;0.969	P;P	0.53593	0.73;0.638	T	0.48222	-0.9054	10	0.51188	T	0.08	.	9.4036	0.38449	0.2155:0.0:0.7845:0.0	.	340;297	P28562;B4DNT2	DUS1_HUMAN;.	K	340;313;275	ENSP00000239223:N340K	ENSP00000239223:N340K	N	-	3	2	DUSP1	172128455	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.925000	0.40074	2.522000	0.85027	0.655000	0.94253	AAC	-	pirsf_MKP		0.632	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	protein_coding	OTTHUMT00000252943.3	G	NM_004417	-		172195849	-1	no_errors	ENST00000239223	ensembl	human	known	74_37	missense	SNP	1.000	T
SPRED3	399473	genome.wustl.edu	37	19	38882864	38882866	+	In_Frame_Del	DEL	CCT	CCT	-	rs151129136		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr19:38882864_38882866delCCT	ENST00000338502.4	+	3	462_464	c.359_361delCCT	c.(358-363)ccctcc>ccc	p.S128del	SPRED3_ENST00000586301.1_In_Frame_Del_p.S128del|SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000587013.1_In_Frame_Del_p.S172del	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	128	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCACTCAccccctcctcctcctc	0.645																																																	0								ENSG00000188766		,	401,4,3395		26,0,349,0,4,1521					,	3.3	0.9		dbSNP_134	44	1035,11,6892		107,0,821,1,9,3031	no	codingComplex,codingComplex	SPRED3	NM_001042522.1,NM_001039616.1	,	133,0,1170,1,13,4552	A1A1,A1A2,A1R,A2A2,A2R,RR		13.1771,10.6579,12.3616	,	,		1436,15,10287				SPRED3	SO:0001651	inframe_deletion	0				HGNC		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.359_361delCCT	19.37:g.38882873_38882875delCCT	ENSP00000345405:p.Ser128del	Somatic	0	36	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68	Q2MJR1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.S124in_frame_del	ENST00000338502.4	37	c.359_361	CCDS42560.1	19																																																																																			-	NULL		0.645	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	protein_coding	OTTHUMT00000459216.1	CCT	XM_351191			38882866	+1	no_errors	ENST00000338502	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.995:0.997	-
PKD1L1	168507	genome.wustl.edu	37	7	47945469	47945469	+	Missense_Mutation	SNP	T	T	C	rs200709779		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr7:47945469T>C	ENST00000289672.2	-	10	1543	c.1493A>G	c.(1492-1494)cAc>cGc	p.H498R		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	498					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGTCATGCTGTGCCAAGCCTG	0.423													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19256	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000158683						71.0	68.0	69.0					7																	47945469		2203	4300	6503	PKD1L1	SO:0001583	missense	0			GMAF=0	HGNC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1493A>G	7.37:g.47945469T>C	ENSP00000289672:p.His498Arg	Somatic	0	60	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	97	37.01	Q6UWK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_PLAT/LH2_dom,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like	p.H498R	ENST00000289672.2	37	c.1493	CCDS34633.1	7	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	5.954	0.359955	0.11296	.	.	ENSG00000158683	ENST00000289672	T	0.18502	2.21	5.1	-8.04	0.01110	.	3.244950	0.00766	N	0.001172	T	0.06142	0.0159	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27297	-1.0078	10	0.12430	T	0.62	1.9553	2.638	0.04963	0.1389:0.1959:0.1658:0.4994	.	498	Q8TDX9	PK1L1_HUMAN	R	498	ENSP00000289672:H498R	ENSP00000289672:H498R	H	-	2	0	PKD1L1	47911994	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-2.334000	0.01107	-2.052000	0.00902	-1.330000	0.01273	CAC	-	NULL		0.423	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	protein_coding	OTTHUMT00000340974.1	T	NM_138295	rs200709779		47945469	-1	no_errors	ENST00000289672	ensembl	human	known	74_37	missense	SNP	0.000	C
DNAH10	196385	genome.wustl.edu	37	12	124358165	124358165	+	Missense_Mutation	SNP	G	G	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr12:124358165G>C	ENST00000409039.3	+	45	7517	c.7492G>C	c.(7492-7494)Gaa>Caa	p.E2498Q		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2498	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGAAATTTAGAAGCAAATGT	0.448																																																	0								ENSG00000197653						73.0	68.0	70.0					12																	124358165		1906	4134	6040	DNAH10	SO:0001583	missense	0			-	HGNC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7492G>C	12.37:g.124358165G>C	ENSP00000386770:p.Glu2498Gln	Somatic	0	92	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	41	40.58	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.E2498Q	ENST00000409039.3	37	c.7492	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675348	0.88445	.	.	ENSG00000197653	ENST00000409039	T	0.49139	0.79	5.51	5.51	0.81932	ATPase, AAA+ type, core (1);	0.000000	0.64402	U	0.000001	T	0.74906	0.3778	M	0.90425	3.115	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	T	0.79581	-0.1744	10	0.59425	D	0.04	.	19.4169	0.94704	0.0:0.0:1.0:0.0	.	2498	Q8IVF4	DYH10_HUMAN	Q	2498	ENSP00000386770:E2498Q	ENSP00000386770:E2498Q	E	+	1	0	DNAH10	122924118	1.000000	0.71417	0.243000	0.24186	0.961000	0.63080	9.808000	0.99193	2.599000	0.87857	0.561000	0.74099	GAA	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.448	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	G		-		124358165	+1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	SNP	1.000	C
KRBA1	84626	genome.wustl.edu	37	7	149430495	149430495	+	Missense_Mutation	SNP	G	G	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr7:149430495G>C	ENST00000485033.2	+	15	2269	c.2269G>C	c.(2269-2271)Gcc>Ccc	p.A757P	KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000255992.10_Missense_Mutation_p.A817P|KRBA1_ENST00000319551.8_Missense_Mutation_p.A757P			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	818	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGATCGGCTCGCCACAGCGCT	0.697																																																	0								ENSG00000133619						8.0	11.0	10.0					7																	149430495		2020	4129	6149	KRBA1	SO:0001583	missense	0			-	HGNC	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.2269G>C	7.37:g.149430495G>C	ENSP00000420112:p.Ala757Pro	Somatic	0	61	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	37	35.59	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A817P	ENST00000485033.2	37	c.2449		7	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622337	0.28889	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.38722	1.13;1.12;1.12	4.89	1.56	0.23342	.	0.376720	0.19608	N	0.110207	T	0.52041	0.1710	.	.	.	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.976	T	0.31943	-0.9925	9	0.35671	T	0.21	-4.177	6.3012	0.21113	0.0982:0.0:0.5665:0.3353	.	757;818	E7ENE9;A5PL33	.;KRBA1_HUMAN	P	817;757;757	ENSP00000255992:A817P;ENSP00000317165:A757P;ENSP00000420112:A757P	ENSP00000255992:A817P	A	+	1	0	KRBA1	149061428	0.000000	0.05858	0.002000	0.10522	0.110000	0.19582	0.189000	0.17037	0.454000	0.26884	0.467000	0.42956	GCC	-	NULL		0.697	KRBA1-004	PUTATIVE	basic	protein_coding	KRBA1	protein_coding	OTTHUMT00000349841.3	G	NM_032534	-		149430495	+1	no_errors	ENST00000255992	ensembl	human	known	74_37	missense	SNP	0.000	C
CR1	1378	genome.wustl.edu	37	1	207753676	207753676	+	Silent	SNP	T	T	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:207753676T>C	ENST00000367049.4	+	30	5028	c.5028T>C	c.(5026-5028)tgT>tgC	p.C1676C	CR1_ENST00000367052.1_Silent_p.C1226C|RP11-78B10.2_ENST00000597497.1_RNA|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367053.1_Silent_p.C1226C|CR1_ENST00000367051.1_Silent_p.C1226C|CR1_ENST00000400960.2_Silent_p.C1226C	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1226	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCTACAGCTGTGAGCCTGGCT	0.577																																																	0								ENSG00000203710						123.0	127.0	126.0					1																	207753676		1984	4177	6161	CR1	SO:0001819	synonymous_variant	0			-	HGNC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5028T>C	1.37:g.207753676T>C		Somatic	0	142	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	34	54.05	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.C1676	ENST00000367049.4	37	c.5028	CCDS44308.1	1																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.577	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	T	NM_000573	-		207753676	+1	no_errors	ENST00000367049	ensembl	human	known	74_37	silent	SNP	1.000	C
SYT16	83851	genome.wustl.edu	37	14	62567269	62567269	+	Silent	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:62567269C>T	ENST00000430451.2	+	6	1979	c.1782C>T	c.(1780-1782)tcC>tcT	p.S594S	RP11-355I22.2_ENST00000554252.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	594	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TGATGATTTCCGTTTATAACA	0.502																																																	0								ENSG00000139973						101.0	98.0	99.0					14																	62567269		2001	4168	6169	SYT16	SO:0001819	synonymous_variant	0			-	HGNC	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1782C>T	14.37:g.62567269C>T		Somatic	0	79	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	15	69.39	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S594	ENST00000430451.2	37	c.1782	CCDS45121.1	14																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.502	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	protein_coding	OTTHUMT00000411700.1	C	NM_031914	-		62567269	+1	no_errors	ENST00000430451	ensembl	human	novel	74_37	silent	SNP	0.929	T
GPRC6A	222545	genome.wustl.edu	37	6	117127901	117127901	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr6:117127901C>A	ENST00000310357.3	-	3	988	c.967G>T	c.(967-969)Gtt>Ttt	p.V323F	GPRC6A_ENST00000368549.3_Missense_Mutation_p.V323F|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	323					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AACCCTACAACTTTGCCAATC	0.373																																																	0								ENSG00000173612						109.0	107.0	107.0					6																	117127901		2203	4298	6501	GPRC6A	SO:0001583	missense	0			-	HGNC	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.967G>T	6.37:g.117127901C>A	ENSP00000309493:p.Val323Phe	Somatic	0	35	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	19	45.71	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.V323F	ENST00000310357.3	37	c.967	CCDS5112.1	6	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143068	0.57044	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.85955	-2.05;-2.05	5.48	1.66	0.24008	Extracellular ligand-binding receptor (1);	0.279335	0.25091	N	0.033218	D	0.86752	0.6008	M	0.71036	2.16	0.80722	D	1	D;D	0.76494	0.999;0.986	D;D	0.74348	0.983;0.921	D	0.86104	0.1558	10	0.87932	D	0	.	9.3736	0.38270	0.0:0.7038:0.0:0.2962	.	323;323	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	F	323	ENSP00000309493:V323F;ENSP00000357537:V323F	ENSP00000309493:V323F	V	-	1	0	GPRC6A	117234594	0.096000	0.21769	0.999000	0.59377	0.997000	0.91878	0.332000	0.19751	0.117000	0.18138	0.650000	0.86243	GTT	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.373	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	protein_coding	OTTHUMT00000041966.2	C		-		117127901	-1	no_errors	ENST00000310357	ensembl	human	known	74_37	missense	SNP	0.995	A
NLRC3	197358	genome.wustl.edu	37	16	3613566	3613566	+	RNA	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr16:3613566G>T	ENST00000301749.7	-	0	1777				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AACTCCTGCAGGGACAGGTGG	0.617																																																	0								ENSG00000167984						29.0	32.0	31.0					16																	3613566		2052	4207	6259	NLRC3			0			-	HGNC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3613566G>T		Somatic	0	41	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L505M	ENST00000301749.7	37	c.1513		16	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249491	0.39797	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.35	4.19	0.49359	.	0.185930	0.36101	N	0.002787	D	0.87414	0.6171	.	.	.	0.23010	N	0.998434	D	0.54047	0.964	P	0.53912	0.737	T	0.80728	-0.1253	9	0.59425	D	0.04	.	12.1949	0.54292	0.0974:0.0:0.9026:0.0	.	505	C9JLH9	.	M	458;458;458;505;440	ENSP00000301749:L458M;ENSP00000352039:L458M;ENSP00000414415:L505M;ENSP00000323897:L440M	ENSP00000301749:L458M	L	-	1	2	NLRC3	3553567	0.997000	0.39634	1.000000	0.80357	0.861000	0.49209	1.317000	0.33631	2.503000	0.84419	0.655000	0.94253	CTG	-	NULL		0.617	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	polymorphic_pseudogene		G	NM_178844	-		3613566	-1	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	SNP	0.966	T
CDON	50937	genome.wustl.edu	37	11	125828460	125828461	+	3'UTR	INS	-	-	TATATGTG	rs582224|rs371911236		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr11:125828460_125828461insTATATGTG	ENST00000392693.3	-	0	6367_6368				RP11-680F20.6_ENST00000531193.1_RNA|RP11-680F20.12_ENST00000582823.1_RNA|RP11-680F20.6_ENST00000524962.2_RNA|CDON_ENST00000531738.1_3'UTR	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated						anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		atatatatatatgtgtgtgtgt	0.307																																																	0								ENSG00000264299																																			RP11-680F20.12	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.*2377->CACATATA	11.37:g.125828460_125828461insTATATGTG		Somatic	NA	NA	NA		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14631	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392693.3	37	NULL	CCDS58192.1	11																																																																																			-	-		0.307	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000264299	protein_coding	OTTHUMT00000386749.2	-	NM_016952			125828461	+1	no_errors	ENST00000582823	ensembl	human	known	74_37	rna	INS	0.301:0.221	TATATGTG
MAGEC1	9947	genome.wustl.edu	37	X	140996475	140996475	+	Silent	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chrX:140996475C>T	ENST00000285879.4	+	4	3571	c.3285C>T	c.(3283-3285)gtC>gtT	p.V1095V	MAGEC1_ENST00000406005.2_Silent_p.V162V	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1095	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGAATACCGTCCCTATTACCT	0.448										HNSCC(15;0.026)																																							0								ENSG00000155495						144.0	131.0	135.0					X																	140996475		2203	4300	6503	MAGEC1	SO:0001819	synonymous_variant	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3285C>T	X.37:g.140996475C>T		Somatic	0	34	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	A0PK03|O75451|Q8TCV4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.V1095	ENST00000285879.4	37	c.3285	CCDS35417.1	X																																																																																			-	pfscan_MAGE		0.448	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	C	NM_005462	-		140996475	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	silent	SNP	0.000	T
CTRB1	1504	genome.wustl.edu	37	16	75257097	75257097	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr16:75257097C>T	ENST00000361017.4	+	4	303	c.295C>T	c.(295-297)Cag>Tag	p.Q99*	RP11-331F4.4_ENST00000489723.1_RNA	NM_001906.4	NP_001897.4	P17538	CTRB1_HUMAN	chymotrypsinogen B1	99	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.166)	Aprotinin(DB06692)	GGAGAACATCCAGGTCCTGAA	0.672																																																	0								ENSG00000168925						1.0	2.0	2.0					16																	75257097		1092	2315	3407	CTRB1	SO:0001587	stop_gained	0			-	HGNC		CCDS32490.1	16q23.1	2008-02-05			ENSG00000168925	ENSG00000168925	3.4.21.1		2521	protein-coding gene	gene with protein product		118890		CTRB		2917002, 8186414	Standard	NM_001906		Approved		uc002fds.3	P17538	OTTHUMG00000159272	ENST00000361017.4:c.295C>T	16.37:g.75257097C>T	ENSP00000354294:p.Gln99*	Somatic	0	111	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	31	41.51		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q99*	ENST00000361017.4	37	c.295	CCDS32490.1	16	.	.	.	.	.	.	.	.	.	.	c	37	6.355804	0.97502	.	.	ENSG00000168925	ENST00000361017	.	.	.	4.7	3.72	0.42706	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.7227	0.62737	0.1556:0.8444:0.0:0.0	.	.	.	.	X	99	.	ENSP00000354294:Q99X	Q	+	1	0	CTRB1	73814598	0.101000	0.21875	0.079000	0.20413	0.988000	0.76386	2.521000	0.45563	1.150000	0.42419	0.455000	0.32223	CAG	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.672	CTRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTRB1	protein_coding	OTTHUMT00000354300.2	C	NM_001906	-		75257097	+1	no_errors	ENST00000361017	ensembl	human	known	74_37	nonsense	SNP	0.997	T
CHAF1B	8208	genome.wustl.edu	37	21	37771863	37771863	+	Missense_Mutation	SNP	A	A	G			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr21:37771863A>G	ENST00000314103.5	+	7	774	c.623A>G	c.(622-624)aAt>aGt	p.N208S		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	208					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						GTGGCTTTCAATGTTTCGAAG	0.403																																																	0								ENSG00000159259						153.0	143.0	146.0					21																	37771863		2203	4300	6503	CHAF1B	SO:0001583	missense	0			-	HGNC	U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.623A>G	21.37:g.37771863A>G	ENSP00000315700:p.Asn208Ser	Somatic	0	46	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q99548	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	p.N208S	ENST00000314103.5	37	c.623	CCDS13644.1	21	.	.	.	.	.	.	.	.	.	.	A	14.62	2.590252	0.46214	.	.	ENSG00000159259	ENST00000314103	T	0.64618	-0.11	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.182324	0.56097	D	0.000023	T	0.53238	0.1784	L	0.43701	1.375	0.41357	D	0.987408	B	0.18310	0.027	B	0.17433	0.018	T	0.50516	-0.8819	10	0.11794	T	0.64	-33.584	15.5193	0.75854	1.0:0.0:0.0:0.0	.	208	Q13112	CAF1B_HUMAN	S	208	ENSP00000315700:N208S	ENSP00000315700:N208S	N	+	2	0	CHAF1B	36693733	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	5.328000	0.65887	2.131000	0.65755	0.460000	0.39030	AAT	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.403	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	protein_coding	OTTHUMT00000194616.2	A	NM_005441	-		37771863	+1	no_errors	ENST00000314103	ensembl	human	known	74_37	missense	SNP	1.000	G
MYH14	79784	genome.wustl.edu	37	19	50760604	50760604	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr19:50760604C>A	ENST00000596571.1	+	15	1970	c.1970C>A	c.(1969-1971)cCa>cAa	p.P657Q	MYH14_ENST00000440075.2_Missense_Mutation_p.P698Q|MYH14_ENST00000262269.8_Missense_Mutation_p.P698Q|MYH14_ENST00000425460.1_Missense_Mutation_p.P665Q|MYH14_ENST00000376970.2_Missense_Mutation_p.P690Q|MYH14_ENST00000601313.1_Missense_Mutation_p.P698Q|MYH14_ENST00000598205.1_Missense_Mutation_p.P665Q			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	657	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGCGACGGCCCACCAGGTGGC	0.627																																																	0								ENSG00000105357						18.0	21.0	20.0					19																	50760604		1961	4147	6108	MYH14	SO:0001583	missense	0			-	HGNC	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1970C>A	19.37:g.50760604C>A	ENSP00000472819:p.Pro657Gln	Somatic	0	50	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	17	46.88	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.P698Q	ENST00000596571.1	37	c.2093	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	5.624	0.299925	0.10622	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08	4.51	4.51	0.55191	Myosin head, motor domain (2);	.	.	.	.	D	0.85517	0.5715	N	0.20357	0.565	0.09310	N	1	D;B;P	0.56746	0.977;0.391;0.555	P;B;B	0.59357	0.856;0.425;0.3	T	0.75858	-0.3169	9	0.66056	D	0.02	.	8.659	0.34081	0.0:0.897:0.0:0.103	.	698;657;665	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	Q	657;698;690;665;657;698	ENSP00000406273:P698Q;ENSP00000366169:P690Q;ENSP00000407879:P665Q;ENSP00000262269:P698Q	ENSP00000262269:P698Q	P	+	2	0	MYH14	55452416	0.064000	0.20934	0.630000	0.29268	0.267000	0.26476	2.693000	0.47027	2.520000	0.84964	0.655000	0.94253	CCA	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.627	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	protein_coding	OTTHUMT00000464710.2	C	NM_024729	-		50760604	+1	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	SNP	0.098	A
TRIM27	5987	genome.wustl.edu	37	6	28888004	28888004	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr6:28888004C>T	ENST00000377199.3	-	3	888	c.532G>A	c.(532-534)Gag>Aag	p.E178K	TRIM27_ENST00000498117.1_5'UTR|TRIM27_ENST00000377194.3_Missense_Mutation_p.E178K	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	178					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TTCTCCCTCTCCATCTGGGTT	0.507			T	RET	papillary thyroid																																			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	0								ENSG00000204713						130.0	127.0	128.0					6																	28888004		2203	4300	6503	TRIM27	SO:0001583	missense	0			-	HGNC	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.532G>A	6.37:g.28888004C>T	ENSP00000366404:p.Glu178Lys	Somatic	0	35	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.E178K	ENST00000377199.3	37	c.532	CCDS4654.1	6	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742513	0.30865	.	.	ENSG00000204713	ENST00000377199;ENST00000377194	T;T	0.63580	0.47;-0.05	4.04	4.04	0.47022	.	0.000000	0.48767	D	0.000162	T	0.32133	0.0819	N	0.20807	0.61	0.29655	N	0.843681	P;P;P	0.41450	0.716;0.75;0.664	B;B;B	0.44044	0.439;0.373;0.155	T	0.09640	-1.0665	10	0.28530	T	0.3	.	9.4037	0.38449	0.2123:0.7877:0.0:0.0	.	245;178;178	Q59EC6;P14373-2;P14373	.;.;TRI27_HUMAN	K	178	ENSP00000366404:E178K;ENSP00000366399:E178K	ENSP00000366399:E178K	E	-	1	0	TRIM27	28995983	0.055000	0.20627	1.000000	0.80357	0.894000	0.52154	0.163000	0.16520	2.530000	0.85305	0.655000	0.94253	GAG	-	NULL		0.507	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM27	protein_coding	OTTHUMT00000076442.2	C	NM_030950	-		28888004	-1	no_errors	ENST00000377199	ensembl	human	known	74_37	missense	SNP	1.000	T
USP4	7375	genome.wustl.edu	37	3	49362341	49362341	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr3:49362341G>T	ENST00000265560.4	-	5	665	c.619C>A	c.(619-621)Cta>Ata	p.L207I	USP4_ENST00000351842.4_Missense_Mutation_p.L207I|USP4_ENST00000416417.1_Missense_Mutation_p.L207I|USP4_ENST00000415188.1_Missense_Mutation_p.L207I	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	207	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CCCTGGTATAGCCCAGCATCC	0.542																																																	0								ENSG00000114316						155.0	157.0	156.0					3																	49362341		2203	4300	6503	USP4	SO:0001583	missense	0			-	HGNC	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.619C>A	3.37:g.49362341G>T	ENSP00000265560:p.Leu207Ile	Somatic	0	76	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.L207I	ENST00000265560.4	37	c.619	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651651	0.67472	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.39406	1.86;1.78;1.08	5.6	0.161	0.14977	.	0.161199	0.46145	D	0.000308	T	0.46814	0.1412	L	0.47716	1.5	0.44834	D	0.997844	P;B	0.39535	0.677;0.368	P;P	0.52481	0.7;0.504	T	0.40308	-0.9570	10	0.48119	T	0.1	-8.7681	11.2124	0.48806	0.3716:0.0:0.6284:0.0	.	207;207	Q13107-2;Q13107	.;UBP4_HUMAN	I	207	ENSP00000341028:L207I;ENSP00000265560:L207I;ENSP00000400623:L207I	ENSP00000265560:L207I	L	-	1	2	USP4	49337345	1.000000	0.71417	0.631000	0.29282	0.985000	0.73830	4.037000	0.57311	0.075000	0.16796	-0.258000	0.10820	CTA	-	NULL		0.542	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	protein_coding	OTTHUMT00000346069.1	G	NM_199443	-		49362341	-1	no_errors	ENST00000265560	ensembl	human	known	74_37	missense	SNP	0.943	T
SLC35F5	80255	genome.wustl.edu	37	2	114500276	114500277	+	Frame_Shift_Ins	INS	-	-	A	rs577214214	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr2:114500276_114500277insA	ENST00000245680.2	-	7	1155_1156	c.742_743insT	c.(742-744)tgcfs	p.C248fs	SLC35F5_ENST00000409342.1_Frame_Shift_Ins_p.C242fs	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	248					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.C248fs*22(2)|p.?(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						TACCACAAAGCAAAAAAAAAAG	0.342													|||unknown(HR)	9	0.00179712	0.0015	0.0	5008	,	,		19453	0.002		0.0	False		,,,				2504	0.0051																3	Deletion - Frameshift(2)|Unknown(1)	ovary(2)|skin(1)						ENSG00000115084																																			SLC35F5	SO:0001589	frameshift_variant	0				HGNC	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.743dupT	2.37:g.114500286_114500286dupA	ENSP00000245680:p.Cys248fs	Somatic	0	64	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q9H6P8|Q9H7D8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_DMT	p.C248fs	ENST00000245680.2	37	c.743_742	CCDS2119.1	2																																																																																			-	pfam_DMT		0.342	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F5	protein_coding	OTTHUMT00000254150.1	-	NM_025181			114500277	-1	no_errors	ENST00000245680	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
LOC101927209	101927209	genome.wustl.edu	37	1	142653541	142653541	+	lincRNA	SNP	T	T	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:142653541T>C	ENST00000610091.1	-	0	3560				AL583842.3_ENST00000580249.1_RNA|AL583842.2_ENST00000582446.1_RNA|RP11-417J8.3_ENST00000426408.1_lincRNA|AL583842.1_ENST00000459390.1_RNA																							agcagtgttctggaatcctat	0.453																																																	0								ENSG00000266657																																			AL583842.3			0			-	Clone_based_ensembl_gene																													1.37:g.142653541T>C		Somatic	0	143	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	79	27.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.453	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000266657	lincRNA	OTTHUMT00000037265.2	T		-		142653541	+1	no_errors	ENST00000580249	ensembl	human	novel	74_37	rna	SNP	0.000	C
FGFR4	2264	genome.wustl.edu	37	5	176524620	176524620	+	Silent	SNP	C	C	T	rs199622668		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr5:176524620C>T	ENST00000292408.4	+	18	2597	c.2352C>T	c.(2350-2352)caC>caT	p.H784H	FGFR4_ENST00000292410.3_Silent_p.H744H|FGFR4_ENST00000393648.2_Silent_p.H716H|FGFR4_ENST00000393637.1_Silent_p.H744H|FGFR4_ENST00000502906.1_Silent_p.H784H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	784					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TCTTCAGCCACGACCCCCTGC	0.637										TSP Lung(9;0.080)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18598	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000160867						103.0	78.0	86.0					5																	176524620		2203	4300	6503	FGFR4	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2352C>T	5.37:g.176524620C>T		Somatic	0	44	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	11	60.71	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H784	ENST00000292408.4	37	c.2352	CCDS4410.1	5																																																																																			-	pirsf_FGF_rcpt_fam		0.637	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	protein_coding	OTTHUMT00000253410.1	C		rs199622668		176524620	+1	no_errors	ENST00000292408	ensembl	human	known	74_37	silent	SNP	0.977	T
OR8K3	219473	genome.wustl.edu	37	11	56086342	56086342	+	Missense_Mutation	SNP	T	T	G			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr11:56086342T>G	ENST00000312711.1	+	1	560	c.560T>G	c.(559-561)tTg>tGg	p.L187W		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TTGTTACCTTTGCTTTGTTCA	0.333																																																	0								ENSG00000181689						99.0	99.0	99.0					11																	56086342		2201	4296	6497	OR8K3	SO:0001583	missense	0			-	HGNC	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.560T>G	11.37:g.56086342T>G	ENSP00000323555:p.Leu187Trp	Somatic	0	70	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	19	51.28	Q6IFC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L187W	ENST00000312711.1	37	c.560	CCDS31527.1	11	.	.	.	.	.	.	.	.	.	.	T	10.24	1.294968	0.23564	.	.	ENSG00000181689	ENST00000312711	T	0.00414	7.52	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000413	T	0.02455	0.0075	H	0.99197	4.465	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28522	-1.0041	10	0.87932	D	0	.	10.1964	0.43056	0.1486:0.0:0.0:0.8514	.	187	Q8NH51	OR8K3_HUMAN	W	187	ENSP00000323555:L187W	ENSP00000323555:L187W	L	+	2	0	OR8K3	55842918	0.773000	0.28580	0.058000	0.19502	0.002000	0.02628	5.354000	0.66040	2.036000	0.60181	0.467000	0.42956	TTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.333	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	protein_coding	OTTHUMT00000391602.1	T	NM_001005202	-		56086342	+1	no_errors	ENST00000312711	ensembl	human	known	74_37	missense	SNP	0.012	G
RP11-402P6.11	0	genome.wustl.edu	37	X	70979276	70979276	+	lincRNA	SNP	A	A	G	rs67643106|rs199772875		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chrX:70979276A>G	ENST00000439926.1	-	0	440				BX276092.1_ENST00000408757.1_RNA																							gcgcgcgcgcacacacacaca	0.557													.|||	200	0.0529801	0.0454	0.0562	3775	,	,		12359	0.0188		0.0557	False		,,,				2504	0.0266																0								ENSG00000221684																																			BX276092.1			0			-	Clone_based_ensembl_gene																													X.37:g.70979276A>G		Somatic	0	41	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439926.1	37	NULL		X																																																																																			-	-		0.557	RP11-402P6.11-001	KNOWN	basic	lincRNA	ENSG00000221684	lincRNA	OTTHUMT00000057168.1	A		rs67643106		70979276	-1	no_errors	ENST00000408757	ensembl	human	novel	74_37	rna	SNP	0.001	G
ELAVL4	1996	genome.wustl.edu	37	1	50663196	50663197	+	Intron	INS	-	-	T	rs575024053		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:50663196_50663197insT	ENST00000371823.4	+	6	997				ELAVL4_ENST00000371821.1_Intron|ELAVL4_ENST00000371827.1_Intron|ELAVL4_ENST00000371824.1_Intron|ELAVL4_ENST00000448907.2_Intron|ELAVL4_ENST00000371819.1_Intron|ELAVL4_ENST00000357083.4_Intron	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4						mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TGGGGCTAGAATTTTTTTTTTT	0.351																																																	0								ENSG00000162374																																			ELAVL4	SO:0001627	intron_variant	0				HGNC	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.773+57->T	1.37:g.50663207_50663207dupT		Somatic	0	21	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371823.4	37	NULL	CCDS553.1	1																																																																																			-	-		0.351	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	ELAVL4	protein_coding	OTTHUMT00000021712.1	-	NM_021952			50663197	+1	no_errors	ENST00000474675	ensembl	human	known	74_37	rna	INS	1.000:1.000	T
INSC	387755	genome.wustl.edu	37	11	15243108	15243108	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr11:15243108C>T	ENST00000379554.3	+	8	1092	c.1046C>T	c.(1045-1047)gCc>gTc	p.A349V	INSC_ENST00000447214.2_3'UTR|INSC_ENST00000379556.3_Missense_Mutation_p.A302V|INSC_ENST00000530161.1_Missense_Mutation_p.A302V|INSC_ENST00000424273.1_Missense_Mutation_p.A260V|INSC_ENST00000525218.1_Missense_Mutation_p.A260V|INSC_ENST00000528567.1_Missense_Mutation_p.A302V	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	349					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GCTGTGGTGGCCCAGGTCACC	0.632																																																	0								ENSG00000188487						46.0	52.0	50.0					11																	15243108		2132	4229	6361	INSC	SO:0001583	missense	0			-	HGNC	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1046C>T	11.37:g.15243108C>T	ENSP00000368872:p.Ala349Val	Somatic	0	57	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,smart_Armadillo	p.A349V	ENST00000379554.3	37	c.1046	CCDS41621.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.490311	0.96339	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.51574	0.73;0.73;0.7;0.73;0.73;0.7	5.46	5.46	0.80206	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68320	0.2988	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.998	T	0.70238	-0.4927	10	0.72032	D	0.01	-21.8971	19.3063	0.94164	0.0:1.0:0.0:0.0	.	337;260;302;349	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	V	349;302;260;302;302;260	ENSP00000368872:A349V;ENSP00000368874:A302V;ENSP00000389161:A260V;ENSP00000435022:A302V;ENSP00000436194:A302V;ENSP00000436113:A260V	ENSP00000368872:A349V	A	+	2	0	INSC	15199684	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.330000	0.79181	2.552000	0.86080	0.655000	0.94253	GCC	-	superfamily_ARM-type_fold,smart_Armadillo		0.632	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	protein_coding	OTTHUMT00000386590.1	C	NM_001031853	-		15243108	+1	no_errors	ENST00000379554	ensembl	human	known	74_37	missense	SNP	1.000	T
GRK4	2868	genome.wustl.edu	37	4	3015469	3015470	+	Frame_Shift_Ins	INS	-	-	A	rs375862689|rs556199273	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:3015469_3015470insA	ENST00000398052.4	+	8	998_999	c.655_656insA	c.(655-657)caafs	p.Q219fs	GRK4_ENST00000398051.4_Frame_Shift_Ins_p.Q187fs|GRK4_ENST00000504933.1_Frame_Shift_Ins_p.Q219fs|GRK4_ENST00000345167.6_Frame_Shift_Ins_p.Q187fs	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CAAAAAGCTACAAAAAAAAAGA	0.391													AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	4	0.000798722	0.003	0.0	5008	,	,		20780	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000125388																																			GRK4	SO:0001589	frameshift_variant	0				HGNC		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.664dupA	4.37:g.3015478_3015478dupA	ENSP00000381129:p.Gln219fs	Somatic	0	50	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.R222fs	ENST00000398052.4	37	c.655_656	CCDS33946.1	4																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.391	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK4	protein_coding	OTTHUMT00000358176.2	-	NM_005307			3015470	+1	no_errors	ENST00000398052	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
MAMLD1	10046	genome.wustl.edu	37	X	149671639	149671639	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chrX:149671639G>T	ENST00000370401.2	+	6	2446	c.2136G>T	c.(2134-2136)gaG>gaT	p.E712D	MAMLD1_ENST00000455522.2_Missense_Mutation_p.E152D|MAMLD1_ENST00000426613.2_Missense_Mutation_p.E687D|MAMLD1_ENST00000262858.5_Missense_Mutation_p.E712D|MAMLD1_ENST00000432680.2_Intron			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	712					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TGGGGAGTGAGTCCTTCCTGC	0.657																																																	0								ENSG00000013619						72.0	71.0	71.0					X																	149671639		2203	4299	6502	MAMLD1	SO:0001583	missense	0			-	HGNC	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.2136G>T	X.37:g.149671639G>T	ENSP00000359428:p.Glu712Asp	Somatic	0	47	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	9	60.87	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E712D	ENST00000370401.2	37	c.2136	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723042	0.68959	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000262858;ENST00000426613;ENST00000455522	T;T;T;T	0.62941	-0.01;-0.01;-0.0;0.43	3.55	3.55	0.40652	.	0.419372	0.19776	N	0.106325	T	0.71921	0.3397	L	0.57536	1.79	0.26886	N	0.967439	D;D;D	0.67145	0.996;0.99;0.99	D;D;D	0.73380	0.978;0.98;0.98	T	0.61397	-0.7071	10	0.52906	T	0.07	.	9.7056	0.40214	0.0:0.0:1.0:0.0	.	584;687;712	F6WVG1;Q13495-4;Q13495	.;.;MAMD1_HUMAN	D	584;712;712;687;152	ENSP00000359428:E712D;ENSP00000262858:E712D;ENSP00000397438:E687D;ENSP00000389106:E152D	ENSP00000262858:E712D	E	+	3	2	MAMLD1	149422297	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.654000	0.54453	2.036000	0.60181	0.529000	0.55759	GAG	-	NULL		0.657	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	protein_coding	OTTHUMT00000060844.2	G	NM_005491	-		149671639	+1	no_errors	ENST00000262858	ensembl	human	known	74_37	missense	SNP	1.000	T
SUFU	51684	genome.wustl.edu	37	10	104357026	104357026	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr10:104357026C>T	ENST00000369902.3	+	7	1052	c.886C>T	c.(886-888)Cag>Tag	p.Q296*	SUFU_ENST00000471000.1_3'UTR|SUFU_ENST00000369899.2_Nonsense_Mutation_p.Q296*|SUFU_ENST00000423559.2_Nonsense_Mutation_p.Q296*	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	296					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		CATCGGCACACAGCCCCGGCG	0.622			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation		OREG0020482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	0								ENSG00000107882						70.0	66.0	68.0					10																	104357026		2203	4300	6503	SUFU	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.886C>T	10.37:g.104357026C>T	ENSP00000358918:p.Gln296*	Somatic	0	56	0.00	1381	0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SUFU_C,pfam_SUFU-like_domain,pirsf_Suppressor_of_fused_euk	p.Q296*	ENST00000369902.3	37	c.886	CCDS7537.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.590570	0.97688	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-22.2906	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	296	.	ENSP00000358915:Q296X	Q	+	1	0	SUFU	104347016	1.000000	0.71417	0.983000	0.44433	0.979000	0.70002	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	CAG	-	pfam_SUFU_C,pirsf_Suppressor_of_fused_euk		0.622	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUFU	protein_coding	OTTHUMT00000050089.1	C	NM_016169	-		104357026	+1	no_errors	ENST00000369902	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CCNL2	81669	genome.wustl.edu	37	1	1334664	1334666	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:1334664_1334666delGCC	ENST00000400809.3	-	1	26_28	c.21_23delGGC	c.(19-24)gcggct>gct	p.7_8AA>A	CCNL2_ENST00000408918.4_In_Frame_Del_p.7_8AA>A|RP4-758J18.2_ENST00000576232.1_5'Flank|MRPL20_ENST00000493287.1_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank|CCNL2_ENST00000408952.5_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	7					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A8S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		TGCAGCACCAgccgccgccgccg	0.773																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000221978																																			CCNL2	SO:0001651	inframe_deletion	0				HGNC	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.21_23delGGC	1.37:g.1334673_1334675delGCC	ENSP00000383611:p.Ala8del	Somatic	0	27	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.A8in_frame_del	ENST00000400809.3	37	c.23_21	CCDS30557.1	1																																																																																			-	pirsf_Cyclin_L		0.773	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	protein_coding	OTTHUMT00000008146.2	GCC	NM_030937			1334666	-1	no_errors	ENST00000400809	ensembl	human	known	74_37	in_frame_del	DEL	0.005:0.003:0.058	-
ZFYVE26	23503	genome.wustl.edu	37	14	68250044	68250044	+	Silent	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:68250044G>T	ENST00000347230.4	-	21	3963	c.3825C>A	c.(3823-3825)tcC>tcA	p.S1275S	ZFYVE26_ENST00000555452.1_Silent_p.S1275S	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1275					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TTGTCCTCGGGGAGCTCGGTG	0.577																																																	0								ENSG00000072121						111.0	113.0	112.0					14																	68250044		2203	4300	6503	ZFYVE26	SO:0001819	synonymous_variant	0			-	HGNC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3825C>A	14.37:g.68250044G>T		Somatic	0	49	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.S1275	ENST00000347230.4	37	c.3825	CCDS9788.1	14																																																																																			-	NULL		0.577	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	protein_coding	OTTHUMT00000412736.2	G	NM_015346	-		68250044	-1	no_errors	ENST00000347230	ensembl	human	known	74_37	silent	SNP	0.000	T
MFSD10	10227	genome.wustl.edu	37	4	2934379	2934379	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:2934379G>T	ENST00000329687.4	-	4	1013	c.479C>A	c.(478-480)tCc>tAc	p.S160Y	NOP14-AS1_ENST00000512712.2_RNA|NOP14-AS1_ENST00000507999.1_RNA|NOP14-AS1_ENST00000515194.1_RNA|MFSD10_ENST00000507555.1_Missense_Mutation_p.S160Y|NOP14-AS1_ENST00000505731.1_RNA|MFSD10_ENST00000355443.4_Missense_Mutation_p.S160Y|MFSD10_ENST00000514800.1_Missense_Mutation_p.S160Y|MFSD10_ENST00000508221.1_Missense_Mutation_p.S160Y	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	160					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GATGGCCGTGGAGAGGCTGAC	0.637																																																	0								ENSG00000109736						83.0	93.0	90.0					4																	2934379		2203	4300	6503	MFSD10	SO:0001583	missense	0			-	HGNC	L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.479C>A	4.37:g.2934379G>T	ENSP00000332646:p.Ser160Tyr	Somatic	0	41	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	Q07706	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S160Y	ENST00000329687.4	37	c.479	CCDS3365.1	4	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756012	0.49362	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	4.73	2.95	0.34219	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.151623	0.64402	N	0.000013	T	0.72669	0.3489	M	0.72894	2.215	0.32263	N	0.569941	D;D;D;D	0.64830	0.988;0.994;0.987;0.988	D;D;D;D	0.70227	0.953;0.968;0.968;0.953	T	0.79162	-0.1917	10	0.72032	D	0.01	-16.3675	13.6233	0.62149	0.0:0.4534:0.5465:0.0	.	160;160;160;160	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	Y	160	ENSP00000426907:S160Y;ENSP00000347619:S160Y;ENSP00000332646:S160Y;ENSP00000425757:S160Y;ENSP00000423402:S160Y	ENSP00000332646:S160Y	S	-	2	0	MFSD10	2904177	1.000000	0.71417	0.997000	0.53966	0.476000	0.33039	3.764000	0.55264	0.397000	0.25310	-0.302000	0.09304	TCC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.637	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD10	protein_coding	OTTHUMT00000358072.2	G	NM_001120	-		2934379	-1	no_errors	ENST00000329687	ensembl	human	known	74_37	missense	SNP	1.000	T
OR2T2	401992	genome.wustl.edu	37	1	248616705	248616711	+	Frame_Shift_Del	DEL	TGCTGCG	TGCTGCG	-	rs199823862|rs372931983		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	TGCTGCG	TGCTGCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:248616705_248616711delTGCTGCG	ENST00000342927.3	+	1	629_635	c.607_613delTGCTGCG	c.(607-615)tgctgcgtgfs	p.CCV203fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGCCTGCTGCGTGCTGATGCT	0.527																																																	0								ENSG00000196240			51,3755		2,47,1854						-2.5	0.6			76	261,7371		12,237,3567	no	frameshift	OR2T2	NM_001004136.1		14,284,5421	A1A1,A1R,RR		3.4198,1.34,2.7277				312,11126				OR2T2	SO:0001589	frameshift_variant	0				HGNC	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.607_613delTGCTGCG	1.37:g.248616705_248616711delTGCTGCG	ENSP00000343062:p.Cys203fs	Somatic	NA	NA	NA		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RNM1|B9EH01	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C204fs	ENST00000342927.3	37	c.607_613	CCDS31116.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	protein_coding	OTTHUMT00000097421.1	TGCTGCG	NM_001004136			248616711	+1	no_errors	ENST00000342927	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.001:0.000:0.000:0.000:0.000:0.001	-
DEFB105A	245908	genome.wustl.edu	37	8	7679549	7679549	+	Missense_Mutation	SNP	C	C	T	rs200757797		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr8:7679549C>T	ENST00000334773.6	-	3	268	c.218G>A	c.(217-219)tGc>tAc	p.C73Y		NM_152250.1	NP_689463.1	Q8NG35	D105A_HUMAN	defensin, beta 105A	73					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				lung(2)|skin(1)	3				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		CTGTCTGCAGCAGAGAAAGTT	0.483																																																	0								ENSG00000186562						2.0	2.0	2.0					8																	7679549		1339	2913	4252	DEFB105A	SO:0001583	missense	0			-	HGNC	AB089180	CCDS34832.1	8p23.1	2011-03-29	2005-02-28	2005-03-03	ENSG00000186562	ENSG00000186562		"""Defensins, beta"""	18087	protein-coding gene	gene with protein product			"""defensin, beta 105"""	DEFB105		11854508, 12734011	Standard	NM_152250		Approved	DEFB-5	uc011kwp.2	Q8NG35	OTTHUMG00000150011	ENST00000334773.6:c.218G>A	8.37:g.7679549C>T	ENSP00000334330:p.Cys73Tyr	Somatic	0	25	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	A1A581|Q8IZN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C73Y	ENST00000334773.6	37	c.218	CCDS34832.1	8	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747567	0.30955	.	.	ENSG00000186562	ENST00000334773	D	0.99270	-5.66	3.1	2.16	0.27623	.	0.160540	0.30076	N	0.010461	D	0.98298	0.9436	.	.	.	0.20764	N	0.999856	.	.	.	.	.	.	D	0.96415	0.9307	7	0.87932	D	0	-9.8301	7.9374	0.29937	0.0:0.7452:0.2548:0.0	.	.	.	.	Y	73	ENSP00000334330:C73Y	ENSP00000334330:C73Y	C	-	2	0	DEFB105A	7716959	0.871000	0.30034	0.185000	0.23176	0.020000	0.10135	2.543000	0.45752	0.810000	0.34279	0.543000	0.68304	TGC	-	NULL		0.483	DEFB105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB105A	protein_coding	OTTHUMT00000315758.2	C	NM_152250	rs200757797		7679549	-1	no_errors	ENST00000334773	ensembl	human	known	74_37	missense	SNP	0.244	T
GNAS	2778	genome.wustl.edu	37	20	57466892	57466892	+	Silent	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr20:57466892C>T	ENST00000371085.3	+	1	535	c.111C>T	c.(109-111)taC>taT	p.Y37Y	GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000306090.10_Silent_p.Y37Y|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000371081.1_Silent_p.Y37Y|GNAS_ENST00000371095.3_Silent_p.Y37Y|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000265620.7_Silent_p.Y37Y|GNAS_ENST00000354359.7_Silent_p.Y37Y|GNAS_ENST00000464624.2_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	37					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AGCAGGTCTACCGGGCCACGC	0.716			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0			GRCh37	CM002268	GNAS	M		ENSG00000087460						47.0	37.0	40.0					20																	57466892		2196	4292	6488	GNAS	SO:0001819	synonymous_variant	0			-	HGNC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.111C>T	20.37:g.57466892C>T		Somatic	0	35	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	20	55.56	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.Y37	ENST00000371085.3	37	c.111	CCDS13472.1	20																																																																																			-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su		0.716	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080431.2	C	NM_000516	-		57466892	+1	no_errors	ENST00000354359	ensembl	human	known	74_37	silent	SNP	0.996	T
OR4F6	390648	genome.wustl.edu	37	15	102346825	102346825	+	Silent	SNP	A	A	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr15:102346825A>T	ENST00000328882.4	+	1	924	c.903A>T	c.(901-903)cgA>cgT	p.R301R		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TGAGAAGACGATGCTCTCAGT	0.308																																																	0								ENSG00000184140						30.0	29.0	30.0					15																	102346825		2202	4300	6502	OR4F6	SO:0001819	synonymous_variant	0			-	HGNC	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.903A>T	15.37:g.102346825A>T		Somatic	0	56	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	25	57.63	B9EH28|Q6IF95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R301	ENST00000328882.4	37	c.903	CCDS32341.1	15																																																																																			-	NULL		0.308	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	protein_coding	OTTHUMT00000417593.1	A		-		102346825	+1	no_errors	ENST00000328882	ensembl	human	known	74_37	silent	SNP	0.000	T
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
UBE2K	3093	genome.wustl.edu	37	4	39780193	39780193	+	3'UTR	SNP	G	G	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:39780193G>A	ENST00000261427.5	+	0	1026				UBE2K_ENST00000438068.2_3'UTR|UBE2K_ENST00000445950.2_3'UTR|UBE2K_ENST00000295963.6_3'UTR|UBE2K_ENST00000503368.1_3'UTR	NM_001111112.1|NM_005339.4	NP_001104582.1|NP_005330.1	P61086	UBE2K_HUMAN	ubiquitin-conjugating enzyme E2K						intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein K48-linked ubiquitination (GO:0070936)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)			large_intestine(1)|lung(1)|ovary(2)	4						ATTGGAGACTGAAAAAAAAAA	0.303																																					NSCLC(101;689 1592 16105 29682 31745)												0								ENSG00000078140																																			UBE2K	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U58522	CCDS33976.1, CCDS47043.1, CCDS47044.1	4p14	2011-05-19	2011-05-19	2007-12-04	ENSG00000078140	ENSG00000078140		"""Ubiquitin-conjugating enzymes E2"""	4914	protein-coding gene	gene with protein product		602846	"""huntingtin interacting protein 2"", ""ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)"""	HIP2		8702625, 17873885	Standard	NM_005339		Approved	HYPG, UBC1	uc003guu.4	P61086	OTTHUMG00000160543	ENST00000261427.5:c.*139G>A	4.37:g.39780193G>A		Somatic	0	48	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.42	A6NJC1|A8K5Y9|B2RDF8|C9JGP1|O54806|P27924|Q16721|Q9CVV9|Q9Y2D3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261427.5	37	NULL	CCDS33976.1	4																																																																																			-	-		0.303	UBE2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2K	protein_coding	OTTHUMT00000361061.1	G	NM_005339	-		39780193	+1	no_errors	ENST00000438068	ensembl	human	known	74_37	rna	SNP	1.000	A
NOTCH1	4851	genome.wustl.edu	37	9	139409819	139409819	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:139409819G>T	ENST00000277541.6	-	12	2012	c.1937C>A	c.(1936-1938)gCc>gAc	p.A646D		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	646	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGGGCTGCTGGCACAGTCATC	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0								ENSG00000148400						71.0	80.0	77.0					9																	139409819		2137	4250	6387	NOTCH1	SO:0001583	missense	0			-	HGNC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1937C>A	9.37:g.139409819G>T	ENSP00000277541:p.Ala646Asp	Somatic	0	79	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q59ED8|Q5SXM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.A646D	ENST00000277541.6	37	c.1937	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151414	0.57151	.	.	ENSG00000148400	ENST00000277541	D	0.87334	-2.24	4.92	4.03	0.46877	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.206476	0.41294	U	0.000901	D	0.84170	0.5413	L	0.31752	0.955	0.46317	D	0.998984	P	0.39131	0.661	P	0.47915	0.561	T	0.80843	-0.1201	10	0.30078	T	0.28	.	12.2799	0.54757	0.0826:0.0:0.9174:0.0	.	646	P46531	NOTC1_HUMAN	D	646	ENSP00000277541:A646D	ENSP00000277541:A646D	A	-	2	0	NOTCH1	138529640	1.000000	0.71417	0.993000	0.49108	0.622000	0.37654	5.695000	0.68279	1.058000	0.40530	-0.251000	0.11542	GCC	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	protein_coding	OTTHUMT00000055087.1	G	NM_017617	-		139409819	-1	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	SNP	1.000	T
GUCY2EP	390226	genome.wustl.edu	37	11	76414357	76414357	+	lincRNA	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr11:76414357G>T	ENST00000533588.1	+	0	904				GUCY2EP_ENST00000526984.1_RNA																							GGAATGGAATGCCAGCCTCCT	0.423																																																	0								ENSG00000204529																																			GUCY2EP			0			-	HGNC																													11.37:g.76414357G>T		Somatic	0	42	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000533588.1	37	NULL		11																																																																																			-	-		0.423	RP11-672A2.3-001	KNOWN	basic|exp_conf	lincRNA	GUCY2EP	lincRNA	OTTHUMT00000383015.2	G		-		76414357	-1	no_errors	ENST00000526984	ensembl	human	known	74_37	rna	SNP	0.001	T
TECPR2	9895	genome.wustl.edu	37	14	102900692	102900692	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:102900692G>T	ENST00000359520.7	+	9	1764	c.1538G>T	c.(1537-1539)gGc>gTc	p.G513V	TECPR2_ENST00000558678.1_Missense_Mutation_p.G513V	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	513					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						AGTGTCCTGGGCAGTAGCGTG	0.537																																																	0								ENSG00000196663						93.0	88.0	90.0					14																	102900692		2203	4300	6503	TECPR2	SO:0001583	missense	0			-	HGNC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1538G>T	14.37:g.102900692G>T	ENSP00000352510:p.Gly513Val	Somatic	0	40	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.G513V	ENST00000359520.7	37	c.1538	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414410	0.25465	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.16743	2.32	5.19	4.3	0.51218	.	0.787657	0.12072	N	0.502188	T	0.15176	0.0366	L	0.43152	1.355	0.48288	D	0.999628	P;P	0.37122	0.583;0.583	B;B	0.34489	0.07;0.184	T	0.03325	-1.1048	10	0.48119	T	0.1	.	8.7622	0.34680	0.0758:0.0:0.7752:0.149	.	513;513	A5PKY3;O15040	.;TCPR2_HUMAN	V	513	ENSP00000352510:G513V	ENSP00000352510:G513V	G	+	2	0	TECPR2	101970445	1.000000	0.71417	0.960000	0.40013	0.306000	0.27790	4.080000	0.57620	1.196000	0.43129	0.555000	0.69702	GGC	-	NULL		0.537	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	protein_coding	OTTHUMT00000415056.2	G	NM_014844	-		102900692	+1	no_errors	ENST00000359520	ensembl	human	known	74_37	missense	SNP	0.997	T
BMP2K	55589	genome.wustl.edu	37	4	79792085	79792085	+	Missense_Mutation	SNP	G	G	C	rs376418550	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:79792085G>C	ENST00000335016.5	+	11	1546	c.1380G>C	c.(1378-1380)caG>caC	p.Q460H	BMP2K_ENST00000502871.1_Missense_Mutation_p.Q460H	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	460	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.Q460H(3)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ATCCTCACcagcagcagcagc	0.577																																																	3	Substitution - Missense(3)	endometrium(2)|prostate(1)						ENSG00000138756						40.0	45.0	44.0					4																	79792085		2203	4300	6503	BMP2K	SO:0001583	missense	0			-	HGNC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1380G>C	4.37:g.79792085G>C	ENSP00000334836:p.Gln460His	Somatic	0	79	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	10.71	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q460H	ENST00000335016.5	37	c.1380	CCDS47083.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.089|8.089	0.774118|0.774118	0.16051|0.16051	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000502613|ENST00000502871;ENST00000335016;ENST00000264889	.|T;T	.|0.74002	.|0.79;-0.8	5.12|5.12	2.26|2.26	0.28386|0.28386	.|.	.|1.238260	.|0.06146	.|N	.|0.673324	T|T	0.57504|0.57504	0.2058|0.2058	N|N	0.15975|0.15975	0.35|0.35	0.30181|0.30181	N|N	0.800383|0.800383	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.51803|0.51803	-0.8659|-0.8659	5|10	.|0.42905	.|T	.|0.14	0.0809|0.0809	5.9141|5.9141	0.19045|0.19045	0.0722:0.2493:0.5501:0.1284|0.0722:0.2493:0.5501:0.1284	.|.	.|460;460	.|Q9NSY1;Q4W5H2	.|BMP2K_HUMAN;.	P|H	153|460;460;474	.|ENSP00000421768:Q460H;ENSP00000334836:Q460H	.|ENSP00000264889:Q474H	A|Q	+|+	1|3	0|2	BMP2K|BMP2K	80011109|80011109	0.996000|0.996000	0.38824|0.38824	0.995000|0.995000	0.50966|0.50966	0.181000|0.181000	0.23173|0.23173	0.092000|0.092000	0.15066|0.15066	0.524000|0.524000	0.28502|0.28502	0.460000|0.460000	0.39030|0.39030	GCA|CAG	-	NULL		0.577	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	protein_coding		G	NM_017593	-		79792085	+1	no_errors	ENST00000335016	ensembl	human	known	74_37	missense	SNP	1.000	C
GANAB	23193	genome.wustl.edu	37	11	62396402	62396402	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr11:62396402G>T	ENST00000356638.3	-	17	2035	c.2019C>A	c.(2017-2019)ttC>ttA	p.F673L	GANAB_ENST00000534779.1_Missense_Mutation_p.F581L|GANAB_ENST00000346178.4_Missense_Mutation_p.F695L|GANAB_ENST00000540933.1_Missense_Mutation_p.F576L	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	673					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CATGTGCCCGGAAGAATGGCT	0.547																																					Melanoma(23;1005 1074 15747 18937)												0								ENSG00000089597						132.0	127.0	129.0					11																	62396402		2202	4299	6501	GANAB	SO:0001583	missense	0			-	HGNC	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2019C>A	11.37:g.62396402G>T	ENSP00000349053:p.Phe673Leu	Somatic	0	37	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom	p.F695L	ENST00000356638.3	37	c.2085	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583031	0.65992	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86	5.19	2.85	0.33270	Glycoside hydrolase, superfamily (1);	0.107074	0.64402	D	0.000006	D	0.91630	0.7355	M	0.87097	2.86	0.52099	D	0.999946	P;P;B;B	0.36974	0.576;0.576;0.168;0.083	B;B;B;B	0.44163	0.443;0.443;0.174;0.075	D	0.90634	0.4569	10	0.72032	D	0.01	-14.4677	6.5398	0.22375	0.3568:0.0:0.6432:0.0	.	559;581;673;695	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	L	695;673;581;576	ENSP00000340466:F695L;ENSP00000349053:F673L;ENSP00000435306:F581L;ENSP00000442962:F576L	ENSP00000340466:F695L	F	-	3	2	GANAB	62152978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.205000	0.51090	1.085000	0.41206	0.655000	0.94253	TTC	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.547	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	protein_coding	OTTHUMT00000395689.1	G	NM_198334	-		62396402	-1	no_errors	ENST00000346178	ensembl	human	known	74_37	missense	SNP	1.000	T
UNC5B	219699	genome.wustl.edu	37	10	72975564	72975565	+	Intron	DEL	GT	GT	-	rs61070575|rs55848098|rs201949769|rs151276494|rs55906066|rs72091766|rs71924552		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr10:72975564_72975565delGT	ENST00000335350.6	+	1	495				UNC5B_ENST00000373192.4_Intron|UNC5B-AS1_ENST00000447119.2_RNA|UNC5B-AS1_ENST00000449737.1_RNA|AL359832.1_ENST00000401185.1_RNA	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						TCTCTGCTTGgtgtgtgtgtgt	0.485																																																	0								ENSG00000216004																																			AL359832.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.79+2743GT>-	10.37:g.72975574_72975575delGT		Somatic	0	15	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000335350.6	37	NULL	CCDS7309.1	10																																																																																			-	-		0.485	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216004	protein_coding	OTTHUMT00000048541.1	GT	NM_170744			72975565	+1	no_errors	ENST00000401185	ensembl	human	novel	74_37	rna	DEL	0.024:0.453	-
KCNH5	27133	genome.wustl.edu	37	14	63269288	63269288	+	Missense_Mutation	SNP	G	G	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:63269288G>C	ENST00000322893.7	-	9	1849	c.1581C>G	c.(1579-1581)atC>atG	p.I527M	KCNH5_ENST00000394968.1_Missense_Mutation_p.I469M|KCNH5_ENST00000420622.2_Missense_Mutation_p.I527M	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	527					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CCTTGGGACAGATGGAGAGGA	0.428																																																	0								ENSG00000140015						37.0	39.0	38.0					14																	63269288		2203	4300	6503	KCNH5	SO:0001583	missense	0			-	HGNC	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1581C>G	14.37:g.63269288G>C	ENSP00000321427:p.Ile527Met	Somatic	0	24	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	6	64.71	C9JP98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.I527M	ENST00000322893.7	37	c.1581	CCDS9756.1	14	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812984	0.32053	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968	D;D;D	0.96745	-4.11;-4.11;-4.11	5.35	2.51	0.30379	Cyclic nucleotide-binding-like (1);	0.050763	0.85682	D	0.000000	D	0.92932	0.7751	L	0.29908	0.895	0.80722	D	1	P;P;P	0.48016	0.531;0.531;0.904	B;B;P	0.49561	0.382;0.269;0.615	D	0.89179	0.3542	10	0.35671	T	0.21	.	5.9722	0.19359	0.3125:0.0:0.5575:0.1301	.	469;527;527	Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;KCNH5_HUMAN	M	527;527;469	ENSP00000321427:I527M;ENSP00000395439:I527M;ENSP00000378419:I469M	ENSP00000321427:I527M	I	-	3	3	KCNH5	62339041	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.033000	0.30191	0.771000	0.33359	-0.244000	0.11960	ATC	-	superfamily_cNMP-bd-like,prints_K_chnl_volt-dep_EAG		0.428	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	protein_coding	OTTHUMT00000411747.1	G	NM_139318	-		63269288	-1	no_errors	ENST00000322893	ensembl	human	known	74_37	missense	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	39010003	39010003	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr19:39010003G>T	ENST00000359596.3	+	67	10168	c.10168G>T	c.(10168-10170)Ggc>Tgc	p.G3390C	RYR1_ENST00000360985.3_Missense_Mutation_p.G3390C|RYR1_ENST00000355481.4_Missense_Mutation_p.G3390C			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3390					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGCCCAGGAGGGCGAGCTGCT	0.662																																																	0								ENSG00000196218						52.0	40.0	44.0					19																	39010003		2202	4300	6502	RYR1	SO:0001583	missense	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10168G>T	19.37:g.39010003G>T	ENSP00000352608:p.Gly3390Cys	Somatic	0	53	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.G3390C	ENST00000359596.3	37	c.10168	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480351	0.26598	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96885	-4.16;-4.15;-4.16	3.55	3.55	0.40652	.	0.286504	0.27294	U	0.020023	D	0.94324	0.8176	L	0.38175	1.15	0.35696	D	0.815245	D;D;D	0.61697	0.971;0.99;0.983	P;P;B	0.50378	0.639;0.639;0.436	D	0.95626	0.8685	10	0.66056	D	0.02	.	10.3976	0.44209	0.0:0.0:0.804:0.196	.	3390;3390;3390	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	C	3390;3390;3390;310	ENSP00000352608:G3390C;ENSP00000347667:G3390C;ENSP00000354254:G3390C	ENSP00000347667:G3390C	G	+	1	0	RYR1	43701843	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.150000	0.71801	1.836000	0.53414	0.430000	0.28490	GGC	-	NULL		0.662	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	G		-		39010003	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE1A	5136	genome.wustl.edu	37	2	183066503	183066503	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr2:183066503G>T	ENST00000410103.1	-	10	1047	c.964C>A	c.(964-966)Cta>Ata	p.L322I	PDE1A_ENST00000409365.1_Missense_Mutation_p.L306I|PDE1A_ENST00000346717.4_Missense_Mutation_p.L288I|PDE1A_ENST00000456212.1_Missense_Mutation_p.L322I|PDE1A_ENST00000351439.5_Missense_Mutation_p.L306I|PDE1A_ENST00000331935.6_Missense_Mutation_p.L322I|PDE1A_ENST00000536095.1_Missense_Mutation_p.L218I|PDE1A_ENST00000435564.1_Missense_Mutation_p.L322I|PDE1A_ENST00000358139.2_Missense_Mutation_p.L322I	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	322	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TCAATCACTAGGTTCCGAAGA	0.388																																																	0								ENSG00000115252						70.0	69.0	70.0					2																	183066503		2203	4300	6503	PDE1A	SO:0001583	missense	0			-	HGNC		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.964C>A	2.37:g.183066503G>T	ENSP00000387037:p.Leu322Ile	Somatic	0	42	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	51	15.00	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_PDEase_N,superfamily_GRIP,smart_HD/PDEase_dom,prints_PDEase	p.L322I	ENST00000410103.1	37	c.964	CCDS33344.1	2	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219163	0.58560	.	.	ENSG00000115252	ENST00000435564;ENST00000346717;ENST00000536095;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	D;D;D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.06	2.27	0.28462	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.189104	0.37178	N	0.002208	D	0.87156	0.6107	L	0.58354	1.805	0.50171	D	0.999859	D;D;P;D;D	0.89917	0.998;1.0;0.933;1.0;0.997	D;D;P;D;D	0.91635	0.98;0.999;0.897;0.991;0.967	D	0.85038	0.0921	10	0.72032	D	0.01	.	8.5596	0.33503	0.3382:0.0:0.6618:0.0	.	218;288;322;306;322	B7Z3A7;P54750-3;P54750;P54750-2;P54750-4	.;.;PDE1A_HUMAN;.;.	I	322;288;218;306;322;306;322;322;322	ENSP00000410309:L322I;ENSP00000329112:L288I;ENSP00000439938:L218I;ENSP00000386767:L306I;ENSP00000331574:L322I;ENSP00000309269:L306I;ENSP00000387037:L322I;ENSP00000350858:L322I;ENSP00000408874:L322I	ENSP00000331574:L322I	L	-	1	2	PDE1A	182774748	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	2.125000	0.42016	0.245000	0.21373	0.655000	0.94253	CTA	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom		0.388	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PDE1A	protein_coding	OTTHUMT00000334356.1	G		-		183066503	-1	no_errors	ENST00000456212	ensembl	human	known	74_37	missense	SNP	0.999	T
FLRT2	23768	genome.wustl.edu	37	14	86092517	86092517	+	3'UTR	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:86092517G>T	ENST00000330753.4	+	0	5426					NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TAGAAAGCACGTGATGGAATC	0.408																																																	0								ENSG00000185070																																			FLRT2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.*2676G>T	14.37:g.86092517G>T		Somatic	0	37	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	10	67.74	A0AV84|B7ZLP3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330753.4	37	NULL	CCDS9877.1	14																																																																																			-	-		0.408	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	G		-		86092517	+1	no_errors	ENST00000553650	ensembl	human	putative	74_37	rna	SNP	0.000	T
RABL6	55684	genome.wustl.edu	37	9	139734633	139734635	+	In_Frame_Del	DEL	AGA	AGA	-	rs571278001|rs145591109		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:139734633_139734635delAGA	ENST00000311502.7	+	14	2194_2196	c.1958_1960delAGA	c.(1957-1962)gagaag>gag	p.K660del	RABL6_ENST00000371675.3_In_Frame_Del_p.K545del|RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000371663.4_In_Frame_Del_p.K661del|RABL6_ENST00000357466.2_Intron			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	660	Interaction with CDKN2A.|Lys-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCCTCTaaggagaagaagaagaa	0.571																																																	0								ENSG00000196642		,	149,3501		4,141,1680					,	2.6	1.0		dbSNP_134	65	433,7429		12,409,3510	no	coding,coding	C9orf86	NM_024718.4,NM_001173988.1	,	16,550,5190	A1A1,A1R,RR		5.5075,4.0822,5.0556	,	,		582,10930				RABL6	SO:0001651	inframe_deletion	0				HGNC	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1958_1960delAGA	9.37:g.139734642_139734644delAGA	ENSP00000311134:p.Lys660del	Somatic	0	35	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.K658in_frame_del	ENST00000311502.7	37	c.1961_1963	CCDS48058.1	9																																																																																			-	NULL		0.571	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	protein_coding	OTTHUMT00000055141.4	AGA	NM_024718			139734635	+1	no_errors	ENST00000371663	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
RARB	5915	genome.wustl.edu	37	3	25635144	25635144	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr3:25635144G>T	ENST00000404969.1	+	6	958	c.958G>T	c.(958-960)Gaa>Taa	p.E320*	RARB_ENST00000330688.4_Nonsense_Mutation_p.E313*|RARB_ENST00000458646.1_Nonsense_Mutation_p.E201*|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000437042.2_Nonsense_Mutation_p.E201*			P10826	RARB_HUMAN	retinoic acid receptor, beta	320	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCTGCCTTTGGAAATGGATGA	0.468																																																	0								ENSG00000077092						144.0	131.0	135.0					3																	25635144		2203	4300	6503	RARB	SO:0001587	stop_gained	0			-	HGNC	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.958G>T	3.37:g.25635144G>T	ENSP00000385865:p.Glu320*	Somatic	0	79	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	P12891|Q00989|Q15298|Q9UN48	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.E320*	ENST00000404969.1	37	c.958		3	.	.	.	.	.	.	.	.	.	.	G	40	8.333932	0.98764	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	.	.	.	5.95	5.95	0.96441	.	0.100905	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	20.3712	0.98891	0.0:0.0:1.0:0.0	.	.	.	.	X	320;320;320;201;313;201	.	ENSP00000332296:E313X	E	+	1	0	RARB	25610148	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.038000	0.88943	2.822000	0.97130	0.655000	0.94253	GAA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt		0.468	RARB-201	KNOWN	basic	protein_coding	RARB	protein_coding		G	NM_000965, NM_016152	-		25635144	+1	no_errors	ENST00000404969	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ERN1	2081	genome.wustl.edu	37	17	62133221	62133223	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr17:62133221_62133223delGCT	ENST00000433197.3	-	13	1579_1581	c.1484_1486delAGC	c.(1483-1488)cagctg>ctg	p.Q495del		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						TGGAAGGGCAgctgctgctgctg	0.631																																																	0								ENSG00000178607			53,58,3253		10,0,33,12,34,1593						4.2	1.0			6	0,118,6892		0,0,0,19,80,3406	no	codingComplex	ERN1	NM_001433.3		10,0,33,31,114,4999	A1A1,A1A2,A1R,A2A2,A2R,RR		1.6833,3.2996,2.2074				53,176,10145				ERN1	SO:0001651	inframe_deletion	0				HGNC	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1484_1486delAGC	17.37:g.62133230_62133232delGCT	ENSP00000401445:p.Gln495del	Somatic	0	19	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_KEN_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.Q495in_frame_del	ENST00000433197.3	37	c.1486_1484	CCDS45762.1	17																																																																																			-	NULL		0.631	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	protein_coding	OTTHUMT00000443734.2	GCT	NM_001433			62133223	-1	no_errors	ENST00000433197	ensembl	human	known	74_37	in_frame_del	DEL	0.999:0.998:0.998	-
SAMHD1	25939	genome.wustl.edu	37	20	35545356	35545356	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr20:35545356C>A	ENST00000262878.4	-	8	1148	c.949G>T	c.(949-951)Gcc>Tcc	p.A317S	SAMHD1_ENST00000373694.5_Missense_Mutation_p.A102S	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	317	HD.				dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				GCATACCTGGCAAAATAATCC	0.328																																																	0								ENSG00000101347						54.0	50.0	52.0					20																	35545356		2202	4300	6502	SAMHD1	SO:0001583	missense	0			-	HGNC	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.949G>T	20.37:g.35545356C>A	ENSP00000262878:p.Ala317Ser	Somatic	0	72	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	29	64.63	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HD_domain,pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,smart_HD/PDEase_dom,pfscan_SAM	p.A317S	ENST00000262878.4	37	c.949	CCDS13288.1	20	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818596	0.90790	.	.	ENSG00000101347	ENST00000262878;ENST00000373694	D;D	0.95205	-2.63;-3.64	5.97	5.97	0.96955	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.049720	0.85682	D	0.000000	D	0.94407	0.8201	L	0.41236	1.265	0.80722	D	1	P	0.46859	0.885	P	0.51297	0.665	D	0.93031	0.6448	10	0.35671	T	0.21	.	20.016	0.97477	0.0:1.0:0.0:0.0	.	317	Q9Y3Z3	SAMH1_HUMAN	S	317;102	ENSP00000262878:A317S;ENSP00000362798:A102S	ENSP00000262878:A317S	A	-	1	0	SAMHD1	34978770	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.893000	0.69798	2.823000	0.97156	0.591000	0.81541	GCC	-	pfam_HD_domain,smart_HD/PDEase_dom		0.328	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMHD1	protein_coding	OTTHUMT00000079062.2	C	NM_015474	-		35545356	-1	no_errors	ENST00000262878	ensembl	human	known	74_37	missense	SNP	1.000	A
DLGAP1	9229	genome.wustl.edu	37	18	3708389	3708389	+	Intron	DEL	G	G	-			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr18:3708389delG	ENST00000315677.3	-	7	2187				DLGAP1_ENST00000515196.2_Intron|DLGAP1_ENST00000400149.3_Intron|DLGAP1_ENST00000581699.1_Intron|DLGAP1_ENST00000534970.1_Intron|DLGAP1_ENST00000400150.3_Intron|DLGAP1_ENST00000539435.1_Intron|DLGAP1_ENST00000400155.1_Intron|DLGAP1_ENST00000581527.1_Intron|DLGAP1_ENST00000400145.2_Intron|DLGAP1_ENST00000400147.2_Intron|DLGAP1_ENST00000584874.1_Intron	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1						synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				AATTCACCAAGTTGAAGTTCA	0.458																																																	0								ENSG00000170579																																			DLGAP1	SO:0001627	intron_variant	0				HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1591+20745C>-	18.37:g.3708389delG		Somatic	0	48	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	30	23.08	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000315677.3	37	NULL	CCDS11836.1	18																																																																																			-	-		0.458	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	G				3708389	-1	no_errors	ENST00000498188	ensembl	human	known	74_37	rna	DEL	0.000	-
TTR	7276	genome.wustl.edu	37	18	29178578	29178578	+	Silent	SNP	C	C	T	rs143906738		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr18:29178578C>T	ENST00000237014.3	+	4	561	c.384C>T	c.(382-384)gcC>gcT	p.A128A		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	128					extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ACACCATTGCCGCCCTGCTGA	0.577																																																	0								ENSG00000118271	C		0,4406		0,0,2203	78.0	68.0	71.0		384	-12.2	0.0	18	dbSNP_134	71	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	TTR	NM_000371.3		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		128/148	29178578	4,13002	2203	4300	6503	TTR	SO:0001819	synonymous_variant	0			-	HGNC	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.384C>T	18.37:g.29178578C>T		Somatic	0	72	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transthyretin/HIU_hydrolase_SF,superfamily_Transthyretin/HIU_hydrolase_SF,smart_Transthyretin/HIU_hydrolase_SF,prints_Transthyretin/HIU_hydrolase	p.A128	ENST00000237014.3	37	c.384	CCDS11899.1	18																																																																																			-	pfam_Transthyretin/HIU_hydrolase_SF,superfamily_Transthyretin/HIU_hydrolase_SF,smart_Transthyretin/HIU_hydrolase_SF		0.577	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTR	protein_coding	OTTHUMT00000254948.1	C	NM_000371	rs143906738		29178578	+1	no_errors	ENST00000237014	ensembl	human	known	74_37	silent	SNP	0.085	T
CYP2F1	1572	genome.wustl.edu	37	19	41630690	41630690	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr19:41630690C>T	ENST00000331105.2	+	8	1103	c.1031C>T	c.(1030-1032)gCg>gTg	p.A344V		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	344					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						AAGGACCGCGCGGCCATGCCT	0.662																																																	0								ENSG00000197446						24.0	22.0	23.0					19																	41630690		2201	4300	6501	CYP2F1	SO:0001583	missense	0			-	HGNC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.1031C>T	19.37:g.41630690C>T	ENSP00000333534:p.Ala344Val	Somatic	0	34	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_CYP2_fam,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.A344V	ENST00000331105.2	37	c.1031	CCDS12572.1	19	.	.	.	.	.	.	.	.	.	.	c	5.622	0.299530	0.10622	.	.	ENSG00000197446	ENST00000331105	T	0.69806	-0.43	3.13	0.826	0.18829	.	0.724493	0.13151	U	0.409881	T	0.47820	0.1466	L	0.38733	1.17	0.09310	N	1	B	0.17667	0.023	B	0.08055	0.003	T	0.31194	-0.9952	10	0.36615	T	0.2	.	1.5189	0.02512	0.2192:0.4349:0.2145:0.1314	.	344	P24903	CP2F1_HUMAN	V	344	ENSP00000333534:A344V	ENSP00000333534:A344V	A	+	2	0	CYP2F1	46322530	0.000000	0.05858	0.117000	0.21633	0.408000	0.30992	-3.720000	0.00384	0.065000	0.16485	0.089000	0.15464	GCG	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.662	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2F1	protein_coding	OTTHUMT00000394527.2	C		-		41630690	+1	no_errors	ENST00000331105	ensembl	human	known	74_37	missense	SNP	0.000	T
DEDD	9191	genome.wustl.edu	37	1	161091814	161091815	+	3'UTR	INS	-	-	A	rs34197267|rs397804763|rs369539156		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:161091814_161091815insA	ENST00000368006.3	-	0	1293_1294				NIT1_ENST00000368008.1_Intron|DEDD_ENST00000545495.1_3'UTR|DEDD_ENST00000490843.2_3'UTR|DEDD_ENST00000368005.1_Intron|DEDD_ENST00000458050.2_3'UTR|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000392188.1_3'UTR	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing						decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TCTTTTTCTTTAAAAAAAAAAA	0.47																																																	0								ENSG00000158796																																			DEDD	SO:0001624	3_prime_UTR_variant	0				HGNC	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.*123->T	1.37:g.161091825_161091825dupA		Somatic	0	16	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	D3DVF5|O60737	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368006.3	37	NULL	CCDS1219.1	1																																																																																			-	-		0.470	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEDD	protein_coding	OTTHUMT00000080582.1	-	NM_004216			161091815	-1	no_errors	ENST00000486041	ensembl	human	known	74_37	rna	INS	0.993:1.000	A
TTC22	55001	genome.wustl.edu	37	1	55251790	55251790	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr1:55251790G>T	ENST00000371276.4	-	5	989	c.886C>A	c.(886-888)Ccc>Acc	p.P296T	TTC22_ENST00000371274.4_Missense_Mutation_p.P296T	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	296										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						TTCAGGATGGGAGGTTGGTTC	0.498																																																	0								ENSG00000006555						112.0	95.0	101.0					1																	55251790		2203	4300	6503	TTC22	SO:0001583	missense	0			-	HGNC	AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.886C>A	1.37:g.55251790G>T	ENSP00000360323:p.Pro296Thr	Somatic	0	76	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q9NWT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat	p.P296T	ENST00000371276.4	37	c.886	CCDS44152.1	1	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922896	0.18056	.	.	ENSG00000006555	ENST00000371276;ENST00000371274;ENST00000448308	T;T;T	0.58797	1.61;2.31;0.31	4.71	3.68	0.42216	Tetratricopeptide-like helical (1);	0.287810	0.35320	N	0.003292	T	0.40956	0.1138	N	0.19112	0.55	0.31202	N	0.699719	B;B	0.30439	0.047;0.279	B;B	0.31101	0.036;0.124	T	0.45991	-0.9223	10	0.34782	T	0.22	-18.9899	11.5004	0.50435	0.0963:0.0:0.9037:0.0	.	296;296	Q5TAA0;Q5TAA0-2	TTC22_HUMAN;.	T	296;296;77	ENSP00000360323:P296T;ENSP00000360321:P296T;ENSP00000390300:P77T	ENSP00000360321:P296T	P	-	1	0	TTC22	55024378	0.574000	0.26684	0.512000	0.27736	0.723000	0.41478	0.936000	0.28938	1.048000	0.40298	0.561000	0.74099	CCC	-	smart_TPR_repeat		0.498	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TTC22	protein_coding	OTTHUMT00000027438.1	G	NM_017904	-		55251790	-1	no_errors	ENST00000371276	ensembl	human	known	74_37	missense	SNP	0.852	T
TMC1	117531	genome.wustl.edu	37	9	75451137	75451137	+	3'UTR	DEL	T	T	-	rs78220845		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:75451137delT	ENST00000297784.5	+	0	3071				TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000340019.3_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						ATTTCGTGACTTTTTTTTTTT	0.358																																					Pancreas(75;173 1345 14232 34245 43413)												0								ENSG00000165091																																			TMC1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.*248T>-	9.37:g.75451137delT		Somatic	0	8	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	A8MVZ2|B1AM91	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297784.5	37	NULL	CCDS6643.1	9																																																																																			-	-		0.358	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	protein_coding	OTTHUMT00000052655.1	T				75451137	+1	no_errors	ENST00000486417	ensembl	human	known	74_37	rna	DEL	0.000	-
WBP2	23558	genome.wustl.edu	37	17	73845736	73845736	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr17:73845736G>T	ENST00000591399.1	-	4	677	c.253C>A	c.(253-255)Ccc>Acc	p.P85T	WBP2_ENST00000590221.1_Missense_Mutation_p.P85T|WBP2_ENST00000433525.2_Missense_Mutation_p.P85T|WBP2_ENST00000254806.3_Missense_Mutation_p.P85T|WBP2_ENST00000585462.1_Missense_Mutation_p.P63T|WBP2_ENST00000590450.1_5'UTR|WBP2_ENST00000344296.4_Missense_Mutation_p.P63T			Q969T9	WBP2_HUMAN	WW domain binding protein 2	85					cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCAAATACGGGCTGCTTGATC	0.537																																																	0								ENSG00000132471						172.0	135.0	148.0					17																	73845736		2203	4300	6503	WBP2	SO:0001583	missense	0			-	HGNC	U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.253C>A	17.37:g.73845736G>T	ENSP00000467579:p.Pro85Thr	Somatic	0	81	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	O95638	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WW-domain-binding,pfam_GRAM	p.P85T	ENST00000591399.1	37	c.253	CCDS11731.1	17	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820764	0.90873	.	.	ENSG00000132471	ENST00000254806;ENST00000344296;ENST00000433525;ENST00000431190;ENST00000416574	T;T;T	0.39592	1.07;1.07;1.07	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.73666	0.3616	H	0.94423	3.535	0.80722	D	1	D;D;D;D	0.76494	0.999;0.978;0.972;0.972	D;P;P;P	0.66847	0.947;0.672;0.573;0.573	T	0.83247	-0.0055	10	0.87932	D	0	-8.4697	17.8009	0.88586	0.0:0.0:1.0:0.0	.	85;85;85;85	B4DV07;B4DFG2;Q7Z511;Q969T9	.;.;.;WBP2_HUMAN	T	85;63;85;85;85	ENSP00000254806:P85T;ENSP00000341570:P63T;ENSP00000415251:P85T	ENSP00000254806:P85T	P	-	1	0	WBP2	71357331	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.808000	0.99193	2.201000	0.70794	0.561000	0.74099	CCC	-	NULL		0.537	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2	protein_coding	OTTHUMT00000448862.1	G	NM_012478	-		73845736	-1	no_errors	ENST00000254806	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM189A2	9413	genome.wustl.edu	37	9	72000789	72000789	+	Missense_Mutation	SNP	G	G	T	rs11138396	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:72000789G>T	ENST00000257515.8	+	9	1202	c.782G>T	c.(781-783)aGa>aTa	p.R261I	FAM189A2_ENST00000455972.1_Missense_Mutation_p.R261I|FAM189A2_ENST00000377216.3_5'Flank|FAM189A2_ENST00000469179.1_3'UTR|FAM189A2_ENST00000303068.7_Missense_Mutation_p.R96I	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	261			R -> K (in dbSNP:rs11138396).			integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CGTCCTATCAGAAGCCGGAGA	0.502																																																	0								ENSG00000135063						86.0	66.0	73.0					9																	72000789		2203	4300	6503	FAM189A2	SO:0001583	missense	0			-	HGNC	L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.782G>T	9.37:g.72000789G>T	ENSP00000257515:p.Arg261Ile	Somatic	0	83	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.R261I	ENST00000257515.8	37	c.782	CCDS6629.1	9	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187084	0.38609	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000303068;ENST00000377225	T;T;T	0.32515	2.48;2.48;1.45	5.93	5.02	0.67125	.	0.696230	0.14493	N	0.316209	T	0.29389	0.0732	L	0.57536	1.79	0.09310	N	0.999997	P;B	0.45078	0.85;0.001	B;B	0.40285	0.325;0.001	T	0.22591	-1.0212	10	0.37606	T	0.19	-4.1172	8.659	0.34081	0.0:0.2698:0.5955:0.1347	.	96;261	F2Z2T9;Q15884	.;F1892_HUMAN	I	261;261;96;260	ENSP00000395675:R261I;ENSP00000257515:R261I;ENSP00000304435:R96I	ENSP00000257515:R261I	R	+	2	0	FAM189A2	71190609	0.001000	0.12720	0.012000	0.15200	0.214000	0.24535	1.130000	0.31393	2.826000	0.97356	0.655000	0.94253	AGA	-	NULL		0.502	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A2	protein_coding	OTTHUMT00000052576.2	G	NM_004816	-		72000789	+1	no_errors	ENST00000257515	ensembl	human	known	74_37	missense	SNP	0.003	T
NR0B1	190	genome.wustl.edu	37	X	30326654	30326654	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chrX:30326654T>C	ENST00000378970.4	-	1	1061	c.827A>G	c.(826-828)cAg>cGg	p.Q276R	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Missense_Mutation_p.Q276R	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	276	Ligand-binding. {ECO:0000250}.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GGGCAGCACCTGGAAGCAGGG	0.652											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000169297						16.0	11.0	13.0					X																	30326654		2173	4252	6425	NR0B1	SO:0001583	missense	0			-	HGNC	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.827A>G	X.37:g.30326654T>C	ENSP00000368253:p.Gln276Arg	Somatic	0	46	0.00	816	0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	8	82.22	Q96F69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.Q276R	ENST00000378970.4	37	c.827	CCDS14223.1	X	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453586	0.63290	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.96365	-3.99;-3.99	5.47	4.23	0.50019	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.108809	0.64402	D	0.000003	D	0.92224	0.7534	N	0.25201	0.72	0.49483	D	0.999794	P	0.42296	0.775	B	0.43658	0.426	D	0.90385	0.4391	10	0.28530	T	0.3	-1.7494	10.5167	0.44894	0.1468:0.0:0.0:0.8532	.	276	P51843	NR0B1_HUMAN	R	276	ENSP00000368253:Q276R;ENSP00000396403:Q276R	ENSP00000368253:Q276R	Q	-	2	0	NR0B1	30236575	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.959000	0.49153	1.823000	0.53134	0.417000	0.27973	CAG	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt		0.652	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B1	protein_coding	OTTHUMT00000056161.1	T	NM_000475	-		30326654	-1	no_errors	ENST00000378970	ensembl	human	known	74_37	missense	SNP	1.000	C
AQP4	361	genome.wustl.edu	37	18	24442131	24442131	+	Intron	SNP	A	A	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr18:24442131A>T	ENST00000383168.4	-	2	576				AQP4_ENST00000440832.3_Intron|AQP4_ENST00000583022.1_5'UTR|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|AQP4_ENST00000581374.1_Intron	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4						carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					GTTTGAAAATAGCTAAAGATG	0.493																																																	0								ENSG00000171885						63.0	66.0	65.0					18																	24442131		2203	4300	6503	AQP4	SO:0001627	intron_variant	0			-	HGNC	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.447+14T>A	18.37:g.24442131A>T		Somatic	0	30	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	26.47	P78564	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383168.4	37	NULL	CCDS11889.1	18																																																																																			-	-		0.493	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP4	protein_coding	OTTHUMT00000254914.2	A	NM_001650, NM_004028	-		24442131	-1	no_errors	ENST00000583022	ensembl	human	known	74_37	rna	SNP	0.013	T
BLOC1S5	63915	genome.wustl.edu	37	6	8015405	8015406	+	3'UTR	INS	-	-	T	rs397765395|rs76544381|rs3832427	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr6:8015405_8015406insT	ENST00000397457.2	-	0	1077_1078				BLOC1S5-TXNDC5_ENST00000439343.2_Intron|BLOC1S5_ENST00000543936.1_3'UTR|BLOC1S5_ENST00000475998.1_5'UTR|TXNDC5_ENST00000539054.1_Intron	NM_001199323.1|NM_201280.2	NP_001186252.1|NP_958437.1	Q8TDH9	BL1S5_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 5, muted						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuron projection development (GO:0031175)|otolith morphogenesis (GO:0032474)|positive regulation of pigment cell differentiation (GO:0050942)	BLOC-1 complex (GO:0031083)|transport vesicle (GO:0030133)											GGACAGCTGGCTTTTTTTTTTG	0.46													|||unknown(HR)	3339	0.666733	0.5908	0.6052	5008	,	,		18576	0.8016		0.6233	False		,,,				2504	0.7188																0								ENSG00000188428																																			BLOC1S5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF426434	CCDS4506.1, CCDS75394.1	6p25.1-p24.3	2012-08-01	2012-08-01	2012-08-01		ENSG00000188428		"""Biogenesis of lysosomal organelles complex-1 subunits"""	18561	protein-coding gene	gene with protein product		607289	"""muted homolog (mouse)"""	MUTED		11912185	Standard	NM_001199322		Approved	MU, dJ303A1.3		Q8TDH9	OTTHUMG00000014220	ENST00000397457.2:c.*477->A	6.37:g.8015415_8015415dupT		Somatic	0	9	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	B4DVM2|Q0VDJ6|Q0VDJ7|Q5THS1|Q68D56|Q8N5F9|Q9NU16	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397457.2	37	NULL	CCDS4506.1	6																																																																																			-	-		0.460	BLOC1S5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S5	protein_coding	OTTHUMT00000039797.2	-	NM_201280			8015406	-1	no_errors	ENST00000475998	ensembl	human	known	74_37	rna	INS	0.003:0.000	T
FBXW5	54461	genome.wustl.edu	37	9	139835416	139835417	+	Frame_Shift_Del	DEL	GC	GC	-	rs538792537		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:139835416_139835417delGC	ENST00000325285.3	-	9	1743_1744	c.1664_1665delGC	c.(1663-1665)cgcfs	p.R555fs	RP11-229P13.25_ENST00000569497.1_RNA|FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	555					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		AGAAGAAGGTGCGAGGCCGTGG	0.673																																																	0								ENSG00000159069																																			FBXW5	SO:0001589	frameshift_variant	0				HGNC	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1664_1665delGC	9.37:g.139835416_139835417delGC	ENSP00000313034:p.Arg555fs	Somatic	0	79	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_F-box_dom,superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R555fs	ENST00000325285.3	37	c.1665_1664	CCDS7014.1	9																																																																																			-	NULL		0.673	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	protein_coding	OTTHUMT00000055227.1	GC	NM_018998			139835417	-1	no_errors	ENST00000325285	ensembl	human	known	74_37	frame_shift_del	DEL	0.927:0.986	-
ACSM5	54988	genome.wustl.edu	37	16	20448601	20448601	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr16:20448601G>A	ENST00000331849.4	+	12	1595	c.1448G>A	c.(1447-1449)gGg>gAg	p.G483E	CTD-2194A8.2_ENST00000574654.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	483					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TACCGGATCGGGCCTGTTGAA	0.557																																																	0								ENSG00000183549						95.0	96.0	96.0					16																	20448601		2203	4300	6503	ACSM5	SO:0001583	missense	0			-	HGNC		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1448G>A	16.37:g.20448601G>A	ENSP00000327916:p.Gly483Glu	Somatic	0	110	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	59	16.90	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.G483E	ENST00000331849.4	37	c.1448	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399543	0.62177	.	.	ENSG00000183549	ENST00000331849	T	0.42513	0.97	4.89	4.89	0.63831	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000011	T	0.60183	0.2249	L	0.50847	1.595	0.50813	D	0.999897	D	0.89917	1.0	D	0.97110	1.0	T	0.63510	-0.6621	10	0.87932	D	0	-26.968	17.1741	0.86837	0.0:0.0:1.0:0.0	.	483	Q6NUN0	ACSM5_HUMAN	E	483	ENSP00000327916:G483E	ENSP00000327916:G483E	G	+	2	0	ACSM5	20356102	1.000000	0.71417	0.672000	0.29872	0.401000	0.30781	8.028000	0.88798	2.413000	0.81919	0.650000	0.86243	GGG	-	pfam_AMP-dep_Synth/Lig		0.557	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	protein_coding	OTTHUMT00000254413.1	G	NM_017888	-		20448601	+1	no_errors	ENST00000331849	ensembl	human	known	74_37	missense	SNP	1.000	A
SPOCK3	50859	genome.wustl.edu	37	4	167983668	167983668	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:167983668C>A	ENST00000357154.3	-	4	356	c.219G>T	c.(217-219)tgG>tgT	p.W73C	SPOCK3_ENST00000357545.4_Missense_Mutation_p.W70C|SPOCK3_ENST00000506886.1_Missense_Mutation_p.W73C|SPOCK3_ENST00000534949.1_Intron|SPOCK3_ENST00000511531.1_Missense_Mutation_p.W73C|SPOCK3_ENST00000512681.1_Intron|SPOCK3_ENST00000504953.1_Missense_Mutation_p.W70C|SPOCK3_ENST00000502330.1_Missense_Mutation_p.W73C|SPOCK3_ENST00000421836.2_Missense_Mutation_p.W22C|SPOCK3_ENST00000541354.1_5'UTR|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000541637.1_Intron|SPOCK3_ENST00000535728.1_5'UTR|SPOCK3_ENST00000511269.1_Missense_Mutation_p.W70C|SPOCK3_ENST00000512648.1_Missense_Mutation_p.W70C|SPOCK3_ENST00000510741.1_Missense_Mutation_p.W70C	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	73					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TTCCTGGACTCCAAGTGCGGA	0.289																																																	0								ENSG00000196104						62.0	65.0	64.0					4																	167983668		2200	4297	6497	SPOCK3	SO:0001583	missense	0			-	HGNC	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.219G>T	4.37:g.167983668C>A	ENSP00000349677:p.Trp73Cys	Somatic	0	97	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	80	135	37.21	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.W73C	ENST00000357154.3	37	c.219	CCDS54817.1	4	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297367	0.60086	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000511269;ENST00000421836;ENST00000512648;ENST00000510403;ENST00000509854;ENST00000506697;ENST00000512042	T;T;T;T;T;T;T;T;T;T;T;T;T	0.51574	1.41;1.44;1.44;1.41;1.41;1.41;1.4;1.44;1.11;2.17;0.76;0.7;0.7	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.69958	0.3169	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.996;0.996;0.999;0.998;0.996	T	0.74121	-0.3767	10	0.56958	D	0.05	-11.9229	17.402	0.87463	0.0:1.0:0.0:0.0	.	22;82;70;73;70;73	B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;TICN3_HUMAN	C	73;70;70;73;73;73;70;70;22;70;70;70;73;73	ENSP00000349677:W73C;ENSP00000350153:W70C;ENSP00000425570:W70C;ENSP00000420920:W73C;ENSP00000423421:W73C;ENSP00000423606:W73C;ENSP00000426716:W70C;ENSP00000425502:W70C;ENSP00000411344:W22C;ENSP00000426177:W70C;ENSP00000423367:W70C;ENSP00000424168:W73C;ENSP00000425407:W73C	ENSP00000349677:W73C	W	-	3	0	SPOCK3	168220243	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.897000	0.63231	2.296000	0.77279	0.585000	0.79938	TGG	-	NULL		0.289	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	protein_coding	OTTHUMT00000364091.1	C		-		167983668	-1	no_errors	ENST00000357154	ensembl	human	known	74_37	missense	SNP	1.000	A
PRR14L	253143	genome.wustl.edu	37	22	32081555	32081555	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr22:32081555G>T	ENST00000327423.6	-	9	6603	c.6414C>A	c.(6412-6414)ttC>ttA	p.F2138L	PRR14L_ENST00000434485.1_3'UTR|PRR14L_ENST00000397493.2_Intron	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	2138										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						CCTTGGCAAAGAAGGTCTCCA	0.458																																																	0								ENSG00000183530						77.0	63.0	67.0					22																	32081555		692	1591	2283	PRR14L	SO:0001583	missense	0			-	HGNC	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.6414C>A	22.37:g.32081555G>T	ENSP00000331845:p.Phe2138Leu	Somatic	0	42	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F2138L	ENST00000327423.6	37	c.6414	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426614	0.43020	.	.	ENSG00000183530	ENST00000327423	T	0.10005	2.92	5.64	2.37	0.29283	.	0.182597	0.50627	D	0.000102	T	0.14527	0.0351	N	0.13098	0.295	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04693	-1.0933	10	0.72032	D	0.01	-12.1181	7.8125	0.29239	0.417:0.0:0.583:0.0	.	2138	Q5THK1	PR14L_HUMAN	L	2138	ENSP00000331845:F2138L	ENSP00000331845:F2138L	F	-	3	2	PRR14L	30411555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.283000	0.33237	0.294000	0.22547	0.655000	0.94253	TTC	-	NULL		0.458	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	protein_coding	OTTHUMT00000074993.2	G	NM_173566	-		32081555	-1	no_errors	ENST00000327423	ensembl	human	novel	74_37	missense	SNP	0.999	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
TTLL5	23093	genome.wustl.edu	37	14	76246006	76246011	+	In_Frame_Del	DEL	AAGAAC	AAGAAC	-			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	AAGAAC	AAGAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr14:76246006_76246011delAAGAAC	ENST00000298832.9	+	24	2681_2686	c.2476_2481delAAGAAC	c.(2476-2481)aagaacdel	p.KN826del	TTLL5_ENST00000556893.1_In_Frame_Del_p.KN377del|TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000554510.1_In_Frame_Del_p.KN335del|TTLL5_ENST00000557636.1_In_Frame_Del_p.KN840del	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	826					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TAAAATTTCTAAGAACAACAACAATT	0.383																																																	0								ENSG00000119685																																			TTLL5	SO:0001651	inframe_deletion	0				HGNC	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2476_2481delAAGAAC	14.37:g.76246006_76246011delAAGAAC	ENSP00000298832:p.Lys826_Asn827del	Somatic	NA	NA	NA		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.KN826in_frame_del	ENST00000298832.9	37	c.2476_2481	CCDS32124.1	14																																																																																			-	NULL		0.383	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	protein_coding	OTTHUMT00000414453.1	AAGAAC	NM_015072			76246011	+1	no_errors	ENST00000298832	ensembl	human	known	74_37	in_frame_del	DEL	0.997:1.000:0.997:0.983:1.000:1.000	-
ANKRD16	54522	genome.wustl.edu	37	10	5929889	5929889	+	Silent	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr10:5929889G>T	ENST00000380094.5	-	2	999	c.456C>A	c.(454-456)atC>atA	p.I152I	ANKRD16_ENST00000380092.4_Silent_p.I152I|FBXO18_ENST00000397269.3_5'Flank|ANKRD16_ENST00000191063.8_Silent_p.I152I|FBXO18_ENST00000362091.4_5'Flank	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	152										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						GGTACTGGAGGATCAGAGGGT	0.532																																																	0								ENSG00000134461						130.0	115.0	120.0					10																	5929889		2203	4300	6503	ANKRD16	SO:0001819	synonymous_variant	0			-	HGNC	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.456C>A	10.37:g.5929889G>T		Somatic	0	36	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A6NEF0|F8WEI4|Q9NT01	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I152	ENST00000380094.5	37	c.456	CCDS31136.1	10																																																																																			-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.532	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ANKRD16	protein_coding	OTTHUMT00000046611.2	G	XM_166138	-		5929889	-1	no_errors	ENST00000380092	ensembl	human	known	74_37	silent	SNP	1.000	T
PCDHB12	56124	genome.wustl.edu	37	5	140588657	140588657	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr5:140588657T>C	ENST00000239450.2	+	1	367	c.178T>C	c.(178-180)Tct>Cct	p.S60P	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGTGAGCTGTCTTCGCGGGG	0.512																																																	0								ENSG00000120328						90.0	100.0	97.0					5																	140588657		2203	4300	6503	PCDHB12	SO:0001583	missense	0			-	HGNC	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.178T>C	5.37:g.140588657T>C	ENSP00000239450:p.Ser60Pro	Somatic	0	74	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	46	38.67	B4DDU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S60P	ENST00000239450.2	37	c.178	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	T	11.10	1.538995	0.27475	.	.	ENSG00000120328	ENST00000239450	T	0.39997	1.05	4.25	1.66	0.24008	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.50735	0.1633	M	0.69463	2.115	0.09310	N	1	P	0.45531	0.86	P	0.57009	0.811	T	0.43114	-0.9411	9	0.72032	D	0.01	.	2.4035	0.04407	0.1437:0.0835:0.2972:0.4756	.	60	Q9Y5F1	PCDBC_HUMAN	P	60	ENSP00000239450:S60P	ENSP00000239450:S60P	S	+	1	0	PCDHB12	140568841	0.000000	0.05858	0.001000	0.08648	0.349000	0.29174	-2.176000	0.01262	0.114000	0.18032	0.459000	0.35465	TCT	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin		0.512	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	protein_coding	OTTHUMT00000251815.2	T	NM_018932	-		140588657	+1	no_errors	ENST00000239450	ensembl	human	known	74_37	missense	SNP	0.006	C
ENDOU	8909	genome.wustl.edu	37	12	48110109	48110109	+	Missense_Mutation	SNP	T	T	G			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr12:48110109T>G	ENST00000422538.3	-	6	847	c.725A>C	c.(724-726)gAg>gCg	p.E242A	RP1-197B17.3_ENST00000547799.1_lincRNA|ENDOU_ENST00000545824.2_Missense_Mutation_p.E179A|ENDOU_ENST00000542202.1_Missense_Mutation_p.E8A|ENDOU_ENST00000229003.3_Missense_Mutation_p.E201A	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	242					female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						GCTGTAGAGCTCCTTCATGAC	0.622											OREG0021752	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000111405						123.0	112.0	116.0					12																	48110109		2203	4300	6503	ENDOU	SO:0001583	missense	0			-	HGNC	M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.725A>C	12.37:g.48110109T>G	ENSP00000397679:p.Glu242Ala	Somatic	0	39	0.00	952	0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	16	48.48	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endoribonuclease_XendoU,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.E201A	ENST00000422538.3	37	c.602	CCDS53785.1	12	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142794	0.57044	.	.	ENSG00000111405	ENST00000229003;ENST00000422538;ENST00000542202;ENST00000545824	T;T	0.30714	1.52;1.53	5.63	4.41	0.53225	.	0.134989	0.64402	D	0.000003	T	0.34832	0.0911	L	0.42245	1.32	0.47584	D	0.999464	P;P;B;P	0.45986	0.852;0.87;0.387;0.73	P;P;P;B	0.54924	0.477;0.764;0.464;0.397	T	0.04708	-1.0932	10	0.07990	T	0.79	-19.8236	11.6585	0.51332	0.0:0.0:0.148:0.852	.	179;8;242;201	P21128-3;B7Z7N4;P21128;P21128-2	.;.;ENDOU_HUMAN;.	A	201;242;8;179	ENSP00000229003:E201A;ENSP00000397679:E242A	ENSP00000229003:E201A	E	-	2	0	ENDOU	46396376	1.000000	0.71417	0.969000	0.41365	0.968000	0.65278	4.530000	0.60595	2.270000	0.75569	0.460000	0.39030	GAG	-	pfam_Endoribonuclease_XendoU		0.622	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENDOU	protein_coding	OTTHUMT00000405352.1	T	NM_006025.2	-		48110109	-1	no_errors	ENST00000229003	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC9A4	389015	genome.wustl.edu	37	2	103148889	103148889	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr2:103148889G>T	ENST00000295269.4	+	12	2596	c.2139G>T	c.(2137-2139)atG>atT	p.M713I		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	713					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TAATACCAATGAAGAGCCTAC	0.478																																																	0								ENSG00000180251						89.0	84.0	86.0					2																	103148889		2203	4300	6503	SLC9A4	SO:0001583	missense	0			-	HGNC		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2139G>T	2.37:g.103148889G>T	ENSP00000295269:p.Met713Ile	Somatic	0	49	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	31	35.42	Q69YK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.M713I	ENST00000295269.4	37	c.2139	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	9.808	1.182463	0.21870	.	.	ENSG00000180251	ENST00000295269	T	0.45668	0.89	4.9	4.9	0.64082	.	1.059790	0.07185	N	0.854634	T	0.38558	0.1045	L	0.34521	1.04	0.30781	N	0.741957	B	0.25667	0.131	B	0.22386	0.039	T	0.28332	-1.0047	10	0.45353	T	0.12	.	15.3561	0.74428	0.0:0.0:1.0:0.0	.	713	Q6AI14	SL9A4_HUMAN	I	713	ENSP00000295269:M713I	ENSP00000295269:M713I	M	+	3	0	SLC9A4	102515321	1.000000	0.71417	0.698000	0.30274	0.007000	0.05969	5.010000	0.64004	2.432000	0.82394	0.655000	0.94253	ATG	-	NULL		0.478	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	protein_coding	OTTHUMT00000329498.1	G	NM_001011552.3	-		103148889	+1	no_errors	ENST00000295269	ensembl	human	known	74_37	missense	SNP	0.976	T
ULBP1	80329	genome.wustl.edu	37	6	150290442	150290442	+	Nonsense_Mutation	SNP	A	A	T			TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr6:150290442A>T	ENST00000229708.3	+	3	614	c.571A>T	c.(571-573)Aag>Tag	p.K191*		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	191	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GGGGGATTGTAAGATGTGGCT	0.453																																																	0								ENSG00000111981						100.0	102.0	101.0					6																	150290442		2203	4300	6503	ULBP1	SO:0001587	stop_gained	0			-	HGNC	AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.571A>T	6.37:g.150290442A>T	ENSP00000229708:p.Lys191*	Somatic	0	29	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q5VY81|Q8IZW3|Q8IZX6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.K191*	ENST00000229708.3	37	c.571	CCDS5223.1	6	.	.	.	.	.	.	.	.	.	.	a	12.70	2.017498	0.35606	.	.	ENSG00000111981	ENST00000367345;ENST00000229708	.	.	.	2.13	-2.73	0.05950	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	0.1821	0.00124	0.364:0.2387:0.163:0.2343	.	.	.	.	X	191	.	ENSP00000229708:K191X	K	+	1	0	ULBP1	150332135	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.614000	0.05604	-0.590000	0.05866	0.164000	0.16699	AAG	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.453	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP1	protein_coding	OTTHUMT00000042677.2	A		-		150290442	+1	no_errors	ENST00000229708	ensembl	human	known	74_37	nonsense	SNP	0.000	T
ZCCHC7	84186	genome.wustl.edu	37	9	37357249	37357250	+	Frame_Shift_Ins	INS	-	-	A	rs1051465		TCGA-X9-A973-01A-11D-A387-09	TCGA-X9-A973-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	231a60ba-0cbf-4e49-80b9-fb79251a0329	3a81eddf-cc20-47e1-ba2e-5bc21240b8d9	g.chr9:37357249_37357250insA	ENST00000336755.5	+	9	1722_1723	c.1616_1617insA	c.(1615-1620)agaaaafs	p.RK539fs	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Frame_Shift_Ins_p.RK249fs	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	539			R -> K (in dbSNP:rs1051465).			cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		ATTAAGCAGAGAAAAAAAAAGT	0.411																																																	0								ENSG00000147905																																			ZCCHC7	SO:0001589	frameshift_variant	0				HGNC	AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.1625dupA	9.37:g.37357258_37357258dupA	ENSP00000337839:p.Arg539fs	Somatic	0	14	0.00		0.6502806362527894	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K543fs	ENST00000336755.5	37	c.1616_1617	CCDS6608.2	9																																																																																			-	NULL		0.411	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC7	protein_coding	OTTHUMT00000052453.2	-	NM_032226			37357250	+1	no_errors	ENST00000336755	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
