Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
HMCN1	83872	broad.mit.edu	37	1	185902810	185902810	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr1:185902810G>A	uc001grq.1	+	11	1911	c.1682G>A	c.(1681-1683)AGA>AAA	p.R561K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	561	Ig-like C2-type 2.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AGAGATGTCAGACTGGCAGAG	0.443			NA											3	63					0	0	0.004672	0	0
TPR	7175	broad.mit.edu	37	1	186302290	186302290	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr1:186302290C>G	uc001grv.2	-	37	5716	c.5419G>C	c.(5419-5421)GAG>CAG	p.E1807Q		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1807					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GAAGGCCGCTCAACTGGTGAA	0.398			NA	T	NTRK1	papillary thyroid								4	53					0	0	0.009096	0	0
CCDC109A	90550	broad.mit.edu	37	10	74618992	74618992	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr10:74618992G>A	uc001jtc.2	+	3	299	c.278G>A	c.(277-279)CGG>CAG	p.R93Q	CCDC109A_uc009xqp.1_RNA|CCDC109A_uc009xqq.1_RNA|CCDC109A_uc010qjy.1_RNA|CCDC109A_uc009xqr.2_Missense_Mutation_p.R93Q|CCDC109A_uc001jtd.2_Missense_Mutation_p.R44Q	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A	93	Mitochondrial matrix (Potential).				elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					CTACCATCCCGGCGTGAACGC	0.423			NA											11	103					0	0	0.080935	0	0
FNBP4	23360	broad.mit.edu	37	11	47772543	47772543	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr11:47772543T>C	uc009ylv.2	-	6	984	c.831A>G	c.(829-831)ATA>ATG	p.I277M	FNBP4_uc001ngj.2_Missense_Mutation_p.I184M|FNBP4_uc001ngl.2_RNA	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	277										ovary(1)	1						CCTTAGAATATATGTCTGTAT	0.343			NA											6	70					0	0	0.021553	0	0
TMEM117	84216	broad.mit.edu	37	12	44238567	44238567	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr12:44238567G>A	uc001rod.2	+	2	179	c.113G>A	c.(112-114)AGC>AAC	p.S38N	TMEM117_uc001roe.2_5'UTR|TMEM117_uc009zkc.2_Missense_Mutation_p.S38N	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	38						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		GTTTCTCATAGCCAAACAGAA	0.393			NA											13	145					0	0	0.105934	0	0
KNTC1	9735	broad.mit.edu	37	12	123109155	123109155	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr12:123109155G>A	uc001ucv.2	+	63	6689	c.6526G>A	c.(6526-6528)GCT>ACT	p.A2176T	KNTC1_uc010taf.1_Missense_Mutation_p.A1101T|GPR81_uc001ucw.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	2176					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTTAGATGAAGCTTCAGTCTT	0.274			NA											5	31					0	0	0.021553	0	0
FKBP3	2287	broad.mit.edu	37	14	45587247	45587247	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr14:45587247C>T	uc010tqf.1	-	6	677	c.604G>A	c.(604-606)GGA>AGA	p.G202R		NM_002013	NP_002004	Q00688	FKBP3_HUMAN	FK506 binding protein 3, 25kDa	202	PPIase FKBP-type.				protein folding	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|receptor activity				0						TCAGGCTGTCCTTTCTTTCCG	0.398			NA											11	132					0	0	0.069234	0	0
BCL11B	64919	broad.mit.edu	37	14	99723900	99723900	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr14:99723900G>A	uc001yga.2	-	2	602	c.335C>T	c.(334-336)CCG>CTG	p.P112L	BCL11B_uc001ygb.2_Missense_Mutation_p.P112L	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	112						nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GATCTCCACCGGCTCGGACAC	0.607			NA	T	TLX3	T-ALL								7	57					0	0	0.038147	0	0
THSD4	79875	broad.mit.edu	37	15	71535077	71535077	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr15:71535077C>T	uc002atb.1	+	4	633	c.554C>T	c.(553-555)ACG>ATG	p.T185M	THSD4_uc002atd.1_Translation_Start_Site	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	185	TSP type-1 1.					proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						ACTGCACACACGCCACAGAGG	0.567			NA											7	133					0	0	0.02938	0	0
NFATC3	4775	broad.mit.edu	37	16	68160359	68160359	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr16:68160359C>T	uc002evo.1	+	3	1457	c.1247C>T	c.(1246-1248)TCA>TTA	p.S416L	NFATC3_uc010vkl.1_5'UTR|NFATC3_uc010vkm.1_5'UTR|NFATC3_uc010vkn.1_5'UTR|NFATC3_uc010vko.1_5'UTR|NFATC3_uc010vkp.1_5'UTR|NFATC3_uc010vkq.1_5'UTR|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Missense_Mutation_p.S416L|NFATC3_uc002evm.1_Missense_Mutation_p.S416L|NFATC3_uc002evn.1_Missense_Mutation_p.S416L|NFATC3_uc010vkr.1_5'UTR|NFATC3_uc010vks.1_5'UTR|NFATC3_uc010vkt.1_5'UTR|NFATC3_uc010vku.1_5'UTR|NFATC3_uc010vkv.1_5'UTR|NFATC3_uc010vkw.1_5'UTR|NFATC3_uc010vkx.1_5'UTR|NFATC3_uc010vky.1_5'UTR|NFATC3_uc010vkz.1_5'UTR|NFATC3_uc010vla.1_5'UTR|NFATC3_uc010vlb.1_5'UTR|NFATC3_uc010vlc.1_5'UTR	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,	416	RHD.				inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		AGCACATCTTCATTACCTCCA	0.398			NA											4	64					0	0	0.009096	0	0
GRIK5	2901	broad.mit.edu	37	19	42507507	42507507	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr19:42507507G>A	uc002osj.1	-	18	2526	c.2491C>T	c.(2491-2493)CGG>TGG	p.R831W	GRIK5_uc002osi.1_Missense_Mutation_p.R403W	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	831	Cytoplasmic (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	GCTGACCTCCGTGTGGACCAT	0.577			NA											7	50					0	0	0.02938	0	0
XIRP2	129446	broad.mit.edu	37	2	167760103	167760104	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr2:167760103_167760104GC>TT	uc002udx.2	+	1	129_130	c.111_112GC>TT	c.(109-114)CAGCCT>CATTCT	p.37_38QP>HS	XIRP2_uc010fpn.2_Missense_Mutation_p.37_38QP>HS|XIRP2_uc010fpo.2_Missense_Mutation_p.37_38QP>HS|XIRP2_uc010fpp.2_Missense_Mutation_p.37_38QP>HS	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CAATTTTCCAGCCTCAGGAAAG	0.495			NA											4	41					0	0	0.004672	0	0
XIRP2	129446	broad.mit.edu	37	2	168101995	168101995	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr2:168101995T>A	uc002udx.2	+	8	4111	c.4093T>A	c.(4093-4095)TCA>ACA	p.S1365T	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S1190T|XIRP2_uc010fpq.2_Missense_Mutation_p.S1143T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1190					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TATTAATAAATCAGAAACTGT	0.368			NA											4	58					0	0	0.009096	0	0
TRIOBP	11078	broad.mit.edu	37	22	38120812	38120812	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr22:38120812A>C	uc003atr.2	+	7	2520	c.2249A>C	c.(2248-2250)CAG>CCG	p.Q750P	TRIOBP_uc003atu.2_Missense_Mutation_p.Q578P|TRIOBP_uc003atq.1_Missense_Mutation_p.Q750P|TRIOBP_uc003ats.1_Missense_Mutation_p.Q578P	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	750					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TCCTGTGCCCAGCGGGACAAT	0.572			NA											3	39					0	0	0.004672	0	0
UGT2B7	7364	broad.mit.edu	37	4	69978332	69978332	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr4:69978332T>G	uc003heg.3	+	6	1514	c.1468T>G	c.(1468-1470)TCT>GCT	p.S490A	UGT2B7_uc010ihq.2_3'UTR	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	490					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CCAGTACCACTCTTTGGATGT	0.473			NA											6	142					0	0	0.038147	0	0
GPRIN3	285513	broad.mit.edu	37	4	90169159	90169159	+	Silent	SNP	G	G	A			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr4:90169159G>A	uc003hsm.1	-	2	2622	c.2103C>T	c.(2101-2103)GAC>GAT	p.D701D		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	701										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GGGACTCTGCGTCCAAGGATG	0.512			NA											7	48					0	0	0.02938	0	0
GRM6	2916	broad.mit.edu	37	5	178408828	178408828	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr5:178408828C>T	uc003mjr.2	-	10	2643	c.2464G>A	c.(2464-2466)GTG>ATG	p.V822M	GRM6_uc003mjq.2_Missense_Mutation_p.V225M	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	822	Helical; Name=7; (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CTCAAGGACACGGTTAGCGTG	0.572			NA											5	136					0	0	0.014758	0	0
HIVEP1	3096	broad.mit.edu	37	6	12120213	12120213	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr6:12120213T>C	uc003nac.2	+	4	364	c.185T>C	c.(184-186)ATA>ACA	p.I62T	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	62					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CTGAAAAAAATACCAAAATCC	0.398			NA											7	108					0	0	0.02938	0	0
ABCA13	154664	broad.mit.edu	37	7	48266967	48266967	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr7:48266967G>C	uc003toq.2	+	6	602	c.577G>C	c.(577-579)GAT>CAT	p.D193H	ABCA13_uc003top.2_Missense_Mutation_p.D193H|ABCA13_uc010kyr.2_5'UTR	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	193					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CACAAGCCATGATCATGTGGA	0.398			NA											4	85					0	0	0.009096	0	0
ADAM18	8749	broad.mit.edu	37	8	39525666	39525666	+	Silent	SNP	C	C	T	rs35144407	byFrequency	TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr8:39525666C>T	uc003xni.2	+	14	1476	c.1476C>T	c.(1474-1476)AAC>AAT	p.N492N	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.N468N	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	492	Cys-rich.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ATTGCTATAACGGACAATGTC	0.378			NA											7	179					0	0	0.058154	0	0
CYBB	1536	broad.mit.edu	37	X	37663304	37663304	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chrX:37663304G>C	uc004ddr.2	+	9	1133	c.1072G>C	c.(1072-1074)GTT>CTT	p.V358L	CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Missense_Mutation_p.V326L|CYBB_uc011mkg.1_Missense_Mutation_p.V91L	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	358	Cytoplasmic (Potential).|FAD-binding FR-type.				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						TATCCGCATCGTTGGGGACTG	0.468			NA											5	64					0	0	0.02938	0	0
C7orf59	389541	broad.mit.edu	37	7	99747177	99747180	+	Frame_Shift_Del	DEL	TACT	TACT	-			TCGA-50-5055-01A-01D-1625-08	TCGA-50-5055-10A-01D-1625-08	TACT	TACT	-	-	TACT	TACT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	12fe153e-a8f7-49ec-9e0c-f680e2311cf6	bd0b53df-7024-4f75-9903-6d1215a6016c	g.chr7:99747177_99747180delTACT	uc003utq.2	+	2	125_128	c.59_62delTACT	c.(58-63)GTACTGfs	p.V20fs		NM_001008395	NP_001008396	Q0VGL1	CG059_HUMAN	hypothetical protein LOC389541	20_21											0						GGCTACCTGGTACTGAGTGAAGGT	0.569			NA											16	192	---	---	---	---	NA	NA	NA	NA	NA
