Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
PPP4R1	9989	broad.mit.edu	hg19	18	9550172	9550172	+	Missense_Mutation	SNP	C	C	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr18:9550172C>A	ENST00000400556.3	-	18	2498	c.2425G>T	c.(2425-2427)Gtg>Ttg	p.V809L	PPP4R1_ENST00000400555.3_Missense_Mutation_p.V792L	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	809		protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity	large_intestine(1)|skin(2)	3					AGCTTCTTCACCATCTCGCTG	0.483	0	72.0	80.0	77.0	18	9550172	2074	4215	6289	SO:0001583	missense	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845	"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908			10026142	Standard	NM_001042388	Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.2425G>T	18.37:g.9550172C>A	ENSP00000383402:p.Val809Leu	Q99774|Q9UNQ7	ENST00000400556.3	37	CCDS42412.1	.	.	.	.	.	.	.	.	.	.	C	8.003	0.755744	0.15846	.	.	ENSG00000154845	ENST00000400556;ENST00000400555	T;T	0.28069	1.63;1.63	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.229234	0.38492	N	0.001671	T	0.14442	0.0349	N	0.02865	-0.47	0.53688	D	0.999975	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.10450	0.004;0.003;0.005	T	0.17715	-1.0360	9	.	.	.	-29.6409	15.5022	0.75709	0.0:0.8622:0.1378:0.0	.	792;809;792	A8K923;Q8TF05;Q8TF05-2	.;PP4R1_HUMAN;.	L	809;792	ENSP00000383402:V809L;ENSP00000383401:V792L	.	V	-	1	0	PPP4R1	9540172	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.728000	0.47319	2.804000	0.96469	0.655000	0.94253	GTG	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1		53.737057	1	0	64	0	2.70639e-06	1	2.80663e-06	NM_005134	18	54.495149	31	0.367347
POU4F1	5457	broad.mit.edu	hg19	13	79175838	79175838	+	Silent	SNP	C	C	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr13:79175838C>T	ENST00000377208.5	-	2	1183	c.972G>A	c.(970-972)gcG>gcA	p.A324A	RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607220.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	324	POU-specific.	axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)	TGGGCTTGAGCGCGATCATGT	0.637	0	38.0	36.0	37.0	13	79175838	2203	4300	6503	SO:0001819	synonymous_variant	X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192	"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A	1357630	Standard	NM_006237	Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.972G>A	13.37:g.79175838C>T		Q14986|Q15318|Q5T227	ENST00000377208.5	37	CCDS31996.1																																																																																			POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3		3.413491	0	0	25	0	0	1	0		3	6.950111	22	0.120000
DNAH8	1769	broad.mit.edu	hg19	6	38828378	38828378	+	Missense_Mutation	SNP	G	G	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr6:38828378G>A	ENST00000359357.3	+	41	5707	c.5453G>A	c.(5452-5454)cGt>cAt	p.R1818H	DNAH8_ENST00000449981.2_Missense_Mutation_p.R2035H|DNAH8_ENST00000441566.1_Missense_Mutation_p.R1818H					dynein, axonemal, heavy chain 8						NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260					TGTACTGATCGTCTTGTTATC	0.289	0	97.0	98.0	98.0	6	38828378	2203	4299	6502	SO:0001583	missense	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721	"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""		9373155	Standard	NM_001206927	Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5453G>A	6.37:g.38828378G>A	ENSP00000352312:p.Arg1818His	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	32	5.178752	0.94846	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.15017	2.46;2.46;2.46	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.49150	0.1540	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64024	-0.6504	10	0.87932	D	0	.	19.177	0.93605	0.0:0.0:1.0:0.0	.	1818	Q96JB1	DYH8_HUMAN	H	2023;2023;1818;1818	ENSP00000333363:R2023H;ENSP00000352312:R1818H;ENSP00000402294:R1818H	ENSP00000333363:R2023H	R	+	2	0	DNAH8	38936356	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.869000	0.99810	2.525000	0.85131	0.650000	0.86243	CGT	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1		5.770815	0	0	74	0	0	1	0	NM_001206927	7	17.469906	65	0.097222
LILRA2	0	broad.mit.edu	hg19	19	55086935	55086935	+	Missense_Mutation	SNP	G	G	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr19:55086935G>A	ENST00000251377.3	+	6	1001	c.868G>A	c.(868-870)Ggg>Agg	p.G290R	LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Missense_Mutation_p.G278R|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.G290R|LILRA2_ENST00000251376.3_Missense_Mutation_p.G290R|LILRB1_ENST00000448689.1_Intron					leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2						breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)	CCCCTCCCACGGGGGCCAGTA	0.657	1	49.0	50.0	50.0	19	55086935	2203	4299	6502	SO:0001583	missense	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998	"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812			9079806, 9548455	Standard	XM_005258452	Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000391737.1:c.832G>A	19.37:g.55086935G>A	ENSP00000375617:p.Gly278Arg	O75020	ENST00000391737.1	37		.	.	.	.	.	.	.	.	.	.	G	10.77	1.443974	0.25987	0.0	1.16E-4	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63	2.8	-0.934	0.10428	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.218720	0.06017	N	0.650667	T	0.12944	0.0314	L	0.33753	1.03	0.09310	N	1	P;P;P;P	0.49559	0.925;0.692;0.692;0.514	P;B;B;B	0.46299	0.511;0.344;0.344;0.231	T	0.26395	-1.0104	10	0.52906	T	0.07	.	5.3337	0.15945	0.4728:0.0:0.5272:0.0	.	290;278;290;290	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	R	290;290;290;290;278	ENSP00000388131:G290R;ENSP00000251377:G290R;ENSP00000375618:G290R;ENSP00000251376:G290R;ENSP00000375617:G278R	ENSP00000251376:G290R	G	+	1	0	LILRA2	59778747	0.000000	0.05858	0.001000	0.08648	0.179000	0.23085	-1.676000	0.01946	-0.239000	0.09710	0.400000	0.26472	GGG	LILRA2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000140814.1		94.246578	0	0	54	0	0	1	0		30	94.300764	34	0.468750
MTOR	2475	broad.mit.edu	hg19	1	11169412	11169412	+	Missense_Mutation	SNP	A	A	C			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr1:11169412A>C	ENST00000361445.4	-	56	7539	c.7463T>G	c.(7462-7464)gTg>gGg	p.V2488G	MTOR_ENST00000376838.1_Missense_Mutation_p.V693G	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2488	PI3K/PI4K.	cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					CTCTGGTTTCACCAAACCGTC	0.393	0	134.0	123.0	127.0	1	11169412	2203	4300	6503	SO:0001583	missense	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793		3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1	8008069, 8660990	Standard	NM_004958	Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7463T>G	1.37:g.11169412A>C	ENSP00000354558:p.Val2488Gly	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428641	0.43122	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.23552	3.21;2.96;1.9	5.82	5.82	0.92795	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.056274	0.64402	D	0.000001	T	0.13200	0.0320	N	0.04297	-0.235	0.80722	D	1	B	0.20671	0.047	B	0.18263	0.021	T	0.17137	-1.0379	10	0.24483	T	0.36	-21.7174	13.9151	0.63893	1.0:0.0:0.0:0.0	.	2488	P42345	MTOR_HUMAN	G	2488;693;144	ENSP00000354558:V2488G;ENSP00000366034:V693G;ENSP00000398745:V144G	ENSP00000354558:V2488G	V	-	2	0	MTOR	11091999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.690000	0.91272	2.223000	0.72356	0.482000	0.46254	GTG	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		170.713520	0	0	110	0	0	1	0	NM_004958	49	178.406859	7	0.875000
LSM1	27257	broad.mit.edu	hg19	8	38021245	38021245	+	Missense_Mutation	SNP	C	C	G			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr8:38021245C>G	ENST00000311351.4	-	4	740	c.345G>C	c.(343-345)caG>caC	p.Q115H	RP11-90P5.2_ENST00000520598.1_RNA|LSM1_ENST00000522515.1_5'UTR|LSM1_ENST00000520755.1_3'UTR	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)	115		exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|mRNA processing|RNA splicing, via transesterification reactions	cytosol|nucleus|ribonucleoprotein complex	protein binding|RNA binding	kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)				CCTTCAGGGCCTGCACTTTCA	0.488	0	160.0	133.0	142.0	8	38021245	2203	4300	6503	SO:0001583	missense	AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324		20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""		12515382, 11953827	Standard	NM_014462	Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.345G>C	8.37:g.38021245C>G	ENSP00000310596:p.Gln115His	B2R5E6	ENST00000311351.4	37	CCDS6103.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413204	0.42817	.	.	ENSG00000175324	ENST00000311351	.	.	.	5.91	2.64	0.31445	.	0.053094	0.85682	D	0.000000	T	0.46795	0.1411	L	0.48362	1.52	0.80722	D	1	P	0.37038	0.579	B	0.34418	0.182	T	0.48445	-0.9035	9	0.62326	D	0.03	-10.3867	9.8378	0.40980	0.0:0.6306:0.0:0.3694	.	115	O15116	LSM1_HUMAN	H	115	.	ENSP00000310596:Q115H	Q	-	3	2	LSM1	38140402	1.000000	0.71417	0.963000	0.40424	0.817000	0.46193	1.652000	0.37313	0.791000	0.33826	0.650000	0.86243	CAG	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376965.1		60.967260	0	0	58	0	0	1	0	NM_014462	21	61.083299	26	0.446809
COL14A1	7373	broad.mit.edu	hg19	8	121224799	121224799	+	Missense_Mutation	SNP	C	C	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr8:121224799C>T	ENST00000297848.3	+	13	1850	c.1580C>T	c.(1579-1581)aCg>aTg	p.T527M	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.T527M|COL14A1_ENST00000247781.3_Missense_Mutation_p.T432M|COL14A1_ENST00000537875.1_Missense_Mutation_p.T527M	NM_021110.1	NP_066933.1	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1	527	Fibronectin type-III 3.	cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		GATCCTGTTACGGGACAAGAA	0.443	0	111.0	101.0	104.0	8	121224799	2203	4300	6503	SO:0001583	missense		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955	"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND	1716629, 9427527	Standard	NM_021110	Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1580C>T	8.37:g.121224799C>T	ENSP00000297848:p.Thr527Met		ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591516	0.86953	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T;T	0.05139	3.49;3.49;3.49;3.49;3.49	6.17	6.17	0.99709	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.053628	0.64402	D	0.000001	T	0.30947	0.0781	M	0.86268	2.805	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;P	0.65233	0.933;0.825	T	0.01071	-1.1461	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	527;527	Q05707-2;Q05707	.;COEA1_HUMAN	M	527;527;527;432;340	ENSP00000443974:T527M;ENSP00000311809:T527M;ENSP00000297848:T527M;ENSP00000247781:T432M;ENSP00000409461:T340M	ENSP00000247781:T432M	T	+	2	0	COL14A1	121293980	1.000000	0.71417	0.912000	0.35992	0.952000	0.60782	7.247000	0.78257	2.941000	0.99782	0.655000	0.94253	ACG	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2		330.526719	0	0	60	0	0	1	0	NM_021110	96	342.270037	20	0.827586
TSC22D4	81628	broad.mit.edu	hg19	7	100074941	100074941	+	Missense_Mutation	SNP	G	G	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr7:100074941G>A	ENST00000300181.2	-	2	1475	c.721C>T	c.(721-723)Cgg>Tgg	p.R241W	TSC22D4_ENST00000393991.1_Missense_Mutation_p.R2W|TSC22D4_ENST00000496728.1_5'UTR	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	241		negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding transcription factor activity	breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				ATCCGCAGCCGCATGTCTACA	0.652	0	61.0	65.0	64.0	7	100074941	2203	4300	6503	SO:0001583	missense	BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925		21696	protein-coding gene	gene with protein product		611914				Standard	NM_030935	Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000393991.1:c.4C>T	7.37:g.100074941G>A	ENSP00000377560:p.Arg2Trp	A4D2C3|A8MWR6|D6W5V9	ENST00000393991.1	37		.	.	.	.	.	.	.	.	.	.	G	11.99	1.802794	0.31869	.	.	ENSG00000166925	ENST00000300181;ENST00000393991	.	.	.	4.33	3.35	0.38373	.	0.358712	0.20599	N	0.089183	T	0.19886	0.0478	N	0.14661	0.345	0.21290	N	0.99974	D;D	0.60160	0.987;0.978	P;B	0.47705	0.555;0.249	T	0.04664	-1.0935	9	0.42905	T	0.14	-4.8287	6.3839	0.21550	0.136:0.0:0.864:0.0	.	241;241	Q8IV54;Q9Y3Q8	.;T22D4_HUMAN	W	241;2	.	ENSP00000300181:R241W	R	-	1	2	TSC22D4	99912877	0.739000	0.28196	0.608000	0.28969	0.589000	0.36550	1.724000	0.38064	2.255000	0.74692	0.549000	0.68633	CGG	TSC22D4-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000316971.1		-1.635802	0	0	64	0	0	1	0	NM_030935	4	8.155715	49	0.075472
ARSJ	79642	broad.mit.edu	hg19	4	114823726	114823726	+	Missense_Mutation	SNP	G	G	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr4:114823726G>T	ENST00000315366.7	-	2	2370	c.1504C>A	c.(1504-1506)Cca>Aca	p.P502T	ARSJ_ENST00000541197.1_Missense_Mutation_p.P502T	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	502			extracellular region	arylsulfatase activity|metal ion binding	endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)	CTCTCATATGGGTCGGCTGTG	0.512	0	77.0	74.0	75.0	4	114823726	1929	4132	6061	SO:0001583	missense		CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801	"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""		12975309, 16174644	Standard	NM_024590	Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1504C>A	4.37:g.114823726G>T	ENSP00000320219:p.Pro502Thr	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	ENST00000315366.7	37	CCDS43264.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046908	0.75846	.	.	ENSG00000180801	ENST00000315366;ENST00000541197;ENST00000545965	D;D	0.98234	-4.81;-4.81	5.41	5.41	0.78517	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.369476	0.27526	N	0.018969	D	0.99360	0.9775	H	0.96547	3.84	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98730	1.0712	10	0.72032	D	0.01	.	19.2114	0.93757	0.0:0.0:1.0:0.0	.	502;502	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	T	502;502;71	ENSP00000320219:P502T;ENSP00000438836:P502T	ENSP00000320219:P502T	P	-	1	0	ARSJ	115043175	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	9.697000	0.98697	2.544000	0.85801	0.655000	0.94253	CCA	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363650.1		62.495828	1	0	57	0	1.96292e-10	1	2.11392e-10	NM_024590	20	62.616527	25	0.444444
VCL	7414	ucsc.edu	hg19	10	75867112	75867112	+	Silent	SNP	A	A	G			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c																										AACAACTCCGAGTAAGTAAAT	0.512	0	54.0	53.0	53.0	10	75867112	2203	4300	6503	SO:0001630	splice_region_variant	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403		12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065			1339348	Standard	NM_014000	Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000372755.3:c.2559+1A>G	10.37:g.75867112A>G		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	ENST00000372755.3	37	CCDS7340.1																																																																																			VCL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048751.1				0	50					NM_003373, NM_014000	4		30	
APLF	200558	broad.mit.edu	hg19	2	68753323	68753323	+	Silent	SNP	A	A	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr2:68753323A>T	ENST00000303795.4	+	6	924	c.753A>T	c.(751-753)acA>acT	p.T251T		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	251		double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding	autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25					AACAAGACACAGGAGAAGAGT	0.338	0	108.0	112.0	110.0	2	68753323	2203	4300	6503	SO:0001819	synonymous_variant	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621		28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13	18474613, 18077224, 17353262	Standard	NM_173545	Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.753A>T	2.37:g.68753323A>T		A8K476|Q53P47|Q53PB9|Q53QU0	ENST00000303795.4	37	CCDS1888.1																																																																																			APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1		-4.722614	0	0	60	0	0	1	0	NM_173545	3	6.777261	52	0.054545
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		77.036419	0	0	81	0	0	1	0	NM_002067	26	77.860796	42	0.382353
MTOR	2475	broad.mit.edu	hg19	1	11169374	11169374	+	Missense_Mutation	SNP	T	T	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr1:11169374T>A	ENST00000361445.4	-	56	7577	c.7501A>T	c.(7501-7503)Att>Ttt	p.I2501F	MTOR_ENST00000376838.1_Missense_Mutation_p.I706F	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2501	PI3K/PI4K.	cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					ACCCTGTTAATAATCTGGATA	0.413	0	177.0	156.0	163.0	1	11169374	2203	4300	6503	SO:0001583	missense	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793		3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1	8008069, 8660990	Standard	NM_004958	Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7501A>T	1.37:g.11169374T>A	ENSP00000354558:p.Ile2501Phe	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.180381	0.78677	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.28454	3.1;2.84;1.61	5.82	5.82	0.92795	Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.000000	0.85682	D	0.000000	T	0.52741	0.1753	M	0.85197	2.74	0.80722	D	1	D	0.62365	0.991	P	0.54924	0.764	T	0.61178	-0.7115	10	0.72032	D	0.01	-1.8424	13.9151	0.63893	0.0:0.0:0.0:1.0	.	2501	P42345	MTOR_HUMAN	F	2501;706;157	ENSP00000354558:I2501F;ENSP00000366034:I706F;ENSP00000398745:I157F	ENSP00000354558:I2501F	I	-	1	0	MTOR	11091961	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.466000	0.80914	2.223000	0.72356	0.482000	0.46254	ATT	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		13.329645	0	0	122	0	0	1	0	NM_004958	9	21.782087	57	0.136364
C15orf60	283677	broad.mit.edu	hg19	15	73852150	73852150	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr15:73852150G>T	ENST00000331090.6	+	6	722	c.694G>T	c.(694-696)Gaa>Taa	p.E232*	C15orf60_ENST00000560581.1_Nonsense_Mutation_p.E204*	NM_001042367.1	NP_001035826.1	Q7Z4M0	CO060_HUMAN	chromosome 15 open reading frame 60	232					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17					ATGGGGTGCAGAAGAGTTAGG	0.478	0	91.0	89.0	89.0	15	73852150	1850	4085	5935	SO:0001587	stop_gained																									ENST00000331090.6:c.694G>T	15.37:g.73852150G>T	ENSP00000328423:p.Glu232*		ENST00000331090.6	37	CCDS45296.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530040	0.27387	.	.	ENSG00000183324	ENST00000331090	.	.	.	6.02	6.02	0.97574	.	0.694289	0.14214	N	0.333848	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-5.7041	15.7463	0.77944	0.0:0.1456:0.8544:0.0	.	.	.	.	X	232	.	ENSP00000328423:E232X	E	+	1	0	C15orf60	71639203	0.924000	0.31332	0.008000	0.14137	0.431000	0.31685	3.797000	0.55514	2.857000	0.98124	0.650000	0.86243	GAA	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		0.097933	1	0	87	0	0.00198382	1	0.00198382		6	12.540485	65	0.084507
GMEB2	26205	broad.mit.edu	hg19	20	62236098	62236098	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr20:62236098A>T	ENST00000266068.1	-	2	705	c.227T>A	c.(226-228)tTa>tAa	p.L76*	GMEB2_ENST00000370077.1_Nonsense_Mutation_p.L76*|GMEB2_ENST00000370069.1_Nonsense_Mutation_p.L25*			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	76		regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding	breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)		CTTCCTACCTAACACGGCTTC	0.572	0	74.0	72.0	73.0	20	62236098	2203	4300	6503	SO:0001587	stop_gained	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216		4371	protein-coding gene	gene with protein product		607451			10523663, 11743720	Standard	NM_012384	Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.227T>A	20.37:g.62236098A>T	ENSP00000266068:p.Leu76*	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	ENST00000266068.1	37	CCDS13528.1	.	.	.	.	.	.	.	.	.	.	A	38	6.668376	0.97747	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	.	.	.	4.87	4.87	0.63330	.	0.090745	0.46758	D	0.000270	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-8.4045	14.1277	0.65233	1.0:0.0:0.0:0.0	.	.	.	.	X	25;76;76	.	ENSP00000266068:L76X	L	-	2	0	GMEB2	61706542	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	5.709000	0.68384	1.822000	0.53115	0.379000	0.24179	TTA	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1		14.439090	0	0	69	0	0	1	0	NM_012384	9	21.255279	50	0.152542
SHANK1	50944	broad.mit.edu	hg19	19	51220008	51220008	+	Missense_Mutation	SNP	G	G	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr19:51220008G>A	ENST00000293441.1	-	1	187	c.169C>T	c.(169-171)Ctc>Ttc	p.L57F	SHANK1_ENST00000359082.3_Missense_Mutation_p.L57F|SHANK1_ENST00000391814.1_Missense_Mutation_p.L57F	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	57		cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	CGGCCCTGGAGGCCTCTAACA	0.672	0	51.0	46.0	48.0	19	51220008	2203	4300	6503	SO:0001583	missense	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681	"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999			10551867	Standard	NM_016148	Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.169C>T	19.37:g.51220008G>A	ENSP00000293441:p.Leu57Phe	A8MXP5|B7WNY6|Q9NYW9	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048774	0.36181	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.40476	1.14;1.13;1.03	3.18	2.12	0.27331	.	1.696560	0.05419	U	0.543844	T	0.25975	0.0633	N	0.08118	0	0.29684	N	0.841484	B	0.12630	0.006	B	0.08055	0.003	T	0.27536	-1.0071	10	0.54805	T	0.06	.	8.3835	0.32486	0.1257:0.0:0.8743:0.0	.	57	Q9Y566	SHAN1_HUMAN	F	57	ENSP00000293441:L57F;ENSP00000351984:L57F;ENSP00000375690:L57F	ENSP00000293441:L57F	L	-	1	0	SHANK1	55911820	1.000000	0.71417	0.999000	0.59377	0.757000	0.42996	3.299000	0.51826	0.461000	0.27071	0.282000	0.19409	CTC	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1		1.201187	0	0	37	0	0	1	0	NM_016148	3	7.026769	31	0.088235
ABCB4	5244	ucsc.edu	hg19	7	87083881	87083881	+	Missense_Mutation	SNP	G	G	A			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c																										AATTTTGCCTGGATTTAGCAG	0.274	0	43.0	47.0	46.0	7	87083881	2202	4296	6498	SO:0001583	missense	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471	"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3	2892668, 11313316	Standard	NM_018850	Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000359206.3:c.314C>T	7.37:g.87083881G>A	ENSP00000352135:p.Pro105Leu	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	ENST00000359206.3	37	CCDS5605.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711792	0.48517	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.87103	-2.14;-2.21;-2.19;-2.21;-2.14	5.4	5.4	0.78164	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.465118	0.21477	N	0.073894	T	0.79610	0.4475	N	0.14661	0.345	0.58432	D	0.999997	B;P;B;B	0.35242	0.001;0.492;0.0;0.002	B;B;B;B	0.38225	0.01;0.268;0.003;0.012	T	0.77346	-0.2622	10	0.26408	T	0.33	-7.5299	16.2583	0.82528	0.0:0.0:1.0:0.0	.	105;105;105;105	Q6PJ81;A4D1D5;P21439-2;P21439	.;.;.;MDR3_HUMAN	L	105	ENSP00000352135:P105L;ENSP00000351172:P105L;ENSP00000265723:P105L;ENSP00000392983:P105L;ENSP00000437465:P105L	ENSP00000265723:P105L	P	-	2	0	ABCB4	86921817	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.407000	0.52644	2.699000	0.92147	0.555000	0.69702	CCA	ABCB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253601.3				0	55					NM_000443	4		33	
EDEM2	55741	broad.mit.edu	hg19	20	33722607	33722607	+	Silent	SNP	C	C	T			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr20:33722607C>T	ENST00000540582.1	-	10	1234	c.513G>A	c.(511-513)ccG>ccA	p.P171P	EDEM2_ENST00000542871.1_Intron|EDEM2_ENST00000374492.3_Silent_p.P212P|EDEM2_ENST00000374491.3_Silent_p.P175P|EDEM2_ENST00000541621.1_5'UTR			Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	212		post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)		CTTCGAACACCGGGTCACCAG	0.582	0	93.0	80.0	85.0	20	33722607	2203	4300	6503	SO:0001819	synonymous_variant	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298		15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31	15537790, 15579471	Standard	NM_018217	Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.636G>A	20.37:g.33722607C>T		B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	ENST00000374492.3	37	CCDS13247.1																																																																																			EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2		-4.316697	0	0	66	0	0	1	0	NM_018217	3	6.627498	50	0.056604
BAP1	8314	broad.mit.edu	hg19	3	52442457	52442503	+	Splice_Site	DEL	CACCCTCCAAACAAAGCACAGAGTCCAGCAGACCTGGTGGGCAAAGA	CACCCTCCAAACAAAGCACAGAGTCCAGCAGACCTGGTGGGCAAAGA	-			TCGA-RZ-AB0B-01A-11D-A39W-08	TCGA-RZ-AB0B-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4a5e52a-4422-40bc-b6a4-b8403051345e	3cd31965-60cf-4ffc-a130-e5b3aa8f124c	g.chr3:52442457_52442503delCACCCTCCAAACAAAGCACAGAGTCCAGCAGACCTGGTGGGCAAAGA	ENST00000460680.1	-	4	713_727	c.242_256delTCTTTGCCCACCAGGTCTGCTGGACTCTGTGCTTTGTTTGGAGGGTG	c.(241-258)ttctttgcccaccaggtc>ttc	p.FAHQV82fs	PHF7_ENST00000347025.2_5'Flank|PHF7_ENST00000327906.3_5'Flank|BAP1_ENST00000296288.5_Splice_Site_p.FAHQV82fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.	anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	GGCAGCATCCCACCCTCCAAACAAAGCACAGAGTCCAGCAGACCTGGTGGGCAAAGAACATGTTATT	0.502	2									SO:0001630	splice_region_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.255+1TCTTTGCCCACCAGGTCTGCTGGACTCTGTGCTTTGTTTGGAGGGTG>-	3:g.52442457_52442503delCACCCTCCAAACAAAGCACAGAGTCCAGCAGACCTGGTGGGCAAAGA		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1		CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	5.720000e+00	4.700000e+00		0	12						1		0	1
