Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
TGFBRAP1	9392	broad.mit.edu	hg19	2	105890086	105890086	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr2:105890086G>T	ENST00000393359.2	-	9	2153	c.1727C>A	c.(1726-1728)cCa>cAa	p.P576Q	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.P576Q			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	576		regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding	central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31					AATGTCGTCTGGATTAAAACT	0.433	0	215.0	206.0	209.0	2	105890086	2203	4300	6503	SO:0001583	missense	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966		16836	protein-coding gene	gene with protein product		606237			9545258, 11278302	Standard	NM_001142621	Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1727C>A	2.37:g.105890086G>T	ENSP00000377027:p.Pro576Gln	A8K5R7|D3DVJ8|O60466	ENST00000393359.2	37	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823339	0.50739	.	.	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.19806	2.12;2.12	5.58	4.7	0.59300	.	0.053943	0.85682	D	0.000000	T	0.49729	0.1574	M	0.90145	3.09	0.49483	D	0.999793	D;P	0.89917	1.0;0.952	D;P	0.81914	0.995;0.88	T	0.56038	-0.8045	10	0.19590	T	0.45	-14.4711	12.6216	0.56605	0.0768:0.0:0.9232:0.0	.	31;576	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	Q	576;576;31	ENSP00000377027:P576Q;ENSP00000258449:P576Q	ENSP00000258449:P576Q	P	-	2	0	TGFBRAP1	105256518	1.000000	0.71417	0.365000	0.25901	0.087000	0.18053	9.011000	0.93618	1.351000	0.45789	0.591000	0.81541	CCA	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2		-6.521593	1	-1	63	0	1	1	1	NM_004257	3	6.639394	58	0.049180
PPP1R3A	5506	broad.mit.edu	hg19	7	113517782	113517782	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr7:113517782T>C	ENST00000284601.3	-	4	3433	c.3365A>G	c.(3364-3366)aAg>aGg	p.K1122R		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1122		glycogen metabolic process	integral to membrane		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121					CTGAGGTTACTTCTTTTTGAC	0.383	0	95.0	96.0	96.0	7	113517782	2203	4299	6502	SO:0001583	missense	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3	7926294	Standard	NM_002711	Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3365A>G	7.37:g.113517782T>C	ENSP00000284601:p.Lys1122Arg	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392859	0.62066	.	.	ENSG00000154415	ENST00000284601	T	0.29142	1.58	5.74	5.74	0.90152	.	0.115334	0.43416	D	0.000571	T	0.42449	0.1203	L	0.27053	0.805	0.30118	N	0.805949	D	0.76494	0.999	D	0.66084	0.941	T	0.44081	-0.9351	10	0.72032	D	0.01	.	16.0249	0.80536	0.0:0.0:0.0:1.0	.	1122	Q16821	PPR3A_HUMAN	R	1122	ENSP00000284601:K1122R	ENSP00000284601:K1122R	K	-	2	0	PPP1R3A	113305018	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.249000	0.65427	2.181000	0.69327	0.528000	0.53228	AAG	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1		-7.029345	0	-6	108	0	0	1	0	NM_002711	3	6.417819	59	0.048387
SLC7A2	6542	broad.mit.edu	hg19	8	17417930	17417930	+	Silent	SNP	C	C	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr8:17417930C>A	ENST00000470360.1	+	11	1626	c.1509C>A	c.(1507-1509)tcC>tcA	p.S503S	SLC7A2_ENST00000522656.1_Silent_p.S464S|SLC7A2_ENST00000004531.10_Silent_p.S504S|SLC7A2_ENST00000398090.3_Silent_p.S503S|SLC7A2_ENST00000494857.1_Silent_p.S464S			P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	464		cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AGAGTGAGTCCCAGGTCACCA	0.552	0	122.0	114.0	116.0	8	17417930	2203	4300	6503	SO:0001819	synonymous_variant	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989	"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2	8954799	Standard	NM_001164771	Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1392C>A	8.37:g.17417930C>A		B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	ENST00000494857.1	37	CCDS34852.1																																																																																			SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3		128.631706	1	-9	59	0	5.71845e-15	1	6.86214e-15	NM_003046	39	128.658080	36	0.520000
MICU1	10367	broad.mit.edu	hg19	10	74322810	74322810	+	Missense_Mutation	SNP	T	T	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr10:74322810T>A	ENST00000398761.4	-	3	305	c.173A>T	c.(172-174)gAa>gTa	p.E58V	MICU1_ENST00000361114.5_Missense_Mutation_p.E58V|MICU1_ENST00000604025.1_5'UTR|MICU1_ENST00000401998.3_Missense_Mutation_p.E58V			Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	58		calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding							TGGTGGAGATTCTGCATGGGC	0.388	0	130.0	109.0	116.0	10	74322810	1863	4109	5972	SO:0001583	missense	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745	"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1	9806765, 20693986	Standard	NM_006077	Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.173A>T	10.37:g.74322810T>A	ENSP00000354415:p.Glu58Val	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	ENST00000361114.5	37	CCDS55715.1	.	.	.	.	.	.	.	.	.	.	T	19.23	3.788425	0.70337	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998	D;D;D	0.82255	-1.59;-1.59;-1.59	5.5	5.5	0.81552	.	0.047096	0.85682	D	0.000000	D	0.84447	0.5474	L	0.58101	1.795	0.80722	D	1	D	0.59357	0.985	P	0.54590	0.756	T	0.81099	-0.1086	10	0.11794	T	0.64	.	13.2708	0.60159	0.0:0.0:0.0:1.0	.	58	Q9BPX6	MICU1_HUMAN	V	58	ENSP00000354415:E58V;ENSP00000381745:E58V;ENSP00000384068:E58V	ENSP00000354415:E58V	E	-	2	0	MICU1	73992816	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	4.116000	0.57871	2.216000	0.71823	0.460000	0.39030	GAA	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1		13.769143	0	-1	31	0	0	1	0	NM_006077	5	14.269912	11	0.312500
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		31.925513	0	-11	70	0	0	1	0	NM_002067	11	32.731604	22	0.333333
PLCE1	51196	broad.mit.edu	hg19	10	95891952	95891952	+	Missense_Mutation	SNP	G	G	C	rs145451189	by1000genomes	TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr10:95891952G>C	ENST00000371380.3	+	2	1463	c.1228G>C	c.(1228-1230)Gaa>Caa	p.E410Q	PLCE1_ENST00000371385.3_Missense_Mutation_p.E102Q|PLCE1_ENST00000260766.3_Missense_Mutation_p.E410Q|PLCE1_ENST00000371375.1_Missense_Mutation_p.E102Q			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1			activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)			AGTGAGAAGAGAAGAAACAGA	0.408	0	122.0	120.0	120.0	10	95891952	1953	4156	6109	SO:0001583	missense		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414			11022047, 11022048	Standard	NM_016341	Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1228G>C	10.37:g.95891952G>C	ENSP00000360431:p.Glu410Gln	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799554	0.50208	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	5.08	5.08	0.68730	Ras guanine nucleotide exchange factor, domain (1);	0.306355	0.27159	N	0.020644	T	0.73094	0.3543	N	0.24115	0.695	0.31020	N	0.71818	B;D;P	0.58620	0.031;0.983;0.454	B;P;B	0.54499	0.01;0.754;0.107	T	0.75991	-0.3122	10	0.62326	D	0.03	.	16.0129	0.80417	0.0:0.0:1.0:0.0	.	410;102;410	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	Q	410;410;102;102	ENSP00000260766:E410Q;ENSP00000360431:E410Q;ENSP00000360438:E102Q;ENSP00000360426:E102Q	ENSP00000260766:E410Q	E	+	1	0	PLCE1	95881942	1.000000	0.71417	0.966000	0.40874	0.873000	0.50193	2.203000	0.42752	2.512000	0.84698	0.563000	0.77884	GAA	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3		20.881245	0	16	49	0	0	1	0	NM_016341	8	23.246658	27	0.228571
KDM6A	7403	broad.mit.edu	hg19	X	44918345	44918345	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chrX:44918345A>G	ENST00000377967.4	+	11	1011	c.970A>G	c.(970-972)Ata>Gta	p.I324V	KDM6A_ENST00000536777.1_Missense_Mutation_p.I324V|KDM6A_ENST00000543216.1_Missense_Mutation_p.I324V|KDM6A_ENST00000382899.4_Missense_Mutation_p.I324V	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	324		histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170					ATGGTGTTCAATAGGGTAAGC	0.318	8	91.0	80.0	84.0	X	44918345	2203	4300	6503	SO:0001583	missense	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050	"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX	9499428, 9381176	Standard	XM_005272655	Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.970A>G	X.37:g.44918345A>G	ENSP00000367203:p.Ile324Val	Q52LL9|Q5JVQ7	ENST00000377967.4	37	CCDS14265.1	.	.	.	.	.	.	.	.	.	.	A	17.63	3.438109	0.62955	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	T;T;T;T	0.52754	2.17;2.17;0.65;2.17	5.1	5.1	0.69264	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.68997	0.3062	M	0.78801	2.425	0.47094	D	0.99931	P;B;P;P;P	0.47604	0.65;0.348;0.514;0.898;0.543	P;B;P;D;P	0.68192	0.743;0.391;0.525;0.956;0.525	T	0.73313	-0.4022	10	0.87932	D	0	-13.455	14.1992	0.65690	1.0:0.0:0.0:0.0	.	324;324;324;324;324	F8W8R6;F5H6S1;B7ZKN5;B4E253;O15550	.;.;.;.;KDM6A_HUMAN	V	324	ENSP00000367203:I324V;ENSP00000437405:I324V;ENSP00000372355:I324V;ENSP00000443078:I324V	ENSP00000367203:I324V	I	+	1	0	KDM6A	44803289	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.910000	0.92685	1.799000	0.52666	0.417000	0.27973	ATA	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1		88.292649	0	-40	39	0	0	1	0	NM_021140	25	90.625249	7	0.781250
MPP1	4354	broad.mit.edu	hg19	X	154014531	154014531	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chrX:154014531C>T	ENST00000413259.3	-	7	927	c.535G>A	c.(535-537)Ggc>Agc	p.G179S	MPP1_ENST00000462825.1_5'UTR|MPP1_ENST00000369534.3_Missense_Mutation_p.G209S|MPP1_ENST00000393531.1_Missense_Mutation_p.G189S	NM_001166462.1	NP_001159934.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	209	SH3.	regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				TTGGAGGAGCCTTCCACCCGT	0.532	0	217.0	190.0	199.0	X	154014531	2203	4300	6503	SO:0001583	missense		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830		7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E	1713685	Standard	NM_002436	Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.625G>A	X.37:g.154014531C>T	ENSP00000358547:p.Gly209Ser	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.167022	0.57476	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529;ENST00000428488	T;T;D;T;T;T	0.82433	1.86;1.86;-1.61;1.86;1.86;1.86	5.1	4.23	0.50019	Src homology-3 domain (3);Variant SH3 (1);	0.144197	0.64402	D	0.000006	T	0.77519	0.4142	L	0.56396	1.775	0.46149	D	0.99889	B;B;B;B;B	0.25521	0.034;0.001;0.128;0.004;0.006	B;B;B;B;B	0.24269	0.026;0.014;0.052;0.008;0.014	T	0.73987	-0.3809	10	0.34782	T	0.22	.	9.1221	0.36793	0.0:0.8948:0.0:0.1052	.	192;179;83;189;209	B4E325;B4DZV5;C9J9J4;G3XAI1;Q00013	.;.;.;.;EM55_HUMAN	S	209;179;189;83;163;106	ENSP00000358547:G209S;ENSP00000400155:G179S;ENSP00000377165:G189S;ENSP00000410888:G83S;ENSP00000377163:G163S;ENSP00000391701:G106S	ENSP00000358547:G209S	G	-	1	0	MPP1	153667725	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.215000	0.58534	2.103000	0.63969	0.513000	0.50165	GGC	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3		-6.298331	0	-120	135	0	0	1	0	NM_002436	5	11.578563	82	0.057471
PSME4	23198	broad.mit.edu	hg19	2	54096539	54096539	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr2:54096539G>A	ENST00000404125.1	-	44	5292	c.5237C>T	c.(5236-5238)tCt>tTt	p.S1746F	PSME4_ENST00000421748.2_Missense_Mutation_p.S890F|PSME4_ENST00000476586.1_5'UTR	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1746		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		ATCTCCTACAGAACCAGGGTC	0.398	0	236.0	224.0	228.0	2	54096539	2203	4300	6503	SO:0001583	missense	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878	"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705			7584044, 12093752	Standard	NM_014614	Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.5237C>T	2.37:g.54096539G>A	ENSP00000384211:p.Ser1746Phe	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758877	0.49468	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.27104	1.69;1.7	5.97	1.06	0.20224	Armadillo-like helical (1);Armadillo-type fold (1);	0.452374	0.27871	N	0.017506	T	0.23410	0.0566	L	0.54323	1.7	0.39967	D	0.974742	B;B;B;B	0.32526	0.089;0.374;0.374;0.205	B;B;B;B	0.33521	0.028;0.106;0.165;0.031	T	0.05305	-1.0893	10	0.52906	T	0.07	0.01	9.5626	0.39378	0.3708:0.0:0.6292:0.0	.	1121;890;890;1746	Q14997-2;Q14997-3;F8WB44;Q14997	.;.;.;PSME4_HUMAN	F	890;1746	ENSP00000410830:S890F;ENSP00000384211:S1746F	ENSP00000384211:S1746F	S	-	2	0	PSME4	53950043	1.000000	0.71417	0.417000	0.26559	0.996000	0.88848	3.583000	0.53928	-0.081000	0.12662	0.591000	0.81541	TCT	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1		133.535041	0	8	200	0	0	1	0	XM_040158	48	139.109509	111	0.301887
OR2L3	391192	broad.mit.edu	hg19	1	248224859	248224859	+	Silent	SNP	G	G	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr1:248224859G>A	ENST00000359959.3	+	1	876	c.876G>A	c.(874-876)agG>agA	p.R292R	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	292		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)		ATAGCCTGAGGAACAAGGAGG	0.498	0	59.0	60.0	59.0	1	248224859	2203	4300	6503	SO:0001819	synonymous_variant	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128	"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product						Standard	NM_001004687	Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.876G>A	1.37:g.248224859G>A		B9EH44	ENST00000359959.3	37	CCDS31104.1																																																																																			OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1		37.528827	0	0	66	0	0	1	0	NM_001004687	14	39.548491	35	0.285714
PPP1R18	170954	broad.mit.edu	hg19	6	30653733	30653733	+	Silent	SNP	G	G	T			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr6:30653733G>T	ENST00000274853.3	-	1	1939	c.63C>A	c.(61-63)tcC>tcA	p.S21S	PPP1R18_ENST00000488324.1_Intron|PPP1R18_ENST00000399199.3_Silent_p.S21S	NM_133471.3	NP_597728.1	Q6NYC8	PHTNS_HUMAN	protein phosphatase 1, regulatory subunit 18	21			cytoplasm|cytoskeleton	actin binding							GGCCTCGAACGGACGCCTCCT	0.672	0	104.0	125.0	118.0	6	30653733	1267	2530	3797	SO:0001819	synonymous_variant	AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949	11853319	Standard	NM_001134870	Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.63C>A	6.37:g.30653733G>T		A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	ENST00000274853.3	37	CCDS43444.1																																																																																			PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076498.2		208.684235	1	-32	146	0	1.12115e-39	1	1.41619e-39	NM_133471	68	208.690543	66	0.507463
NACA2	342538	broad.mit.edu	hg19	17	59668490	59668490	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr17:59668490G>A	ENST00000521764.1	-	1	73	c.52C>T	c.(52-54)Cag>Tag	p.Q18*		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	18		protein transport	cytoplasm|nucleus		large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)				GCCTGGGACTGCGGCAACTCC	0.567	0	77.0	68.0	71.0	17	59668490	2203	4300	6503	SO:0001587	stop_gained	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506		23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL	12406326	Standard	NM_199290	Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.52C>T	17.37:g.59668490G>A	ENSP00000427802:p.Gln18*	Q2VIR9	ENST00000521764.1	37	CCDS11630.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481108	0.84747	.	.	ENSG00000253506	ENST00000521764	.	.	.	0.753	0.753	0.18404	.	0.101993	0.39615	U	0.001318	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	X	18	.	.	Q	-	1	0	NACA2	57023272	1.000000	0.71417	0.995000	0.50966	0.773000	0.43773	2.777000	0.47717	0.702000	0.31825	0.411000	0.27672	CAG	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2		52.137059	0	1	65	0	0	1	0	NM_199290	18	52.795909	30	0.375000
ADAMTSL1	92949	broad.mit.edu	hg19	9	18721576	18721576	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr9:18721576G>A	ENST00000380548.4	+	15	2258	c.1919G>A	c.(1918-1920)cGg>cAg	p.R640Q	ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.R640Q	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	640	TSP type-1 5.		proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)	AAACAGACTCGGGAGCCTGCT	0.592	0	93.0	92.0	92.0	9	18721576	2203	4300	6503	SO:0001583	missense	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031	"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94	9628581, 11805097	Standard	NM_001040272	Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000276935.6:c.1919G>A	9.37:g.18721576G>A	ENSP00000276935:p.Arg640Gln	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	ENST00000276935.6	37		.	.	.	.	.	.	.	.	.	.	G	4.264	0.048046	0.08243	.	.	ENSG00000178031	ENST00000380548;ENST00000276935	T;T	0.62788	0.06;-0.0	5.86	4.02	0.46733	.	0.071793	0.08080	U	1.000000	T	0.43010	0.1228	N	0.05534	-0.03	0.80722	D	1	B	0.18013	0.025	B	0.12156	0.007	T	0.09552	-1.0669	10	0.07030	T	0.85	.	15.3244	0.74147	0.128:0.0:0.872:0.0	.	640	Q8N6G6	ATL1_HUMAN	Q	640	ENSP00000369921:R640Q;ENSP00000276935:R640Q	ENSP00000276935:R640Q	R	+	2	0	ADAMTSL1	18711576	1.000000	0.71417	0.841000	0.33234	0.846000	0.48090	5.311000	0.65786	0.407000	0.25591	-0.813000	0.03139	CGG	ADAMTSL1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051804.5		93.079132	0	-6	122	0	0	1	0		30	94.157669	50	0.375000
SNAPC2	6618	broad.mit.edu	hg19	19	7987612	7987612	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr19:7987612T>C	ENST00000221573.6	+	5	1019	c.968T>C	c.(967-969)cTg>cCg	p.L323P	SNAPC2_ENST00000597584.1_Missense_Mutation_p.L86P	NM_003083.3	NP_003074.1	Q13487	SNPC2_HUMAN	small nuclear RNA activating complex, polypeptide 2, 45kDa	323		snRNA transcription|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	sequence-specific DNA binding transcription factor activity	NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6					CTGGTGCCCCTGGAGCTTCTG	0.697	0	57.0	76.0	69.0	19	7987612	2190	4288	6478	SO:0001583	missense	U44898	CCDS12190.1	19p13	2008-07-22	2002-08-29			ENSG00000104976		11135	protein-coding gene	gene with protein product		605076	"""small nuclear RNA activating complex, polypeptide 2, 45kD"""		8633057	Standard	NM_003083	Approved	SNAP45, PTFdelta	uc002miw.2	Q13487		ENST00000221573.6:c.968T>C	19.37:g.7987612T>C	ENSP00000221573:p.Leu323Pro	B2RBZ6|D6W663|Q13486	ENST00000221573.6	37	CCDS12190.1	.	.	.	.	.	.	.	.	.	.	t	15.57	2.874133	0.51695	.	.	ENSG00000104976	ENST00000221573	T	0.60299	0.2	4.55	4.55	0.56014	.	0.104561	0.39083	N	0.001480	T	0.72236	0.3435	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75224	-0.3393	10	0.87932	D	0	-13.2986	10.2213	0.43198	0.0:0.0:0.0:1.0	.	323	Q13487	SNPC2_HUMAN	P	323	ENSP00000221573:L323P	ENSP00000221573:L323P	L	+	2	0	SNAPC2	7893612	1.000000	0.71417	1.000000	0.80357	0.360000	0.29518	2.797000	0.47877	1.915000	0.55452	0.370000	0.22315	CTG	SNAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461358.1		-9.470205	0	-20	107	0	0	1	0	NM_003083	4	7.994886	77	0.049383
RYR2	6262	broad.mit.edu	hg19	1	237777594	237777594	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr1:237777594C>A	ENST00000366574.2	+	37	5483	c.5166C>A	c.(5164-5166)aaC>aaA	p.N1722K	RYR2_ENST00000542537.1_Missense_Mutation_p.N1706K|RYR2_ENST00000360064.6_Missense_Mutation_p.N1720K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1722	4 X approximate repeats.	cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		TCATGATGAACAACGAGTACA	0.527	0	61.0	61.0	61.0	1	237777594	2151	4259	6410	SO:0001583	missense	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626	"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2	2380170, 8406504, 11159936	Standard	NM_001035	Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5166C>A	1.37:g.237777594C>A	ENSP00000355533:p.Asn1722Lys	Q15411|Q546N8|Q5T3P2	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	2.823	-0.244362	0.05906	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73363	-0.74;-0.74;-0.74	5.43	4.52	0.55395	.	0.000000	0.64402	D	0.000003	T	0.48095	0.1481	N	0.12182	0.205	0.80722	D	1	B	0.31968	0.349	B	0.22152	0.038	T	0.51585	-0.8687	10	0.02654	T	1	.	10.8808	0.46937	0.0:0.8366:0.0:0.1634	.	1722	Q92736	RYR2_HUMAN	K	1722;1720;1706	ENSP00000355533:N1722K;ENSP00000353174:N1720K;ENSP00000443798:N1706K	ENSP00000353174:N1720K	N	+	3	2	RYR2	235844217	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	1.586000	0.36611	1.294000	0.44707	0.650000	0.86243	AAC	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		35.627336	1	-9	31	0	0.010729	1	0.0117044	NM_001035	11	35.730505	8	0.578947
ZNF354C	30832	broad.mit.edu	hg19	5	178506834	178506834	+	Silent	SNP	G	G	A			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr5:178506834G>A	ENST00000315475.6	+	5	1707	c.1401G>A	c.(1399-1401)ccG>ccA	p.P467P		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	467		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)	GAGAGAAACCGTATCAGTGTA	0.393	0	72.0	79.0	77.0	5	178506834	2203	4300	6503	SO:0001819	synonymous_variant		CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932	"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product					10786630	Standard	NM_014594	Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1401G>A	5.37:g.178506834G>A		Q6P4P9|Q8NFX1	ENST00000315475.6	37	CCDS4443.1																																																																																			ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2		57.109542	0	-3	63	0	0	1	0		19	58.268974	36	0.345455
MN1	4330	broad.mit.edu	hg19	22	28194881	28194883	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr22:28194881_28194883delGCT	ENST00000302326.4	-	1	2603_2605	c.1649_1651delAGC	c.(1648-1653)cagcgc>cgc	p.Q550del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	550	Poly-Gln.			binding	NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45					GCGTTTTGGCgctgctgctgctg	0.645	0									SO:0001651	inframe_deletion	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184		7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR	7731706, 12569362	Standard	NM_002430	Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1649_1651delAGC	22.37:g.28194890_28194892delGCT	ENSP00000304956:p.Gln550del	A9Z1V9	ENST00000302326.4	37	CCDS42998.1																																																																																			MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	.	.		2	4					NM_002430	3		3	0.50
LINC00189	0	broad.mit.edu	hg19	21	30595091	30595091	+	RNA	DEL	C	C	-			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr21:30595091delC	ENST00000420364.1	+	0	767					NR_027072.2																TCCTGTACCACCAACTTCTTC	0.512	0											AF490769		21q22.11	2012-10-12	2011-08-11	2011-08-11	ENSG00000215533	ENSG00000215533	"""Long non-coding RNAs"""	18461	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 109"", ""non-protein coding RNA 189"""	C21orf109, NCRNA00189	12036298	Standard	NR_027072	Approved		uc002yni.3		OTTHUMG00000078876		21.37:g.30595091delC			ENST00000420364.1	37																																																																																				LINC00189-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000171969.1	.	.		-5	6					NR_027072	2		4	0.33
RP11-325K19.1	0	broad.mit.edu	hg19	18	58331400	58331400	+	RNA	DEL	C	C	-			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr18:58331400delC	ENST00000591869.1	-	0	228																					AGCAATTCATCCCGAGCTTAA	0.502	0																																				18.37:g.58331400delC			ENST00000591869.1	37																																																																																				RP11-325K19.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449086.1	.	.		6	14						2		4	0.33
PLCB2	5330	broad.mit.edu	hg19	15	40594218	40594218	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V4-A9E8-01A-11D-A39W-08	TCGA-V4-A9E8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a878d471-6a96-4065-91cb-22d1fffad852	3d7200fc-9efc-460f-9491-823158221c82	g.chr15:40594218delA	ENST00000260402.3	-	7	771	c.522delT	c.(520-522)tttfs	p.F174fs	PLCB2_ENST00000456256.2_Frame_Shift_Del_p.F174fs|PLCB2_ENST00000543785.2_Frame_Shift_Del_p.F174fs|PLCB2_ENST00000557821.1_Frame_Shift_Del_p.F174fs	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	174		activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	GGTCAGCAGGAAACATCTGGA	0.582	0	49.0	54.0	53.0	15	40594218	1978	4158	6136	SO:0001589	frameshift_variant		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841		9055	protein-coding gene	gene with protein product		604114			1644792, 9925923	Standard	XM_005254448	Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000543785.2:c.522delT	15.37:g.40594218delA	ENSP00000444652:p.Phe174fs	A8K6J2|B9EGH5	ENST00000543785.2	37																																																																																				PLCB2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000418439.1	.	.		-5	46						8		7	0.53
