Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
CSNK1A1L	122011	broad.mit.edu	hg19	13	37679303	37679303	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr13:37679303C>T	ENST00000379800.3	-	1	500	c.91G>A	c.(91-93)Gtt>Att	p.V31I		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	31	Protein kinase.	Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)	CCCAGATAAACGTCTCCAAAG	0.537	0	139.0	127.0	131.0	13	37679303	2203	4300	6503	SO:0001583	missense	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138		20289	protein-coding gene	gene with protein product						Standard	NM_145203	Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.91G>A	13.37:g.37679303C>T	ENSP00000369126:p.Val31Ile	Q5T2N2	ENST00000379800.3	37	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	C	0.110	-1.140119	0.01728	.	.	ENSG00000180138	ENST00000379800	T	0.80824	-1.42	0.778	0.778	0.18543	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055899	0.64402	N	0.000002	T	0.43590	0.1254	N	0.01431	-0.87	0.29898	N	0.824643	B	0.09022	0.002	B	0.11329	0.006	T	0.46414	-0.9193	10	0.02654	T	1	.	3.0398	0.06134	0.0:0.6793:0.0:0.3206	.	31	Q8N752	KC1AL_HUMAN	I	31	ENSP00000369126:V31I	ENSP00000369126:V31I	V	-	1	0	CSNK1A1L	36577303	1.000000	0.71417	0.488000	0.27440	0.808000	0.45660	2.847000	0.48270	0.686000	0.31488	0.561000	0.74099	GTT	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1		-11.641275	0	-12	76	0	0	1	0	NM_145203	3	6.312662	75	0.038462
ARSI	340075	broad.mit.edu	hg19	5	149677696	149677696	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr5:149677696G>A	ENST00000328668.7	-	2	1370	c.791C>T	c.(790-792)gCg>gTg	p.A264V		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	264			endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		CACCATGGCCGCGTACTTCCG	0.587	0	45.0	40.0	42.0	5	149677696	2203	4300	6503	SO:0001583	missense	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876	"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""		16174644, 24482476	Standard	NM_001012301	Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.791C>T	5.37:g.149677696G>A	ENSP00000333395:p.Ala264Val	A1L3B0|B3KV22|B7XD03	ENST00000328668.7	37	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764814	0.90020	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.96856	-4.15;-4.15	4.46	4.46	0.54185	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98121	0.9380	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99116	1.0848	10	0.87932	D	0	.	17.6599	0.88189	0.0:0.0:1.0:0.0	.	264	Q5FYB1	ARSI_HUMAN	V	264;121	ENSP00000333395:A264V;ENSP00000426879:A121V	ENSP00000333395:A264V	A	-	2	0	ARSI	149657889	1.000000	0.71417	0.978000	0.43139	0.951000	0.60555	9.591000	0.98241	2.460000	0.83146	0.561000	0.74099	GCG	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1		2.004453	0	4	39	0	0	1	0	NM_001012301	3	6.545151	26	0.103448
LRRC49	54839	broad.mit.edu	hg19	15	71193327	71193327	+	Missense_Mutation	SNP	A	A	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr15:71193327A>C	ENST00000260382.5	+	4	520	c.260A>C	c.(259-261)gAg>gCg	p.E87A	LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000544974.2_Missense_Mutation_p.E77A|LRRC49_ENST00000560691.1_5'UTR|LRRC49_ENST00000560369.1_Missense_Mutation_p.E92A|LRRC49_ENST00000443425.2_Missense_Mutation_p.E43A	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	87			cytoplasm|microtubule		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34					TCTTCTGAAGAGAAAATTCTT	0.313	0	80.0	83.0	82.0	15	71193327	2199	4295	6494	SO:0001583	missense		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821		25965	protein-coding gene	gene with protein product					12477932	Standard	NM_001199017	Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000560369.1:c.275A>C	15.37:g.71193327A>C	ENSP00000453273:p.Glu92Ala	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	ENST00000560369.1	37	CCDS58376.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.388005	0.61956	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.37752	1.18;1.9;1.9	5.86	5.86	0.93980	.	0.198988	0.35870	N	0.002921	T	0.31420	0.0796	L	0.32530	0.975	0.39912	D	0.974043	P;P;P;P;P	0.44478	0.836;0.831;0.492;0.741;0.814	B;B;B;B;B	0.42882	0.238;0.401;0.276;0.143;0.287	T	0.09574	-1.0668	10	0.39692	T	0.17	-24.9529	12.9413	0.58345	1.0:0.0:0.0:0.0	.	92;59;43;87;77	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	A	77;87;43;59	ENSP00000439600:E77A;ENSP00000260382:E87A;ENSP00000414065:E43A	ENSP00000260382:E87A	E	+	2	0	LRRC49	68980381	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.952000	0.70282	2.367000	0.80283	0.528000	0.53228	GAG	LRRC49-005	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417208.1		46.315344	0	-7	117	0	0	1	0	NM_017691	15	46.418548	19	0.441176
COL4A2	1284	broad.mit.edu	hg19	13	111098204	111098204	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr13:111098204G>C	ENST00000360467.5	+	17	1292	c.986G>C	c.(985-987)gGg>gCg	p.G329A		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	329	Triple-helical region.	angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		GGCTATCAAGGGCCTGATGGA	0.512	0	106.0	110.0	108.0	13	111098204	1926	4122	6048	SO:0001583	missense	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871	"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090			2439508, 3025878	Standard	NM_001846	Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.986G>C	13.37:g.111098204G>C	ENSP00000353654:p.Gly329Ala	Q14052|Q548C3|Q5VZA9|Q66K23	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289460	0.40494	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99329	-5.75	3.74	3.74	0.42951	.	0.122377	0.36591	N	0.002507	D	0.99489	0.9818	M	0.94142	3.5	0.44117	D	0.996898	D	0.76494	0.999	D	0.91635	0.999	D	0.98095	1.0411	10	0.62326	D	0.03	.	11.36	0.49638	0.0:0.0:1.0:0.0	.	329	P08572	CO4A2_HUMAN	A	329	ENSP00000353654:G329A	ENSP00000257309:G329A	G	+	2	0	COL4A2	109896205	0.992000	0.36948	0.435000	0.26784	0.391000	0.30476	3.423000	0.52756	2.376000	0.81061	0.643000	0.83706	GGG	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2		114.253508	0	-22	96	0	0	1	0	NM_001846	37	114.619824	49	0.430233
DSG1	1828	broad.mit.edu	hg19	18	28913603	28913603	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr18:28913603G>A	ENST00000257192.4	+	7	948	c.736G>A	c.(736-738)Gca>Aca	p.A246T		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	246	Cadherin 2.	calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding	NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)		AGATGGCGGGGCAGATGGCAT	0.428	0	144.0	130.0	135.0	18	28913603	2203	4300	6503	SO:0001583	missense	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760	"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG	1889810	Standard	NM_001942	Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.736G>A	18.37:g.28913603G>A	ENSP00000257192:p.Ala246Thr	B7Z845	ENST00000257192.4	37	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	G	9.571	1.121016	0.20877	.	.	ENSG00000134760	ENST00000257192	T	0.50813	0.73	5.82	0.68	0.17980	Cadherin (4);Cadherin-like (1);	0.538614	0.17967	N	0.155976	T	0.30479	0.0766	L	0.35723	1.085	0.44302	D	0.997175	B	0.21520	0.057	B	0.29267	0.1	T	0.05533	-1.0879	10	0.17369	T	0.5	.	2.7782	0.05353	0.165:0.1091:0.5023:0.2237	.	246	Q02413	DSG1_HUMAN	T	246	ENSP00000257192:A246T	ENSP00000257192:A246T	A	+	1	0	DSG1	27167601	0.075000	0.21258	0.338000	0.25549	0.637000	0.38172	0.670000	0.25157	0.083000	0.17047	0.655000	0.94253	GCA	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1		79.644528	0	-1	57	0	0	1	0	NM_001942	26	79.644528	26	0.500000
HK1	3098	broad.mit.edu	hg19	10	71144107	71144107	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr10:71144107C>T	ENST00000448642.2	+	16	2083	c.1694C>T	c.(1693-1695)gCc>gTc	p.A565V	HK1_ENST00000404387.2_Missense_Mutation_p.A534V|HK1_ENST00000360289.2_Missense_Mutation_p.A518V|HK1_ENST00000359426.6_Missense_Mutation_p.A530V|HK1_ENST00000298649.3_Missense_Mutation_p.A529V|HK1_ENST00000494253.1_3'UTR			P19367	HXK1_HUMAN	hexokinase 1	530	Catalytic.	glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35					GACTTCTTGGCCCTGGATCTT	0.473	0	180.0	175.0	177.0	10	71144107	2203	4300	6503	SO:0001583	missense	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515		4922	protein-coding gene	gene with protein product		142600				Standard	NM_033496	Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1589C>T	10.37:g.71144107C>T	ENSP00000352398:p.Ala530Val	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	C	36	5.666245	0.96745	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.99494	-6.01;-6.01;-6.01;-6.01;-6.01	5.77	5.77	0.91146	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99554	0.9840	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D	0.89917	0.973;0.995;0.988;1.0;1.0;1.0	P;P;P;D;D;D	0.97110	0.675;0.675;0.678;0.999;0.999;1.0	D	0.98662	1.0684	10	0.87932	D	0	-20.7112	19.5653	0.95390	0.0:1.0:0.0:0.0	.	530;530;529;565;534;518	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	V	518;565;534;529;530;530	ENSP00000353433:A518V;ENSP00000402103:A565V;ENSP00000384774:A534V;ENSP00000298649:A529V;ENSP00000352398:A530V	ENSP00000298649:A529V	A	+	2	0	HK1	70814113	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.729000	0.93468	0.650000	0.86243	GCC	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2		117.648876	0	-55	145	0	0	1	0	NM_000188	39	118.692693	61	0.390000
EP300	2033	broad.mit.edu	hg19	22	41573600	41573600	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr22:41573600T>C	ENST00000263253.7	+	31	7104	c.5885T>C	c.(5884-5886)aTg>aCg	p.M1962T	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1962		apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171					ATGACTCCCATGGCCCCCATG	0.597	0	67.0	65.0	66.0	22	41573600	2203	4300	6503	SO:0001583	missense	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393	"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700			7523245	Standard	NM_001429	Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5885T>C	22.37:g.41573600T>C	ENSP00000263253:p.Met1962Thr	B1AKC2	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.629237	0.28978	.	.	ENSG00000100393	ENST00000263253	D	0.82984	-1.67	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000015	T	0.76644	0.4016	L	0.52364	1.645	0.45205	D	0.998213	B	0.30482	0.281	B	0.21917	0.037	T	0.73190	-0.4061	10	0.15499	T	0.54	-8.3909	15.2854	0.73826	0.0:0.0:0.0:1.0	.	1962	Q09472	EP300_HUMAN	T	1962	ENSP00000263253:M1962T	ENSP00000263253:M1962T	M	+	2	0	EP300	39903546	1.000000	0.71417	0.931000	0.37212	0.549000	0.35272	4.068000	0.57534	2.016000	0.59253	0.459000	0.35465	ATG	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1		81.741499	0	-37	64	0	0	1	0	NM_001429	26	81.973914	34	0.433333
GABRE	2564	broad.mit.edu	hg19	X	151131076	151131076	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chrX:151131076C>T	ENST00000370325.1	-	4	435	c.382G>A	c.(382-384)Gac>Aac	p.D128N	GABRE_ENST00000393914.3_5'UTR|GABRE_ENST00000370328.3_Missense_Mutation_p.D128N			P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	128		gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				AGGCGTTCGTCGTACCAGGTC	0.463	0	175.0	139.0	152.0	X	151131076	2203	4300	6503	SO:0001583	missense	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287	"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093			9039914, 9084408	Standard	NM_004961	Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.382G>A	X.37:g.151131076C>T	ENSP00000359353:p.Asp128Asn	E7ET93|O15345|O15346|Q6PCD2|Q99520	ENST00000370328.3	37	CCDS14703.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350148	0.82132	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	D;D	0.93547	-3.24;-3.24	5.6	5.6	0.85130	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.52532	D	0.000069	D	0.97548	0.9197	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98567	1.0644	10	0.87932	D	0	.	15.8742	0.79148	0.0:1.0:0.0:0.0	.	128	P78334	GBRE_HUMAN	N	128	ENSP00000359353:D128N;ENSP00000359350:D128N	ENSP00000359350:D128N	D	-	1	0	GABRE	150881732	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	7.818000	0.86416	2.348000	0.79779	0.600000	0.82982	GAC	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1		117.501382	0	-24	89	0	0	1	0	NM_004961, NM_021990, NM_021984	36	117.504459	35	0.507042
KLHL31	401265	broad.mit.edu	hg19	6	53519136	53519136	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr6:53519136C>T	ENST00000370905.3	-	2	1075	c.935G>A	c.(934-936)cGa>cAa	p.R312Q	KLHL31_ENST00000407079.1_Missense_Mutation_p.R312Q	NM_001003760.4	NP_001003760.2	Q9H511	KLH31_HUMAN	kelch-like family member 31	312		regulation of transcription, DNA-dependent|transcription, DNA-dependent			autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)				GCAGCCACCTCGGATTCTTGT	0.483	0	145.0	137.0	139.0	6	53519136	2203	4300	6503	SO:0001583	missense		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743	"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1		Standard	NM_001003760	Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.935G>A	6.37:g.53519136C>T	ENSP00000384644:p.Arg312Gln	A6N9J2|B2RP49	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260823	0.80246	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.74002	-0.8;-0.8	5.49	5.49	0.81192	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.88822	0.6541	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.90999	0.4841	10	0.87932	D	0	.	19.4094	0.94662	0.0:1.0:0.0:0.0	.	312	Q9H511	KLH31_HUMAN	Q	312	ENSP00000359942:R312Q;ENSP00000384644:R312Q	ENSP00000359942:R312Q	R	-	2	0	KLHL31	53627095	1.000000	0.71417	0.972000	0.41901	0.594000	0.36715	7.818000	0.86416	2.583000	0.87209	0.561000	0.74099	CGA	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1		168.744348	0	-13	132	0	0	1	0	NM_001003760	54	168.775420	58	0.482143
SIM2	6493	broad.mit.edu	hg19	21	38115707	38115707	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr21:38115707C>T	ENST00000290399.6	+	9	1631	c.1018C>T	c.(1018-1020)Ctt>Ttt	p.L340F	SIM2_ENST00000430056.3_Missense_Mutation_p.L340F	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	340	Single-minded C-terminal.	cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16					ATACAAGGAACTTCAGCTGTC	0.587	0	92.0	96.0	95.0	21	38115707	2203	4300	6503	SO:0001583	missense		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263	"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM	7485157	Standard	NM_009586	Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.1018C>T	21.37:g.38115707C>T	ENSP00000290399:p.Leu340Phe	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	ENST00000290399.6	37	CCDS13646.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.53|12.53	1.965967|1.965967	0.34659|0.34659	.|.	.|.	ENSG00000159263|ENSG00000159263	ENST00000290399;ENST00000430056|ENST00000431229	T;T|.	0.09817|.	2.97;2.94|.	4.49|4.49	1.43|1.43	0.22495|0.22495	Single-minded, C-terminal (1);|.	0.064020|.	0.64402|.	D|.	0.000005|.	T|T	0.45657|0.45657	0.1353|0.1353	M|M	0.66939|0.66939	2.045|2.045	0.23926|0.23926	N|N	0.996441|0.996441	D;P|.	0.56287|.	0.975;0.954|.	P;P|.	0.58210|.	0.835;0.826|.	T|T	0.34700|0.34700	-0.9818|-0.9818	10|5	0.87932|.	D|.	0|.	.|.	7.3607|7.3607	0.26745|0.26745	0.1349:0.7116:0.0:0.1536|0.1349:0.7116:0.0:0.1536	.|.	340;340|.	Q14190;Q14190-2|.	SIM2_HUMAN;.|.	F|I	340|277	ENSP00000290399:L340F;ENSP00000404176:L340F|.	ENSP00000290399:L340F|.	L|T	+|+	1|2	0|0	SIM2|SIM2	37037577|37037577	0.751000|0.751000	0.28327|0.28327	0.052000|0.052000	0.19188|0.19188	0.953000|0.953000	0.61014|0.61014	1.401000|1.401000	0.34589|0.34589	0.435000|0.435000	0.26365|0.26365	0.462000|0.462000	0.41574|0.41574	CTT|ACT	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1		10.687037	0	-2	94	0	0	1	0	NM_009586	7	17.657973	46	0.132075
FANCL	55120	broad.mit.edu	hg19	2	58388662	58388662	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr2:58388662A>G	ENST00000402135.3	-	12	1066	c.1030T>C	c.(1030-1032)Tat>Cat	p.Y344H	FANCL_ENST00000233741.4_Missense_Mutation_p.Y339H|FANCL_ENST00000403676.1_Missense_Mutation_p.Y222H|FANCL_ENST00000403295.3_Missense_Mutation_p.Y311H	NM_001114636.1	NP_001108108.1	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	339		DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding	endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8					TTTACCTCATATAAGCATATT	0.338	0	75.0	81.0	79.0	2	58388662	2201	4297	6498	SO:0001583	missense	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392	"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9		Standard	NM_018062	Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000402135.3:c.1030T>C	2.37:g.58388662A>G	ENSP00000385021:p.Tyr344His	Q6GU60	ENST00000402135.3	37	CCDS46294.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.733916	0.89482	.	.	ENSG00000115392	ENST00000403295;ENST00000233741;ENST00000402135;ENST00000403676;ENST00000449070	T;T;T;T;T	0.67865	-0.24;-0.29;-0.29;-0.24;-0.24	5.91	5.91	0.95273	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.053587	0.85682	D	0.000000	D	0.84238	0.5428	M	0.87097	2.86	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.986;0.99;0.999;1.0	D	0.86473	0.1786	10	0.59425	D	0.04	-17.6464	16.3469	0.83138	1.0:0.0:0.0:0.0	.	280;311;344;339	C9JZA9;B5MC31;Q9NW38-2;Q9NW38	.;.;.;FANCL_HUMAN	H	311;339;344;222;280	ENSP00000386097:Y311H;ENSP00000233741:Y339H;ENSP00000385021:Y344H;ENSP00000384046:Y222H;ENSP00000401280:Y280H	ENSP00000233741:Y339H	Y	-	1	0	FANCL	58242166	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.828000	0.92047	2.263000	0.75096	0.528000	0.53228	TAT	FANCL-002	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325254.1		21.585112	0	15	79	0	0	1	0	NM_018062	8	24.137054	28	0.222222
SETX	23064	broad.mit.edu	hg19	9	135205194	135205194	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr9:135205194G>C	ENST00000372169.2	-	10	1973	c.1791C>G	c.(1789-1791)ttC>ttG	p.F597L	SETX_ENST00000224140.5_Missense_Mutation_p.F597L|SETX_ENST00000393220.1_Missense_Mutation_p.F597L			Q7Z333	SETX_HUMAN	senataxin	597		cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	GAGGTGCTTTGAATTTTATGT	0.358	0	56.0	52.0	54.0	9	135205194	2203	4299	6502	SO:0001583	missense	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290		445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1	9497266, 11022012	Standard	NM_015046	Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1791C>G	9.37:g.135205194G>C	ENSP00000224140:p.Phe597Leu	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	G	3.984	-0.005752	0.07773	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.81499	-1.5;-1.5;-1.5	5.92	-0.453	0.12201	.	2.275650	0.01566	N	0.020363	T	0.63070	0.2480	N	0.19112	0.55	0.20764	N	0.99986	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.47420	-0.9119	10	0.09590	T	0.72	.	2.0329	0.03533	0.1925:0.1097:0.4507:0.2471	.	597;597;597	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	L	597	ENSP00000224140:F597L;ENSP00000361242:F597L;ENSP00000376913:F597L	ENSP00000224140:F597L	F	-	3	2	SETX	134195015	0.101000	0.21875	0.033000	0.17914	0.701000	0.40568	0.215000	0.17562	-0.127000	0.11661	-1.301000	0.01330	TTC	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3		18.613318	0	16	65	0	0	1	0	NM_015046	7	19.701928	18	0.280000
TNFRSF8	0	broad.mit.edu	hg19	1	12164444	12164444	+	Missense_Mutation	SNP	G	G	A	rs141205943		TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr1:12164444G>A	ENST00000263932.2	+	4	499	c.277G>A	c.(277-279)Gtg>Atg	p.V93M	TNFRSF8_ENST00000417814.2_5'UTR	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	93		cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	AGACGACCTCGTGGAGAAGAC	0.592	1	124.0	100.0	108.0	1	12164444	2203	4300	6503	SO:0001583	missense	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949	"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E	1330892, 1310894	Standard	XM_006711049	Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.277G>A	1.37:g.12164444G>A	ENSP00000263932:p.Val93Met	B1AN79|B9EGD9|D3YTD8|Q6P4D9	ENST00000263932.2	37	CCDS144.1	.	.	.	.	.	.	.	.	.	.	.	16.19	3.053279	0.55218	2.27E-4	0.0	ENSG00000120949	ENST00000263932	D	0.92149	-2.98	4.92	4.92	0.64577	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.121291	0.36303	N	0.002670	D	0.95427	0.8515	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95108	0.8236	10	0.54805	T	0.06	-36.1039	14.3555	0.66735	0.0:0.0:1.0:0.0	.	93	P28908	TNR8_HUMAN	M	93	ENSP00000263932:V93M	ENSP00000263932:V93M	V	+	1	0	TNFRSF8	12087031	1.000000	0.71417	0.977000	0.42913	0.304000	0.27724	4.870000	0.63035	2.665000	0.90641	0.650000	0.86243	GTG	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		51.269975	0	-23	72	0	0	1	0		17	51.294285	19	0.472222
RYR2	6262	broad.mit.edu	hg19	1	237791261	237791261	+	Silent	SNP	G	G	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr1:237791261G>T	ENST00000366574.2	+	41	6638	c.6321G>T	c.(6319-6321)acG>acT	p.T2107T	RYR2_ENST00000542537.1_Silent_p.T2091T|RYR2_ENST00000360064.6_Silent_p.T2105T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2107	4 X approximate repeats.	cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		AGACCTACACGATAAATGGTG	0.547	0	92.0	93.0	93.0	1	237791261	2002	4144	6146	SO:0001819	synonymous_variant	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626	"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2	2380170, 8406504, 11159936	Standard	NM_001035	Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6321G>T	1.37:g.237791261G>T		Q15411|Q546N8|Q5T3P2	ENST00000366574.2	37	CCDS55691.1																																																																																			RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		40.070863	1	0	43	0	7.03913e-09	1	7.45319e-09	NM_001035	13	40.187047	17	0.433333
SACS	26278	broad.mit.edu	hg19	13	23913291	23913291	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr13:23913291C>T	ENST00000382298.3	-	10	5312	c.4724G>A	c.(4723-4725)cGg>cAg	p.R1575Q	SACS_ENST00000402364.1_Missense_Mutation_p.R825Q|SACS_ENST00000382292.3_Missense_Mutation_p.R1575Q	NM_014363.4	NP_055178.3	Q9NZJ4	SACS_HUMAN	spastic ataxia of Charlevoix-Saguenay (sacsin)	1575		cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	CATGAATTCCCGACTCATAAT	0.338	0	88.0	86.0	87.0	13	23913291	2203	4298	6501	SO:0001583	missense	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835	"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""		10610707, 15057823, 21726565	Standard	NM_001278055	Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4724G>A	13.37:g.23913291C>T	ENSP00000371729:p.Arg1575Gln	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045175	0.75846	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87809	-2.3;-2.3;-2.3	6.16	6.16	0.99307	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.91233	0.7237	L	0.53249	1.67	0.50467	D	0.999873	D	0.65815	0.995	P	0.58520	0.84	D	0.89566	0.3810	10	0.45353	T	0.12	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1575	Q9NZJ4	SACS_HUMAN	Q	1575;825;1575	ENSP00000371729:R1575Q;ENSP00000385844:R825Q;ENSP00000371735:R1575Q	ENSP00000371729:R1575Q	R	-	2	0	SACS	22811291	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	CGG	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3		-3.416873	0	-4	91	0	0	1	0	NM_014363	3	6.705284	47	0.060000
NDN	4692	broad.mit.edu	hg19	15	23932001	23932001	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr15:23932001G>T	ENST00000331837.4	-	1	449	c.364C>A	c.(364-366)Cca>Aca	p.P122T		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	122	MAGE.	negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding	breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)	ACCATGTCTGGAAACCAGATG	0.622	0	90.0	84.0	86.0	15	23932001	2203	4300	6503	SO:0001583	missense	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636		7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""		9302265	Standard	NM_002487	Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.364C>A	15.37:g.23932001G>T	ENSP00000332643:p.Pro122Thr	B2R6Z5	ENST00000331837.4	37	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	G	7.935	0.741565	0.15642	.	.	ENSG00000182636	ENST00000331837	T	0.03920	3.76	3.7	2.66	0.31614	.	0.061993	0.64402	D	0.000006	T	0.02455	0.0075	N	0.03154	-0.405	0.30090	N	0.808422	B	0.25904	0.137	B	0.31290	0.127	T	0.23154	-1.0196	10	0.45353	T	0.12	.	7.6073	0.28110	0.0:0.0:0.7466:0.2533	.	122	Q99608	NECD_HUMAN	T	122	ENSP00000332643:P122T	ENSP00000332643:P122T	P	-	1	0	NDN	21483094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.825000	0.39081	1.999000	0.58509	0.655000	0.94253	CCA	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2		7.938849	1	-66	145	0	2.27111e-07	1	2.336e-07	NM_002487	11	25.778952	100	0.099099
SLC27A6	28965	broad.mit.edu	hg19	5	128302199	128302199	+	Silent	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr5:128302199C>T	ENST00000262462.4	+	1	1379	c.369C>T	c.(367-369)ttC>ttT	p.F123F	SLC27A6_ENST00000506176.1_Silent_p.F123F|SLC27A6_ENST00000395266.1_Silent_p.F123F			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	123		long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	ACGTGTGGTTCGGCCTCGCCA	0.592	0	79.0	59.0	65.0	5	128302199	2203	4300	6503	SO:0001819	synonymous_variant	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396	"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196			12556534, 10479480	Standard	XM_005271967	Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.369C>T	5.37:g.128302199C>T		Q6IAM5|Q7Z6E6|Q86YF6	ENST00000262462.4	37	CCDS4145.1																																																																																			SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1		33.825504	0	-3	22	0	0	1	0	NM_014031	11	33.861312	13	0.458333
RPS6KC1	26750	broad.mit.edu	hg19	1	213415244	213415244	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr1:213415244G>T	ENST00000366960.3	+	11	2575	c.2425G>T	c.(2425-2427)Gta>Tta	p.V809L	RPS6KC1_ENST00000543470.1_Missense_Mutation_p.V597L|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.V797L|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543354.1_Missense_Mutation_p.V512L	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	809	Protein kinase 2.	cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	TGAGTCAGCAGTAACTGCAAA	0.393	0	125.0	127.0	127.0	1	213415244	2203	4300	6503	SO:0001583	missense	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643		10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""		10552933	Standard	XM_005273095	Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366959.3:c.2389G>T	1.37:g.213415244G>T	ENSP00000355926:p.Val797Leu	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	ENST00000366959.3	37	CCDS44317.1	.	.	.	.	.	.	.	.	.	.	G	0.207	-1.039505	0.02013	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.39056	1.47;1.49;1.5;1.1	5.63	1.23	0.21249	Protein kinase, catalytic domain (1);	1.366050	0.04548	N	0.389286	T	0.30355	0.0762	L	0.36672	1.1	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.19128	-1.0315	10	0.35671	T	0.21	-24.3873	1.1846	0.01852	0.197:0.1561:0.3853:0.2615	.	597;809;797	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	L	597;809;797;512	ENSP00000442306:V597L;ENSP00000355927:V809L;ENSP00000355926:V797L;ENSP00000439282:V512L	ENSP00000355926:V797L	V	+	1	0	RPS6KC1	211481867	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	-0.165000	0.09968	0.259000	0.21709	0.655000	0.94253	GTA	RPS6KC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089691.1		116.171916	1	-9	115	0	5.43694e-19	1	5.9312e-19	NM_012424	37	116.171916	37	0.500000
EIF1AX	1964	broad.mit.edu	hg19	X	20156731	20156731	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chrX:20156731C>T	ENST00000379607.5	-	2	229	c.26G>A	c.(25-27)gGt>gAt	p.G9D	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	9			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					TCTGTTTTTACCTCCTTTACC	0.313	0	143.0	133.0	136.0	X	20156731	2203	4300	6503	SO:0001583	missense	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.26G>A	X.37:g.20156731C>T	ENSP00000368927:p.Gly9Asp	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618536	0.66787	.	.	ENSG00000173674	ENST00000379607	T	0.48201	0.82	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.79021	0.4376	H	0.96301	3.8	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.86715	0.1938	9	0.87932	D	0	-11.9247	17.661	0.88193	0.0:1.0:0.0:0.0	.	9	P47813	IF1AX_HUMAN	D	9	ENSP00000368927:G9D	ENSP00000368927:G9D	G	-	2	0	EIF1AX	20066652	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGT	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		77.401855	0	-23	152	0	0	1	0		24	77.445234	21	0.533333
KRTAP4-4	84616	broad.mit.edu	hg19	17	39316785	39316785	+	Silent	SNP	G	G	A			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr17:39316785G>A	ENST00000390661.3	-	1	198	c.159C>T	c.(157-159)acC>acT	p.T53T		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	53	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		keratin filament		kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)		TGCAGCAGGTGGTCTGGCAGC	0.672	0	46.0	54.0	51.0	17	39316785	2201	4298	6499	SO:0001819	synonymous_variant	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396	"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13	11279113	Standard	NM_032524	Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.159C>T	17.37:g.39316785G>A		Q9BYU7	ENST00000390661.3	37	CCDS11383.1																																																																																			KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1		35.393988	0	17	75	0	0	1	0		12	35.656306	18	0.400000
SF3B1	23451	broad.mit.edu	hg19	2	198267370	198267370	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr2:198267370T>G	ENST00000335508.6	-	14	2078	c.1987A>C	c.(1987-1989)Act>Cct	p.T663P		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		TTAATACCAGTGTGTCTCGCT	0.418	0	122.0	121.0	122.0	2	198267370	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1987A>C	2.37:g.198267370T>G	ENSP00000335321:p.Thr663Pro	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775956	0.90195	.	.	ENSG00000115524	ENST00000335508	T	0.66638	-0.22	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88032	0.6328	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92028	0.5631	10	0.87932	D	0	.	15.938	0.79729	0.0:0.0:0.0:1.0	.	663	O75533	SF3B1_HUMAN	P	663	ENSP00000335321:T663P	ENSP00000335321:T663P	T	-	1	0	SF3B1	197975615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.877000	0.87225	2.167000	0.68274	0.459000	0.35465	ACT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		53.169048	0	-11	54	0	0	1	0		17	53.429583	24	0.414634
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		134.968138	0	-24	88	0	0	1	0	NM_002072	41	134.978597	43	0.488095
RGL1	23179	broad.mit.edu	hg19	1	183885710	183885710	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr1:183885710T>C	ENST00000304685.4	+	17	2433	c.1984T>C	c.(1984-1986)Tct>Cct	p.S662P	RGL1_ENST00000360851.3_Missense_Mutation_p.S627P|RGL1_ENST00000539189.1_Missense_Mutation_p.S598P|RGL1_ENST00000536277.1_Missense_Mutation_p.S625P	NM_015149.3	NP_055964.3	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1		Ras-associating.	cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity	breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51					CCACAAGCGCTCTGTCTCGGT	0.493	0	203.0	187.0	193.0	1	183885710	2203	4300	6503	SO:0001583	missense	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344		30281	protein-coding gene	gene with protein product		605667			10760592, 10231032	Standard	XM_005245010	Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000304685.4:c.1984T>C	1.37:g.183885710T>C	ENSP00000303192:p.Ser662Pro	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	ENST00000304685.4	37	CCDS1359.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.905457	0.92107	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	T;T;T;T;T	0.54675	0.61;0.61;0.64;0.63;0.56	5.43	5.43	0.79202	.	0.210963	0.44902	D	0.000408	T	0.66509	0.2796	L	0.60455	1.87	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.994;0.994;0.994	D;P;P;P	0.65010	0.931;0.855;0.855;0.855	T	0.65274	-0.6208	10	0.36615	T	0.2	.	15.1614	0.72788	0.0:0.0:0.0:1.0	.	598;625;627;662	F5H6U6;B7Z2W5;Q9NZL6;Q5SXQ6	.;.;RGL1_HUMAN;.	P	662;662;625;627;598	ENSP00000303192:S662P;ENSP00000356501:S662P;ENSP00000438662:S625P;ENSP00000354097:S627P;ENSP00000437355:S598P	ENSP00000303192:S662P	S	+	1	0	RGL1	182152333	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.837000	0.62796	2.066000	0.61787	0.528000	0.53228	TCT	RGL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085481.3		-6.722803	0	-6	107	0	0	1	0	NM_015149	3	6.717506	59	0.048387
PNPLA7	375775	broad.mit.edu	hg19	9	140374845	140374845	+	Silent	SNP	T	T	C			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr9:140374845T>C	ENST00000406427.1	-	23	2835	c.2499A>G	c.(2497-2499)acA>acG	p.T833T	PNPLA7_ENST00000277531.4_Silent_p.T808T|PNPLA7_ENST00000371457.1_Silent_p.T414T	NM_001098537.1	NP_001092007.1	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	808		lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity	breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)	GGGTCCAGGGTGTGAGCGTGC	0.677	0	69.0	53.0	58.0	9	140374845	2203	4300	6503	SO:0001819	synonymous_variant	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653	"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111	16799181, 12640454, 19029121	Standard	XM_005266082	Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2424A>G	9.37:g.140374845T>C		B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	ENST00000277531.4	37	CCDS7045.1																																																																																			PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1		43.151073	0	-21	21	0	0	1	0	NM_152286	15	43.156091	14	0.517241
SLC39A7	7922	broad.mit.edu	hg19	6	33169207	33169208	+	Frame_Shift_Ins	INS	-	-	T			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr6:33169207_33169208insT	ENST00000374677.3	+	1	558_559	c.185_186insT	c.(184-189)catggcfs	p.G63fs	SLC39A7_ENST00000374675.3_Frame_Shift_Ins_p.G63fs	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	63	His-rich.		endoplasmic reticulum membrane|integral to membrane|membrane fraction	protein binding|zinc ion transmembrane transporter activity	NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18					AGCCATGCCCATGGCCATGGCC	0.559	1									SO:0001589	frameshift_variant	AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473	"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4	8812499, 1855816, 19246244, 15705588	Standard	NM_006979	Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.186dupT	6.37:g.33169208_33169208dupT	ENSP00000363809:p.Gly63fs	B0UXF6|Q5STP8|Q9UIQ0	ENST00000374677.3	37	CCDS43453.1																																																																																			SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076499.2	.	.		-4	50					NM_006979	32		32	0.50
AIM1	202	broad.mit.edu	hg19	6	106960619	106960619	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr6:106960619delA	ENST00000369066.3	+	1	890	c.403delA	c.(403-405)aagfs	p.K135fs		NM_001624.2	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	135				sugar binding	breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	GTCCCCACCCAAGAGGGTGCC	0.756	0	4.0	6.0	5.0	6	106960619	1924	3973	5897	SO:0001589	frameshift_variant	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297		356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4	1680551, 12693952	Standard	NM_001624	Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.403delA	6.37:g.106960619delA	ENSP00000358062:p.Lys135fs	Q6P2P0|Q9BTM3	ENST00000369066.3	37	CCDS34506.1																																																																																			AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1	.	.		-3	6						2		4	0.33
TYRP1	7306	broad.mit.edu	hg19	9	12695537	12695541	+	Frame_Shift_Del	DEL	AAGTA	AAGTA	-			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chr9:12695537_12695541delAAGTA	ENST00000388918.5	+	3	537_541	c.408_412delAAGTA	c.(406-414)ttaagtaaafs	p.SK137fs	TYRP1_ENST00000381137.2_5'UTR	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	137		melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity	NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)	TTCTGGACTTAAGTAAAGAAGAAAA	0.429	0									SO:0001589	frameshift_variant	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165		12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2	9434945	Standard	NM_000550	Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.408_412delAAGTA	9.37:g.12695537_12695541delAAGTA	ENSP00000373570:p.Ser137fs	P78468|P78469|Q13721|Q15679	ENST00000388918.5	37	CCDS34990.1																																																																																			TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	.	.		0	77					NM_000550	13		76	0.15
RENBP	5973	broad.mit.edu	hg19	X	153207074	153207074	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V4-A9EC-01A-11D-A39W-08	TCGA-V4-A9EC-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	97bf744b-75e3-448c-a19b-1ffcff0bd095	10e564b2-59b4-4c19-9434-386d5516eb05	g.chrX:153207074delG	ENST00000393700.3	-	8	882	c.802delC	c.(802-804)cgtfs	p.R268fs	RENBP_ENST00000412763.1_Frame_Shift_Del_p.S240fs|RENBP_ENST00000369997.3_Frame_Shift_Del_p.R254fs	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	268		mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				ATGCAATGACGGAGCAGAAAC	0.637	0	68.0	61.0	63.0	X	153207074	2203	4300	6503	SO:0001589	frameshift_variant		CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032		9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""		1618798	Standard	NM_002910	Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.802delC	X.37:g.153207074delG	ENSP00000377303:p.Arg268fs	B4DNZ3|Q96BI6	ENST00000393700.3	37	CCDS14738.2																																																																																			RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3	.	.		-31	75					NM_002910	21		46	0.31
