Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
ZNF157	7712	broad.mit.edu	hg19	X	47272125	47272125	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chrX:47272125T>C	ENST00000377073.3	+	4	739	c.653T>C	c.(652-654)tTt>tCt	p.F218S		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	218		negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11					GAGAGGCCCTTTGAATGTAAT	0.438	0	64.0	58.0	60.0	X	47272125	2203	4300	6503	SO:0001583	missense	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117	"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""		8586441	Standard	NM_003446	Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.653T>C	X.37:g.47272125T>C	ENSP00000366273:p.Phe218Ser	Q96LE9	ENST00000377073.3	37	CCDS14278.1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.298904	0.40694	.	.	ENSG00000147117	ENST00000377073	T	0.24908	1.83	2.87	-0.686	0.11324	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37320	0.0999	M	0.89353	3.025	0.18873	N	0.999981	P	0.49307	0.922	P	0.46825	0.528	T	0.29792	-1.0000	9	0.87932	D	0	.	6.3279	0.21255	0.4938:0.0:0.0:0.5062	.	218	P51786	ZN157_HUMAN	S	218	ENSP00000366273:F218S	ENSP00000366273:F218S	F	+	2	0	ZNF157	47157069	0.001000	0.12720	0.407000	0.26434	0.946000	0.59487	-0.161000	0.10026	-0.169000	0.10834	0.430000	0.28490	TTT	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1		104.531066	0	-26	20	0	0	1	0	NM_003446	29	109.810079	3	0.906250
IGKV1D-17	0	broad.mit.edu	hg19	2	90122037	90122037	+	RNA	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr2:90122037C>T	ENST00000483379.1	+	0	436																					CAAGGTTCAGCGGCAGTGGAT	0.473	0	113.0	107.0	109.0	2	90122037	1854	4084	5938			X63392		2p11.2	2012-02-08			ENSG00000242766	ENSG00000242766	"""Immunoglobulins / IGK locus"""	5749	other	immunoglobulin gene						Standard	NG_000833	Approved				OTTHUMG00000151610		2.37:g.90122037C>T			ENST00000483379.1	37																																																																																				IGKV1D-17-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323282.1		-14.555809	0	-124	100	0	0	1	0	NG_000833	6	13.171400	121	0.047244
EVC	2121	broad.mit.edu	hg19	4	5798849	5798849	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr4:5798849C>T	ENST00000382674.2	+	14	2171	c.1987C>T	c.(1987-1989)Cgg>Tgg	p.R663W	EVC_ENST00000515113.1_3'UTR|EVC_ENST00000264956.6_Missense_Mutation_p.R663W			P57679	EVC_HUMAN	Ellis van Creveld syndrome	663		muscle organ development	integral to membrane		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)			GACGCAGATGCGGCTATCGGG	0.677	0	43.0	42.0	42.0	4	5798849	2203	4300	6503	SO:0001583	missense	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840		3497	protein-coding gene	gene with protein product		604831			10700184	Standard	NM_153717	Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1987C>T	4.37:g.5798849C>T	ENSP00000264956:p.Arg663Trp		ENST00000264956.6	37	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598476	0.66332	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.62639	0.01;0.01	5.04	-3.25	0.05079	.	0.000000	0.85682	D	0.000000	T	0.74465	0.3720	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77768	-0.2464	10	0.87932	D	0	.	17.6432	0.88142	0.2058:0.7942:0.0:0.0	.	663	P57679	EVC_HUMAN	W	663	ENSP00000264956:R663W;ENSP00000372120:R663W	ENSP00000264956:R663W	R	+	1	2	EVC	5849750	0.512000	0.26186	0.982000	0.44146	0.656000	0.38851	0.084000	0.14891	-0.392000	0.07751	-0.293000	0.09583	CGG	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		-0.644183	0	-24	34	0	0	1	0		3	6.977666	38	0.073171
SLC26A9	115019	broad.mit.edu	hg19	1	205897160	205897160	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr1:205897160G>A	ENST00000367135.3	-	9	1084	c.971C>T	c.(970-972)tCg>tTg	p.S324L	SLC26A9_ENST00000367134.2_Missense_Mutation_p.S324L|SLC26A9_ENST00000340781.4_Missense_Mutation_p.S324L	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	324			integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity	NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)		GACCACAGGCGACACCGGGGT	0.627	0	48.0	44.0	45.0	1	205897160	2203	4300	6503	SO:0001583	missense	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502	"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""		11834742	Standard	NM_134325	Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.971C>T	1.37:g.205897160G>A	ENSP00000356103:p.Ser324Leu	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	G	8.094	0.775066	0.16051	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.91011	-2.77;-2.77;-2.77	5.08	-5.06	0.02946	Sulphate transporter (1);	0.940463	0.08820	N	0.888975	T	0.64238	0.2580	N	0.00395	-1.55	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.62978	-0.6739	10	0.05959	T	0.93	.	10.9397	0.47266	0.7013:0.1102:0.1885:0.0	.	324;324	Q7LBE3;B1AVM8	S26A9_HUMAN;.	L	324	ENSP00000341682:S324L;ENSP00000356103:S324L;ENSP00000356102:S324L	ENSP00000341682:S324L	S	-	2	0	SLC26A9	204163783	0.000000	0.05858	0.003000	0.11579	0.578000	0.36192	0.109000	0.15417	-1.365000	0.02158	-0.136000	0.14681	TCG	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1		36.297902	0	-6	24	0	0	1	0	NM_052934	12	36.331299	14	0.461538
TBC1D10A	83874	broad.mit.edu	hg19	22	30690061	30690061	+	Silent	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr22:30690061C>T	ENST00000215790.7	-	7	908	c.744G>A	c.(742-744)ctG>ctA	p.L248L	RP1-130H16.18_ENST00000447976.1_Silent_p.L122L|TBC1D10A_ENST00000403362.1_Silent_p.L160L|TBC1D10A_ENST00000403477.3_Silent_p.L255L	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	248	Rab-GAP TBC.		intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity	cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					CCTTCTGCAACAGCGAGAAAA	0.602	0	129.0	118.0	122.0	22	30690061	2203	4300	6503	SO:0001819	synonymous_variant	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992		23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10	11285285, 20404108	Standard	NM_001204240	Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000403477.3:c.765G>A	22.37:g.30690061C>T		B3KXT8|O76053|Q20WK7|Q543A2	ENST00000403477.3	37	CCDS56227.1																																																																																			TBC1D10A-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320551.1		76.643779	0	-20	71	0	0	1	0	NM_031937	26	76.739158	31	0.456140
SAP18	10284	hgsc.bcm.edu	hg19	13	21721323	21721323	+	Splice_Site	SNP	A	A	C			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf																										TCTTTCTTACAGAGTTAAGGA	0.403	0	81.0	82.0	82.0	13	21721323	2203	4300	6503	SO:0001630	splice_region_variant	U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459		10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""		9150135	Standard	NM_005870	Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000382533.4:c.363-1A>C	13.37:g.21721323A>C		B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	ENST00000382533.4	37	CCDS9295.2	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813283	0.50527	.	.	ENSG00000150459	ENST00000382533;ENST00000450573	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8228	0.57702	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SAP18	20619323	1.000000	0.71417	0.993000	0.49108	0.682000	0.39822	9.066000	0.93949	2.009000	0.58944	0.482000	0.46254	.	SAP18-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044109.3				0	78					NM_005870	8		96	
KIF13B	23303	broad.mit.edu	hg19	8	29024912	29024912	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr8:29024912C>T	ENST00000524189.1	-	11	1174	c.1136G>A	c.(1135-1137)cGg>cAg	p.R379Q	KIF13B_ENST00000521515.1_Missense_Mutation_p.R379Q	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	379		microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding	endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)	CAGCTGCTCCCGGAGTTTCTC	0.552	0	36.0	36.0	36.0	8	29024912	1954	4156	6110	SO:0001583	missense	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892	"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350			9734811, 10859302, 16864656	Standard	NM_015254	Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1136G>A	8.37:g.29024912C>T	ENSP00000427900:p.Arg379Gln	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769807	0.69992	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	T;T	0.78246	-1.16;-1.09	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.84288	0.5439	L	0.45581	1.43	0.80722	D	1	D;D;P	0.71674	0.997;0.998;0.946	D;P;P	0.70227	0.968;0.812;0.606	D	0.85911	0.1440	10	0.62326	D	0.03	.	17.4419	0.87567	0.0:1.0:0.0:0.0	.	365;379;379	C9JK41;Q9NQT8;F8VPJ2	.;KI13B_HUMAN;.	Q	379	ENSP00000427900:R379Q;ENSP00000429201:R379Q	ENSP00000429201:R379Q	R	-	2	0	KIF13B	29080831	0.992000	0.36948	0.990000	0.47175	0.982000	0.71751	3.163000	0.50763	2.347000	0.79759	0.561000	0.74099	CGG	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		95.209216	0	-3	26	0	0	1	0		28	95.585906	19	0.595745
GLA	2717	broad.mit.edu	hg19	X	100653465	100653465	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chrX:100653465T>C	ENST00000218516.3	-	6	913	c.892A>G	c.(892-894)Aat>Gat	p.N298D	RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	298		glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding	endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14					CGGAGGTCATTAGACATGAAT	0.493	0	140.0	136.0	138.0	X	100653465	2203	4300	6503	SO:0001583	missense	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393		4296	protein-coding gene	gene with protein product		300644				Standard	NM_000169	Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.892A>G	X.37:g.100653465T>C	ENSP00000218516:p.Asn298Asp	Q6LER7	ENST00000218516.3	37	CCDS14484.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.593064	0.86953	.	.	ENSG00000102393	ENST00000218516	D	0.99683	-6.39	5.91	4.73	0.59995	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.080242	0.85682	D	0.000000	D	0.99629	0.9864	.	.	.	0.46167	D	0.998904	D	0.89917	1.0	D	0.76071	0.987	D	0.98104	1.0416	9	0.56958	D	0.05	-14.5514	12.4053	0.55436	0.0:0.0:0.1384:0.8616	.	298	P06280	AGAL_HUMAN	D	298	ENSP00000218516:N298D	ENSP00000218516:N298D	N	-	1	0	GLA	100540121	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	8.040000	0.89188	0.826000	0.34661	0.486000	0.48141	AAT	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1		260.315726	0	-120	87	0	0	1	0		73	270.869964	12	0.858824
CHAT	1103	broad.mit.edu	hg19	10	50863168	50863168	+	Silent	SNP	C	C	T	rs145370753		TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr10:50863168C>T	ENST00000395562.2	+	13	1885	c.1416C>T	c.(1414-1416)taC>taT	p.Y472Y	CHAT_ENST00000339797.1_Silent_p.Y436Y|CHAT_ENST00000455728.2_Silent_p.Y436Y|CHAT_ENST00000337653.2_Silent_p.Y554Y|CHAT_ENST00000395559.2_Silent_p.Y436Y|CHAT_ENST00000351556.3_Silent_p.Y436Y	NM_001142933.1|NM_001142934.1	NP_001136405|NP_001136406.1	P28329	CLAT_HUMAN	choline O-acetyltransferase	554		neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity	central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	TGCCCACCTACGAGAGCGCGT	0.527	0	56.0	57.0	57.0	10	50863168	2203	4300	6503	SO:0001819	synonymous_variant	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""		1840566	Standard	NM_020984	Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1662C>T	10.37:g.50863168C>T		A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	ENST00000337653.2	37	CCDS7232.1																																																																																			CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1		81.682250	0	-35	55	0	0	1	0	NM_020549	28	82.549839	45	0.383562
OR51B6	390058	broad.mit.edu	hg19	11	5372973	5372973	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr11:5372973T>C	ENST00000380219.1	+	1	236	c.236T>C	c.(235-237)gTg>gCg	p.V79A	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	79		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	ATGCCCACAGTGCTAGGTGTT	0.478	0	133.0	122.0	126.0	11	5372973	2201	4297	6498	SO:0001583	missense		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239	"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product						Standard	NM_001004750	Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.236T>C	11.37:g.5372973T>C	ENSP00000369568:p.Val79Ala		ENST00000380219.1	37	CCDS31379.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066574	0.36470	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.03124	4.04	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000201	T	0.08492	0.0211	M	0.61703	1.905	0.31894	N	0.616853	P	0.35307	0.494	B	0.41202	0.35	T	0.00942	-1.1506	10	0.87932	D	0	.	13.9298	0.63989	0.0:0.0:0.0:1.0	.	79	Q9H340	O51B6_HUMAN	A	78;79	ENSP00000369568:V79A	ENSP00000369568:V79A	V	+	2	0	OR51B6	5329549	0.001000	0.12720	0.915000	0.36163	0.380000	0.30137	1.169000	0.31871	2.157000	0.67596	0.455000	0.32223	GTG	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1		142.962572	0	-18	75	0	0	1	0	NM_001004750	45	143.944684	27	0.625000
FBN1	2200	broad.mit.edu	hg19	15	48730066	48730066	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr15:48730066G>A	ENST00000316623.5	-	51	6667	c.6212C>T	c.(6211-6213)tCa>tTa	p.S2071L		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2071	TB 8.	heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	TTTGGGTGATGAACACTTTCC	0.493	0	165.0	146.0	153.0	15	48730066	2198	4296	6494	SO:0001583	missense	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147		3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS	10036187, 12525539	Standard	NM_000138	Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6212C>T	15.37:g.48730066G>A	ENSP00000325527:p.Ser2071Leu	B2RUU0|D2JYH6|Q15972|Q75N87	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214719	0.58452	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.93659	-3.26	5.65	5.65	0.86999	Matrix fibril-associated (3);TGF-beta binding (1);	0.437603	0.26213	N	0.025677	D	0.92361	0.7576	M	0.64260	1.97	0.80722	D	1	P	0.34462	0.454	B	0.34931	0.192	D	0.90027	0.4132	10	0.29301	T	0.29	.	19.5069	0.95121	0.0:0.0:1.0:0.0	.	2071	P35555	FBN1_HUMAN	L	2071;639;961	ENSP00000325527:S2071L	ENSP00000325527:S2071L	S	-	2	0	FBN1	46517358	1.000000	0.71417	0.935000	0.37517	0.900000	0.52787	3.258000	0.51507	2.941000	0.99782	0.655000	0.94253	TCA	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		92.972331	0	-6	132	0	0	1	0		32	94.852700	60	0.347826
RGS12	6002	broad.mit.edu	hg19	4	3419159	3419159	+	Silent	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr4:3419159G>A	ENST00000336727.3	+	9	3556	c.2652G>A	c.(2650-2652)ctG>ctA	p.L884L	RGS12_ENST00000306648.7_Silent_p.L282L|RGS12_ENST00000338806.4_Silent_p.L236L|RGS12_ENST00000538395.1_Silent_p.L226L|RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000344733.5_Silent_p.L884L|RGS12_ENST00000543385.1_3'UTR|RGS12_ENST00000382788.3_Silent_p.L884L	NM_002926.3	NP_002917.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	884			condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	ATGAAGAGCTGGGGGATGAGG	0.498	0	46.0	49.0	48.0	4	3419159	2203	4300	6503	SO:0001819	synonymous_variant	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788	"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""		9651375	Standard	NM_198229	Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2652G>A	4.37:g.3419159G>A		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	ENST00000344733.5	37	CCDS3366.1																																																																																			RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1		44.314335	0	-12	35	0	0	1	0	NM_002926	15	44.863360	25	0.375000
EFTUD1	79631	broad.mit.edu	hg19	15	82517553	82517553	+	Silent	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr15:82517553G>A	ENST00000268206.7	-	12	1413	c.1245C>T	c.(1243-1245)tcC>tcT	p.S415S	EFTUD1_ENST00000359445.3_Silent_p.S364S	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	415		mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity	cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32					CAAACATTTTGGAAACAAATA	0.378	0	64.0	60.0	61.0	15	82517553	1837	4092	5929	SO:0001819	synonymous_variant	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598		25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""				14702039	Standard	NM_024580	Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1245C>T	15.37:g.82517553G>A		A6NKY5|B7Z6I0|Q9H8Z6	ENST00000268206.7	37	CCDS42071.1																																																																																			EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1		43.743821	0	-19	40	0	0	1	0	NM_024580	14	43.975049	20	0.411765
RALYL	138046	broad.mit.edu	hg19	8	85799947	85799947	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr8:85799947C>T	ENST00000521268.1	+	8	1899	c.794C>T	c.(793-795)gCc>gTc	p.A265V	RALYL_ENST00000518566.1_Missense_Mutation_p.A254V|RALYL_ENST00000517638.1_Missense_Mutation_p.A278V|RALYL_ENST00000522455.1_Missense_Mutation_p.A265V|RALYL_ENST00000523850.1_Missense_Mutation_p.A192V|RALYL_ENST00000521376.1_Intron|RALYL_ENST00000521695.1_Missense_Mutation_p.A265V	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	265				identical protein binding|nucleotide binding|RNA binding	endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24					GGGCCAGATGCCGATGGAGAA	0.488	0	150.0	154.0	153.0	8	85799947	2007	4178	6185	SO:0001583	missense		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672	"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648			12688537	Standard	NM_001100391	Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.794C>T	8.37:g.85799947C>T	ENSP00000430367:p.Ala265Val	B3KTH2|G3V129|Q6ZW87|Q8N1C2	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.098964	0.37048	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850	T;T;T;T;T;T	0.14144	2.94;2.94;2.94;2.96;2.94;2.53	5.46	5.46	0.80206	.	0.295105	0.32068	N	0.006622	T	0.10035	0.0246	N	0.13043	0.29	0.80722	D	1	B;B;B;B	0.15930	0.003;0.015;0.015;0.008	B;B;B;B	0.16289	0.001;0.015;0.009;0.002	T	0.17501	-1.0367	10	0.35671	T	0.21	-8.5446	16.1174	0.81319	0.0:0.7977:0.2023:0.0	.	254;192;278;265	B3KT61;Q86SE5-2;G3V129;Q86SE5	.;.;.;RALYL_HUMAN	V	265;265;265;254;278;192	ENSP00000430394:A265V;ENSP00000428667:A265V;ENSP00000430367:A265V;ENSP00000430065:A254V;ENSP00000430128:A278V;ENSP00000428807:A192V	ENSP00000430128:A278V	A	+	2	0	RALYL	85962502	1.000000	0.71417	0.932000	0.37286	0.902000	0.53008	3.471000	0.53107	2.562000	0.86427	0.561000	0.74099	GCC	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		-49.980140	0	-20	78	0	0	1	0		4	6.374570	212	0.018519
ZNF79	7633	broad.mit.edu	hg19	9	130206861	130206861	+	Silent	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr9:130206861G>A	ENST00000342483.5	+	5	1288	c.882G>A	c.(880-882)caG>caA	p.Q294Q	ZNF79_ENST00000543471.1_Silent_p.Q270Q	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	294		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28					CTCTTGTTCAGCATCAGAGAA	0.542	0	123.0	107.0	112.0	9	130206861	2203	4300	6503	SO:0001819	synonymous_variant	X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152	"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""		8478004	Standard	NM_007135	Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.882G>A	9.37:g.130206861G>A		Q5VVW1|Q96NV1	ENST00000342483.5	37	CCDS6871.1																																																																																			ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1		-3.115855	0	-26	82	0	0	1	0	NM_007135	3	6.460650	45	0.062500
ZBTB7B	51043	broad.mit.edu	hg19	1	154987749	154987749	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr1:154987749C>T	ENST00000368426.3	+	3	750	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	ZBTB7B_ENST00000292176.2_Missense_Mutation_p.R205W|ZBTB7B_ENST00000417934.2_Missense_Mutation_p.R239W|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.R205W	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	205		cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)		CCGCAAGCCCCGGAAAGCTTT	0.647	0	34.0	40.0	38.0	1	154987749	2201	4297	6498	SO:0001583	missense	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685	"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67	9370309, 7937772	Standard	NR_045515	Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.613C>T	1.37:g.154987749C>T	ENSP00000357411:p.Arg205Trp	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	ENST00000368426.3	37	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227362	0.79576	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.10099	2.95;2.95;2.91;2.95	4.09	4.09	0.47781	.	0.477271	0.19272	N	0.118382	T	0.12178	0.0296	L	0.27053	0.805	0.47698	D	0.999497	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	T	0.03344	-1.1046	10	0.66056	D	0.02	.	11.6405	0.51230	0.0:1.0:0.0:0.0	.	205;205;239	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	W	205;205;239;205	ENSP00000438647:R205W;ENSP00000357411:R205W;ENSP00000406286:R239W;ENSP00000292176:R205W	ENSP00000292176:R205W	R	+	1	2	ZBTB7B	153254373	0.998000	0.40836	0.997000	0.53966	0.946000	0.59487	1.699000	0.37804	2.105000	0.64084	0.462000	0.41574	CGG	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1		38.262832	0	-28	44	0	0	1	0	NM_015872	13	39.348995	27	0.325000
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		111.080561	0	-43	69	0	0	1	0	NM_002072	33	111.211037	27	0.550000
PMPCA	23203	broad.mit.edu	hg19	9	139316331	139316331	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr9:139316331G>A	ENST00000371717.3	+	12	1320	c.1311G>A	c.(1309-1311)atG>atA	p.M437I	PMPCA_ENST00000399219.3_Missense_Mutation_p.M306I	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	437		proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding	endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)	TGCTCATGATGAACCTGGAAT	0.622	0	100.0	81.0	88.0	9	139316331	2203	4300	6503	SO:0001583	missense	D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688		18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E	8590280, 7788527	Standard	NM_015160	Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.1311G>A	9.37:g.139316331G>A	ENSP00000360782:p.Met437Ile	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	ENST00000371717.3	37	CCDS35180.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989561	0.93106	.	.	ENSG00000165688	ENST00000371717;ENST00000399219;ENST00000444897	T;T;T	0.32272	1.46;1.46;1.46	5.04	5.04	0.67666	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.65995	0.2745	M	0.92555	3.32	0.80722	D	1	P;D;D	0.89917	0.949;1.0;1.0	P;D;D	0.91635	0.636;0.999;0.999	T	0.75921	-0.3147	10	0.72032	D	0.01	.	17.3968	0.87448	0.0:0.0:1.0:0.0	.	306;437;437	B4DKL3;Q5SXM9;Q10713	.;.;MPPA_HUMAN	I	437;306;145	ENSP00000360782:M437I;ENSP00000416702:M306I;ENSP00000408393:M145I	ENSP00000360782:M437I	M	+	3	0	PMPCA	138436152	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.474000	0.97718	2.332000	0.79248	0.655000	0.94253	ATG	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1		82.096152	0	-25	36	0	0	1	0	NM_015160	25	82.652824	15	0.625000
FBN1	2200	broad.mit.edu	hg19	15	48730067	48730067	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr15:48730067A>G	ENST00000316623.5	-	51	6666	c.6211T>C	c.(6211-6213)Tca>Cca	p.S2071P		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2071	TB 8.	heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	TTGGGTGATGAACACTTTCCT	0.493	0	166.0	147.0	154.0	15	48730067	2198	4296	6494	SO:0001583	missense	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147		3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS	10036187, 12525539	Standard	NM_000138	Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6211T>C	15.37:g.48730067A>G	ENSP00000325527:p.Ser2071Pro	B2RUU0|D2JYH6|Q15972|Q75N87	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760190	0.69763	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.93712	-3.27	5.52	4.39	0.52855	Matrix fibril-associated (3);TGF-beta binding (1);	0.437603	0.26213	N	0.025677	D	0.93413	0.7899	M	0.80982	2.52	0.80722	D	1	P	0.47191	0.891	P	0.48368	0.575	D	0.91847	0.5488	10	0.51188	T	0.08	.	6.5568	0.22464	0.7897:0.0:0.0732:0.1371	.	2071	P35555	FBN1_HUMAN	P	2071;639;961	ENSP00000325527:S2071P	ENSP00000325527:S2071P	S	-	1	0	FBN1	46517359	1.000000	0.71417	0.956000	0.39512	0.893000	0.52053	3.053000	0.49901	1.101000	0.41535	0.460000	0.39030	TCA	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		101.973891	0	-6	129	0	0	1	0		32	103.969771	61	0.344086
IGKV1-17	0	broad.mit.edu	hg19	2	89416929	89416929	+	RNA	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr2:89416929G>A	ENST00000490686.1	-	0	281																					ATCCACTGCCGCTGAACCTTG	0.483	0	45.0	63.0	57.0	2	89416929	1787	4047	5834			X72808		2p11.2	2012-02-08			ENSG00000240382	ENSG00000240382	"""Immunoglobulins / IGK locus"""	5733	other	immunoglobulin gene						Standard	NG_000834	Approved	IGKV117, A30			OTTHUMG00000151650		2.37:g.89416929G>A			ENST00000490686.1	37																																																																																				IGKV1-17-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323399.1		-18.048383	0	-78	97	0	0	1	0	NG_000834	4	6.457720	102	0.037736
MTNR1B	4544	broad.mit.edu	hg19	11	92703062	92703062	+	Silent	SNP	C	C	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr11:92703062C>A	ENST00000257068.2	+	1	177	c.171C>A	c.(169-171)ggC>ggA	p.G57G		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	57		G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity	central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			ACGTCGTGGGCAACCTCCTGG	0.682	0	35.0	28.0	31.0	11	92703062	2200	4296	6496	SO:0001819	synonymous_variant	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640	"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804				Standard	NM_005959	Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.171C>A	11.37:g.92703062C>A			ENST00000257068.2	37	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	C	6.963	0.547606	0.13312	.	.	ENSG00000134640	ENST00000528076	.	.	.	4.57	1.55	0.23275	.	.	.	.	.	T	0.53433	0.1796	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39702	-0.9601	4	.	.	.	-21.4303	6.1095	0.20092	0.0:0.6661:0.1587:0.1752	.	.	.	.	E	38	.	.	A	+	2	0	MTNR1B	92342710	0.949000	0.32298	0.955000	0.39395	0.159000	0.22180	-0.034000	0.12225	0.029000	0.15352	-0.157000	0.13467	GCA	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		11.798134	1	-2	22	0	0.0215528	1	0.0215528		4	11.885539	6	0.400000
HDAC5	10014	broad.mit.edu	hg19	17	42157822	42157822	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr17:42157822C>G	ENST00000225983.6	-	22	3098	c.2775G>C	c.(2773-2775)tgG>tgC	p.W925C	HDAC5_ENST00000393622.2_Missense_Mutation_p.W924C|HDAC5_ENST00000586802.1_Missense_Mutation_p.W924C|HDAC5_ENST00000336057.5_Missense_Mutation_p.W839C			Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	924	Histone deacetylase.	B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)	CACCTCCTGTCCATGCCACGT	0.592	0	113.0	104.0	107.0	17	42157822	2203	4300	6503	SO:0001583	missense	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18						14068	protein-coding gene	gene with protein product		605315			10220385, 9610721	Standard	XM_005256905	Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000225983.6:c.2775G>C	17.37:g.42157822C>G	ENSP00000225983:p.Trp925Cys	C9JFV9|O60340|O60528|Q96DY4	ENST00000225983.6	37	CCDS32663.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051972	0.75960	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.70282	-0.47;-0.47;-0.47	4.82	4.82	0.62117	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.88474	0.6446	H	0.94771	3.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.996;0.998	D	0.91694	0.5368	10	0.87932	D	0	-10.2938	16.824	0.85926	0.0:1.0:0.0:0.0	.	839;925;924	Q9UQL6-2;Q9UQL6-3;Q9UQL6	.;.;HDAC5_HUMAN	C	925;924;839	ENSP00000225983:W925C;ENSP00000377244:W924C;ENSP00000337290:W839C	ENSP00000225983:W925C	W	-	3	0	HDAC5	39513348	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.978000	0.40598	2.522000	0.85027	0.655000	0.94253	TGG	HDAC5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457683.1		72.249308	0	-51	49	0	0	1	0	NM_001015053	22	72.268094	24	0.478261
SBK2	646643	broad.mit.edu	hg19	19	56041168	56041168	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr19:56041168G>A	ENST00000413299.1	-	4	1016	c.979C>T	c.(979-981)Cgc>Tgc	p.R327C	SBK2_ENST00000344158.3_Missense_Mutation_p.R327C	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	327	Protein kinase.			ATP binding|protein serine/threonine kinase activity	endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9					CTCCAGGGGCGCCCCAGGTGC	0.736	0	14.0	20.0	18.0	19	56041168	2034	4168	6202	SO:0001583	missense		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550		34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""			Standard	NM_001101401	Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.979C>T	19.37:g.56041168G>A	ENSP00000389015:p.Arg327Cys		ENST00000413299.1	37	CCDS42631.1	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742396	0.15642	.	.	ENSG00000187550	ENST00000413299;ENST00000344158	T;T	0.70869	-0.52;-0.52	3.85	3.85	0.44370	Protein kinase, catalytic domain (1);	1.839090	0.02871	U	0.131554	T	0.60117	0.2244	N	0.24115	0.695	0.09310	N	0.999999	B	0.17667	0.023	B	0.14023	0.01	T	0.47983	-0.9074	10	0.51188	T	0.08	-6.4477	7.4852	0.27427	0.1178:0.0:0.8822:0.0	.	327	P0C263	SBK2_HUMAN	C	327	ENSP00000389015:R327C;ENSP00000345044:R327C	ENSP00000345044:R327C	R	-	1	0	SBK2	60732980	0.000000	0.05858	0.439000	0.26833	0.155000	0.21991	0.340000	0.19892	2.165000	0.68154	0.467000	0.42956	CGC	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1		7.986491	0	-15	16	0	0	1	0	NM_001101401	4	10.079295	18	0.181818
DSTN	11034	broad.mit.edu	hg19	20	17581467	17581471	+	Frame_Shift_Del	DEL	AAGAA	AAGAA	-			TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr20:17581467_17581471delAAGAA	ENST00000246069.7	+	2	434_438	c.88_92delAAGAA	c.(88-93)aagaaafs	p.KK30fs	DSTN_ENST00000474024.1_Frame_Shift_Del_p.KK13fs	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)		ADF-H.	actin filament severing|actin polymerization or depolymerization		actin binding	endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15					AGAAGAAATCAAGAAAAGAAAGAAG	0.385	0									SO:0001589	frameshift_variant	S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868		15750	protein-coding gene	gene with protein product		609114			8399167, 2156828	Standard	NM_006870	Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.88_92delAAGAA	20.37:g.17581472_17581476delAAGAA	ENSP00000246069:p.Lys30fs	B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	ENST00000246069.7	37	CCDS13127.1																																																																																			DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	.	.		-28	31					NM_001011546	19		50	0.28
BAP1	8314	broad.mit.edu	hg19	3	52441415	52441535	+	Splice_Site	DEL	CTGGCATGGCTATTATGGGCCTTGGCCAACTCCGGGGCATTGCCAATCGCATATCCTTTGCTCTACGGGGAAGAAAATAAGGCCGTATCAGAATAATTTCTCCTCAGGTAGGACTATGGGT	CTGGCATGGCTATTATGGGCCTTGGCCAACTCCGGGGCATTGCCAATCGCATATCCTTTGCTCTACGGGGAAGAAAATAAGGCCGTATCAGAATAATTTCTCCTCAGGTAGGACTATGGGT	-	rs67706685		TCGA-V4-A9EE-01A-11D-A39W-08	TCGA-V4-A9EE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	91ceaaa8-b551-4047-9045-f7d633dc0962	9d2fc8be-62b9-43d2-bc05-c055812f76cf	g.chr3:52441415_52441535delCTGGCATGGCTATTATGGGCCTTGGCCAACTCCGGGGCATTGCCAATCGCATATCCTTTGCTCTACGGGGAAGAAAATAAGGCCGTATCAGAATAATTTCTCCTCAGGTAGGACTATGGGT	ENST00000460680.1	-	6	847_908	c.376_437delACCCATAGTCCTACCTGAGGAGAAATTATTCTGATACGGCCTTATTTTCTTCCCCGTAGAGCAAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAATAGCCATGCCAG	c.(376-438)acccatagtcctacctgaggagaaattattctgatacggccttattttcttccccgtagagca>a	p.THSPT*GEIILIRPYFLPRRA126fs	BAP1_ENST00000296288.5_Splice_Site_p.THSPT*GEIILIRPYFLPRRA126fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.	anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	TCCCACACACCTGGCATGGCTATTATGGGCCTTGGCCAACTCCGGGGCATTGCCAATCGCATATCCTTTGCTCTACGGGGAAGAAAATAAGGCCGTATCAGAATAATTTCTCCTCAGGTAGGACTATGGGTGGAAGGCAAA	0.536	7									SO:0001630	splice_region_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.376-1ACCCATAGTCCTACCTGAGGAGAAATTATTCTGATACGGCCTTATTTTCTTCCCCGTAGAGCAAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAATAGCCATGCCAG>-	3:g.52441415_52441535delCTGGCATGGCTATTATGGGCCTTGGCCAACTCCGGGGCATTGCCAATCGCATATCCTTTGCTCTACGGGGAAGAAAATAAGGCCGTATCAGAATAATTTCTCCTCAGGTAGGACTATGGGT		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1		CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	3.247000e+01	1.676000e+01		-40	69						6		25	2.000000e-01
