Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
AADACL4	343066	broad.mit.edu	hg19	1	12711307	12711307	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr1:12711307C>T	ENST00000376221.1	+	2	334	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	112			integral to membrane	carboxylesterase activity	breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)	CTCCAGACCCCGGCGAGGCAT	0.572	0	57.0	57.0	57.0	1	12711307	2203	4300	6503	SO:0001583	missense		CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518		32038	protein-coding gene	gene with protein product						Standard	XM_006710608	Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.334C>T	1.37:g.12711307C>T	ENSP00000365395:p.Arg112Trp		ENST00000376221.1	37	CCDS30590.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.152062	0.38021	.	.	ENSG00000204518	ENST00000376221	T	0.60040	0.22	4.9	1.84	0.25277	.	0.076451	0.49916	U	0.000138	T	0.49253	0.1546	M	0.75085	2.285	0.09310	N	1	D	0.53619	0.961	B	0.40038	0.317	T	0.49283	-0.8956	10	0.48119	T	0.1	-18.1748	4.5334	0.12017	0.2898:0.5378:0.0:0.1725	.	112	Q5VUY2	ADCL4_HUMAN	W	112	ENSP00000365395:R112W	ENSP00000365395:R112W	R	+	1	2	AADACL4	12633894	0.000000	0.05858	0.005000	0.12908	0.917000	0.54804	-2.711000	0.00817	0.468000	0.27243	0.462000	0.41574	CGG	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1		42.140314	0	5	83	0	0	1	0	NM_001013630	14	42.822819	25	0.358974
BBX	56987	ucsc.edu	hg19	3	107520041	107520041	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc																										GGGGAGACGCGGAGCAGTACT	0.527	0	92.0	88.0	89.0	3	107520041	2203	4300	6503	SO:0001583	missense	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439		14422	protein-coding gene	gene with protein product	"""x 001 protein"""				11680820	Standard	NM_001142568	Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000402543.1:c.2501G>A	3.37:g.107520041G>A	ENSP00000385317:p.Arg834Gln	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	ENST00000402543.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.80|15.80	2.941703|2.941703	0.53079|0.53079	.|.	.|.	ENSG00000114439|ENSG00000114439	ENST00000416476|ENST00000415149;ENST00000402543;ENST00000325805;ENST00000406780;ENST00000458347	D|T;D;D;T	0.99245|0.97642	-5.62|1.55;-4.47;-4.46;1.55	6.02|6.02	5.14|5.14	0.70334|0.70334	.|.	.|0.354425	.|0.30028	.|N	.|0.010597	D|D	0.95965|0.95965	0.8686|0.8686	L|L	0.27053|0.27053	0.805|0.805	0.31493|0.31493	N|N	0.665777|0.665777	B|P;D	0.29508|0.76494	0.246|0.88;0.999	B|B;D	0.11329|0.71870	0.006|0.288;0.975	D|D	0.93134|0.93134	0.6535|0.6535	9|10	0.87932|0.62326	D|D	0|0.03	-6.7643|-6.7643	5.805|5.805	0.18434|0.18434	0.2493:0.0:0.7507:0.0|0.2493:0.0:0.7507:0.0	.|.	548|884;854	A2RRM7|Q8WY36;Q8WY36-2	.|BBX_HUMAN;.	R|Q	548|854;834;884;854;74	ENSP00000403860:G548R|ENSP00000408358:R854Q;ENSP00000385317:R834Q;ENSP00000319974:R884Q;ENSP00000385530:R854Q	ENSP00000403860:G548R|ENSP00000319974:R884Q	G|R	+|+	1|2	0|0	BBX|BBX	109002731|109002731	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.508000|0.508000	0.34012|0.34012	4.511000|4.511000	0.60462|0.60462	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GGA|CGG	BBX-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000317815.1				-26	22					NM_020235	4		17	
DNM1	1759	broad.mit.edu	hg19	9	131008775	131008775	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr9:131008775G>A	ENST00000341179.7	+	16	1866	c.1774G>A	c.(1774-1776)Gag>Aag	p.E592K	DNM1_ENST00000372923.3_Missense_Mutation_p.E592K|DNM1_ENST00000486160.1_Missense_Mutation_p.E592K|DNM1_ENST00000393594.3_Missense_Mutation_p.E592K|DNM1_ENST00000493925.1_3'UTR|DNM1_ENST00000475805.1_Missense_Mutation_p.E592K	NM_001005336.1	NP_001005336.1	Q05193	DYN1_HUMAN	dynamin 1	592	PH.	receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity	breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32					CTTTAACACGGAGCAGAGGTG	0.557	0	136.0	95.0	109.0	9	131008775	2203	4300	6503	SO:0001583	missense	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976	"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM	2144893, 9143509	Standard	XM_005251763	Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1774G>A	9.37:g.131008775G>A	ENSP00000362014:p.Glu592Lys	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	G	36	5.626414	0.96671	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	D;D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93;-3.93	4.71	4.71	0.59529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.249757	0.39407	N	0.001373	D	0.97059	0.9039	M	0.80982	2.52	0.80722	D	1	P;P	0.47484	0.896;0.873	P;P	0.55615	0.78;0.673	D	0.97059	0.9769	10	0.48119	T	0.1	-2.6415	17.8368	0.88700	0.0:0.0:1.0:0.0	.	592;592	Q05193;Q05193-3	DYN1_HUMAN;.	K	592;592;592;587;592;592;137	ENSP00000419225:E592K;ENSP00000345680:E592K;ENSP00000362014:E592K;ENSP00000377219:E592K;ENSP00000420045:E592K	ENSP00000345680:E592K	E	+	1	0	DNM1	130048596	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.476000	0.97823	2.436000	0.82500	0.498000	0.49722	GAG	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1		21.223471	0	-19	20	0	0	1	0	NM_004408	7	21.238002	8	0.466667
ABCA13	154664	broad.mit.edu	hg19	7	48311887	48311887	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr7:48311887A>T	ENST00000435803.1	+	17	2648	c.2624A>T	c.(2623-2625)cAg>cTg	p.Q875L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	875		transport	integral to membrane	ATP binding|ATPase activity	breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270					AACTTTTCCCAGTTGTTCCAT	0.313	0	107.0	106.0	107.0	7	48311887	1811	4073	5884	SO:0001583	missense	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869	"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807			12697998	Standard	NM_152701	Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2624A>T	7.37:g.48311887A>T	ENSP00000411096:p.Gln875Leu	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	9.081	0.999410	0.19121	.	.	ENSG00000179869	ENST00000435803	D	0.85629	-2.01	5.33	1.53	0.23141	.	0.536026	0.15692	N	0.249392	T	0.78000	0.4215	M	0.64997	1.995	0.09310	N	1	P	0.38922	0.651	B	0.32805	0.153	T	0.70324	-0.4903	10	0.87932	D	0	.	5.1346	0.14928	0.6893:0.1521:0.1586:0.0	.	875	Q86UQ4	ABCAD_HUMAN	L	875	ENSP00000411096:Q875L	ENSP00000411096:Q875L	Q	+	2	0	ABCA13	48282433	0.008000	0.16893	0.002000	0.10522	0.242000	0.25591	1.272000	0.33109	0.502000	0.28037	0.528000	0.53228	CAG	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2		97.807068	0	33	186	0	0	1	0	NM_152701	31	98.783777	50	0.382716
AGO2	27161	broad.mit.edu	hg19	8	141570580	141570580	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr8:141570580G>A	ENST00000220592.5	-	5	660	c.548C>T	c.(547-549)aCc>aTc	p.T183I	AGO2_ENST00000519980.1_Missense_Mutation_p.T183I	NM_012154.3	NP_036286.2			argonaute RISC catalytic component 2												TTCGGACGCGGTGAAGAAGGA	0.612	0	56.0	60.0	59.0	8	141570580	2203	4300	6503	SO:0001583	missense	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908	"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2	10534406, 12906857	Standard	NM_012154	Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.548C>T	8.37:g.141570580G>A	ENSP00000220592:p.Thr183Ile	Q8TCZ5|Q8WV58|Q96ID1	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427286	0.62733	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.10288	2.89;2.89	5.02	5.02	0.67125	Argonaute/Dicer protein, PAZ (1);Domain of unknown function DUF1785 (1);	0.000000	0.85682	D	0.000000	T	0.12305	0.0299	L	0.28649	0.875	0.80722	D	1	B;B	0.29805	0.257;0.069	B;B	0.33121	0.142;0.158	T	0.09907	-1.0653	10	0.87932	D	0	-14.5758	18.7056	0.91637	0.0:0.0:1.0:0.0	.	183;183	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	I	183	ENSP00000220592:T183I;ENSP00000430176:T183I	ENSP00000220592:T183I	T	-	2	0	EIF2C2	141639762	1.000000	0.71417	0.930000	0.37139	0.479000	0.33129	7.867000	0.87062	2.495000	0.84180	0.655000	0.94253	ACC	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		-3.717131	0	-13	46	0	0	1	0		3	6.405961	47	0.060000
ANKAR	150709	hgsc.bcm.edu	hg19	2	190569760	190569760	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc																										TCCAACACCTCTACACCTTGC	0.428	0	146.0	119.0	128.0	2	190569760	2203	4300	6503	SO:0001583	missense	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687	"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803			15110750	Standard	NM_144708	Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1720C>G	2.37:g.190569760C>G	ENSP00000427882:p.Leu574Val	Q3ZCS6|Q4G0M2|Q6ZU02	ENST00000520309.1	37	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035782	0.54896	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	5.63	3.84	0.44239	.	0.167527	0.28549	N	0.014944	T	0.81912	0.4923	M	0.93106	3.38	0.09310	N	0.999995	.	.	.	.	.	.	T	0.74833	-0.3530	8	0.59425	D	0.04	-11.0285	7.8037	0.29189	0.0:0.6885:0.0:0.3115	.	.	.	.	V	574;574;574;503;338	ENSP00000427882:L574V;ENSP00000313513:L574V;ENSP00000397243:L574V;ENSP00000393043:L503V;ENSP00000281412:L338V	ENSP00000281412:L338V	L	+	1	2	ANKAR	190278005	0.350000	0.24878	0.945000	0.38365	0.925000	0.55904	0.109000	0.15417	0.742000	0.32697	0.561000	0.74099	CTA	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3				43	136					NM_144708	6		142	
SPHKAP	80309	broad.mit.edu	hg19	2	228881555	228881555	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr2:228881555C>T	ENST00000392056.3	-	7	4061	c.4015G>A	c.(4015-4017)Ggc>Agc	p.G1339S	SPHKAP_ENST00000344657.5_Missense_Mutation_p.G1339S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1339			cytoplasm	protein binding	NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	GAGGGAGAGCCACCAGAAACA	0.512	0	100.0	88.0	92.0	2	228881555	2203	4300	6503	SO:0001583	missense		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820	"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646			12080051, 11214970	Standard	NM_030623	Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4015G>A	2.37:g.228881555C>T	ENSP00000375909:p.Gly1339Ser	Q68DA3|Q68DR8|Q9C0I5	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886879	0.51908	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12039	2.72;2.72	5.67	4.79	0.61399	.	0.323944	0.36703	N	0.002456	T	0.15998	0.0385	M	0.69823	2.125	0.09310	N	0.999997	B;B;B	0.32653	0.094;0.379;0.372	B;B;B	0.27076	0.024;0.03;0.076	T	0.12604	-1.0541	10	0.22706	T	0.39	.	13.5017	0.61459	0.0:0.9254:0.0:0.0746	.	370;1339;1339	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	S	1339	ENSP00000375909:G1339S;ENSP00000339886:G1339S	ENSP00000339886:G1339S	G	-	1	0	SPHKAP	228589799	0.612000	0.27000	0.002000	0.10522	0.014000	0.08584	2.320000	0.43797	1.401000	0.46761	0.467000	0.42956	GGC	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1		46.144963	0	-6	57	0	0	1	0	NM_030623	20	54.717606	81	0.198020
ANKAR	150709	hgsc.bcm.edu	hg19	2	190569770	190569770	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc																										CTACACCTTGCTGCACAGGCT	0.418	0	147.0	121.0	130.0	2	190569770	2203	4300	6503	SO:0001583	missense	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687	"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803			15110750	Standard	NM_144708	Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1730C>A	2.37:g.190569770C>A	ENSP00000427882:p.Ala577Asp	Q3ZCS6|Q4G0M2|Q6ZU02	ENST00000520309.1	37	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153498	0.78114	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	5.63	4.76	0.60689	.	0.243608	0.29185	N	0.012898	D	0.91297	0.7256	H	0.98664	4.295	0.47511	D	0.999441	.	.	.	.	.	.	D	0.93985	0.7261	8	0.87932	D	0	-8.3898	13.6348	0.62217	0.0:0.9242:0.0:0.0758	.	.	.	.	D	577;577;577;506;341	ENSP00000427882:A577D;ENSP00000313513:A577D;ENSP00000397243:A577D;ENSP00000393043:A506D;ENSP00000281412:A341D	ENSP00000281412:A341D	A	+	2	0	ANKAR	190278015	1.000000	0.71417	0.993000	0.49108	0.832000	0.47134	5.325000	0.65869	1.381000	0.46364	0.561000	0.74099	GCT	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3				28	137					NM_144708	8		148	
ANKAR	150709	broad.mit.edu	hg19	2	190569815	190569815	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr2:190569815C>G	ENST00000520309.1	+	8	1863	c.1775C>G	c.(1774-1776)tCc>tGc	p.S592C	ANKAR_ENST00000313581.4_Missense_Mutation_p.S592C|ANKAR_ENST00000281412.6_Missense_Mutation_p.S356C|ANKAR_ENST00000431575.2_Missense_Mutation_p.S521C|ANKAR_ENST00000438402.2_Missense_Mutation_p.S592C	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	592			integral to membrane	binding	breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)		CTACTGTGTTCCAAAGCTGAT	0.433	0	166.0	142.0	150.0	2	190569815	2203	4300	6503	SO:0001583	missense	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687	"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803			15110750	Standard	NM_144708	Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1775C>G	2.37:g.190569815C>G	ENSP00000427882:p.Ser592Cys	Q3ZCS6|Q4G0M2|Q6ZU02	ENST00000520309.1	37	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	C	5.850	0.341047	0.11069	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.63	-0.945	0.10388	.	0.484707	0.19558	N	0.111382	T	0.45915	0.1366	N	0.25380	0.74	0.09310	N	0.999997	.	.	.	.	.	.	T	0.38090	-0.9677	8	0.38643	T	0.18	-5.1425	6.9316	0.24444	0.3394:0.0693:0.0:0.5912	.	.	.	.	C	592;592;592;521;356	ENSP00000427882:S592C;ENSP00000313513:S592C;ENSP00000397243:S592C;ENSP00000393043:S521C;ENSP00000281412:S356C	ENSP00000281412:S356C	S	+	2	0	ANKAR	190278060	0.800000	0.28916	0.675000	0.29917	0.224000	0.24922	0.735000	0.26115	0.065000	0.16485	-1.683000	0.00735	TCC	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3		-13.091415	0	15	136	0	0	1	0	NM_144708	7	15.866295	129	0.051471
USP34	9736	broad.mit.edu	hg19	2	61433951	61433951	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr2:61433951A>G	ENST00000398571.2	-	71	9066	c.8990T>C	c.(8989-8991)cTt>cCt	p.L2997P		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2997		positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)		TATTGACAGAAGTTCTACTAA	0.358	0	74.0	70.0	71.0	2	61433951	1858	4102	5960	SO:0001583	missense	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464	"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""		12838346	Standard	NM_014709	Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8990T>C	2.37:g.61433951A>G	ENSP00000381577:p.Leu2997Pro	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813613	0.90790	.	.	ENSG00000115464	ENST00000263989;ENST00000398571	T	0.29142	1.58	5.82	5.82	0.92795	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45816	0.1361	L	0.55481	1.735	0.80722	D	1	D	0.58970	0.984	P	0.55161	0.77	T	0.43343	-0.9397	10	0.87932	D	0	.	16.19	0.81981	1.0:0.0:0.0:0.0	.	2997	Q70CQ2	UBP34_HUMAN	P	2845;2997	ENSP00000381577:L2997P	ENSP00000263989:L2845P	L	-	2	0	USP34	61287455	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.225000	0.72522	0.460000	0.39030	CTT	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		22.084617	0	-8	46	0	0	1	0		8	23.902432	24	0.250000
COL14A1	7373	broad.mit.edu	hg19	8	121237427	121237427	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr8:121237427A>G	ENST00000297848.3	+	15	2108	c.1838A>G	c.(1837-1839)gAg>gGg	p.E613G	COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.E613G|COL14A1_ENST00000247781.3_Missense_Mutation_p.E518G|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1	613	Fibronectin type-III 4.	cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		GGACAGTCAGAGCCTCTGACT	0.423	0	75.0	74.0	74.0	8	121237427	2203	4300	6503	SO:0001583	missense		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955	"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND	1716629, 9427527	Standard	NM_021110	Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1838A>G	8.37:g.121237427A>G	ENSP00000297848:p.Glu613Gly		ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.819041	0.50633	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.39	4.22	0.49857	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.133204	0.52532	D	0.000079	T	0.61974	0.2390	M	0.76328	2.33	0.80722	D	1	D;P	0.54397	0.966;0.879	P;P	0.57371	0.819;0.708	T	0.60271	-0.7296	10	0.14252	T	0.57	.	9.7997	0.40757	0.8168:0.0:0.0:0.1832	.	613;613	Q05707-2;Q05707	.;COEA1_HUMAN	G	613;613;518;426	ENSP00000311809:E613G;ENSP00000297848:E613G;ENSP00000247781:E518G;ENSP00000409461:E426G	ENSP00000247781:E518G	E	+	2	0	COL14A1	121306608	1.000000	0.71417	0.506000	0.27664	0.796000	0.44982	5.607000	0.67648	0.847000	0.35167	0.459000	0.35465	GAG	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2		84.160177	0	-15	78	0	0	1	0	NM_021110	29	86.546998	60	0.325843
FOCAD	54914	broad.mit.edu	hg19	9	20929514	20929514	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr9:20929514C>A	ENST00000380249.1	+	29	3600	c.3236C>A	c.(3235-3237)gCt>gAt	p.A1079D	FOCAD_ENST00000605086.1_Missense_Mutation_p.A515D|FOCAD_ENST00000338382.6_Missense_Mutation_p.A1079D	NM_017794.3	NP_060264.3	Q5VW36	K1797_HUMAN	focadhesin	1079			integral to membrane	binding							AAACCAAGTGCTGATGAGTCT	0.443	0	121.0	92.0	102.0	9	20929514	2203	4300	6503	SO:0001583	missense	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352		23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797	22427331	Standard	XM_006716794	Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3236C>A	9.37:g.20929514C>A	ENSP00000369599:p.Ala1079Asp	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	C	35	5.459661	0.96240	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.14640	2.49;2.49	6.16	6.16	0.99307	Armadillo-type fold (1);	0.048945	0.85682	D	0.000000	T	0.38427	0.1040	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	P	0.62560	0.904	T	0.02126	-1.1209	10	0.87932	D	0	-26.1172	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1079	Q5VW36	K1797_HUMAN	D	1079	ENSP00000369599:A1079D;ENSP00000344307:A1079D	ENSP00000344307:A1079D	A	+	2	0	KIAA1797	20919514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.271000	0.78506	2.937000	0.99478	0.650000	0.86243	GCT	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1		-3.215769	1	37	112	0	0.115264	1	0.115264	NM_017794	3	6.360778	45	0.062500
RPTN	126638	broad.mit.edu	hg19	1	152128319	152128319	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr1:152128319T>C	ENST00000316073.3	-	3	1320	c.1256A>G	c.(1255-1257)gAc>gGc	p.D419G		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	419	Gln-rich.		proteinaceous extracellular matrix	calcium ion binding	breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59					GCCTTGTCGGTCCATCTGACT	0.512	0	791.0	684.0	716.0	1	152128319	1568	3582	5150	SO:0001583	missense	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853	"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259			15854042	Standard	NM_001122965	Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1256A>G	1.37:g.152128319T>C	ENSP00000317895:p.Asp419Gly	B7ZBZ3	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	T	5.949	0.359144	0.11239	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.11063	2.81	4.12	-1.3	0.09259	.	.	.	.	.	T	0.01835	0.0058	L	0.52759	1.655	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48080	-0.9066	9	0.05721	T	0.95	.	4.3432	0.11120	0.0:0.2252:0.3305:0.4443	.	419	Q6XPR3	RPTN_HUMAN	G	419;74	ENSP00000317895:D419G	ENSP00000317895:D419G	D	-	2	0	RPTN	150394943	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.099000	0.15210	-0.129000	0.11620	0.323000	0.21402	GAC	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1		-100.123849	0	0	776	0	0	1	0	XM_371312	4	6.359135	382	0.010363
DNM1	1759	broad.mit.edu	hg19	9	131008684	131008684	+	Silent	SNP	G	G	A			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr9:131008684G>A	ENST00000341179.7	+	16	1775	c.1683G>A	c.(1681-1683)aaG>aaA	p.K561K	DNM1_ENST00000372923.3_Silent_p.K561K|DNM1_ENST00000486160.1_Silent_p.K561K|DNM1_ENST00000393594.3_Silent_p.K561K|DNM1_ENST00000493925.1_3'UTR|DNM1_ENST00000475805.1_Silent_p.K561K	NM_001005336.1	NP_001005336.1	Q05193	DYN1_HUMAN	dynamin 1	561	PH.	receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity	breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32					AGAAAGAGAAGAAATACATGC	0.542	0	167.0	128.0	141.0	9	131008684	2203	4300	6503	SO:0001819	synonymous_variant	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976	"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM	2144893, 9143509	Standard	XM_005251763	Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1683G>A	9.37:g.131008684G>A		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	ENST00000372923.3	37	CCDS6895.1																																																																																			DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1		35.627155	0	-36	34	0	0	1	0	NM_004408	11	35.730307	8	0.578947
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		62.420080	0	13	125	0	0	1	0	NM_002072	19	62.546628	24	0.441860
FTHL17	53940	broad.mit.edu	hg19	X	31089834	31089834	+	Silent	SNP	G	G	T			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chrX:31089834G>T	ENST00000359202.3	-	1	336	c.237C>A	c.(235-237)ggC>ggA	p.G79G		NM_031894.2	NP_114100.1	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	79	Ferritin-like diiron.	cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity	endometrium(2)|large_intestine(2)|liver(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	23					GGCAGATGTGGCCACCGCGCA	0.602	0	62.0	55.0	57.0	X	31089834	2202	4300	6502	SO:0001819	synonymous_variant	AF285592	CCDS14227.1	Xp21.2	2010-07-06			ENSG00000132446	ENSG00000132446		3987	protein-coding gene	gene with protein product	"""cancer/testis antigen 38"""	300308			11279525	Standard	NM_031894	Approved	CT38	uc004dcl.1	Q9BXU8	OTTHUMG00000021332	ENST00000359202.3:c.237C>A	X.37:g.31089834G>T		Q6NT24|Q6NTE2	ENST00000359202.3	37	CCDS14227.1																																																																																			FTHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056178.1		15.771475	1	-18	55	0	0.000157383	1	0.00017487	NM_031894	8	20.606672	39	0.170213
PNLIP	5406	broad.mit.edu	hg19	10	118314738	118314738	+	Missense_Mutation	SNP	G	G	A	rs149884015		TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr10:118314738G>A	ENST00000369221.2	+	7	648	c.620G>A	c.(619-621)cGa>cAa	p.R207Q		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	207		lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity	central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	GAATTAGTCCGATTGGACCCC	0.483	1	91.0	83.0	85.0	10	118314738	2203	4300	6503	SO:0001583	missense	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535		9155	protein-coding gene	gene with protein product		246600			1783385	Standard	NM_000936	Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.620G>A	10.37:g.118314738G>A	ENSP00000358223:p.Arg207Gln	Q5VSQ2	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834656	0.91036	.	.	ENSG00000175535	ENST00000369221	D	0.93133	-3.17	6.07	6.07	0.98685	Lipase, N-terminal (1);	0.000000	0.64402	D	0.000011	D	0.98024	0.9349	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98550	1.0636	10	0.87932	D	0	.	19.424	0.94734	0.0:0.0:1.0:0.0	.	207	P16233	LIPP_HUMAN	Q	207	ENSP00000358223:R207Q	ENSP00000358223:R207Q	R	+	2	0	PNLIP	118304728	1.000000	0.71417	0.998000	0.56505	0.521000	0.34408	8.029000	0.88807	2.890000	0.99128	0.585000	0.79938	CGA	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1		62.158166	0	-9	75	0	0	1	0	NM_000936	21	63.237185	38	0.355932
CACNA1B	774	broad.mit.edu	hg19	9	141014734	141014736	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr9:141014734_141014736delCAC	ENST00000277549.5	+	45	6299_6301	c.3730_3732delCAC	c.(3730-3732)cacdel	p.H1248del	CACNA1B_ENST00000371363.1_In_Frame_Del_p.H2052del|CACNA1B_ENST00000371355.4_In_Frame_Del_p.H2055del|CACNA1B_ENST00000277551.2_In_Frame_Del_p.H2054del|CACNA1B_ENST00000371357.1_In_Frame_Del_p.H2053del|CACNA1B_ENST00000371372.1_In_Frame_Del_p.H2054del			Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2054		membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	GGCGTCGTCGCACCACCACCACC	0.700	1									SO:0001651	inframe_deletion	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408	"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5	8825650, 16382099	Standard	NM_000718	Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6148_6150delCAC	9.37:g.141014743_141014745delCAC	ENSP00000360423:p.His2054del	B1AQK5	ENST00000371372.1	37	CCDS59522.1																																																																																			CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	.	.		-7	14					NM_000718	3		5	0.38
PCLO	27445	broad.mit.edu	hg19	7	82585204	82585204	+	Frame_Shift_Del	DEL	T	T	-			TCGA-V4-A9EK-01A-11D-A39W-08	TCGA-V4-A9EK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397a7be6-de7f-4ad3-94db-3d70a4deac6d	db3da402-fe98-494a-9b88-860c419545fc	g.chr7:82585204delT	ENST00000333891.9	-	5	5402	c.5065delA	c.(5065-5067)acafs	p.T1689fs	PCLO_ENST00000423517.2_Frame_Shift_Del_p.T1689fs	NM_033026.5	NP_149015.2	Q9Y6V0	PCLO_HUMAN	piccolo presynaptic cytomatrix protein			cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259					TACAAACTTGTTTTTTTCTGT	0.428	2	88.0	81.0	84.0	7	82585204	1856	4091	5947	SO:0001589	frameshift_variant	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472		13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""		8900486, 9628581	Standard	NM_014510	Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5065delA	7.37:g.82585204delT	ENSP00000334319:p.Thr1689fs		ENST00000333891.9	37	CCDS47630.1																																																																																			PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	.	.		0	53					NM_014510	7		13	0.35
