Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
NBN	4683	broad.mit.edu	hg19	8	90982757	90982757	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr8:90982757A>G	ENST00000265433.3	-	7	885	c.731T>C	c.(730-732)tTt>tCt	p.F244S	NBN_ENST00000409330.1_Missense_Mutation_p.F162S	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	244		cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding	autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)		CCCACCTCCAAAGACAACTGC	0.343	0	72.0	70.0	71.0	8	90982757	2203	4300	6503	SO:0001583	missense	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320		7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1	9590181, 9590180	Standard	XM_005250923	Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.731T>C	8.37:g.90982757A>G	ENSP00000265433:p.Phe244Ser	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	ENST00000265433.3	37	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256243	0.39896	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387;ENST00000519426;ENST00000517772	T;T;T;T	0.73681	0.29;0.25;-0.77;-0.49	5.6	5.6	0.85130	.	0.180545	0.52532	D	0.000070	T	0.70518	0.3233	L	0.39633	1.23	0.39461	D	0.967569	P;P	0.42357	0.777;0.777	B;B	0.43575	0.424;0.424	T	0.75800	-0.3190	10	0.72032	D	0.01	-24.069	14.0228	0.64568	1.0:0.0:0.0:0.0	.	244;244	A6H8Y5;O60934	.;NBN_HUMAN	S	244;162;244;156;162	ENSP00000265433:F244S;ENSP00000386924:F162S;ENSP00000430983:F156S;ENSP00000428717:F162S	ENSP00000265433:F244S	F	-	2	0	NBN	91051933	1.000000	0.71417	0.976000	0.42696	0.657000	0.38888	5.857000	0.69525	2.123000	0.65237	0.533000	0.62120	TTT	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3		50.307424	0	5	92	0	0	1	0	NM_001024688	21	60.970984	93	0.184211
HHAT	55733	broad.mit.edu	hg19	1	210536203	210536203	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr1:210536203A>T	ENST00000367010.1	+	3	326	c.99A>T	c.(97-99)gaA>gaT	p.E33D	HHAT_ENST00000537898.1_Missense_Mutation_p.E33D|HHAT_ENST00000261458.3_Missense_Mutation_p.E33D|HHAT_ENST00000391905.3_Missense_Mutation_p.E33D|HHAT_ENST00000545781.1_Intron|HHAT_ENST00000541565.1_Missense_Mutation_p.E33D|HHAT_ENST00000413764.2_Missense_Mutation_p.E33D|HHAT_ENST00000308852.6_Intron|HHAT_ENST00000545154.1_Missense_Mutation_p.E34D	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	33		multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding	breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)	CAGAACACGAAGAGGAGCTGG	0.398	0	87.0	85.0	86.0	1	210536203	2203	4300	6503	SO:0001583	missense	AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392		18270	protein-coding gene	gene with protein product		605743			11160356	Standard	NM_001170587	Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.99A>T	1.37:g.210536203A>T	ENSP00000355977:p.Glu33Asp	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	ENST00000367010.1	37	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	a	17.06	3.292996	0.60086	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000261458;ENST00000367010	T;T;T;T;T;T;T	0.50548	2.2;0.74;2.08;2.09;2.19;2.2;2.2	4.61	4.61	0.57282	.	0.049418	0.85682	D	0.000000	T	0.59514	0.2199	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.61697	0.99;0.984;0.984;0.976	D;D;D;P	0.70935	0.971;0.956;0.956;0.683	T	0.56056	-0.8042	10	0.16896	T	0.51	-15.0535	10.3285	0.43807	1.0:0.0:0.0:0.0	.	34;33;33;33	F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;HHAT_HUMAN	D	33;33;34;33;33;33;33	ENSP00000416845:E33D;ENSP00000444995:E33D;ENSP00000438468:E34D;ENSP00000442625:E33D;ENSP00000375773:E33D;ENSP00000261458:E33D;ENSP00000355977:E33D	ENSP00000261458:E33D	E	+	3	2	HHAT	208602826	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	3.855000	0.55957	1.933000	0.56026	0.460000	0.39030	GAA	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1		61.770346	0	4	50	0	0	1	0	NM_018194	24	65.541697	62	0.279070
CNOT6L	246175	ucsc.edu	hg19	4	78694260	78694260	+	Silent	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990																										TTTGTAGCTGGAAGAGCCGAC	0.308	0	45.0	45.0	45.0	4	78694260	1794	4069	5863	SO:0001819	synonymous_variant	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767		18042	protein-coding gene	gene with protein product						Standard	NM_144571	Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.375C>T	4.37:g.78694260G>A		Q9UF92	ENST00000504123.1	37		.	.	.	.	.	.	.	.	.	.	G	9.612	1.131520	0.21041	.	.	ENSG00000138767	ENST00000515506	.	.	.	4.78	3.92	0.45320	.	.	.	.	.	T	0.64170	0.2574	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63422	-0.6641	4	.	.	.	-4.4282	13.2156	0.59859	0.0786:0.0:0.9214:0.0	.	.	.	.	S	154	.	.	P	-	1	0	CNOT6L	78913284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.943000	0.49026	2.190000	0.69967	0.555000	0.69702	CCA	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1				2	24						4		18	
E2F2	1870	broad.mit.edu	hg19	1	23857136	23857136	+	Silent	SNP	C	C	T			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr1:23857136C>T	ENST00000361729.2	-	1	576	c.150G>A	c.(148-150)ccG>ccA	p.P50P		NM_004091.3	NP_004082.1	Q14209	E2F2_HUMAN	E2F transcription factor 2	50		G1 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	endometrium(4)|large_intestine(2)|lung(1)|ovary(3)|skin(2)|urinary_tract(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)	GCGCCGTCTGCGGGTACAGCG	0.711	0	18.0	24.0	22.0	1	23857136	2200	4292	6492	SO:0001819	synonymous_variant	L22846	CCDS236.1	1p36	2008-02-05			ENSG00000007968	ENSG00000007968		3114	protein-coding gene	gene with protein product		600426			8246995, 8246996	Standard	NM_004091	Approved	E2F-2	uc001bhe.2	Q14209	OTTHUMG00000003223	ENST00000361729.2:c.150G>A	1.37:g.23857136C>T		B2R9W1|Q7Z6H1	ENST00000361729.2	37	CCDS236.1																																																																																			E2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008885.1		4.609941	0	-4	13	0	0	1	0	NM_004091	3	7.905397	21	0.125000
MARCH6	10299	broad.mit.edu	hg19	5	10426521	10426521	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr5:10426521G>A	ENST00000274140.5	+	24	2525	c.2393G>A	c.(2392-2394)cGg>cAg	p.R798Q	MARCH6_ENST00000510792.1_Missense_Mutation_p.R496Q|MARCH6_ENST00000503788.1_Missense_Mutation_p.R693Q|MARCH6_ENST00000449913.2_Missense_Mutation_p.R750Q	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	798		protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding	breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54					AATGGCATCCGGAACATTGAC	0.408	0	394.0	339.0	358.0	5	10426521	2203	4300	6503	SO:0001583	missense	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495	"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""		14722266	Standard	NM_001270660	Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2393G>A	5.37:g.10426521G>A	ENSP00000274140:p.Arg798Gln	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783881	0.90282	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.44482	1.94;0.93;1.94;0.92	5.63	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.60143	0.2246	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.76494	0.992;0.984;0.999;0.992	P;B;P;B	0.62649	0.803;0.426;0.905;0.44	T	0.59573	-0.7429	10	0.24483	T	0.36	-27.7943	14.9409	0.70992	0.0686:0.0:0.9314:0.0	.	693;750;378;798	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	Q	750;693;798;496	ENSP00000414643:R750Q;ENSP00000425930:R693Q;ENSP00000274140:R798Q;ENSP00000424512:R496Q	ENSP00000274140:R798Q	R	+	2	0	MARCH6	10479521	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.418000	0.97395	1.538000	0.49270	0.655000	0.94253	CGG	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2		180.157428	0	1	193	0	0	1	0	NM_005885	60	183.395805	110	0.352941
ARHGAP17	55114	broad.mit.edu	hg19	16	24946929	24946929	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr16:24946929C>G	ENST00000289968.6	-	18	1825	c.1756G>C	c.(1756-1758)Gct>Cct	p.A586P	ARHGAP17_ENST00000303665.5_Missense_Mutation_p.A508P|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	586	Pro-rich.	regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)	GCTGGCACAGCTGCAGATACA	0.517	0	84.0	79.0	80.0	16	24946929	2197	4300	6497	SO:0001583	missense	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750	"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293			10967100, 11431473	Standard	XM_005255413	Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1756G>C	16.37:g.24946929C>G	ENSP00000289968:p.Ala586Pro	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	C	9.027	0.986398	0.18889	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.21734	1.99;2.01	5.19	-2.71	0.05986	.	0.505510	0.16645	N	0.205470	T	0.17874	0.0429	N	0.12746	0.255	0.27690	N	0.94616	D;B;B;B	0.63046	0.992;0.006;0.0;0.001	D;B;B;B	0.73708	0.981;0.003;0.002;0.001	T	0.19451	-1.0305	10	0.25751	T	0.34	.	4.7834	0.13213	0.1104:0.334:0.4447:0.1109	.	508;586;119;419	Q68EM7-2;Q68EM7;Q68EM7-7;B4DWE9	.;RHG17_HUMAN;.;.	P	586;508;586	ENSP00000289968:A586P;ENSP00000303130:A508P	ENSP00000289968:A586P	A	-	1	0	ARHGAP17	24854430	0.005000	0.15991	0.003000	0.11579	0.016000	0.09150	-0.236000	0.09003	-0.206000	0.10203	-0.176000	0.13171	GCT	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3		64.495174	0	-9	51	0	0	1	0	NM_018054	20	64.616073	25	0.444444
DLGAP5	9787	ucsc.edu	hg19	14	55629724	55629724	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990																										TGATTCATATTATTATTGACT	0.289	0	91.0	92.0	91.0	14	55629724	2203	4293	6496	SO:0001583	missense	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787		16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7	7584026, 7584028	Standard	NM_014750	Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1618A>G	14.37:g.55629724T>C	ENSP00000247191:p.Asn540Asp	A8MTM6|B4DRM8|Q86T11|Q8NG58	ENST00000247191.2	37	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	T	1.376	-0.584627	0.03827	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.17054	2.3;2.3	4.83	3.59	0.41128	.	0.537099	0.17005	N	0.190767	T	0.09335	0.0230	N	0.22421	0.69	0.09310	N	1	B;B	0.19583	0.037;0.007	B;B	0.21151	0.033;0.015	T	0.31558	-0.9939	10	0.13853	T	0.58	.	5.5034	0.16840	0.1647:0.0:0.2815:0.5538	.	540;540	A8MTM6;Q15398	.;DLGP5_HUMAN	D	540	ENSP00000378815:N540D;ENSP00000247191:N540D	ENSP00000247191:N540D	N	-	1	0	DLGAP5	54699477	0.001000	0.12720	0.089000	0.20774	0.348000	0.29142	0.369000	0.20416	1.951000	0.56629	0.477000	0.44152	AAT	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2				-12	53					NM_014750	4		32	
KCNS2	3788	broad.mit.edu	hg19	8	99440584	99440584	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr8:99440584G>A	ENST00000287042.4	+	2	727	c.377G>A	c.(376-378)cGc>cAc	p.R126H	KCNS2_ENST00000521839.1_Missense_Mutation_p.R126H	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	126			voltage-gated potassium channel complex	voltage-gated potassium channel activity	autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)		TACCATGGCCGCAAAGTAGAG	0.552	1	85.0	91.0	89.0	8	99440584	2203	4300	6503	SO:0001583	missense	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906			9305895, 16382104	Standard	NM_020697	Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.377G>A	8.37:g.99440584G>A	ENSP00000287042:p.Arg126His	A8KAN1	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054137	0.75960	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	T;T	0.46451	0.87;0.87	5.31	5.31	0.75309	BTB/POZ-like (1);BTB/POZ fold (1);	0.136406	0.47093	D	0.000244	T	0.59445	0.2194	M	0.67397	2.05	0.44798	D	0.997809	D	0.76494	0.999	D	0.73380	0.98	T	0.56408	-0.7984	10	0.33141	T	0.24	.	12.3465	0.55124	0.0775:0.0:0.9225:0.0	.	126	Q9ULS6	KCNS2_HUMAN	H	126	ENSP00000287042:R126H;ENSP00000430712:R126H	ENSP00000287042:R126H	R	+	2	0	KCNS2	99509760	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.869000	0.99810	2.470000	0.83445	0.563000	0.77884	CGC	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1		-17.127778	0	4	57	0	0	1	0	NM_020697	4	7.887640	104	0.037037
ACD	65057	broad.mit.edu	hg19	16	67692869	67692869	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr16:67692869G>C	ENST00000219251.8	-	7	1187	c.856C>G	c.(856-858)Cct>Gct	p.P286A	ACD_ENST00000393919.4_Missense_Mutation_p.P289A	NM_001082486.1|NM_001082487.1|NM_022914.2	NP_001075955.1|NP_001075956.1|NP_075065.2	Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	289	Interaction with POT1.	intracellular protein transport|negative regulation of telomere maintenance via telomerase|positive regulation of single-stranded telomeric DNA binding|positive regulation of telomerase activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|telomere assembly	nuclear telomere cap complex|nucleoplasm	DNA binding|DNA polymerase binding	endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)	TGGGTGACAGGGGGTGCTGTG	0.612	0	72.0	71.0	72.0	16	67692869	2198	4300	6498	SO:0001583	missense	AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977		25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377			15231715, 15181449	Standard	NM_001082486	Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.865C>G	16.37:g.67692869G>C	ENSP00000377496:p.Pro289Ala	Q562H5|Q9H8F9	ENST00000393919.4	37	CCDS42181.1	.	.	.	.	.	.	.	.	.	.	G	9.259	1.042842	0.19748	.	.	ENSG00000102977	ENST00000219251;ENST00000393919	T;T	0.35421	1.31;1.31	4.96	-0.708	0.11241	.	0.507828	0.19458	N	0.113779	T	0.16896	0.0406	N	0.20986	0.625	0.09310	N	1	B;B	0.13594	0.005;0.008	B;B	0.14578	0.005;0.011	T	0.11446	-1.0587	10	0.27785	T	0.31	-1.3785	1.3808	0.02230	0.1698:0.1432:0.3928:0.2942	.	289;286	Q96AP0;Q96AP0-2	ACD_HUMAN;.	A	286;289	ENSP00000219251:P286A;ENSP00000377496:P289A	ENSP00000219251:P286A	P	-	1	0	ACD	66250370	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.090000	0.15025	-0.390000	0.07774	-0.467000	0.05162	CCT	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268880.1		113.707483	0	-31	93	0	0	1	0	NM_022914	39	114.073865	51	0.433333
COL25A1	84570	broad.mit.edu	hg19	4	109822282	109822282	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr4:109822282C>G	ENST00000399132.1	-	14	1357	c.827G>C	c.(826-828)gGa>gCa	p.G276A	COL25A1_ENST00000399127.1_Missense_Mutation_p.G272A|COL25A1_ENST00000399126.1_Missense_Mutation_p.G276A	NM_198721.2	NP_942014.1	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1	276	Collagen-like 3.		collagen|extracellular space	beta-amyloid binding|heparin binding	NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	AACCTTAGGTCCTGGTATTCC	0.348	0	101.0	96.0	98.0	4	109822282	1857	4106	5963	SO:0001583	missense	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517	"""Collagens"""	18603	protein-coding gene	gene with protein product		610004			11927537	Standard	NM_001256074	Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.827G>C	4.37:g.109822282C>G	ENSP00000382083:p.Gly276Ala		ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015437	0.54468	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.99523	-6.08;-4.57;-6.08	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.99651	0.9871	M	0.93420	3.415	0.48288	D	0.999626	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.981	D	0.97845	1.0271	9	.	.	.	0.0018	16.5147	0.84296	0.0:1.0:0.0:0.0	.	276;276	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	A	276;278;272;272;276;206	ENSP00000382083:G276A;ENSP00000382078:G272A;ENSP00000382077:G276A	.	G	-	2	0	COL25A1	110041731	0.999000	0.42202	0.959000	0.39883	0.870000	0.49936	4.478000	0.60230	2.685000	0.91497	0.591000	0.81541	GGA	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2		44.037933	0	5	78	0	0	1	0	NM_032518	14	44.948395	27	0.341463
RSPH4A	345895	broad.mit.edu	hg19	6	116944015	116944015	+	Silent	SNP	A	A	G			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr6:116944015A>G	ENST00000229554.5	+	2	908	c.771A>G	c.(769-771)caA>caG	p.Q257Q	RSPH4A_ENST00000368581.4_Silent_p.Q257Q|RSPH4A_ENST00000368580.4_Silent_p.Q257Q	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	257		cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke		breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27					ATATTAGCCAAGATGTGAAGA	0.323	0	99.0	107.0	105.0	6	116944015	2203	4299	6502	SO:0001819	synonymous_variant		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834		21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3	19200523	Standard	NM_001010892	Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.771A>G	6.37:g.116944015A>G		B4DSI1|Q3KP24|Q5TD95	ENST00000229554.5	37	CCDS34521.1																																																																																			RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041960.1		183.804411	0	28	203	0	0	1	0	NM_001010892	64	193.502198	163	0.281938
NLRP14	338323	broad.mit.edu	hg19	11	7059980	7059980	+	Missense_Mutation	SNP	C	C	T	rs146049510	byFrequency	TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr11:7059980C>T	ENST00000299481.4	+	2	509	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	55	DAPIN.	cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	GAAGGCCAGGCGGGAGGACCT	0.448	0	58.0	63.0	61.0	11	7059980	2201	4296	6497	SO:0001583	missense	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077	"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14	12563287	Standard	NM_176822	Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.163C>T	11.37:g.7059980C>T	ENSP00000299481:p.Arg55Trp	Q7RTR6	ENST00000299481.4	37	CCDS7776.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	C	15.43	2.832721	0.50845	0.003408	0.0	ENSG00000158077	ENST00000299481	T	0.54675	0.56	4.22	-1.36	0.09085	Pyrin (2);DEATH-like (2);	0.529188	0.15927	N	0.237859	T	0.48333	0.1494	L	0.60067	1.865	0.09310	N	1	D	0.89917	1.0	D	0.71870	0.975	T	0.43669	-0.9377	10	0.49607	T	0.09	.	0.7116	0.00925	0.3593:0.2971:0.1447:0.1989	.	55	Q86W24	NAL14_HUMAN	W	55	ENSP00000299481:R55W	ENSP00000299481:R55W	R	+	1	2	NLRP14	7016556	0.000000	0.05858	0.000000	0.03702	0.948000	0.59901	-0.628000	0.05515	-0.224000	0.09928	0.655000	0.94253	CGG	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1		33.989188	0	20	66	0	0	1	0	NM_176822	12	34.637857	22	0.352941
SETD2	29072	broad.mit.edu	hg19	3	47103828	47103828	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr3:47103828G>A	ENST00000409792.3	-	14	6160	c.6118C>T	c.(6118-6120)Cga>Tga	p.R2040*	SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2040		regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	TCCCTTCCTCGTTCAGTTGCT	0.388	0	199.0	202.0	201.0	3	47103828	2203	4300	6503	SO:0001587	stop_gained	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555	"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778			16118227, 11461154	Standard	NM_014159	Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6118C>T	3.37:g.47103828G>A	ENSP00000386759:p.Arg2040*	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	44	10.715565	0.99455	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	4.77	3.83	0.44106	.	0.000000	0.42420	D	0.000710	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0351	0.71738	0.0:0.0:0.8576:0.1424	.	.	.	.	X	2040	.	ENSP00000386759:R2040X	R	-	1	2	SETD2	47078832	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	4.345000	0.59360	2.639000	0.89480	0.455000	0.32223	CGA	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		244.248357	0	-10	192	0	0	1	0	NM_014159	81	244.683017	100	0.447514
RHPN2	85415	broad.mit.edu	hg19	19	33517480	33517480	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr19:33517480A>T	ENST00000254260.3	-	3	279	c.244T>A	c.(244-246)Tca>Aca	p.S82T	RHPN2_ENST00000400226.4_5'UTR	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	82		signal transduction	perinuclear region of cytoplasm	protein binding	NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)				TGCAGGTCTGAGTTGACGAAG	0.552	0	104.0	99.0	100.0	19	33517480	2203	4297	6500	SO:0001583	missense	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941		19974	protein-coding gene	gene with protein product					12221077	Standard	NM_033103	Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.244T>A	19.37:g.33517480A>T	ENSP00000254260:p.Ser82Thr	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785321	0.70337	.	.	ENSG00000131941	ENST00000254260	T	0.17691	2.26	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	M	0.79475	2.455	0.80722	D	1	P	0.42620	0.785	P	0.45037	0.467	T	0.17077	-1.0381	10	0.87932	D	0	2.0166	12.8517	0.57860	1.0:0.0:0.0:0.0	.	82	Q8IUC4	RHPN2_HUMAN	T	82	ENSP00000254260:S82T	ENSP00000254260:S82T	S	-	1	0	RHPN2	38209320	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.842000	0.75379	1.761000	0.52028	0.455000	0.32223	TCA	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2		225.999445	0	-61	173	0	0	1	0	NM_033103	76	226.706256	100	0.431818
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	A	rs121913492		TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr9:80409488T>A	ENST00000286548.4	-	5	848	c.626A>T	c.(625-627)cAa>cTa	p.Q209L	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7L	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>T	9.37:g.80409488T>A	ENSP00000286548:p.Gln209Leu	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985495	0.93044	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97573	0.9205	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99402	1.0928	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	L	209;7	ENSP00000286548:Q209L;ENSP00000443197:Q7L	ENSP00000286548:Q209L	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		163.259000	0	-7	105	0	0	1	0	NM_002072	50	163.554906	39	0.561798
VWF	7450	broad.mit.edu	hg19	12	6128239	6128239	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr12:6128239G>C	ENST00000261405.5	-	28	4599	c.4345C>G	c.(4345-4347)Caa>Gaa	p.Q1449E		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1449	VWFA 1; binding site for platelet glycoprotein Ib.	blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					TCGTCCCTTTGCTGCTCCAGC	0.612	0	68.0	71.0	70.0	12	6128239	2203	4300	6503	SO:0001583	missense		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799	"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF	2251280	Standard	NM_000552	Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4345C>G	12.37:g.6128239G>C	ENSP00000261405:p.Gln1449Glu	Q8TCE8|Q99806	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	3.253	-0.152788	0.06585	.	.	ENSG00000110799	ENST00000261405	D	0.83163	-1.69	4.35	-1.2	0.09554	von Willebrand factor, type A (3);	0.616955	0.13134	N	0.411235	T	0.73426	0.3585	L	0.43152	1.355	0.22446	N	0.999094	B	0.18166	0.026	B	0.20955	0.032	T	0.60777	-0.7196	10	0.38643	T	0.18	.	8.3008	0.32012	0.0867:0.0:0.4033:0.51	.	1449	P04275	VWF_HUMAN	E	1449	ENSP00000261405:Q1449E	ENSP00000261405:Q1449E	Q	-	1	0	VWF	5998500	0.027000	0.19231	0.616000	0.29078	0.132000	0.20833	0.643000	0.24750	0.010000	0.14839	-0.378000	0.06908	CAA	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1		69.240949	0	-20	54	0	0	1	0	NM_000552	22	69.574499	31	0.415094
OR3A1	4994	broad.mit.edu	hg19	17	3195504	3195504	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr17:3195504G>A	ENST00000323404.1	-	1	372	c.373C>T	c.(373-375)Cga>Tga	p.R125*	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	125		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20					GCCAGGAATCGGTCATAGGCC	0.592	0	94.0	86.0	89.0	17	3195504	2203	4300	6503	SO:0001587	stop_gained	X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090	"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product					8921386, 8647456	Standard	NM_002550	Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.373C>T	17.37:g.3195504G>A	ENSP00000313803:p.Arg125*	Q4VB06|Q6IFM4	ENST00000323404.1	37	CCDS11023.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	29.8	5.040067	0.93630	.	.	ENSG00000180090	ENST00000323404	.	.	.	5.31	4.33	0.51752	.	0.000000	0.42964	D	0.000626	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5448	14.167	0.65483	0.0:0.0:0.849:0.1509	.	.	.	.	X	125	.	ENSP00000313803:R125X	R	-	1	2	OR3A1	3142254	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.771000	0.38542	1.445000	0.47624	-0.188000	0.12872	CGA	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2		-7.126452	0	18	91	0	0	1	0		3	6.318280	59	0.048387
ST6GALNAC5	81849	broad.mit.edu	hg19	1	77334298	77334298	+	Silent	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr1:77334298G>A	ENST00000477717.1	+	2	367	c.132G>A	c.(130-132)caG>caA	p.Q44Q	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	44	Poly-Gln.	protein glycosylation	integral to Golgi membrane	sialyltransferase activity	endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18					agcagcagcagcaacagcagc	0.711	0	12.0	12.0	12.0	1	77334298	2054	3972	6026	SO:0001819	synonymous_variant		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069	"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E	10521438, 10601645	Standard	NM_030965	Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.132G>A	1.37:g.77334298G>A		B1AK82	ENST00000477717.1	37	CCDS673.1																																																																																			ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2		0.863100	0	-2	35	0	0	1	0	NM_030965	4	8.809454	42	0.086957
MAPKAPK2	9261	broad.mit.edu	hg19	1	206904072	206904072	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr1:206904072G>A	ENST00000367103.3	+	6	924	c.731G>A	c.(730-732)tGt>tAt	p.C244Y	MAPKAPK2_ENST00000294981.4_Missense_Mutation_p.C244Y	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	244	Protein kinase.	activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity	central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)		GACAAGTCCTGTGACATGTGG	0.577	0	149.0	135.0	139.0	1	206904072	2203	4300	6503	SO:0001583	missense	U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889		6887	protein-coding gene	gene with protein product		602006			8179591, 8280084	Standard	NM_004759	Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.731G>A	1.37:g.206904072G>A	ENSP00000356070:p.Cys244Tyr	Q5SY30|Q5SY41|Q8IYD6	ENST00000367103.3	37	CCDS31001.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273199	0.80580	.	.	ENSG00000162889	ENST00000294981;ENST00000367103	T;T	0.49720	0.77;0.77	5.83	3.94	0.45596	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.72220	0.3433	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75827	-0.3180	9	0.87932	D	0	-14.1069	10.1253	0.42646	0.0715:0.0:0.7919:0.1367	.	244;244	P49137;P49137-2	MAPK2_HUMAN;.	Y	244	ENSP00000294981:C244Y;ENSP00000356070:C244Y	ENSP00000294981:C244Y	C	+	2	0	MAPKAPK2	204970695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.777000	0.99008	0.795000	0.33922	0.655000	0.94253	TGT	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1		207.143265	0	-28	81	0	0	1	0	NM_004759	66	208.100673	44	0.600000
MYBPC2	4606	broad.mit.edu	hg19	19	50939080	50939080	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr19:50939080G>C	ENST00000357701.5	+	3	208	c.157G>C	c.(157-159)Gtt>Ctt	p.V53L		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	53	Ig-like C2-type 1.	cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle	breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)	GCCCACCGGCGTTTTCCTGAA	0.662	1	21.0	23.0	22.0	19	50939080	1881	4102	5983	SO:0001583	missense		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967	"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""		8375400	Standard	NM_004533	Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.157G>C	19.37:g.50939080G>C	ENSP00000350332:p.Val53Leu	A1L4G9	ENST00000357701.5	37	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.065034	0.00382	.	.	ENSG00000086967	ENST00000357701	T	0.68624	-0.34	4.6	-9.19	0.00685	Immunoglobulin-like fold (1);	.	.	.	.	T	0.21062	0.0507	N	0.00419	-1.52	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34800	-0.9814	9	0.02654	T	1	.	8.5286	0.33319	0.1909:0.4591:0.35:0.0	.	53	Q14324	MYPC2_HUMAN	L	53	ENSP00000350332:V53L	ENSP00000350332:V53L	V	+	1	0	MYBPC2	55630892	0.000000	0.05858	0.003000	0.11579	0.064000	0.16182	-2.122000	0.01321	-1.955000	0.01023	-0.483000	0.04790	GTT	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1		25.701770	0	0	19	0	0	1	0	NM_004533	8	25.764061	6	0.571429
TTN	7273	broad.mit.edu	hg19	2	179413443	179413443	+	Silent	SNP	A	A	C			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr2:179413443A>C	ENST00000589042.1	-	339	93134	c.92910T>G	c.(92908-92910)gcT>gcG	p.A30970A	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.A22097A|TTN_ENST00000591111.1_Silent_p.A29329A|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.A28402A|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Silent_p.A22030A|TTN_ENST00000460472.2_Silent_p.A21905A|TTN-AS1_ENST00000592600.1_RNA	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	29329	Fibronectin type-III 126.			ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		TATGGATATCAGCCCGAAGGC	0.473	0	126.0	121.0	123.0	2	179413443	1963	4147	6110	SO:0001819	synonymous_variant	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.92910T>G	2.37:g.179413443A>C		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1																																																																																			TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		-9.066645	0	-9	88	0	0	1	0	NM_133378	4	7.014795	72	0.052632
EIF1B	10289	broad.mit.edu	hg19	3	40352412	40352412	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr3:40352412C>G	ENST00000232905.3	+	2	318	c.60C>G	c.(58-60)gaC>gaG	p.D20E		NM_005875.2	NP_005866.1	O60739	EIF1B_HUMAN	eukaryotic translation initiation factor 1B	20		regulation of translational initiation		protein binding|translation initiation factor activity	central_nervous_system(1)|lung(3)	4				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)	CTAAGGGTGACGACTTACTCC	0.388	0	49.0	49.0	49.0	3	40352412	2203	4300	6503	SO:0001583	missense	BC006996	CCDS2690.1	3p22.1	2006-02-03			ENSG00000114784	ENSG00000114784		30792	protein-coding gene	gene with protein product					7904817	Standard	NM_005875	Approved	GC20	uc003ckc.3	O60739	OTTHUMG00000131388	ENST00000232905.3:c.60C>G	3.37:g.40352412C>G	ENSP00000232905:p.Asp20Glu	Q9UQF8	ENST00000232905.3	37	CCDS2690.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877734	0.51801	.	.	ENSG00000114784	ENST00000232905	T	0.28454	1.61	6.17	3.42	0.39159	Translation initiation factor SUI1 (1);	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	M	0.67569	2.06	0.49389	D	0.999785	B	0.15141	0.012	B	0.19666	0.026	T	0.06463	-1.0825	10	0.41790	T	0.15	.	8.1084	0.30900	0.0:0.7243:0.1315:0.1442	.	20	O60739	EIF1B_HUMAN	E	20	ENSP00000232905:D20E	ENSP00000232905:D20E	D	+	3	2	EIF1B	40327416	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.724000	0.54962	0.478000	0.27488	-0.140000	0.14226	GAC	EIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254177.1		56.805868	0	6	72	0	0	1	0	NM_005875	19	58.208172	38	0.333333
MAP1S	55201	broad.mit.edu	hg19	19	17835950	17835951	+	Frame_Shift_Del	DEL	AG	AG	-	rs138091544		TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr19:17835950_17835951delAG	ENST00000324096.4	+	4	547_548	c.396_397delAG	c.(394-399)acagggfs	p.G134fs	MAP1S_ENST00000597681.1_Intron|MAP1S_ENST00000544059.2_Frame_Shift_Del_p.G108fs	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	134	Necessary for the microtubule-organizing center localization.	apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding	NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25					TGCTACAGACAGGGGGCTTCTC	0.619	1									SO:0001589	frameshift_variant	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479		15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1	11827465, 15528209, 16297881, 14627543	Standard	NM_018174	Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.396_397delAG	19.37:g.17835950_17835951delAG	ENSP00000325313:p.Gly134fs	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	ENST00000324096.4	37	CCDS32954.1																																																																																			MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	.	.		-2	99					NM_018174	21		92	0.19
HSPG2	3339	broad.mit.edu	hg19	1	22182161	22182161	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr1:22182161delG	ENST00000374695.3	-	46	5788	c.5709delC	c.(5707-5709)cccfs	p.P1903fs		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1903	Ig-like C2-type 4.	angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	GCTGGCCGCCGGGGCCCCCTG	0.667	0	12.0	13.0	13.0	1	22182161	2195	4287	6482	SO:0001589	frameshift_variant	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798	"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1	1685141, 11941538	Standard	XM_005245863	Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5709delC	1.37:g.22182161delG	ENSP00000363827:p.Pro1903fs	Q16287|Q5SZI3|Q9H3V5	ENST00000374695.3	37	CCDS30625.1																																																																																			HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	.	.		0	12					NM_005529	2		4	0.33
SRSF2	6427	broad.mit.edu	hg19	17	74732946	74732969	+	In_Frame_Del	DEL	GTGTGAGTCCGGGGGGCGGCCGTA	GTGTGAGTCCGGGGGGCGGCCGTA	-			TCGA-V4-A9EM-01A-11D-A39W-08	TCGA-V4-A9EM-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66011a50-b91f-4e3a-bd35-ae6127ec4ed4	8354dea5-9394-4f7c-8412-b9751136d990	g.chr17:74732946_74732969delGTGTGAGTCCGGGGGGCGGCCGTA	ENST00000392485.2	-	1	446_469	c.274_297delTACGGCCGCCCCCCGGACTCACAC	c.(274-297)tacggccgccccccggactcacacdel	p.YGRPPDSH92del	MFSD11_ENST00000586622.1_5'UTR|MFSD11_ENST00000588460.1_5'UTR|MFSD11_ENST00000591864.1_5'UTR|SRSF2_ENST00000508921.3_In_Frame_Del_p.YGRPPDSH92del|SRSF2_ENST00000359995.5_In_Frame_Del_p.YGRPPDSH92del|RP11-318A15.7_ENST00000587459.1_Intron	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	92	RRM.	mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity	haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329					GGCGGCTGTGGTGTGAGTCCGGGGGGCGGCCGTAGCGCGCCATT	0.732	189									SO:0001651	inframe_deletion	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547	"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2	8530103, 20516191	Standard	NM_003016	Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.274_297delTACGGCCGCCCCCCGGACTCACAC	17.37:g.74732946_74732969delGTGTGAGTCCGGGGGGCGGCCGTA	ENSP00000376276:p.Tyr92_His99del	B3KWD5|B4DN89|H0YG49	ENST00000392485.2	37	CCDS11749.1																																																																																			SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	.	.		-5	29					NM_003016	10		27	0.27
