Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
USP35	57558	broad.mit.edu	hg19	11	77911266	77911266	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr11:77911266G>A	ENST00000529308.1	+	5	1285	c.1024G>A	c.(1024-1026)Gaa>Aaa	p.E342K	USP35_ENST00000530267.1_Intron|USP35_ENST00000441408.2_5'UTR|USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_Missense_Mutation_p.E73K	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	342		ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)		GCACTCCCACGAAGCCTTCCA	0.622	0	72.0	73.0	73.0	11	77911266	1982	4152	6134	SO:0001583	missense	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369	"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""		12838346	Standard	NM_020798	Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1024G>A	11.37:g.77911266G>A	ENSP00000431876:p.Glu342Lys		ENST00000529308.1	37	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377826	0.82682	.	.	ENSG00000118369	ENST00000528910;ENST00000529308;ENST00000526425	T;T;T	0.42131	0.98;0.98;0.98	4.7	4.7	0.59300	Armadillo-like helical (1);	0.000000	0.53938	D	0.000055	T	0.61590	0.2359	L	0.57536	1.79	0.54753	D	0.999988	D	0.89917	1.0	D	0.80764	0.994	T	0.62854	-0.6766	10	0.51188	T	0.08	-28.922	17.8481	0.88737	0.0:0.0:1.0:0.0	.	342	Q9P2H5	UBP35_HUMAN	K	98;342;73	ENSP00000436001:E98K;ENSP00000431876:E342K;ENSP00000434942:E73K	ENSP00000434942:E73K	E	+	1	0	USP35	77588914	1.000000	0.71417	0.993000	0.49108	0.940000	0.58332	9.657000	0.98554	2.437000	0.82529	0.655000	0.94253	GAA	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1		15.404560	0	-32	34	0	0	1	0	XM_290527	7	18.334803	28	0.200000
DPCR1	135656	broad.mit.edu	hg19	6	30919999	30919999	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:30919999C>G	ENST00000462446.1	+	2	3786	c.3758C>G	c.(3757-3759)tCt>tGt	p.S1253C	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Missense_Mutation_p.S95C			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	377			integral to membrane		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10					GGAGACAAATCTCTCACTACT	0.418	0	136.0	134.0	135.0	6	30919999	2203	4300	6503	SO:0001583	missense	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631		21666	protein-coding gene	gene with protein product		613928			12185533, 10677310	Standard	NM_080870	Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3758C>G	6.37:g.30919999C>G	ENSP00000417182:p.Ser1253Cys	C9IZC0|Q658M7|Q8WYN2	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232160	0.39498	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.29142	1.58;1.69	3.69	1.87	0.25490	.	.	.	.	.	T	0.24160	0.0585	L	0.40543	1.245	0.09310	N	1	D	0.59767	0.986	D	0.67103	0.949	T	0.04693	-1.0933	9	0.72032	D	0.01	3.1604	5.9248	0.19104	0.0:0.7496:0.0:0.2504	.	1253	E9PEI6	.	C	1253;377;95	ENSP00000417182:S1253C;ENSP00000305948:S95C	ENSP00000305948:S95C	S	+	2	0	DPCR1	31027978	0.002000	0.14202	0.001000	0.08648	0.012000	0.07955	1.470000	0.35354	0.338000	0.23692	-0.271000	0.10264	TCT	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3		84.157864	0	9	74	0	0	1	0	NM_080870	31	92.645945	101	0.234848
DPCR1	135656	broad.mit.edu	hg19	6	30920102	30920102	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:30920102C>G	ENST00000462446.1	+	2	3889	c.3861C>G	c.(3859-3861)atC>atG	p.I1287M	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Missense_Mutation_p.I129M			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	411			integral to membrane		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10					TGAGTTCTATCACATCAGAAG	0.438	0	96.0	94.0	95.0	6	30920102	2203	4300	6503	SO:0001583	missense	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631		21666	protein-coding gene	gene with protein product		613928			12185533, 10677310	Standard	NM_080870	Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3861C>G	6.37:g.30920102C>G	ENSP00000417182:p.Ile1287Met	C9IZC0|Q658M7|Q8WYN2	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496829	0.44352	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.26810	1.71;1.79	3.61	-0.797	0.10909	.	.	.	.	.	T	0.13114	0.0318	L	0.33485	1.01	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.06058	-1.0848	9	0.49607	T	0.09	-0.0029	0.696	0.00899	0.1925:0.3853:0.1883:0.2339	.	1287	E9PEI6	.	M	1287;411;129	ENSP00000417182:I1287M;ENSP00000305948:I129M	ENSP00000305948:I129M	I	+	3	3	DPCR1	31028081	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.038000	0.13862	0.006000	0.14734	-0.323000	0.08544	ATC	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3		138.062749	0	4	81	0	0	1	0	NM_080870	47	143.857231	111	0.297468
ALYREF	10189	broad.mit.edu	hg19	17	79848635	79848635	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr17:79848635G>A	ENST00000331204.4	-	2	325	c.299C>T	c.(298-300)gCc>gTc	p.A100V	ALYREF_ENST00000512673.1_5'UTR|ALYREF_ENST00000505490.2_Missense_Mutation_p.A107V	NM_005782.3	NP_005773.3	Q86V81	THOC4_HUMAN	Aly/REF export factor	100	Ala/Arg/Gly-rich.	intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding							CTCCACGCCGGCACCACCGCC	0.532	0	66.0	65.0	66.0	17	79848635	2203	4300	6503	SO:0001583	missense	AF047002	CCDS32768.1, CCDS32768.2	17q25.3	2013-02-12	2011-12-12	2011-12-12	ENSG00000183684	ENSG00000183684	"""THO complex subunits"", ""RNA binding motif (RRM) containing"""	19071	protein-coding gene	gene with protein product		604171	"""THO complex 4"""	THOC4	11032328	Standard	NM_005782	Approved	ALY, BEF, ALY/REF, REF	uc002kbu.2	Q86V81	OTTHUMG00000160470	ENST00000505490.2:c.320C>T	17.37:g.79848635G>A	ENSP00000421592:p.Ala107Val	O43672	ENST00000505490.2	37	CCDS32768.2	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566266	0.65651	.	.	ENSG00000183684	ENST00000331204;ENST00000505490	T;T	0.13657	2.57;2.57	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.16854	0.0405	L	0.55990	1.75	0.47341	D	0.999392	B	0.23128	0.08	B	0.20384	0.029	T	0.02966	-1.1088	10	0.34782	T	0.22	.	17.8453	0.88728	0.0:0.0:1.0:0.0	.	107	E9PB61	.	V	100;107	ENSP00000331817:A100V;ENSP00000421592:A107V	ENSP00000331817:A100V	A	-	2	0	THOC4	77441931	1.000000	0.71417	0.956000	0.39512	0.997000	0.91878	4.381000	0.59587	2.617000	0.88574	0.655000	0.94253	GCC	ALYREF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360729.2		-1.189910	0	-8	60	0	0	1	0	NM_005782	4	8.293763	48	0.076923
DHX34	9704	broad.mit.edu	hg19	19	47882984	47882984	+	Silent	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr19:47882984C>T	ENST00000328771.4	+	14	3073	c.2724C>T	c.(2722-2724)agC>agT	p.S908S		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	908			intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding	breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)	TGCTTTTTAGCCGGTCTTTGG	0.632	0	102.0	88.0	92.0	19	47882984	2203	4300	6503	SO:0001819	synonymous_variant	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815	"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34	10708517, 8590280	Standard	NM_014681	Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.2724C>T	19.37:g.47882984C>T		B4DMY8	ENST00000328771.4	37	CCDS12700.1																																																																																			DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3		-22.712553	0	14	174	0	0	1	0	NM_014681	4	7.229425	121	0.032000
CNTN3	5067	broad.mit.edu	hg19	3	74535622	74535622	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr3:74535622T>G	ENST00000263665.6	-	3	370	c.343A>C	c.(343-345)Aaa>Caa	p.K115Q		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	115	Ig-like C2-type 1.	cell adhesion	anchored to membrane|plasma membrane	protein binding	NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	AACTGAAGTTTGGCTTCTCTG	0.338	0	129.0	125.0	126.0	3	74535622	2203	4300	6503	SO:0001583	missense	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG	8661054, 8586965	Standard	XM_005264757	Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.343A>C	3.37:g.74535622T>G	ENSP00000263665:p.Lys115Gln	B9EK50|Q9H039	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	T	9.295	1.051643	0.19827	.	.	ENSG00000113805	ENST00000263665	T	0.67345	-0.26	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.107337	0.64402	D	0.000006	T	0.51449	0.1675	L	0.28608	0.87	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.34551	-0.9824	10	0.22109	T	0.4	.	9.4441	0.38686	0.1582:0.0:0.0:0.8418	.	115	Q9P232	CNTN3_HUMAN	Q	115	ENSP00000263665:K115Q	ENSP00000263665:K115Q	K	-	1	0	CNTN3	74618312	0.823000	0.29233	0.117000	0.21633	0.715000	0.41141	4.097000	0.57741	2.230000	0.72887	0.477000	0.44152	AAA	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1		24.055014	0	-11	45	0	0	1	0	NM_020872	9	26.833137	31	0.225000
EYA3	2140	broad.mit.edu	hg19	1	28339771	28339771	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr1:28339771T>C	ENST00000373871.3	-	9	860	c.620A>G	c.(619-621)cAg>cGg	p.Q207R	EYA3_ENST00000436342.2_Missense_Mutation_p.Q81R|EYA3_ENST00000545175.1_Missense_Mutation_p.Q154R|EYA3_ENST00000373863.3_Missense_Mutation_p.Q161R|EYA3_ENST00000373864.1_Missense_Mutation_p.Q51R|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000540618.1_Missense_Mutation_p.Q161R	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	eyes absent homolog 3 (Drosophila)	207		anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity	breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)	GGCCTGGTACTGATTCTGACC	0.463	0	135.0	125.0	128.0	1	28339771	2203	4300	6503	SO:0001583	missense	U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161	"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""		9020840	Standard	NM_001990	Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.620A>G	1.37:g.28339771T>C	ENSP00000362978:p.Gln207Arg	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	ENST00000373871.3	37	CCDS316.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.742727	0.89573	.	.	ENSG00000158161	ENST00000373871;ENST00000436342;ENST00000373864;ENST00000540618;ENST00000545175;ENST00000373863	D;D;D;D;D;D	0.94417	-3.12;-3.41;-3.42;-1.96;-1.96;-1.96	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.96756	0.8941	M	0.71206	2.165	0.80722	D	1	D;D;D	0.71674	0.981;0.994;0.998	D;D;D	0.79784	0.969;0.985;0.993	D	0.96997	0.9726	10	0.56958	D	0.05	-17.8503	15.8132	0.78581	0.0:0.0:0.0:1.0	.	161;161;207	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	R	207;81;51;161;154;161	ENSP00000362978:Q207R;ENSP00000405587:Q81R;ENSP00000362971:Q51R;ENSP00000442558:Q161R;ENSP00000442280:Q154R;ENSP00000362970:Q161R	ENSP00000362970:Q161R	Q	-	2	0	EYA3	28212358	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.691000	0.61738	2.196000	0.70406	0.533000	0.62120	CAG	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1		102.840978	0	-16	84	0	0	1	0	NM_001990	34	102.947026	40	0.459459
C2orf71	388939	broad.mit.edu	hg19	2	29297043	29297043	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr2:29297043G>A	ENST00000331664.5	-	1	84	c.85C>T	c.(85-87)Cgg>Tgg	p.R29W		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	29		response to stimulus|visual perception	photoreceptor outer segment		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60					CATCCTGGCCGAATTGCTTTG	0.512	0	92.0	87.0	89.0	2	29297043	1992	4166	6158	SO:0001583	missense		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270		34383	protein-coding gene	gene with protein product		613425			20398886	Standard	NM_001029883	Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.85C>T	2.37:g.29297043G>A	ENSP00000332809:p.Arg29Trp		ENST00000331664.5	37	CCDS42669.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.86	1.765442	0.31228	.	.	ENSG00000179270	ENST00000331664	T	0.17854	2.25	5.88	-5.99	0.02213	.	0.143123	0.29853	N	0.011038	T	0.14570	0.0352	N	0.22421	0.69	0.19300	N	0.999976	D	0.57571	0.98	P	0.47744	0.556	T	0.22556	-1.0213	10	0.72032	D	0.01	-2.8259	19.4436	0.94836	0.2736:0.0:0.7264:0.0	.	29	A6NGG8	CB071_HUMAN	W	29	ENSP00000332809:R29W	ENSP00000332809:R29W	R	-	1	2	C2orf71	29150547	0.015000	0.18098	0.113000	0.21522	0.211000	0.24417	-0.612000	0.05616	-1.088000	0.03077	-0.291000	0.09656	CGG	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3		44.575644	0	-4	83	0	0	1	0	NM_001029883	19	51.918954	73	0.206522
DPCR1	135656	broad.mit.edu	hg19	6	30919895	30919895	+	Silent	SNP	C	C	G			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:30919895C>G	ENST00000462446.1	+	2	3682	c.3654C>G	c.(3652-3654)acC>acG	p.T1218T	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Silent_p.T60T			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	342			integral to membrane		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10					CCACACTGACCACTGAGACCA	0.453	0	137.0	138.0	137.0	6	30919895	2203	4300	6503	SO:0001819	synonymous_variant	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631		21666	protein-coding gene	gene with protein product		613928			12185533, 10677310	Standard	NM_080870	Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3654C>G	6.37:g.30919895C>G		C9IZC0|Q658M7|Q8WYN2	ENST00000462446.1	37	CCDS4692.2																																																																																			DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3		55.781895	0	-19	60	0	0	1	0	NM_080870	23	60.834420	68	0.252747
CRISP1	167	broad.mit.edu	hg19	6	49819827	49819827	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:49819827C>T	ENST00000335847.4	-	3	183	c.82G>A	c.(82-84)Gac>Aac	p.D28N	CRISP1_ENST00000329411.5_Missense_Mutation_p.D28N|CRISP1_ENST00000536021.1_Missense_Mutation_p.D28N|CRISP1_ENST00000507853.1_Missense_Mutation_p.D28N|CRISP1_ENST00000505118.1_Missense_Mutation_p.D28N|CRISP1_ENST00000355791.2_Missense_Mutation_p.D28N	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	28		fusion of sperm to egg plasma membrane	extracellular space		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)				TTAAATTGGTCTCTAGCTGAT	0.368	0	160.0	162.0	161.0	6	49819827	2203	4300	6503	SO:0001583	missense	D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812		304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1	8838800	Standard	NM_001131	Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.82G>A	6.37:g.49819827C>T	ENSP00000338276:p.Asp28Asn	B5BU98|O00698|Q13248|Q14082|Q96SF6	ENST00000335847.4	37	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	C	6.231	0.410788	0.11812	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01	4.93	-1.26	0.09376	CAP domain (2);	3.392110	0.00732	N	0.000946	T	0.01592	0.0051	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.43798	-0.9369	9	.	.	.	.	10.4782	0.44678	0.0:0.5052:0.0:0.4948	.	28;28	P54107-2;P54107	.;CRIS1_HUMAN	N	28	ENSP00000425020:D28N;ENSP00000338276:D28N;ENSP00000348044:D28N;ENSP00000331317:D28N;ENSP00000427589:D28N;ENSP00000441798:D28N	.	D	-	1	0	CRISP1	49927786	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.682000	0.05185	-0.829000	0.04268	-2.010000	0.00438	GAC	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2		-29.226784	0	-31	95	0	0	1	0	NM_001131	4	7.331254	144	0.027027
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		114.419026	0	-30	82	0	0	1	0	NM_002072	35	114.522009	41	0.460526
NEDD4	4734	broad.mit.edu	hg19	15	56208903	56208903	+	Missense_Mutation	SNP	T	T	C	rs148700559		TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr15:56208903T>C	ENST00000508342.1	-	1	426	c.127A>G	c.(127-129)Acg>Gcg	p.T43A	NEDD4_ENST00000338963.2_Missense_Mutation_p.T43A|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Missense_Mutation_p.T43A	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	43		development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity	breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)	ACGTTAGACGTTGAAATCCGT	0.443	0	186.0	168.0	174.0	15	56208903	2193	4291	6484	SO:0001583	missense	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869		7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""		9073511, 8649367	Standard	XR_243101	Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000506154.1:c.127A>G	15.37:g.56208903T>C	ENSP00000422705:p.Thr43Ala	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	ENST00000506154.1	37		.	.	.	.	.	.	.	.	.	.	T	2.182	-0.387367	0.04932	0.0	1.17E-4	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.40756	1.02;1.02;1.02	5.39	-10.8	0.00216	.	1.573570	0.04489	N	0.379220	T	0.16342	0.0393	.	.	.	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.12863	-1.0531	9	0.07482	T	0.82	.	9.7125	0.40254	0.0922:0.3362:0.0:0.5716	.	43;43;43	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	A	43	ENSP00000424827:T43A;ENSP00000345530:T43A;ENSP00000422705:T43A	ENSP00000345530:T43A	T	-	1	0	NEDD4	53996195	0.008000	0.16893	0.000000	0.03702	0.904000	0.53231	-0.498000	0.06420	-2.554000	0.00477	-1.345000	0.01243	ACG	NEDD4-003	KNOWN	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359818.1		51.372713	0	3	135	0	0	1	0	NM_198400	22	63.957842	104	0.174603
SF3B1	23451	broad.mit.edu	hg19	2	198267483	198267483	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr2:198267483C>T	ENST00000335508.6	-	14	1965	c.1874G>A	c.(1873-1875)cGt>cAt	p.R625H		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		TGTTGTGTTACGGACATACTC	0.438	12	95.0	92.0	93.0	2	198267483	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1874G>A	2.37:g.198267483C>T	ENSP00000335321:p.Arg625His	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	35	5.485860	0.96323	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.91369	0.7277	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93329	0.6699	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	625	O75533	SF3B1_HUMAN	H	625	ENSP00000335321:R625H	ENSP00000335321:R625H	R	-	2	0	SF3B1	197975728	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.728000	0.84847	2.752000	0.94435	0.655000	0.94253	CGT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		60.217713	0	6	61	0	0	1	0		19	60.521250	27	0.413043
CD2AP	23607	broad.mit.edu	hg19	6	47573987	47573987	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:47573987C>T	ENST00000359314.5	+	14	1960	c.1504C>T	c.(1504-1506)Ccg>Tcg	p.P502S		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	502		cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton	kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)		AAGAAGGTTGCCGGGCCGTTT	0.378	0	117.0	109.0	112.0	6	47573987	2203	4300	6503	SO:0001583	missense	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087		14258	protein-coding gene	gene with protein product		604241			10339567	Standard	NM_012120	Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1504C>T	6.37:g.47573987C>T	ENSP00000352264:p.Pro502Ser	A6NL34|Q5VYA3|Q9UG97	ENST00000359314.5	37	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812460	0.90707	.	.	ENSG00000198087	ENST00000359314	T	0.65549	-0.16	5.72	5.72	0.89469	.	2.864440	0.01726	N	0.028575	T	0.81394	0.4813	M	0.81497	2.545	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.67573	-0.5636	10	0.48119	T	0.1	-12.2541	19.8711	0.96851	0.0:1.0:0.0:0.0	.	502	Q9Y5K6	CD2AP_HUMAN	S	502	ENSP00000352264:P502S	ENSP00000352264:P502S	P	+	1	0	CD2AP	47681946	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.675000	0.68123	2.689000	0.91719	0.591000	0.81541	CCG	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		-24.817989	0	15	72	0	0	1	0		4	7.419018	129	0.030075
CAMK1D	57118	broad.mit.edu	hg19	10	12867686	12867686	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr10:12867686G>A	ENST00000378847.3	+	10	1373	c.1036G>A	c.(1036-1038)Gac>Aac	p.D346N	CAMK1D_ENST00000378845.1_Missense_Mutation_p.D346N	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	346	Ser-rich.		calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)	CAGCCAAAAAGACTGTGCGTA	0.552	0	138.0	131.0	134.0	10	12867686	2203	4300	6503	SO:0001583	missense	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049		19341	protein-coding gene	gene with protein product		607957			11050006	Standard	XM_006717481	Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.1036G>A	10.37:g.12867686G>A	ENSP00000368124:p.Asp346Asn	B0YIY0|Q9HD31	ENST00000378847.3	37	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172228	0.78452	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.68331	-0.32;-0.27	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	N	0.25890	0.77	0.38139	D	0.938405	B;B	0.33694	0.421;0.421	B;B	0.27608	0.081;0.059	T	0.58509	-0.7624	10	0.38643	T	0.18	-26.2489	17.3077	0.87199	0.0:0.0:1.0:0.0	.	346;346	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	N	346	ENSP00000368124:D346N;ENSP00000368122:D346N	ENSP00000368122:D346N	D	+	1	0	CAMK1D	12907692	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.225000	0.78051	2.563000	0.86464	0.650000	0.86243	GAC	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1		-18.939539	0	-17	131	0	0	1	0	NM_020397	5	10.140164	122	0.039370
NCAPH	23397	broad.mit.edu	hg19	2	97031759	97031759	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr2:97031759C>A	ENST00000455200.1	+	14	2106	c.1811C>A	c.(1810-1812)aCa>aAa	p.T604K	NCAPH_ENST00000240423.4_Missense_Mutation_p.T615K|NCAPH_ENST00000427946.1_Missense_Mutation_p.T479K			Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	615		cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)			GACATCACAACATATGGGGAG	0.438	0	172.0	158.0	163.0	2	97031759	2203	4300	6503	SO:0001583	missense	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152		1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1	9417923	Standard	NM_015341	Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000455200.1:c.1811C>A	2.37:g.97031759C>A	ENSP00000407308:p.Thr604Lys	B4E189|Q8TB87	ENST00000455200.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.02|16.02	3.005366|3.005366	0.54254|0.54254	.|.	.|.	ENSG00000121152|ENSG00000121152	ENST00000435349|ENST00000240423;ENST00000427946;ENST00000435975;ENST00000455200	.|T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91	5.79|5.79	3.66|3.66	0.41972|0.41972	.|.	.|0.235751	.|0.49305	.|D	.|0.000145	T|T	0.40767|0.40767	0.1130|0.1130	M|M	0.71581|0.71581	2.175|2.175	0.37538|0.37538	D|D	0.918201|0.918201	.|P;B;P	.|0.41366	.|0.629;0.437;0.747	.|B;B;B	.|0.42653	.|0.237;0.252;0.394	T|T	0.39333|0.39333	-0.9619|-0.9619	5|10	.|0.20519	.|T	.|0.43	-12.1453|-12.1453	7.9462|7.9462	0.29987|0.29987	0.0:0.7148:0.1878:0.0973|0.0:0.7148:0.1878:0.0973	.|.	.|591;604;615	.|B4DRG7;E9PHA2;Q15003	.|.;.;CND2_HUMAN	K|K	55|615;479;604;604	.|ENSP00000240423:T615K;ENSP00000400774:T479K;ENSP00000405237:T604K;ENSP00000407308:T604K	.|ENSP00000240423:T615K	N|T	+|+	3|2	2|0	NCAPH|NCAPH	96395486|96395486	0.635000|0.635000	0.27199|0.27199	0.848000|0.848000	0.33437|0.33437	0.928000|0.928000	0.56348|0.56348	2.464000|2.464000	0.45067|0.45067	1.424000|1.424000	0.47217|0.47217	0.563000|0.563000	0.77884|0.77884	AAC|ACA	NCAPH-005	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338875.1		-1.204169	1	7	67	0	0.115264	1	0.119381	NM_015341	3	6.473595	38	0.073171
SLIT3	6586	broad.mit.edu	hg19	5	168175312	168175312	+	Silent	SNP	G	G	A	rs116182795	byFrequency	TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr5:168175312G>A	ENST00000519560.1	-	20	2684	c.2265C>T	c.(2263-2265)acC>acT	p.T755T	SLIT3_ENST00000404867.3_Silent_p.T755T|SLIT3_ENST00000332966.8_Silent_p.T755T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	755		apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		CTTACAGCTCGGTCACATCCT	0.612	0	116.0	116.0	116.0	5	168175312	2203	4300	6503	SO:0001819	synonymous_variant	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347		11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2	9693030, 9813312	Standard	NM_001271946	Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2265C>T	5.37:g.168175312G>A		A6H8U9|J3KNP3|O95804|Q9UFH5	ENST00000519560.1	37	CCDS4369.1																																																																																			SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4		49.084573	0	-12	108	0	0	1	0	NM_003062	20	56.224624	74	0.212766
GINM1	116254	broad.mit.edu	hg19	6	149901014	149901014	+	Silent	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:149901014C>T	ENST00000367419.5	+	5	595	c.474C>T	c.(472-474)aaC>aaT	p.N158N		NM_138785.3	NP_620140.1			glycoprotein integral membrane 1												TAGTTAAGAACCGGGGAGTAC	0.353	0	68.0	65.0	66.0	6	149901014	2202	4300	6502	SO:0001819	synonymous_variant	BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211		21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72		Standard	NM_138785	Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.474C>T	6.37:g.149901014C>T		B2RDY7|E1P5A2	ENST00000367419.5	37	CCDS5216.1																																																																																			GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042644.1		4.811017	0	-2	53	0	0	1	0	NM_138785	3	7.160935	17	0.150000
EVC	2121	broad.mit.edu	hg19	4	5735137	5735137	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr4:5735137C>T	ENST00000382674.2	+	5	861	c.677C>T	c.(676-678)aCg>aTg	p.T226M	EVC_ENST00000509451.1_Missense_Mutation_p.T226M|EVC_ENST00000264956.6_Missense_Mutation_p.T226M			P57679	EVC_HUMAN	Ellis van Creveld syndrome	226		muscle organ development	integral to membrane		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)			CATTTGGACACGGCACTGAGG	0.478	1	307.0	283.0	291.0	4	5735137	2203	4300	6503	SO:0001583	missense	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840		3497	protein-coding gene	gene with protein product		604831			10700184	Standard	NM_153717	Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000509451.1:c.677C>T	4.37:g.5735137C>T	ENSP00000426774:p.Thr226Met		ENST00000509451.1	37		.	.	.	.	.	.	.	.	.	.	C	3.901	-0.021972	0.07634	0.0	2.33E-4	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.54479	0.57;0.57;0.61	4.73	2.88	0.33553	.	0.947586	0.08861	N	0.883086	T	0.37265	0.0997	N	0.19112	0.55	0.09310	N	1	B	0.25719	0.132	B	0.19148	0.024	T	0.26744	-1.0094	10	0.52906	T	0.07	.	9.2585	0.37597	0.1429:0.7772:0.0:0.0798	.	226	P57679	EVC_HUMAN	M	226	ENSP00000264956:T226M;ENSP00000372120:T226M;ENSP00000426774:T226M	ENSP00000264956:T226M	T	+	2	0	EVC	5786038	0.000000	0.05858	0.006000	0.13384	0.078000	0.17371	0.536000	0.23129	1.121000	0.41925	-0.143000	0.13931	ACG	EVC-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000358875.1		84.684322	0	-12	338	0	0	1	0		42	113.687387	221	0.159696
FANCM	57697	broad.mit.edu	hg19	14	45668011	45668011	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr14:45668011G>T	ENST00000267430.5	+	22	5966	c.5881G>T	c.(5881-5883)Gtt>Ttt	p.V1961F	FANCM_ENST00000542564.2_Missense_Mutation_p.V1935F	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1961	Interaction with FAAP24 and EME1.	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85					TGGTATTCATGTTCCAACAGT	0.358	0	82.0	84.0	83.0	14	45668011	2203	4300	6503	SO:0001583	missense	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790	"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596	10997877, 16116422	Standard	NM_020937	Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000542564.2:c.5803G>T	14.37:g.45668011G>T	ENSP00000442493:p.Val1935Phe	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	ENST00000542564.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.07|10.07	1.249543|1.249543	0.22880|0.22880	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250;ENST00000555484	.|T;T;T	.|0.21361	.|2.61;2.61;2.01	5.71|5.71	2.89|2.89	0.33648|0.33648	.|RuvA domain 2-like (1);	.|0.127059	.|0.52532	.|D	.|0.000063	T|T	0.21022|0.21022	0.0506|0.0506	M|M	0.63843|0.63843	1.955|1.955	0.31377|0.31377	N|N	0.67947|0.67947	.|B;B	.|0.15719	.|0.003;0.014	.|B;B	.|0.17433	.|0.007;0.018	T|T	0.11421|0.11421	-1.0588|-1.0588	5|10	.|0.56958	.|D	.|0.05	.|.	7.6476|7.6476	0.28329|0.28329	0.1436:0.0:0.7221:0.1343|0.1436:0.0:0.7221:0.1343	.|.	.|1935;1961	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	F|F	928|1961;1935;1477;87	.|ENSP00000267430:V1961F;ENSP00000442493:V1935F;ENSP00000452033:V1477F	.|ENSP00000267430:V1961F	C|V	+|+	2|1	0|0	FANCM|FANCM	44737761|44737761	0.966000|0.966000	0.33281|0.33281	0.906000|0.906000	0.35671|0.35671	0.366000|0.366000	0.29705|0.29705	1.731000|1.731000	0.38135|0.38135	0.330000|0.330000	0.23485|0.23485	-0.152000|-0.152000	0.13540|0.13540	TGT|GTT	FANCM-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000410475.1		47.085225	1	-7	52	0	2.48551e-13	1	2.66962e-13	XM_048128	16	48.143281	31	0.340426
DPCR1	135656	broad.mit.edu	hg19	6	30919829	30919829	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr6:30919829C>G	ENST00000462446.1	+	2	3616	c.3588C>G	c.(3586-3588)tgC>tgG	p.C1196W	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Missense_Mutation_p.C38W			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	320			integral to membrane		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10					AGACCATATGCACCAAAGGGA	0.478	0	165.0	163.0	164.0	6	30919829	2203	4300	6503	SO:0001583	missense	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631		21666	protein-coding gene	gene with protein product		613928			12185533, 10677310	Standard	NM_080870	Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3588C>G	6.37:g.30919829C>G	ENSP00000417182:p.Cys1196Trp	C9IZC0|Q658M7|Q8WYN2	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355578	0.24598	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.24151	1.87;1.91	1.31	0.0321	0.14174	.	.	.	.	.	T	0.11836	0.0288	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	D	0.66979	0.948	T	0.11275	-1.0594	9	0.66056	D	0.02	14.3943	7.3939	0.26926	0.0:0.4153:0.5847:0.0	.	1196	E9PEI6	.	W	1196;320;38	ENSP00000417182:C1196W;ENSP00000305948:C38W	ENSP00000305948:C38W	C	+	3	2	DPCR1	31027808	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-6.305000	0.00071	-0.193000	0.10415	0.448000	0.29417	TGC	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3		56.952938	0	-7	65	0	0	1	0	NM_080870	22	61.575972	64	0.255814
TTC17	55761	broad.mit.edu	hg19	11	43429111	43429111	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr11:43429111C>T	ENST00000039989.4	+	15	2062	c.2048C>T	c.(2047-2049)gCc>gTc	p.A683V	TTC17_ENST00000299240.6_Missense_Mutation_p.A683V|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	683				binding	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53					CAAGCTTTGGCCATCAATAGC	0.388	0	68.0	60.0	62.0	11	43429111	2203	4300	6503	SO:0001583	missense	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841	"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product					12477932	Standard	NM_018259	Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2048C>T	11.37:g.43429111C>T	ENSP00000039989:p.Ala683Val	G3XAB3|Q8NEC0	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284051	0.23392	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.61274	0.12;0.12	5.63	4.72	0.59763	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.395423	0.29814	N	0.011133	T	0.55162	0.1903	L	0.55213	1.73	0.26891	N	0.967325	B;B;B	0.27997	0.197;0.19;0.164	B;B;B	0.30316	0.111;0.114;0.067	T	0.54214	-0.8327	10	0.52906	T	0.07	-4.8348	14.8381	0.70201	0.0:0.9309:0.0:0.0691	.	683;683;683	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	V	683	ENSP00000299240:A683V;ENSP00000039989:A683V	ENSP00000039989:A683V	A	+	2	0	TTC17	43385687	0.822000	0.29219	0.908000	0.35775	0.440000	0.31957	1.552000	0.36244	1.395000	0.46643	-0.189000	0.12847	GCC	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2		-2.414808	0	-19	58	0	0	1	0	NM_018259	3	6.888134	44	0.063830
ZNF195	0	broad.mit.edu	hg19	11	3380662	3380662	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr11:3380662C>T	ENST00000354599.6	-	4	1464	c.1360G>A	c.(1360-1362)Gaa>Aaa	p.E454K	ZNF195_ENST00000399602.4_Missense_Mutation_p.E526K|ZNF195_ENST00000429541.2_Missense_Mutation_p.E458K|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000343338.7_Missense_Mutation_p.E458K|ZNF195_ENST00000526601.1_Missense_Mutation_p.E507K|ZNF195_ENST00000005082.9_Missense_Mutation_p.E503K	NM_001242843.1|NM_001256825.1|NM_007152.4	NP_001229772.1|NP_001243754.1|NP_009083.2	O14628	ZN195_HUMAN	zinc finger protein 195	526		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	TTTCCACATTCGTCACATTTG	0.413	0	158.0	160.0	159.0	11	3380662	2056	4223	6279	SO:0001583	missense		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801	"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187			9344677	Standard	NM_001130520	Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1576G>A	11.37:g.3380662C>T	ENSP00000382511:p.Glu526Lys	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	ENST00000399602.4	37	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	c	13.72	2.320050	0.41096	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601	T;T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2;3.2	1.27	-0.151	0.13411	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11665	0.0284	N	0.16903	0.455	0.09310	N	1	P;P;D;P;D;P	0.67145	0.875;0.937;0.994;0.922;0.996;0.922	P;B;D;B;D;B	0.70227	0.807;0.209;0.946;0.133;0.968;0.133	T	0.28554	-1.0040	9	0.72032	D	0.01	.	6.6009	0.22701	0.0:0.6997:0.3003:0.0	.	507;385;503;458;526;454	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	K	454;526;458;458;503;507	ENSP00000346613:E454K;ENSP00000382511:E526K;ENSP00000344483:E458K;ENSP00000387998:E458K;ENSP00000005082:E503K;ENSP00000435828:E507K	ENSP00000005082:E503K	E	-	1	0	ZNF195	3337238	0.000000	0.05858	0.006000	0.13384	0.150000	0.21749	-0.845000	0.04340	0.638000	0.30545	0.305000	0.20034	GAA	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		128.865516	0	-1	167	0	0	1	0		41	129.101913	51	0.445652
KRT16	3868	broad.mit.edu	hg19	17	39767698	39767698	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr17:39767698G>A	ENST00000301653.4	-	3	734	c.670C>T	c.(670-672)Cgc>Tgc	p.R224C		NM_005557.3	NP_005548.2	P08779	K1C16_HUMAN	keratin 16	224	Coil 1B.|Rod.	cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Breast(137;0.000307)			AACACCCGGCGCAGGCCATTG	0.617	0	59.0	59.0	59.0	17	39767698	2203	4300	6503	SO:0001583	missense	S79867	CCDS11401.1	17q21.2	2013-01-16	2008-08-01		ENSG00000186832	ENSG00000186832	"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6423	protein-coding gene	gene with protein product	"""focal non-epidermolytic palmoplantar keratoderma"""	148067			2451124, 16831889	Standard	NM_005557	Approved	NEPPK	uc002hxg.4	P08779	OTTHUMG00000133495	ENST00000301653.4:c.670C>T	17.37:g.39767698G>A	ENSP00000301653:p.Arg224Cys	A8K488|P30654|Q16402|Q9UBG8	ENST00000301653.4	37	CCDS11401.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458154	0.43634	.	.	ENSG00000186832	ENST00000301653	D	0.92545	-3.06	4.84	4.84	0.62591	Filament (1);	0.000000	0.52532	D	0.000074	D	0.91549	0.7331	M	0.70108	2.13	0.54753	D	0.999988	B	0.33964	0.434	B	0.32465	0.146	D	0.91905	0.5535	10	0.66056	D	0.02	.	18.4976	0.90870	0.0:0.0:1.0:0.0	.	224	P08779	K1C16_HUMAN	C	224	ENSP00000301653:R224C	ENSP00000301653:R224C	R	-	1	0	KRT16	37021224	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	3.201000	0.51059	2.666000	0.90696	0.561000	0.74099	CGC	KRT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257408.1		-6.614947	0	0	97	0	0	1	0	NM_005557	4	8.306926	68	0.055556
ANO8	57719	broad.mit.edu	hg19	19	17439127	17439127	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V4-A9F4-01A-11D-A39W-08	TCGA-V4-A9F4-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc39a132-88f1-40d6-8931-c80d6b6e4135	4fdb815c-0d5d-47c5-ad0f-ea9309587d66	g.chr19:17439127delC	ENST00000159087.4	-	13	2228	c.2070delG	c.(2068-2070)gggfs	p.G690fs		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	690			chloride channel complex	chloride channel activity	autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27					CCCCGTCGGGCCCCTGGTCTC	0.741	0	8.0	9.0	9.0	19	17439127	2053	4141	6194	SO:0001589	frameshift_variant	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855	"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H	10997877, 24692353	Standard	NM_020959	Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.2070delG	19.37:g.17439127delC	ENSP00000159087:p.Gly690fs	A6NIJ0	ENST00000159087.4	37	CCDS32949.1																																																																																			ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	.	.		1	13					XM_050644	2		4	0.33
