Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		43.850190	0	-1	80	0	0	1	0	NM_002067	14	43.912763	17	0.451613
FRMD7	90167	broad.mit.edu	hg19	X	131212668	131212668	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chrX:131212668T>C	ENST00000298542.4	-	12	1552	c.1377A>G	c.(1375-1377)atA>atG	p.I459M	FRMD7_ENST00000464296.1_Missense_Mutation_p.I444M|FRMD7_ENST00000370879.1_Missense_Mutation_p.I339M	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	459		regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding	breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)				GGCCAGAATATATGCTCATGT	0.453	0	174.0	164.0	167.0	X	131212668	2203	4300	6503	SO:0001583	missense	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694		8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1	2063919, 17013395	Standard	NM_194277	Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1377A>G	X.37:g.131212668T>C	ENSP00000298542:p.Ile459Met	C0LLJ3|Q5JX99	ENST00000298542.4	37	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	T	0.220	-1.029676	0.02045	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.85861	-2.04;-1.69;-1.81	5.39	1.34	0.21922	.	0.716976	0.13440	N	0.387740	T	0.67344	0.2883	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.54748	-0.8247	10	0.44086	T	0.13	.	1.2566	0.01993	0.1252:0.2626:0.2007:0.4115	.	444;459	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	M	339;459;444	ENSP00000359916:I339M;ENSP00000298542:I459M;ENSP00000417996:I444M	ENSP00000298542:I459M	I	-	3	3	FRMD7	131040349	0.955000	0.32602	0.425000	0.26659	0.247000	0.25773	0.165000	0.16564	0.691000	0.31592	-0.360000	0.07572	ATA	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1		180.756382	0	-37	186	0	0	1	0	NM_194277	57	183.030375	97	0.370130
DCDC2B	149069	broad.mit.edu	hg19	1	32677692	32677692	+	Silent	SNP	G	G	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr1:32677692G>A	ENST00000409358.1	+	4	417	c.417G>A	c.(415-417)ctG>ctA	p.L139L		NM_001099434.1	NP_001092904.1	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	139	Doublecortin 2.	intracellular signal transduction			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)			ATGGGGACCTGGTAAGTCCCC	0.567	0	44.0	46.0	46.0	1	32677692	1904	4116	6020	SO:0001819	synonymous_variant	BC128073	CCDS44100.1	1p35.1	2008-05-13			ENSG00000222046	ENSG00000222046		32576	protein-coding gene	gene with protein product						Standard	NM_001099434	Approved		uc001bun.2	A2VCK2	OTTHUMG00000005741	ENST00000409358.1:c.417G>A	1.37:g.32677692G>A		B7ZBC6	ENST00000409358.1	37	CCDS44100.1																																																																																			DCDC2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328293.1		6.685775	0	-7	29	0	0	1	0	XM_940631	4	9.662737	22	0.153846
ITGB8	3696	broad.mit.edu	hg19	7	20421427	20421427	+	Silent	SNP	T	T	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr7:20421427T>C	ENST00000222573.4	+	6	1563	c.879T>C	c.(877-879)gaT>gaC	p.D293D	ITGB8_ENST00000537992.1_Silent_p.D158D	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8		VWFA.	cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity	NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37					TCGCTCTTGATAGCAAATTGG	0.428	0	143.0	126.0	132.0	7	20421427	2203	4300	6503	SO:0001819	synonymous_variant		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855	"""Integrins"""	6163	protein-coding gene	gene with protein product		604160				Standard	XM_005249751	Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.879T>C	7.37:g.20421427T>C		A4D133|B4DHD4	ENST00000222573.4	37	CCDS5370.1																																																																																			ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3		23.284390	0	3	79	0	0	1	0	NM_002214	11	30.457791	56	0.164179
PCDHA2	0	broad.mit.edu	hg19	5	140174912	140174912	+	Silent	SNP	G	G	T			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr5:140174912G>T	ENST00000526136.1	+	1	363	c.363G>T	c.(361-363)gtG>gtT	p.V121V	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Silent_p.V121V|PCDHA2_ENST00000520672.2_Silent_p.V121V|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1									NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		ATGTGGAAGTGGAGGTGAAGG	0.547	0	101.0	111.0	107.0	5	140174912	2203	4300	6503	SO:0001819	synonymous_variant	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969	"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308			10380929	Standard	NM_018905	Approved			Q9Y5H9		ENST00000520672.2:c.363G>T	5.37:g.140174912G>T		O75287|Q9BTV3	ENST00000520672.2	37																																																																																				PCDHA2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374265.2		5.143067	1	8	168	0	1.58986e-06	1	1.64875e-06	NM_018905	11	23.240528	101	0.098214
PADI2	11240	broad.mit.edu	hg19	1	17395607	17395607	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr1:17395607C>A	ENST00000375486.4	-	16	1993	c.1930G>T	c.(1930-1932)Gaa>Taa	p.E644*	PADI2_ENST00000466151.1_5'UTR|PADI2_ENST00000444885.2_Nonsense_Mutation_p.E528*	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	644		peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity	breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	CAGTGGACTTCCCCCAGAAAT	0.612	0	111.0	102.0	105.0	1	17395607	2203	4300	6503	SO:0001587	stop_gained	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935			2768262	Standard	NM_007365	Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1930G>T	1.37:g.17395607C>A	ENSP00000364635:p.Glu644*	Q96DA7|Q9UPN2	ENST00000375486.4	37	CCDS177.1	.	.	.	.	.	.	.	.	.	.	C	39	7.423699	0.98275	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.4562	17.5705	0.87933	0.0:1.0:0.0:0.0	.	.	.	.	X	644;528	.	ENSP00000364635:E644X	E	-	1	0	PADI2	17268194	1.000000	0.71417	0.921000	0.36526	0.900000	0.52787	7.513000	0.81739	2.494000	0.84150	0.655000	0.94253	GAA	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		65.423026	1	-6	97	0	7.88262e-20	1	8.82854e-20		23	66.046162	36	0.389831
ELTD1	64123	broad.mit.edu	hg19	1	79383680	79383680	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr1:79383680G>A	ENST00000370742.3	-	11	1580	c.1517C>T	c.(1516-1518)gCa>gTa	p.A506V		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	506		neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	GCACATCCATGCAAAAGCAGC	0.348	0	132.0	125.0	127.0	1	79383680	1884	4114	5998	SO:0001583	missense	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618	"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product					11050079	Standard	NM_022159	Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1517C>T	1.37:g.79383680G>A	ENSP00000359778:p.Ala506Val	B1AR71|Q5KU34	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	34	5.343919	0.95807	.	.	ENSG00000162618	ENST00000370742	T	0.43294	0.95	6.08	6.08	0.98989	GPCR, family 2-like (1);	0.050733	0.85682	D	0.000000	T	0.48502	0.1503	M	0.67700	2.07	0.80722	D	1	P	0.46395	0.877	P	0.51016	0.656	T	0.29274	-1.0017	9	.	.	.	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	506	Q9HBW9	ELTD1_HUMAN	V	506	ENSP00000359778:A506V	.	A	-	2	0	ELTD1	79156268	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GCA	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1		97.452591	0	-23	98	0	0	1	0	NM_022159	33	98.564964	54	0.379310
SMC1A	8243	broad.mit.edu	hg19	X	53410065	53410065	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chrX:53410065A>G	ENST00000322213.4	-	20	3210	c.3083T>C	c.(3082-3084)aTg>aCg	p.M1028T		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1028		cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity	NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49					CAGCTTTTCCATGGCCTTCAT	0.507	0	119.0	90.0	100.0	X	53410065	2203	4300	6503	SO:0001583	missense	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501	"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1	7757074	Standard	NM_006306	Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3083T>C	X.37:g.53410065A>G	ENSP00000323421:p.Met1028Thr	O14995|Q16351|Q2M228	ENST00000322213.4	37	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.475957	0.44044	.	.	ENSG00000072501	ENST00000322213	T	0.76709	-1.04	5.36	5.36	0.76844	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	L	0.55213	1.73	0.80722	D	1	B	0.21688	0.059	B	0.20184	0.028	T	0.71020	-0.4713	10	0.49607	T	0.09	.	13.367	0.60689	1.0:0.0:0.0:0.0	.	1028	Q14683	SMC1A_HUMAN	T	1028	ENSP00000323421:M1028T	ENSP00000323421:M1028T	M	-	2	0	SMC1A	53426790	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.346000	0.79347	1.798000	0.52647	0.430000	0.28490	ATG	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2		45.548485	0	-7	35	0	0	1	0	NM_006306	14	45.577411	16	0.466667
RHO	6010	broad.mit.edu	hg19	3	129249761	129249761	+	Missense_Mutation	SNP	G	G	A	rs104893774		TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr3:129249761G>A	ENST00000296271.3	+	2	498	c.404G>A	c.(403-405)cGg>cAg	p.R135Q		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	135		protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding	breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	GCCATCGAGCGGTACGTGGTG	0.622	0	256.0	202.0	220.0	3	129249761	2203	4300	6503	SO:0001583	missense	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914	"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4	2016091	Standard	NM_000539	Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.404G>A	3.37:g.129249761G>A	ENSP00000296271:p.Arg135Gln	Q16414|Q2M249	ENST00000296271.3	37	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	36	5.758799	0.96898	.	.	ENSG00000163914	ENST00000296271	D	0.97161	-4.27	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99327	0.9764	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98270	1.0503	10	0.87932	D	0	.	18.8606	0.92270	0.0:0.0:1.0:0.0	.	135	P08100	OPSD_HUMAN	Q	135	ENSP00000296271:R135Q	ENSP00000296271:R135Q	R	+	2	0	RHO	130732451	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.863000	0.99569	2.448000	0.82819	0.462000	0.41574	CGG	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1		-22.008008	0	-45	166	0	0	1	0	NM_000539	4	7.926643	121	0.032000
DVL2	1856	broad.mit.edu	hg19	17	7133647	7133647	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr17:7133647C>T	ENST00000005340.5	-	3	649	c.367G>A	c.(367-369)Gag>Aag	p.E123K	DVL2_ENST00000575458.1_Missense_Mutation_p.E123K|DVL2_ENST00000574642.1_5'UTR	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	123		canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity	breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25					CTGGTCCTCTCGGGTGGCAAA	0.617	0	80.0	89.0	86.0	17	7133647	2203	4300	6503	SO:0001583	missense	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975	"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""		8662242	Standard	NM_004422	Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.367G>A	17.37:g.7133647C>T	ENSP00000005340:p.Glu123Lys	D3DTN3|Q53XM0	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884765	0.91814	.	.	ENSG00000004975	ENST00000005340	T	0.05319	3.46	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.25005	0.0607	M	0.76838	2.35	0.58432	D	0.999996	D;D;D;D	0.89917	0.999;0.999;1.0;0.997	D;P;D;P	0.78314	0.972;0.89;0.991;0.833	T	0.00313	-1.1825	10	0.44086	T	0.13	-21.3078	14.4834	0.67599	0.0:1.0:0.0:0.0	.	30;123;123;123	B4DM44;B4DLQ0;B4E2D6;O14641	.;.;.;DVL2_HUMAN	K	123	ENSP00000005340:E123K	ENSP00000005340:E123K	E	-	1	0	DVL2	7074371	1.000000	0.71417	0.989000	0.46669	0.818000	0.46254	7.459000	0.80802	2.492000	0.84095	0.609000	0.83330	GAG	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2		83.448029	0	-13	87	0	0	1	0	NM_004422	26	83.509854	30	0.464286
CA2	760	broad.mit.edu	hg19	8	86389348	86389348	+	Splice_Site	SNP	G	G	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr8:86389348G>A	ENST00000285379.5	+	6	737		c.e6-1			NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II			one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding	central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					CCTTGTTCTAGGGCAAGAGTG	0.502	0	222.0	188.0	200.0	8	86389348	2203	4300	6503	SO:0001630	splice_region_variant	J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492			3107918	Standard	NM_000067	Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.508-1G>A	8.37:g.86389348G>A		B2R7G8|Q6FI12|Q96ET9	ENST00000285379.5	37	CCDS6239.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.091146	0.36855	.	.	ENSG00000104267	ENST00000285379	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8355	0.88694	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CA2	86576600	1.000000	0.71417	0.945000	0.38365	0.013000	0.08279	9.773000	0.98989	2.531000	0.85337	0.555000	0.69702	.	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381097.2		300.590150	0	15	128	0	0	1	0	NM_000067	90	302.697345	53	0.629371
DSCAM	1826	broad.mit.edu	hg19	21	42064866	42064866	+	Nonsense_Mutation	SNP	A	A	T			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr21:42064866A>T	ENST00000400454.1	-	3	855	c.378T>A	c.(376-378)taT>taA	p.Y126*		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	126	Ig-like C2-type 1.|Ig-like C2-type 2.	cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)			CACGGACTGTATAGGGCTCCC	0.498	0	109.0	107.0	108.0	21	42064866	2023	4177	6200	SO:0001587	stop_gained	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523			9426258	Standard	NM_001271534	Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.378T>A	21.37:g.42064866A>T	ENSP00000383303:p.Tyr126*	O60468	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	A	43	9.994410	0.99313	.	.	ENSG00000171587	ENST00000400454	.	.	.	5.93	3.58	0.41010	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4685	0.32971	0.7908:0.0:0.2092:0.0	.	.	.	.	X	126	.	ENSP00000383303:Y126X	Y	-	3	2	DSCAM	40986736	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.917000	0.39996	0.504000	0.28082	0.533000	0.62120	TAT	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1		34.045141	0	-16	59	0	0	1	0	NM_001389	19	48.308229	105	0.153226
CD163	9332	broad.mit.edu	hg19	12	7649512	7649512	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr12:7649512G>C	ENST00000359156.4	-	5	1198	c.996C>G	c.(994-996)agC>agG	p.S332R	CD163_ENST00000396620.3_Missense_Mutation_p.S332R|CD163_ENST00000541972.1_Missense_Mutation_p.S320R|CD163_ENST00000432237.2_Missense_Mutation_p.S332R	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	332	SRCR 3.	acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					GGCAAGAAACGCTGTCAAGCC	0.488	0	149.0	102.0	118.0	12	7649512	2203	4300	6503	SO:0001583	missense	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575	"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""		10403791, 8370408	Standard	NM_004244	Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.996C>G	12.37:g.7649512G>C	ENSP00000352071:p.Ser332Arg	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974559	0.34848	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.03	-4.84	0.03151	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.110760	0.06454	N	0.728203	T	0.24431	0.0592	N	0.17872	0.535	0.09310	N	1	P;B;P	0.50819	0.939;0.003;0.939	P;B;P	0.51135	0.66;0.005;0.66	T	0.28650	-1.0037	10	0.33141	T	0.24	.	7.7812	0.29066	0.4294:0.0:0.4558:0.1147	.	332;332;332	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	R	332;320;332;332	ENSP00000352071:S332R;ENSP00000444071:S320R;ENSP00000379863:S332R;ENSP00000403885:S332R	ENSP00000352071:S332R	S	-	3	2	CD163	7540779	0.000000	0.05858	0.022000	0.16811	0.784000	0.44337	-2.057000	0.01395	-0.866000	0.04068	-0.415000	0.06103	AGC	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2		82.483798	0	-13	52	0	0	1	0	NM_004244, NM_203416	25	83.032410	15	0.625000
MUSK	4593	broad.mit.edu	hg19	9	113449430	113449430	+	Silent	SNP	T	T	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr9:113449430T>C	ENST00000416899.2	+	3	366	c.240T>C	c.(238-240)aaT>aaC	p.N80N	MUSK_ENST00000374448.4_Silent_p.N80N|MUSK_ENST00000374440.3_5'UTR|MUSK_ENST00000189978.5_Silent_p.N80N			O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	80	Ig-like 1.	transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49					TCCGGGAGAATGGGCAGCTCC	0.488	0	161.0	164.0	163.0	9	113449430	2009	4179	6188	SO:0001819	synonymous_variant	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296			7546737	Standard	NM_005592	Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000189978.5:c.240T>C	9.37:g.113449430T>C		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	ENST00000189978.5	37																																																																																				MUSK-001	PUTATIVE	non_canonical_TEC|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053627.2		8.144414	0	5	95	0	0	1	0		8	19.412045	66	0.108108
ST8SIA3	51046	broad.mit.edu	hg19	18	55024275	55024275	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr18:55024275G>A	ENST00000324000.3	+	3	2468	c.434G>A	c.(433-435)cGg>cAg	p.R145Q		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	145		glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)	AATAACTTCCGGTCACTTCTT	0.383	0	114.0	115.0	115.0	18	55024275	2203	4300	6503	SO:0001583	missense	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511	"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C		Standard	NM_015879	Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.434G>A	18.37:g.55024275G>A	ENSP00000320431:p.Arg145Gln	A8K0F2|Q6B085|Q9NS41	ENST00000324000.3	37	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.415396	0.42817	0.0	4.65E-4	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.29655	1.56	5.74	5.74	0.90152	.	0.051831	0.85682	D	0.000000	T	0.28699	0.0711	L	0.47716	1.5	0.49687	D	0.999819	P	0.48407	0.91	B	0.35470	0.203	T	0.09400	-1.0676	10	0.51188	T	0.08	-9.2619	19.5308	0.95228	0.0:0.0:1.0:0.0	.	145	O43173	SIA8C_HUMAN	Q	252;145	ENSP00000320431:R145Q	ENSP00000320431:R145Q	R	+	2	0	ST8SIA3	53175273	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	4.487000	0.60293	2.715000	0.92844	0.655000	0.94253	CGG	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1		79.330365	0	-15	99	0	0	1	0	NM_015879	26	81.002892	50	0.342105
MCEE	84693	broad.mit.edu	hg19	2	71351503	71351503	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr2:71351503C>T	ENST00000244217.5	-	2	228	c.211G>A	c.(211-213)Gcc>Acc	p.A71T		NM_032601.3	NP_115990.3	Q96PE7	MCEE_HUMAN	methylmalonyl CoA epimerase	71		fatty acid beta-oxidation|L-methylmalonyl-CoA metabolic process	mitochondrial matrix	methylmalonyl-CoA epimerase activity	kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9					CTTACCTGGGCCCCCAGAATA	0.478	0	97.0	102.0	100.0	2	71351503	2203	4300	6503	SO:0001583	missense	AF364547	CCDS1915.1	2p13.3	2011-05-12			ENSG00000124370	ENSG00000124370		16732	protein-coding gene	gene with protein product	"""glyoxalase domain containing 2"""	608419			16697227, 16752391, 16843692	Standard	NM_032601	Approved	GLOD2	uc002shs.2	Q96PE7	OTTHUMG00000129709	ENST00000244217.5:c.211G>A	2.37:g.71351503C>T	ENSP00000244217:p.Ala71Thr	Q53TP1|Q8WW63	ENST00000244217.5	37	CCDS1915.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341316	0.81911	.	.	ENSG00000124370	ENST00000413592;ENST00000244217	T;T	0.70631	-0.5;-0.07	5.33	5.33	0.75918	Glyoxalase/fosfomycin resistance/dioxygenase (1);	0.049051	0.85682	D	0.000000	D	0.85414	0.5691	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86094	0.1552	10	0.48119	T	0.1	-21.6199	16.8888	0.86082	0.0:1.0:0.0:0.0	.	71	Q96PE7	MCEE_HUMAN	T	27;71	ENSP00000391140:A27T;ENSP00000244217:A71T	ENSP00000244217:A71T	A	-	1	0	MCEE	71205011	1.000000	0.71417	0.989000	0.46669	0.355000	0.29361	7.090000	0.76916	2.661000	0.90470	0.650000	0.86243	GCC	MCEE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251917.3		81.352059	0	-20	98	0	0	1	0	NM_032601	29	82.027984	44	0.397260
STAG1	10274	broad.mit.edu	hg19	3	136141361	136141361	+	Nonsense_Mutation	SNP	A	A	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr3:136141361A>C	ENST00000383202.2	-	19	2184	c.1928T>G	c.(1927-1929)tTa>tGa	p.L643*	STAG1_ENST00000536929.1_Nonsense_Mutation_p.L227*|STAG1_ENST00000434713.2_Nonsense_Mutation_p.L417*|STAG1_ENST00000236698.5_Nonsense_Mutation_p.L643*	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	643		cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding	NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58					TTCACTGCATAAGATACTATA	0.388	0	140.0	140.0	140.0	3	136141361	2203	4300	6503	SO:0001587	stop_gained	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007		11354	protein-coding gene	gene with protein product		604358			9305759	Standard	XM_006713471	Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000236698.5:c.1928T>G	3.37:g.136141361A>C	ENSP00000236698:p.Leu643*	O00539|Q6P275	ENST00000236698.5	37		.	.	.	.	.	.	.	.	.	.	A	31	5.072045	0.93950	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9214	0.79580	1.0:0.0:0.0:0.0	.	.	.	.	X	643;643;417;227	.	ENSP00000236698:L643X	L	-	2	0	STAG1	137624051	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.156000	0.67533	0.524000	0.50904	TTA	STAG1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357403.1		19.389449	0	-53	146	0	0	1	0	NM_005862	16	42.925789	136	0.105263
HSPA6	3310	broad.mit.edu	hg19	1	161495096	161495096	+	Silent	SNP	T	T	C			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr1:161495096T>C	ENST00000309758.4	+	1	1061	c.648T>C	c.(646-648)gcT>gcC	p.A216A	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	216		response to unfolded protein		ATP binding	endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		CCATTGACGCTGGTGTCTTTG	0.597	1	45.0	48.0	47.0	1	161495096	2203	4300	6503	SO:0001819	synonymous_variant		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110	"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""		1346391	Standard	NM_002155	Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.648T>C	1.37:g.161495096T>C		Q1HBA8|Q8IYK7|Q9BT95	ENST00000309758.4	37	CCDS1231.1																																																																																			HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1		3.672462	0	-2	40	0	0	1	0	NM_002155	4	9.306377	33	0.108108
OR2B2	81697	broad.mit.edu	hg19	6	27879977	27879977	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr6:27879977C>A	ENST00000303324.2	-	1	197	c.121G>T	c.(121-123)Ggc>Tgc	p.G41C		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	41		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22					GTCAGATTGCCAAAGATTGTC	0.398	0	103.0	102.0	103.0	6	27879977	2203	4300	6503	SO:0001583	missense	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131	"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9		Standard	NM_033057	Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.121G>T	6.37:g.27879977C>A	ENSP00000304419:p.Gly41Cys	B2RNH2|Q9GZL2|Q9Y299	ENST00000303324.2	37	CCDS4641.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268499	0.40095	.	.	ENSG00000168131	ENST00000303324	T	0.04454	3.62	4.37	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39759	U	0.001263	T	0.26629	0.0651	H	0.98682	4.3	0.28609	N	0.908775	D	0.89917	1.0	D	0.74023	0.982	T	0.48502	-0.9030	10	0.87932	D	0	.	15.2222	0.73320	0.0:1.0:0.0:0.0	.	41	Q9GZK3	OR2B2_HUMAN	C	41	ENSP00000304419:G41C	ENSP00000304419:G41C	G	-	1	0	OR2B2	27987956	0.012000	0.17670	0.997000	0.53966	0.225000	0.24961	2.428000	0.44749	2.346000	0.79739	0.563000	0.77884	GGC	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1		71.209905	1	-20	55	0	4.22769e-11	1	4.5529e-11		26	75.273405	67	0.279570
SPECC1	92521	broad.mit.edu	hg19	17	20108455	20108455	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr17:20108455G>A	ENST00000395530.2	+	2	1058	c.850G>A	c.(850-852)Gta>Ata	p.V284I	SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395525.3_Missense_Mutation_p.V284I|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395529.3_Missense_Mutation_p.V365I|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000261503.5_Missense_Mutation_p.V365I|SPECC1_ENST00000395527.4_Missense_Mutation_p.V365I|SPECC1_ENST00000395522.2_Missense_Mutation_p.V284I	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	365	Ser-rich.		nucleus		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)	CCCAAACAGCGTAAGTGAATT	0.473	0	110.0	118.0	116.0	17	20108455	2203	4300	6503	SO:0001583	missense	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487		30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793			15602574, 18763323, 15087372	Standard	NM_001033553	Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000395522.2:c.850G>A	17.37:g.20108455G>A	ENSP00000378893:p.Val284Ile	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	ENST00000395522.2	37	CCDS58531.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.106177	0.00356	0.0	1.16E-4	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.06371	3.31;3.31;3.31;3.31	5.38	3.22	0.36961	.	1.379630	0.04502	N	0.381470	T	0.03095	0.0091	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B	0.10296	0.001;0.003;0.003;0.003;0.001	B;B;B;B;B	0.10450	0.001;0.002;0.005;0.003;0.001	T	0.41627	-0.9498	10	0.19590	T	0.45	-0.5243	6.0425	0.19742	0.3356:0.0:0.6644:0.0	.	365;284;284;365;365	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	I	365;365;365;284;284;284	ENSP00000261503:V365I;ENSP00000378900:V365I;ENSP00000378893:V284I;ENSP00000378896:V284I	ENSP00000261503:V365I	V	+	1	0	SPECC1	20049047	0.004000	0.15560	0.000000	0.03702	0.002000	0.02628	1.601000	0.36773	0.729000	0.32403	0.655000	0.94253	GTA	SPECC1-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132367.4		0.555028	0	-28	92	0	0	1	0	NM_152904	7	16.696593	82	0.078652
SOX3	6658	broad.mit.edu	hg19	X	139586345	139586347	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chrX:139586345_139586347delGGC	ENST00000370536.2	-	1	878_880	c.879_881delGCC	c.(877-882)ccgccc>ccc	p.293_294PP>P		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	293	Poly-Pro.	face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)				cggcagcgcgggcggcggcggcg	0.719	0									SO:0001651	inframe_deletion		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595	"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP	15800844	Standard	NM_005634	Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.879_881delGCC	X.37:g.139586354_139586356delGGC	ENSP00000359567:p.Pro294del	P35714|Q5JWI3|Q9NP49	ENST00000370536.2	37	CCDS14669.1																																																																																			SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1	.	.		9	13						2		4	0.33
KIF7	374654	broad.mit.edu	hg19	15	90185583	90185583	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr15:90185583delC	ENST00000394412.3	-	11	2321	c.2245delG	c.(2245-2247)gagfs	p.E749fs		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	749		microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding	central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)		GCCTCCTGCTCCAGCTCCCGG	0.667	0	15.0	15.0	15.0	15	90185583	2198	4298	6496	SO:0001589	frameshift_variant	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813	"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254			11416179, 15547730	Standard	NM_198525	Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2245delG	15.37:g.90185583delC	ENSP00000377934:p.Glu749fs	Q3SXY0|Q6UXE9|Q8IW72	ENST00000394412.3	37	CCDS32325.2																																																																																			KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	.	.		8	15					NM_198525	2		4	0.33
TTC25	83538	broad.mit.edu	hg19	17	40107073	40107073	+	RNA	DEL	G	G	-			TCGA-VD-A8KG-01A-11D-A39W-08	TCGA-VD-A8KG-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7094897f-1217-43aa-b8f8-d67eb7b00b47	ac53a009-1757-407f-a80b-80fda82fce35	g.chr17:40107073delG	ENST00000591658.1	+	0	1213							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25				cytoplasm	protein binding	endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)			TGGAAAGGATGGTGCTGAGCA	0.587	0	61.0	58.0	59.0	17	40107073	2100	4212	6312			AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815	"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product						Standard	XM_006722129	Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40107073delG		Q6NX40|Q6PJ04|Q9H0K5	ENST00000591658.1	37																																																																																				TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	.	.		1	13					NM_031421	2		4	0.33
