Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
TEX13A	56157	broad.mit.edu	hg19	X	104463874	104463874	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chrX:104463874G>A	ENST00000372578.3	-	3	1115	c.1004C>T	c.(1003-1005)cCg>cTg	p.P335L	TEX13A_ENST00000372575.1_Missense_Mutation_p.P335L|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000413579.1_Silent_p.S334S|IL1RAPL2_ENST00000372582.1_Intron	NM_031274.3	NP_112564.1	Q9BXU3	TX13A_HUMAN	testis expressed 13A	0			intracellular	zinc ion binding	large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8					CCTCCCAGTCGGAAGGCAGCT	0.537	0	104.0	99.0	100.0	X	104463874	2150	4248	6398	SO:0001583	missense	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629		11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""		11279525	Standard	NM_031274	Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000372578.3:c.1004C>T	X.37:g.104463874G>A	ENSP00000361659:p.Pro335Leu	B1B1G8|Q32NB6	ENST00000372578.3	37		.	.	.	.	.	.	.	.	.	.	G	9.010	0.982250	0.18889	.	.	ENSG00000133149	ENST00000372578;ENST00000372575	.	.	.	3.01	1.16	0.20824	.	.	.	.	.	T	0.35913	0.0948	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36744	-0.9735	5	0.87932	D	0	.	3.0504	0.06167	0.1549:0.0:0.5797:0.2653	.	.	.	.	L	335	.	ENSP00000361656:P335L	P	-	2	0	TEX13A	104350530	0.008000	0.16893	0.000000	0.03702	0.001000	0.01503	1.052000	0.30429	0.174000	0.19809	-0.776000	0.03382	CCG	TEX13A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057774.1		0.698932	0	-47	26	0	0	1	0	NM_031274	3	6.527967	31	0.088235
KAL1	3730	broad.mit.edu	hg19	X	8699907	8699907	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chrX:8699907C>A	ENST00000262648.3	-	1	320	c.171G>T	c.(169-171)caG>caT	p.Q57H		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	57		axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity	breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32					TGCGAGTGATCTGCAGGCTCA	0.756	0	9.0	10.0	10.0	X	8699907	2091	4053	6144	SO:0001583	missense		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201	"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX	11463336	Standard	NM_000216	Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.171G>T	X.37:g.8699907C>A	ENSP00000262648:p.Gln57His	B2RPF8	ENST00000262648.3	37	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	c	1.698	-0.502232	0.04261	.	.	ENSG00000011201	ENST00000262648	T	0.73152	-0.72	3.54	1.68	0.24146	.	0.262685	0.30329	U	0.009869	T	0.38026	0.1025	N	0.04162	-0.26	0.23180	N	0.998162	B	0.02656	0.0	B	0.01281	0.0	T	0.30475	-0.9977	10	0.05620	T	0.96	.	6.4111	0.21692	0.0:0.5508:0.3447:0.1045	.	57	P23352	KALM_HUMAN	H	57	ENSP00000262648:Q57H	ENSP00000262648:Q57H	Q	-	3	2	KAL1	8659907	1.000000	0.71417	0.993000	0.49108	0.974000	0.67602	2.116000	0.41930	-0.029000	0.13827	-0.322000	0.08575	CAG	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1		56.091680	1	-17	15	0	3.62473e-10	1	4.25512e-10	NM_000216	17	59.028693	2	0.894737
TTN	7273	broad.mit.edu	hg19	2	179427170	179427170	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr2:179427170C>A	ENST00000589042.1	-	326	83913	c.83689G>T	c.(83689-83691)Ggt>Tgt	p.G27897C	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000591111.1_Missense_Mutation_p.G26256C|TTN_ENST00000342175.6_Missense_Mutation_p.G19024C|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G18957C|TTN_ENST00000342992.6_Missense_Mutation_p.G25329C|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G18832C|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	26256	Fibronectin type-III 103.			ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		ACCACATAACCAGTAATTTTG	0.443	0	72.0	73.0	72.0	2	179427170	1936	4149	6085	SO:0001583	missense	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.83689G>T	2.37:g.179427170C>A	ENSP00000467141:p.Gly27897Cys	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389050	0.25118	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.89	5.01	0.66863	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75867	0.3908	M	0.85630	2.765	0.34300	D	0.684187	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72625	0.978;0.978;0.978;0.968	D	0.84632	0.0690	9	0.87932	D	0	.	9.9879	0.41852	0.1388:0.7925:0.0:0.0687	.	18832;18957;19024;26256	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	25329;18832;19024;18957;18830	ENSP00000343764:G25329C;ENSP00000434586:G18832C;ENSP00000340554:G19024C;ENSP00000352154:G18957C	ENSP00000340554:G19024C	G	-	1	0	TTN	179135416	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.239000	0.43079	1.473000	0.48159	0.655000	0.94253	GGT	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		-3.715808	1	-6	38	0	1	1	1	NM_133378	3	6.406204	47	0.060000
CD160	11126	broad.mit.edu	hg19	1	145706743	145706743	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr1:145706743C>A	ENST00000369290.1	-	2	173	c.16G>T	c.(16-18)Ggc>Tgc	p.G6C	CD160_ENST00000235933.6_Missense_Mutation_p.G6C|CD160_ENST00000369288.2_Missense_Mutation_p.G6C|CD160_ENST00000401557.3_Missense_Mutation_p.G6C			O95971	BY55_HUMAN	CD160 molecule	6		cell proliferation|cell surface receptor linked signaling pathway|cellular defense response|regulation of immune response	anchored to plasma membrane	MHC class I receptor activity|receptor binding	endometrium(3)|large_intestine(2)|lung(2)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)		CAGCCTCTGCCGGGTTCCAAC	0.577	0	66.0	62.0	63.0	1	145706743	2203	4300	6503	SO:0001583	missense	AF060981	CCDS72861.1	1q21.2	2011-01-25	2006-03-28		ENSG00000117281	ENSG00000117281	"""CD molecules"""	17013	protein-coding gene	gene with protein product		604463	"""CD160 antigen"""		9743336, 9973372	Standard	NM_007053	Approved	BY55, NK1, NK28	uc001eol.1	O95971	OTTHUMG00000013749	ENST00000369288.2:c.16G>T	1.37:g.145706743C>A	ENSP00000358294:p.Gly6Cys		ENST00000369288.2	37	CCDS923.1	.	.	.	.	.	.	.	.	.	.	C	9.058	0.993681	0.19043	.	.	ENSG00000117281	ENST00000235933;ENST00000369288;ENST00000369290;ENST00000401557	T;T;T	0.64085	-0.08;-0.08;-0.08	3.68	0.462	0.16695	.	0.204155	0.24654	N	0.036687	T	0.25791	0.0628	L	0.29908	0.895	0.09310	N	1	P;B	0.51351	0.944;0.328	B;B	0.42771	0.397;0.077	T	0.18398	-1.0338	10	0.87932	D	0	-4.0964	2.8773	0.05635	0.2176:0.5364:0.0:0.246	.	6;6	Q5T2V6;O95971	.;BY55_HUMAN	C	6	ENSP00000235933:G6C;ENSP00000358294:G6C;ENSP00000385199:G6C	ENSP00000235933:G6C	G	-	1	0	CD160	144418100	0.051000	0.20477	0.068000	0.19968	0.045000	0.14185	0.726000	0.25984	0.369000	0.24510	-0.140000	0.14226	GGC	CD160-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038532.2		0.197941	1	-6	47	0	1	1	1	NM_007053	3	6.812117	34	0.081081
PPP1R3B	79660	broad.mit.edu	hg19	8	8998589	8998589	+	Silent	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr8:8998589C>T	ENST00000310455.3	-	2	723	c.573G>A	c.(571-573)acG>acA	p.T191T	PPP1R3B_ENST00000519699.1_Silent_p.T191T	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	191	CBM21.	glycogen metabolic process			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)	CGAAGGAGAACGTGTCCCTGT	0.483	0	206.0	170.0	182.0	8	8998589	2203	4300	6503	SO:0001819	synonymous_variant	AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""		11948623, 17555403	Standard	NM_024607	Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.573G>A	8.37:g.8998589C>T		B3KTV3|Q9H812	ENST00000310455.3	37	CCDS5973.1																																																																																			PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251472.1		112.693498	0	-19	60	0	0	1	0	NM_024607	37	112.820906	44	0.456790
NCOA2	10499	broad.mit.edu	hg19	8	71050447	71050447	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr8:71050447C>T	ENST00000452400.2	-	15	3330	c.3149G>A	c.(3148-3150)aGc>aAc	p.S1050N	NCOA2_ENST00000267974.4_Missense_Mutation_p.S138N	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1050		cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)		CCTGTTTTGGCTGGCAAAAGA	0.488	0	77.0	78.0	77.0	8	71050447	1884	4096	5980	SO:0001583	missense	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993			9111344, 8670870	Standard	XM_005251128	Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3149G>A	8.37:g.71050447C>T	ENSP00000399968:p.Ser1050Asn	Q14CD2	ENST00000452400.2	37	CCDS47872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.459|5.459	0.269832|0.269832	0.10349|0.10349	.|.	.|.	ENSG00000140396|ENSG00000140396	ENST00000518363|ENST00000452400;ENST00000267974	.|T;T	.|0.06933	.|4.74;3.24	5.88|5.88	0.93|0.93	0.19454|0.19454	.|.	.|0.493833	.|0.25383	.|N	.|0.031074	T|T	0.02888|0.02888	0.0086|0.0086	N|N	0.03000|0.03000	-0.44|-0.44	0.25544|0.25544	N|N	0.987155|0.987155	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.002;0.0	T|T	0.46610|0.46610	-0.9179|-0.9179	5|10	.|0.07644	.|T	.|0.81	.|.	11.1292|11.1292	0.48336|0.48336	0.0:0.4623:0.0:0.5377|0.0:0.4623:0.0:0.5377	.|.	.|138;1050	.|F8WAJ2;Q15596	.|.;NCOA2_HUMAN	T|N	151|1050;138	.|ENSP00000399968:S1050N;ENSP00000267974:S138N	.|ENSP00000267974:S138N	A|S	-|-	1|2	0|0	NCOA2|NCOA2	71213001|71213001	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.955000|0.955000	0.61496|0.61496	1.358000|1.358000	0.34102|0.34102	-0.111000|-0.111000	0.12001|0.12001	0.655000|0.655000	0.94253|0.94253	GCC|AGC	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		60.539030	0	-10	26	0	0	1	0		19	60.597090	16	0.542857
MYO3B	140469	hgsc.bcm.edu	hg19	2	171356174	171356174	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1																										CAAATATTACCATGTTGAGCA	0.398	1	82.0	77.0	78.0	2	171356174	1871	4109	5980	SO:0001583	missense		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909	"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040				Standard	NM_001083615	Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3145C>T	2.37:g.171356174C>T	ENSP00000386213:p.His1049Tyr	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792220	0.90453	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.70986	-0.53;1.56;-0.53;1.56	5.78	5.78	0.91487	Myosin head, motor domain (1);	0.044994	0.85682	D	0.000000	D	0.87172	0.6111	M	0.87381	2.88	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.994;0.999	D	0.88290	0.2942	10	0.72032	D	0.01	.	20.0278	0.97529	0.0:1.0:0.0:0.0	.	1049;1049;1049	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	Y	1049;1049;1048;1058;1058	ENSP00000386497:H1049Y;ENSP00000386213:H1049Y;ENSP00000446237:H1058Y;ENSP00000335100:H1058Y	ENSP00000314213:H1048Y	H	+	1	0	MYO3B	171064420	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.438000	0.80431	2.732000	0.93576	0.655000	0.94253	CAT	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1				-11	37						16		23	
URAD	646625	broad.mit.edu	hg19	13	28562757	28562757	+	Silent	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr13:28562757G>A	ENST00000332715.5	-	1	34	c.18C>T	c.(16-18)gtC>gtT	p.V6V		NM_001105577.1	NP_001099047.1			ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase												CCATGGAGTTGACCTTCTCAA	0.537	0	93.0	98.0	97.0	13	28562757	2097	4227	6324	SO:0001819	synonymous_variant		CCDS45020.1	13q12.2	2014-04-09	2013-06-18	2013-06-18	ENSG00000183463	ENSG00000183463		17785	protein-coding gene	gene with protein product	"""OHCU decarboxylase"""	615804	"""parahox cluster neighbor"""	PRHOXNB	16462750	Standard	NM_001105577	Approved		uc010aan.1	A6NGE7	OTTHUMG00000186217	ENST00000332715.5:c.18C>T	13.37:g.28562757G>A			ENST00000332715.5	37	CCDS45020.1																																																																																			URAD-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472432.1		99.730906	0	-16	72	0	0	1	0		34	100.474889	51	0.400000
NXPH3	11248	broad.mit.edu	hg19	17	47656053	47656053	+	Silent	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr17:47656053G>A	ENST00000328741.5	+	2	512	c.150G>A	c.(148-150)cgG>cgA	p.R50R	NXPH3_ENST00000513748.1_Silent_p.R50R	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	50	II.	neuropeptide signaling pathway	extracellular region		endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)				CTCGGAAGCGGGGCCACATCT	0.677	0	34.0	38.0	37.0	17	47656053	2203	4298	6501	SO:0001819	synonymous_variant	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575		8077	protein-coding gene	gene with protein product		604636			9570794	Standard	NM_007225	Approved	NPH3	uc002ipa.3	O95157		ENST00000513748.1:c.150G>A	17.37:g.47656053G>A		Q8NDC3|Q8TBF6|Q9ULR1	ENST00000513748.1	37																																																																																				NXPH3-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365144.1		133.587680	0	-7	55	0	0	1	0		43	134.032821	31	0.581081
PSEN2	5664	broad.mit.edu	hg19	1	227071592	227071592	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr1:227071592C>T	ENST00000366782.1	+	5	927	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C	PSEN2_ENST00000366783.3_Missense_Mutation_p.R110C|PSEN2_ENST00000422240.2_Missense_Mutation_p.R110C|PSEN2_ENST00000340188.4_Missense_Mutation_p.R110C|PSEN2_ENST00000391872.2_Missense_Mutation_p.R143C			P49810	PSN2_HUMAN	presenilin 2 (Alzheimer disease 4)	110		amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding	cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)			CAAGTCTGTGCGCTTCTACAC	0.602	0	97.0	88.0	91.0	1	227071592	2203	4300	6503	SO:0001583	missense	BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801		9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4	7638621	Standard	NM_000447	Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366782.1:c.427C>T	1.37:g.227071592C>T	ENSP00000355746:p.Arg143Cys	A8K8D4|B1AP21|Q96P32	ENST00000366782.1	37		.	.	.	.	.	.	.	.	.	.	C	21.4	4.143501	0.77888	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000495488;ENST00000422240;ENST00000366782;ENST00000391872	D;D;D;D;D;D	0.99537	-6.11;-6.11;-6.11;-6.11;-6.11;-6.11	5.49	4.55	0.56014	.	0.043981	0.85682	D	0.000000	D	0.99205	0.9724	L	0.48642	1.525	0.54753	D	0.999989	D;D	0.69078	0.997;0.997	P;P	0.61658	0.892;0.892	D	0.99010	1.0814	10	0.72032	D	0.01	.	13.1833	0.59668	0.2903:0.7097:0.0:0.0	.	110;110	A8K8D4;P49810	.;PSN2_HUMAN	C	110;110;110;110;143;143	ENSP00000355747:R110C;ENSP00000339860:R110C;ENSP00000429682:R110C;ENSP00000403737:R110C;ENSP00000355746:R143C;ENSP00000375745:R143C	ENSP00000339860:R110C	R	+	1	0	PSEN2	225138215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.474000	0.53129	1.274000	0.44362	0.650000	0.86243	CGC	PSEN2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000091540.1		-16.787620	0	-13	83	0	0	1	0	NM_000447	4	7.439110	101	0.038095
RBM12	10137	broad.mit.edu	hg19	20	34241273	34241273	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr20:34241273G>T	ENST00000374114.3	-	3	2235	c.1972C>A	c.(1972-1974)Ccc>Acc	p.P658T	CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397442.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P658T|CPNE1_ENST00000397443.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.P658T|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397445.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	658	Gly-rich.|Pro-rich.		nucleus	nucleotide binding|protein binding|RNA binding	breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)		CCCACACCGGGCAGTCCCGCA	0.582	0	37.0	39.0	38.0	20	34241273	2203	4300	6503	SO:0001583	missense	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462	"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179			11435693	Standard	NM_006047	Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1972C>A	20.37:g.34241273G>T	ENSP00000363228:p.Pro658Thr	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156482	0.38119	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.19938	2.11;2.11;2.11	4.21	3.25	0.37280	.	0.000000	0.37669	N	0.001982	T	0.13756	0.0333	N	0.19112	0.55	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.06954	-1.0798	10	0.30854	T	0.27	-2.3869	12.9934	0.58634	0.0:0.0:0.8366:0.1634	.	658	Q9NTZ6	RBM12_HUMAN	T	658;658;658;457	ENSP00000363228:P658T;ENSP00000352668:P658T;ENSP00000363217:P658T	ENSP00000339879:P457T	P	-	1	0	RBM12	33704687	1.000000	0.71417	0.925000	0.36789	0.026000	0.11368	4.663000	0.61532	1.333000	0.45449	-0.241000	0.12123	CCC	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1		59.514582	1	-12	64	0	4.35082e-09	1	4.89467e-09	NM_006047	21	60.679677	39	0.350000
PDE3A	5139	broad.mit.edu	hg19	12	20766410	20766410	+	Missense_Mutation	SNP	G	G	A	rs150253039	byFrequency	TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr12:20766410G>A	ENST00000359062.3	+	3	1085	c.1045G>A	c.(1045-1047)Gtc>Atc	p.V349I	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	349		lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding	NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			GGACATCGCCGTCATGGGCGA	0.517	2	94.0	85.0	88.0	12	20766410	2203	4300	6503	SO:0001583	missense		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805			1315035, 10679291	Standard	NM_000921	Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1045G>A	12.37:g.20766410G>A	ENSP00000351957:p.Val349Ile	O60865|Q13348|Q17RD1	ENST00000359062.3	37	CCDS31754.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	29.0	4.967825	0.92855	0.001589	1.16E-4	ENSG00000172572	ENST00000359062	T	0.55413	0.52	5.86	5.86	0.93980	.	3.182960	0.00541	N	0.000228	T	0.78916	0.4359	M	0.71206	2.165	0.58432	D	0.999995	D	0.76494	0.999	D	0.75020	0.985	T	0.62627	-0.6814	10	0.51188	T	0.08	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	349	Q14432	PDE3A_HUMAN	I	349	ENSP00000351957:V349I	ENSP00000351957:V349I	V	+	1	0	PDE3A	20657677	1.000000	0.71417	0.991000	0.47740	0.671000	0.39405	8.848000	0.92172	2.937000	0.99478	0.650000	0.86243	GTC	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		-9.364453	0	-24	56	0	0	1	0		4	6.990393	73	0.051948
MMP20	9313	broad.mit.edu	hg19	11	102487572	102487572	+	Silent	SNP	G	G	C			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr11:102487572G>C	ENST00000260228.2	-	2	357	c.345C>G	c.(343-345)ccC>ccG	p.P115P	RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	O60882	MMP20_HUMAN	matrix metallopeptidase 20	115		proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding	endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	TTTTCCATTTGGGTTCACCAG	0.418	1	96.0	85.0	89.0	11	102487572	2203	4299	6502	SO:0001819	synonymous_variant	Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674		7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""		9398237	Standard	NM_004771	Approved		uc001phc.3	O60882		ENST00000260228.2:c.345C>G	11.37:g.102487572G>C		D3DUA8|Q9H3Q0	ENST00000260228.2	37	CCDS8318.1																																																																																			MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		53.336514	0	-11	35	0	0	1	0		18	53.470444	23	0.439024
GPATCH8	23131	broad.mit.edu	hg19	17	42477396	42477396	+	Silent	SNP	T	T	C			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr17:42477396T>C	ENST00000434000.1	-	9	2097	c.1815A>G	c.(1813-1815)aaA>aaG	p.K605K	GPATCH8_ENST00000591680.1_Silent_p.K683K			Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	683			intracellular	nucleic acid binding|zinc ion binding	breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)	GTTTGCTGGATTTTTTGTGCT	0.463	0	216.0	217.0	217.0	17	42477396	2203	4300	6503	SO:0001819	synonymous_variant	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566	"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8	9628581	Standard	NM_001002909	Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.2049A>G	17.37:g.42477396T>C		B9EGP9|O60300|Q8TB99	ENST00000591680.1	37	CCDS32666.1																																																																																			GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1		237.151242	0	-57	168	0	0	1	0	NM_001002909	73	237.832328	96	0.431953
SOST	50964	broad.mit.edu	hg19	17	41835968	41835968	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr17:41835968G>A	ENST00000301691.2	-	1	188	c.142C>T	c.(142-144)Ccg>Tcg	p.P48S		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	48		negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding	large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)	TCCAGCTCCGGTGGAGGCTCG	0.607	0	64.0	61.0	62.0	17	41835968	2203	4300	6503	SO:0001583	missense	AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941		13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""		11179006, 11181578	Standard	NM_025237	Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.142C>T	17.37:g.41835968G>A	ENSP00000301691:p.Pro48Ser	Q495N9	ENST00000301691.2	37	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	G	6.657	0.489703	0.12702	.	.	ENSG00000167941	ENST00000301691	T	0.75821	-0.97	4.26	4.26	0.50523	.	1.314110	0.04876	N	0.446883	T	0.56093	0.1962	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.48670	-0.9015	10	0.07325	T	0.83	-24.0754	7.3891	0.26899	0.0:0.1837:0.6264:0.1899	.	48	Q9BQB4	SOST_HUMAN	S	48	ENSP00000301691:P48S	ENSP00000301691:P48S	P	-	1	0	SOST	39191494	0.244000	0.23889	0.008000	0.14137	0.972000	0.66771	1.235000	0.32671	2.207000	0.71202	0.555000	0.69702	CCG	SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1		93.957856	0	-27	64	0	0	1	0	NM_025237	33	94.564953	48	0.407407
OBSCN	84033	ucsc.edu	hg19	1	228521350	228521350	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1																										GCCCACATCCGCATGACTGAC	0.592	0	55.0	60.0	58.0	1	228521350	2115	4229	6344	SO:0001583	missense	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358	"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616			11448995, 11814696	Standard	NM_001098623	Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000570156.2:c.18794G>A	1.37:g.228521350G>A	ENSP00000455507:p.Arg6265His	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	ENST00000570156.2	37	CCDS59204.1	.	.	.	.	.	.	.	.	.	.	G	9.944	1.218310	0.22373	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.86	-1.45	0.08828	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.470562	0.20918	N	0.083335	T	0.38348	0.1037	N	0.16862	0.45	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.06405	0.002;0.002	T	0.12630	-1.0540	10	0.15066	T	0.55	.	3.6812	0.08310	0.2763:0.0764:0.4946:0.1527	.	5308;5308	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	5308;5308;2942;2427	ENSP00000284548:R5308H;ENSP00000409493:R5308H;ENSP00000355668:R2942H;ENSP00000355670:R2427H	ENSP00000284548:R5308H	R	+	2	0	OBSCN	226587973	0.476000	0.25901	0.018000	0.16275	0.001000	0.01503	0.848000	0.27710	-0.326000	0.08564	-2.034000	0.00421	CGC	OBSCN-011	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000421354.3				-5	16					NM_052843	4		13	
MAPK8IP2	23542	broad.mit.edu	hg19	22	51040256	51040256	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr22:51040256A>C	ENST00000329492.3	+	2	221	c.104A>C	c.(103-105)gAa>gCa	p.E35A	MAPK8IP2_ENST00000442429.2_Missense_Mutation_p.E35A|MAPK8IP2_ENST00000399912.1_5'UTR|MAPK8IP2_ENST00000341339.4_Missense_Mutation_p.E35A	NM_012324.3	NP_036456.1	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting protein 2	35	Asp/Glu-rich (acidic).	behavioral fear response|dendrite morphogenesis|MAPKKK cascade|nonassociative learning|positive regulation of anti-apoptosis|regulation of excitatory postsynaptic membrane potential|regulation of JNK cascade|regulation of receptor activity|regulation of synaptic transmission, glutamatergic|signal complex assembly|social behavior	cytoplasm|postsynaptic density	beta-amyloid binding|kinesin binding|MAP-kinase scaffold activity|protein kinase activator activity|protein kinase binding	central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	TTTGACGACGAAGATCTGTCT	0.577	0	96.0	100.0	99.0	22	51040256	1976	4147	6123	SO:0001583	missense	AL021708	CCDS74886.1	22q13.33	2010-04-06			ENSG00000008735	ENSG00000008735		6883	protein-coding gene	gene with protein product	"""islet-brain 2"", ""JNK-interacting protein 2"""	607755	"""PRKM8 interacting protein-like"""	PRKM8IPL	10490659	Standard	NM_012324	Approved	IB2, JIP2	uc003bmy.3	Q13387	OTTHUMG00000150181	ENST00000329492.3:c.104A>C	22.37:g.51040256A>C	ENSP00000330572:p.Glu35Ala	Q96G62|Q99771|Q9NZ59|Q9UKQ4	ENST00000329492.3	37		.	.	.	.	.	.	.	.	.	.	A	25.9	4.683478	0.88639	.	.	ENSG00000008735	ENST00000329492;ENST00000442429;ENST00000341339	T;T;T	0.69561	0.07;-0.41;0.55	4.75	4.75	0.60458	.	0.062043	0.64402	D	0.000007	T	0.78830	0.4345	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.81169	-0.1055	10	0.87932	D	0	.	12.2634	0.54663	1.0:0.0:0.0:0.0	.	35	Q13387	JIP2_HUMAN	A	35	ENSP00000330572:E35A;ENSP00000404914:E35A;ENSP00000340015:E35A	ENSP00000330572:E35A	E	+	2	0	MAPK8IP2	49387122	1.000000	0.71417	0.987000	0.45799	0.961000	0.63080	9.101000	0.94219	1.776000	0.52262	0.414000	0.27820	GAA	MAPK8IP2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			51.226052	0	-29	64	0	0	1	0	NM_012324	18	54.134578	47	0.276923
MCM5	4174	broad.mit.edu	hg19	22	35811891	35811891	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr22:35811891C>T	ENST00000216122.4	+	10	1427	c.1273C>T	c.(1273-1275)Cgg>Tgg	p.R425W	MCM5_ENST00000465557.1_3'UTR|MCM5_ENST00000382011.5_Missense_Mutation_p.R382W	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	425	MCM.	cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29					CCCTTCGTCCCGGAATTTCAT	0.592	0	191.0	196.0	195.0	22	35811891	2203	4300	6503	SO:0001583	missense		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297		6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46	8751386, 10591208	Standard	NM_006739	Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1273C>T	22.37:g.35811891C>T	ENSP00000216122:p.Arg425Trp	O60785|Q14578|Q9BTJ4|Q9BWL8	ENST00000216122.4	37	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837041	0.91117	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000444582	T;T	0.14266	2.52;2.52	5.66	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.48409	0.1498	H	0.95365	3.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.62374	-0.6868	10	0.87932	D	0	-25.6682	11.9707	0.53062	0.1441:0.7322:0.1237:0.0	.	425;425;382;425	B1AHB0;Q53FG5;B1AHB1;P33992	.;.;.;MCM5_HUMAN	W	425;382;334	ENSP00000216122:R425W;ENSP00000371441:R382W	ENSP00000216122:R425W	R	+	1	2	MCM5	34141891	0.803000	0.28956	0.998000	0.56505	0.948000	0.59901	1.567000	0.36407	1.342000	0.45619	0.655000	0.94253	CGG	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3		321.444072	0	-13	199	0	0	1	0		105	322.837172	145	0.420000
SKA3	221150	broad.mit.edu	hg19	13	21746793	21746793	+	Nonsense_Mutation	SNP	A	A	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr13:21746793A>T	ENST00000314759.5	-	2	255	c.131T>A	c.(130-132)tTa>tAa	p.L44*	SKA3_ENST00000400018.3_Nonsense_Mutation_p.L44*	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	44		cell division|chromosome segregation|mitosis|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytoplasm|spindle microtubule	protein binding	breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19					AAGGTCATATAAAATTCTCAT	0.279	0	31.0	31.0	31.0	13	21746793	2189	4267	6456	SO:0001587	stop_gained	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480		20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3	19387489, 19289083, 19646878, 19360002	Standard	NM_145061	Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000400018.3:c.131T>A	13.37:g.21746793A>T	ENSP00000382896:p.Leu44*	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	ENST00000400018.3	37	CCDS53856.1	.	.	.	.	.	.	.	.	.	.	A	37	6.110145	0.97291	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	.	.	.	5.81	5.81	0.92471	.	0.248786	0.34959	N	0.003558	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9471	14.3871	0.66953	1.0:0.0:0.0:0.0	.	.	.	.	X	44	.	ENSP00000319417:L44X	L	-	2	0	SKA3	20644793	1.000000	0.71417	0.942000	0.38095	0.772000	0.43724	5.564000	0.67359	2.220000	0.72140	0.482000	0.46254	TTA	SKA3-006	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000272913.1		19.218310	0	-6	17	0	0	1	0	NM_145061	7	19.734768	14	0.333333
RND2	8153	broad.mit.edu	hg19	17	41180481	41180481	+	Silent	SNP	G	G	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr17:41180481G>T	ENST00000544533.1	+	5	578	c.471G>T	c.(469-471)gtG>gtT	p.V157V	RND2_ENST00000587250.2_Silent_p.V156V	NM_005440.4	NP_005431.1	P52198	RND2_HUMAN	Rho family GTPase 2	156		small GTPase mediated signal transduction	acrosomal membrane	GTP binding|GTPase activity	large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	TGGGGGCTGTGTCCTATGTTG	0.587	0	92.0	87.0	88.0	17	41180481	2203	4300	6503	SO:0001819	synonymous_variant	X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830		18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN		Standard	XM_005257706	Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817	ENST00000587250.2:c.468G>T	17.37:g.41180481G>T		A8K2D4|O00690|O00734|Q5U0P6|Q99535	ENST00000587250.2	37	CCDS11452.1																																																																																			RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453111.2		76.635335	1	-55	64	0	5.8336e-16	1	7.15942e-16	NM_005440	26	77.370722	41	0.388060
SF3B1	23451	broad.mit.edu	hg19	2	198267483	198267483	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr2:198267483C>T	ENST00000335508.6	-	14	1965	c.1874G>A	c.(1873-1875)cGt>cAt	p.R625H		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		TGTTGTGTTACGGACATACTC	0.438	12	95.0	92.0	93.0	2	198267483	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1874G>A	2.37:g.198267483C>T	ENSP00000335321:p.Arg625His	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	35	5.485860	0.96323	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.91369	0.7277	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93329	0.6699	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	625	O75533	SF3B1_HUMAN	H	625	ENSP00000335321:R625H	ENSP00000335321:R625H	R	-	2	0	SF3B1	197975728	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.728000	0.84847	2.752000	0.94435	0.655000	0.94253	CGT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		69.514775	0	-11	44	0	0	1	0		23	69.904678	33	0.410714
RP11-85G18.6	0	broad.mit.edu	hg19	10	27535505	27535505	+	RNA	SNP	G	G	A			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr10:27535505G>A	ENST00000574842.1	+	0	255																					CCACTGGTCCGTATCCCATTC	0.483	0																																				10.37:g.27535505G>A			ENST00000574842.1	37																																																																																				RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1		53.742554	0	-17	89	0	0	1	0		18	54.399248	30	0.375000
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		81.651164	0	-12	69	0	0	1	0	NM_002067	26	81.668550	24	0.520000
PPP6R2	9701	broad.mit.edu	hg19	22	50874821	50874822	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr22:50874821_50874822delCT	ENST00000359139.3	+	14	1936_1937	c.1542_1543delCT	c.(1540-1545)cgctggfs	p.W515fs	PPP6R2_ENST00000216061.5_Frame_Shift_Del_p.W515fs|PPP6R2_ENST00000395744.3_Frame_Shift_Del_p.W515fs|PPP6R2_ENST00000395741.3_Frame_Shift_Del_p.W516fs	NM_001242898.1|NM_001242899.1|NM_001242900.1|NM_014678.4	NP_001229827.1|NP_001229828.1|NP_001229829.1|NP_055493.2	O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	515			cytoplasm|intracellular membrane-bounded organelle	protein binding	NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22					GCCGTGGCCGCTGGGAGAGCTT	0.703	0									SO:0001589	frameshift_variant	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239	"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2	16769727	Standard	NM_014678	Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000359139.3:c.1542_1543delCT	22.37:g.50874821_50874822delCT	ENSP00000352051:p.Trp515fs	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	ENST00000359139.3	37	CCDS56236.1																																																																																			PPP6R2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316806.1	.	.		-8	4					NM_014678	2		4	0.33
KIAA0556	23247	broad.mit.edu	hg19	16	27642480	27642480	+	Frame_Shift_Del	DEL	C	C	-	rs138512782		TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr16:27642480delC	ENST00000261588.4	+	5	424	c.405delC	c.(403-405)cacfs	p.H135fs		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	135					breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76					GAGGATGGCACCAGGTCTGGA	0.527	0	28.0	24.0	25.0	16	27642480	2195	4294	6489	SO:0001589	frameshift_variant	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578		29068	protein-coding gene	gene with protein product					9628581	Standard	NM_015202	Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.405delC	16.37:g.27642480delC	ENSP00000261588:p.His135fs	A7E2C2	ENST00000261588.4	37	CCDS32415.1																																																																																			KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	.	.		7	9					NM_015202	2		4	0.33
SLC12A9	56996	broad.mit.edu	hg19	7	100460341	100460342	+	Frame_Shift_Ins	INS	-	-	T			TCGA-VD-A8KH-01A-11D-A39W-08	TCGA-VD-A8KH-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78ae4e14-a80a-4583-91ab-73f3bcb1b6d8	3e620f73-8c2b-40b5-a22e-6abc8f03b8c1	g.chr7:100460341_100460342insT	ENST00000354161.3	+	13	1875_1876	c.1750_1751insT	c.(1750-1752)gcafs	p.A584fs	SLC12A9_ENST00000415287.1_Frame_Shift_Ins_p.A495fs|SLC12A9_ENST00000275729.3_Frame_Shift_Ins_p.A495fs|SLC12A9_ENST00000540482.1_Frame_Shift_Ins_p.A584fs|SLC12A9_ENST00000428758.1_Frame_Shift_Ins_p.A584fs	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	584			integral to membrane|plasma membrane	cation:chloride symporter activity	breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)				GCAGTATGGGGCATGGCTCAGC	0.574	0									SO:0001589	frameshift_variant	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828	"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""				10871601, 11239002	Standard	NM_020246	Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	Exception_encountered	7.37:g.100460341_100460342insT	ENSP00000275730:p.Ala584fs	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	ENST00000354161.3	37	CCDS5707.1																																																																																			SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	.	.		0	70					NM_020246	19		44	0.30
