Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
CLEC3B	7123	broad.mit.edu	hg19	3	45077259	45077259	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr3:45077259G>A	ENST00000296130.4	+	3	632	c.452G>A	c.(451-453)cGc>cAc	p.R151H	CLEC3B_ENST00000490386.1_3'UTR|CLEC3B_ENST00000428034.1_Missense_Mutation_p.R109H	NM_003278.2	NP_003269.2	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	151	C-type lectin.	skeletal system development	extracellular space	protein binding|sugar binding	endometrium(1)|lung(3)	4				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	ACCGGCGCCCGCATCGCCTAC	0.662	0	39.0	40.0	40.0	3	45077259	2203	4300	6503	SO:0001583	missense		CCDS2726.1	3p22-p21.3	2010-04-27	2005-02-09	2005-02-09	ENSG00000163815	ENSG00000163815	"""C-type lectin domain containing"""	11891	protein-coding gene	gene with protein product		187520	"""tetranectin (plasminogen binding protein)"""	TNA		Standard	NM_003278	Approved	TN	uc003cok.4	P05452	OTTHUMG00000133087	ENST00000296130.4:c.452G>A	3.37:g.45077259G>A	ENSP00000296130:p.Arg151His	Q6FGX6	ENST00000296130.4	37	CCDS2726.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252312	0.39797	.	.	ENSG00000163815	ENST00000296130;ENST00000428034	T;T	0.19532	2.14;2.14	4.38	-8.39	0.00969	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.263610	0.05103	N	0.487531	T	0.17023	0.0409	L	0.57536	1.79	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.33777	-0.9855	10	0.45353	T	0.12	-3.5296	5.8002	0.18410	0.1757:0.5041:0.2335:0.0867	.	151	P05452	TETN_HUMAN	H	151;109	ENSP00000296130:R151H;ENSP00000396013:R109H	ENSP00000296130:R151H	R	+	2	0	CLEC3B	45052263	0.000000	0.05858	0.001000	0.08648	0.967000	0.64934	-0.397000	0.07269	-1.412000	0.02030	0.561000	0.74099	CGC	CLEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256745.1		0.297600	0	11	62	0	0	1	0	NM_003278	3	6.649186	33	0.083333
HTR1E	3354	hgsc.bcm.edu	hg19	6	87725770	87725770	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e																										TAAACTTACACAGACTTTCTG	0.478	0	142.0	146.0	145.0	6	87725770	2203	4300	6503	SO:0001583	missense		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830	"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""		1608964	Standard	NM_000865	Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.718C>G	6.37:g.87725770C>G	ENSP00000307766:p.Gln240Glu	E1P503|Q9P1Y1	ENST00000305344.5	37	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	C	1.647	-0.514938	0.04200	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.64618	-0.11;-0.11	4.39	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.092832	0.44097	U	0.000488	T	0.19046	0.0457	N	0.04655	-0.195	0.36157	D	0.847847	B	0.11235	0.004	B	0.17098	0.017	T	0.15521	-1.0434	10	0.02654	T	1	.	16.925	0.86174	0.0:1.0:0.0:0.0	.	240	P28566	5HT1E_HUMAN	E	240	ENSP00000307766:Q240E;ENSP00000358597:Q240E	ENSP00000307766:Q240E	Q	+	1	0	HTR1E	87782489	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	3.043000	0.49823	2.004000	0.58718	0.205000	0.17691	CAG	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2				67	219					NM_000865	8		79	
NFE2L2	4780	broad.mit.edu	hg19	2	178096252	178096252	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr2:178096252G>T	ENST00000397062.3	-	5	1633	c.1079C>A	c.(1078-1080)tCa>tAa	p.S360*	NFE2L2_ENST00000446151.2_Nonsense_Mutation_p.S337*|NFE2L2_ENST00000464747.1_Nonsense_Mutation_p.S344*|NFE2L2_ENST00000397063.4_Nonsense_Mutation_p.S344*	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	360		transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)		AGATTCCACTGAGTGTTCTGG	0.473	0	150.0	151.0	151.0	2	178096252	2195	4298	6493	SO:0001587	stop_gained		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044	"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""		7937919	Standard	NM_006164	Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000446151.2:c.1010C>A	2.37:g.178096252G>T	ENSP00000411575:p.Ser337*	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	ENST00000446151.2	37	CCDS46458.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038483	0.75617	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627	.	.	.	5.83	4.95	0.65309	.	0.053330	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.514	14.3596	0.66761	0.0704:0.0:0.9296:0.0	.	.	.	.	X	344;360;337;88	.	ENSP00000380252:S360X	S	-	2	0	NFE2L2	177804498	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.098000	0.76974	2.763000	0.94921	0.563000	0.77884	TCA	NFE2L2-008	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334263.1		25.781308	1	24	176	0	1.50039e-11	1	1.61581e-11	NM_006164	20	47.529257	139	0.125786
AFF3	3899	broad.mit.edu	hg19	2	100210742	100210742	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr2:100210742C>T	ENST00000409236.2	-	13	1493	c.1381G>A	c.(1381-1383)Gca>Aca	p.A461T	AFF3_ENST00000317233.4_Missense_Mutation_p.A461T|AFF3_ENST00000409579.1_Missense_Mutation_p.A486T|AFF3_ENST00000356421.2_Missense_Mutation_p.A486T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3			multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86					TTAGAGGATGCCGGTTCAGCC	0.443	1	124.0	137.0	133.0	2	100210742	2058	4218	6276	SO:0001583	missense	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218		6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4	8662235, 8555498	Standard	XM_005263945	Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1381G>A	2.37:g.100210742C>T	ENSP00000387207:p.Ala461Thr	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959682	0.53400	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.87	5.87	0.94306	.	0.205024	0.35207	N	0.003365	T	0.72716	0.3495	L	0.51422	1.61	0.42120	D	0.991429	D;D;D	0.64830	0.994;0.959;0.976	D;P;P	0.66716	0.946;0.721;0.461	T	0.71692	-0.4516	10	0.45353	T	0.12	.	14.3946	0.67003	0.0:0.7418:0.2582:0.0	.	614;461;486	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	T	461;486;486;461;461;614;486	ENSP00000317421:A461T;ENSP00000348793:A486T;ENSP00000386834:A486T;ENSP00000387207:A461T	ENSP00000317421:A461T	A	-	1	0	AFF3	99577174	1.000000	0.71417	0.491000	0.27477	0.460000	0.32559	5.786000	0.69006	2.781000	0.95711	0.655000	0.94253	GCA	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3		-29.571004	0	16	242	0	0	1	0	NM_002285	5	9.790046	158	0.030675
SCNM1	79005	broad.mit.edu	hg19	1	151140660	151140660	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr1:151140660C>T	ENST00000368905.4	+	6	550	c.439C>T	c.(439-441)Cca>Tca	p.P147S		NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	147		mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding	breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		TTCCCCTATGCCACCCTCAGA	0.552	1	222.0	235.0	230.0	1	151140660	2203	4300	6503	SO:0001583	missense	BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156		23136	protein-coding gene	gene with protein product		608095			12920299	Standard	NM_024041	Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.439C>T	1.37:g.151140660C>T	ENSP00000357901:p.Pro147Ser	B4DWR1|Q5JR74	ENST00000368905.4	37	CCDS987.1	.	.	.	.	.	.	.	.	.	.	C	4.228	0.041268	0.08196	.	.	ENSG00000163156	ENST00000368905;ENST00000368902	.	.	.	5.5	3.52	0.40303	.	0.423784	0.23840	N	0.044056	T	0.09335	0.0230	N	0.19112	0.55	0.09310	N	1	B	0.29162	0.235	B	0.37304	0.246	T	0.28138	-1.0053	9	0.15066	T	0.55	0.1285	6.1395	0.20251	0.1964:0.7104:0.0:0.0932	.	147	Q9BWG6	SCNM1_HUMAN	S	147;112	.	ENSP00000357898:P112S	P	+	1	0	SCNM1	149407284	0.000000	0.05858	0.798000	0.32154	0.005000	0.04900	-0.052000	0.11865	1.557000	0.49525	-0.140000	0.14226	CCA	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034064.2		-58.225841	0	6	338	0	0	1	0	NM_024041	4	6.360435	240	0.016393
RGL3	57139	broad.mit.edu	hg19	19	11517462	11517462	+	Missense_Mutation	SNP	T	T	G			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr19:11517462T>G	ENST00000380456.3	-	6	779	c.716A>C	c.(715-717)cAa>cCa	p.Q239P	RGL3_ENST00000393423.3_Missense_Mutation_p.Q239P	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	239		regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular		breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18					CTGGGGACCTTGAGGCATGAG	0.587	0	58.0	53.0	55.0	19	11517462	2203	4300	6503	SO:0001583	missense	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517		30282	protein-coding gene	gene with protein product					10869344	Standard	NM_001035223	Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.716A>C	19.37:g.11517462T>G	ENSP00000369823:p.Gln239Pro	B5ME84|B7ZL22|Q0P6G0	ENST00000380456.3	37	CCDS32910.1	.	.	.	.	.	.	.	.	.	.	T	9.994	1.231488	0.22626	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.41065	1.15;1.01	4.08	4.08	0.47627	Ras guanine nucleotide exchange factor, domain (1);	0.561985	0.17642	N	0.167003	T	0.23133	0.0559	N	0.12182	0.205	0.28997	N	0.887721	P;P;P;B	0.44195	0.46;0.828;0.46;0.289	B;B;B;B	0.37346	0.247;0.221;0.247;0.062	T	0.08806	-1.0704	10	0.59425	D	0.04	.	9.3589	0.38184	0.0:0.0:0.0:1.0	.	239;239;239;36	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	P	36;239;239	ENSP00000377075:Q239P;ENSP00000369823:Q239P	ENSP00000344665:Q36P	Q	-	2	0	RGL3	11378462	0.045000	0.20229	0.668000	0.29813	0.011000	0.07611	1.052000	0.30429	1.707000	0.51288	0.482000	0.46254	CAA	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3		14.633879	0	5	52	0	0	1	0	XM_290867	6	16.942661	23	0.206897
ABR	29	broad.mit.edu	hg19	17	915998	915998	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr17:915998T>C	ENST00000544583.2	-	18	2352	c.1753A>G	c.(1753-1755)Atg>Gtg	p.M585V	ABR_ENST00000574437.1_Missense_Mutation_p.M585V|ABR_ENST00000572441.1_Missense_Mutation_p.M82V|ABR_ENST00000543210.2_Missense_Mutation_p.M82V|ABR_ENST00000536794.2_Missense_Mutation_p.M413V|ABR_ENST00000291107.2_Missense_Mutation_p.M594V|ABR_ENST00000302538.5_Missense_Mutation_p.M631V	NM_001159746.2	NP_001153218.1	Q12979	ABR_HUMAN	active BCR-related	631	C2.	apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)	TTCAGGCTCATATCTCGGCTG	0.567	0	66.0	61.0	63.0	17	915998	2197	4293	6490	SO:0001583	missense	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842	"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""		2587217, 7479768	Standard	NM_001092	Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1891A>G	17.37:g.915998T>C	ENSP00000303909:p.Met631Val	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	ENST00000302538.5	37	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	T	6.045	0.376726	0.11466	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000543210	T;T;T;T;T	0.16743	2.37;2.35;2.32;3.56;3.16	5.84	5.84	0.93424	.	0.107865	0.64402	D	0.000003	T	0.09024	0.0223	N	0.08118	0	0.31018	N	0.71842	B;B;B;B	0.17268	0.004;0.021;0.004;0.004	B;B;B;B	0.14578	0.011;0.01;0.006;0.011	T	0.14587	-1.0467	10	0.12103	T	0.63	.	13.6467	0.62286	0.0:0.0:0.0:1.0	.	413;82;594;631	B7Z683;F5H3S2;Q12979-2;Q12979	.;.;.;ABR_HUMAN	V	631;585;594;413;82	ENSP00000303909:M631V;ENSP00000442048:M585V;ENSP00000291107:M594V;ENSP00000437429:M413V;ENSP00000445198:M82V	ENSP00000291107:M594V	M	-	1	0	ABR	862748	0.991000	0.36638	0.993000	0.49108	0.971000	0.66376	1.659000	0.37387	2.247000	0.74100	0.477000	0.44152	ATG	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		13.101552	0	0	13	0	0	1	0		4	13.249042	2	0.666667
POTEM	641455	broad.mit.edu	hg19	14	20019998	20019998	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr14:20019998T>C	ENST00000551509.1	-	1	274	c.223A>G	c.(223-225)Agc>Ggc	p.S75G		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	75					endometrium(4)|kidney(1)|lung(4)	9					CTCTTGCCGCTCCCCCTGCAC	0.587	0	11.0	21.0	19.0	14	20019998	316	1135	1451	SO:0001583	missense		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537	"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""				16364570	Standard	NM_001145442	Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.223A>G	14.37:g.20019998T>C	ENSP00000452296:p.Ser75Gly		ENST00000551509.1	37	CCDS45076.1	.	.	.	.	.	.	.	.	.	.	t	3.158	-0.172651	0.06421	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.33438	1.41	.	.	.	.	.	.	.	.	T	0.25606	0.0623	L	0.61218	1.895	0.09310	N	1	B	0.27791	0.189	B	0.29785	0.107	T	0.28459	-1.0043	6	.	.	.	.	.	.	.	.	75	A6NI47	POTEM_HUMAN	G	75	ENSP00000452296:S75G	.	S	-	1	0	POTEM	19089998	0.001000	0.12720	0.005000	0.12908	0.137000	0.21094	0.985000	0.29578	-0.760000	0.04677	0.128000	0.15822	AGC	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409490.3		-136.507564	0	362	806	0	0	1	0	NM_001145442	6	8.340986	523	0.011342
STK33	65975	broad.mit.edu	hg19	11	8435082	8435082	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr11:8435082G>C	ENST00000447869.1	-	11	2222	c.1304C>G	c.(1303-1305)cCt>cGt	p.P435R	STK33_ENST00000396673.1_Intron|STK33_ENST00000473980.1_5'UTR|STK33_ENST00000534493.1_Missense_Mutation_p.P394R|STK33_ENST00000315204.1_Missense_Mutation_p.P435R|STK33_ENST00000396672.1_Missense_Mutation_p.P435R|STK33_ENST00000358872.3_Missense_Mutation_p.P248R			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	435			Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity	NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)	ATTGGCATCAGGGACATTTCC	0.418	0	288.0	264.0	272.0	11	8435082	2201	4296	6497	SO:0001583	missense	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413		14568	protein-coding gene	gene with protein product		607670			11738831	Standard	NM_030906	Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1304C>G	11.37:g.8435082G>C	ENSP00000416750:p.Pro435Arg	Q658S6|Q8NEF5	ENST00000447869.1	37	CCDS7789.1	.	.	.	.	.	.	.	.	.	.	C	0.026	-1.367991	0.01225	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000534493	T;T;T;T;T	0.70399	-0.42;-0.42;-0.42;-0.48;-0.42	4.36	-4.73	0.03259	Protein kinase-like domain (1);	4.285410	0.00166	N	0.000013	T	0.48786	0.1519	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	10	0.11182	T	0.66	.	7.2625	0.26212	0.0:0.2395:0.5073:0.2533	.	435	Q9BYT3	STK33_HUMAN	R	435;435;435;248;394	ENSP00000416750:P435R;ENSP00000320754:P435R;ENSP00000379905:P435R;ENSP00000351743:P248R;ENSP00000436418:P394R	ENSP00000320754:P435R	P	-	2	0	STK33	8391658	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.796000	0.04575	-1.536000	0.01738	-0.968000	0.02614	CCT	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2		135.535750	0	75	237	0	0	1	0	NM_030906	45	137.382859	77	0.368852
UMOD	7369	broad.mit.edu	hg19	16	20357567	20357567	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr16:20357567C>T	ENST00000396134.2	-	6	1285	c.1162G>A	c.(1162-1164)Gac>Aac	p.D388N	UMOD_ENST00000302509.4_Missense_Mutation_p.D355N|UMOD_ENST00000570689.1_Missense_Mutation_p.D355N|UMOD_ENST00000396138.4_Missense_Mutation_p.D404N|UMOD_ENST00000424589.1_Missense_Mutation_p.D388N|UMOD_ENST00000396142.2_Missense_Mutation_p.D355N	NM_001278614.1	NP_001265543.1	P07911	UROM_HUMAN	uromodulin	355	ZP.	cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding	endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41					AAGACCTTGTCGAAGCCCAGA	0.582	0	85.0	78.0	81.0	16	20357567	2203	4300	6503	SO:0001583	missense	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344		12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""		8382593	Standard	NM_003361	Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1063G>A	16.37:g.20357567C>T	ENSP00000460548:p.Asp355Asn	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	c	13.04	2.119808	0.37436	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	4.67	1.02	0.19986	Zona pellucida sperm-binding protein (3);	0.472674	0.17937	N	0.156969	T	0.62816	0.2459	N	0.12746	0.255	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.19946	0.006;0.027	T	0.47459	-0.9116	10	0.27082	T	0.32	-10.3565	3.8168	0.08818	0.0:0.3225:0.3999:0.2775	.	388;355	E9PEA4;P07911	.;UROM_HUMAN	N	355;388;388;355;333;355	ENSP00000379438:D388N;ENSP00000416346:D388N;ENSP00000306279:D355N;ENSP00000379446:D355N	ENSP00000306279:D355N	D	-	1	0	UMOD	20265068	0.001000	0.12720	0.967000	0.41034	0.886000	0.51366	-0.016000	0.12613	0.240000	0.21263	0.306000	0.20318	GAC	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		88.202664	0	8	91	0	0	1	0		29	88.319302	35	0.453125
ODC1	4953	broad.mit.edu	hg19	2	10582209	10582209	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr2:10582209G>A	ENST00000234111.4	-	9	1352	c.842C>T	c.(841-843)gCa>gTa	p.A281V	ODC1_ENST00000405333.1_Missense_Mutation_p.A281V	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	281		polyamine biosynthetic process|regulation of cellular amino acid metabolic process|response to virus	cytosol	ornithine decarboxylase activity|protein binding	NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	GAAAGCTGATGCAACATAGTA	0.438	0	94.0	92.0	92.0	2	10582209	2203	4300	6503	SO:0001583	missense		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758		8109	protein-coding gene	gene with protein product		165640				Standard	NM_002539	Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.842C>T	2.37:g.10582209G>A	ENSP00000234111:p.Ala281Val	Q53TU3|Q6LDS9	ENST00000234111.4	37	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691650	0.88735	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.54675	0.56;0.56	5.79	5.79	0.91817	Orn/DAP/Arg decarboxylase 2, N-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (2);	0.093658	0.64402	D	0.000001	T	0.63355	0.2504	M	0.85710	2.77	0.80722	D	1	P	0.49253	0.921	B	0.42319	0.383	T	0.72050	-0.4407	10	0.72032	D	0.01	.	20.0361	0.97558	0.0:0.0:1.0:0.0	.	281	P11926	DCOR_HUMAN	V	281;281;152	ENSP00000234111:A281V;ENSP00000385333:A281V	ENSP00000234111:A281V	A	-	2	0	ODC1	10499660	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	9.807000	0.99171	2.740000	0.93945	0.563000	0.77884	GCA	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		6.978443	0	30	98	0	0	1	0		7	16.898406	58	0.107692
CPAMD8	27151	broad.mit.edu	hg19	19	17025480	17025480	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr19:17025480T>C	ENST00000443236.1	-	28	3945	c.3914A>G	c.(3913-3915)aAc>aGc	p.N1305S		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1258			extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82					GATGTCCTTGTTCAGGACCCT	0.657	0	28.0	32.0	31.0	19	17025480	1984	4169	6153	SO:0001583	missense	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111		23228	protein-coding gene	gene with protein product		608841			10574462	Standard	NM_015692	Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3914A>G	19.37:g.17025480T>C	ENSP00000402505:p.Asn1305Ser	Q8NC09|Q9ULD7	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.48|15.48	2.846552|2.846552	0.51164|0.51164	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	2.93|2.93	2.93|2.93	0.34026|0.34026	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.58722|0.58722	0.2142|0.2142	L|L	0.49778|0.49778	1.585|1.585	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.80764|.	0.994|.	T|T	0.55055|0.55055	-0.8200|-0.8200	9|5	0.44086|.	T|.	0.13|.	.|.	11.0345|11.0345	0.47793|0.47793	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1258|.	Q8IZJ3|.	CPMD8_HUMAN|.	S|A	1305|1316	.|.	ENSP00000291440:N1305S|.	N|T	-|-	2|1	0|0	CPAMD8|CPAMD8	16886480|16886480	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.925000|0.925000	0.55904|0.55904	6.461000|6.461000	0.73522|0.73522	0.993000|0.993000	0.38866|0.38866	0.454000|0.454000	0.30748|0.30748	AAC|ACA	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		4.006278	0	5	35	0	0	1	0	NM_015692	3	7.794190	23	0.115385
MBP	4155	broad.mit.edu	hg19	18	74729169	74729169	+	Silent	SNP	A	A	C	rs144597580		TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr18:74729169A>C	ENST00000397860.3	-	4	409	c.195T>G	c.(193-195)acT>acG	p.T65T	MBP_ENST00000580402.1_Silent_p.T65T|MBP_ENST00000354542.4_5'UTR|MBP_ENST00000397863.1_Silent_p.T65T|MBP_ENST00000355994.2_Silent_p.T65T|MBP_ENST00000487778.1_5'UTR|MBP_ENST00000579129.1_Silent_p.T65T	NM_001025100.1	NP_001020271.1	P02686	MBP_HUMAN	myelin basic protein	65		central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath	endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	GCTTGGAGTCAGTCACCGCTG	0.582	0	71.0	71.0	71.0	18	74729169	2203	4300	6503	SO:0001819	synonymous_variant		CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971		6925	protein-coding gene	gene with protein product		159430			2425357	Standard	XM_005266699	Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397860.3:c.195T>G	18.37:g.74729169A>C		A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	ENST00000397860.3	37	CCDS42450.1																																																																																			MBP-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267945.1		35.269307	0	0	65	0	0	1	0	NM_001025081	13	35.878548	23	0.361111
SYTL3	94120	hgsc.bcm.edu	hg19	6	159129365	159129365	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e																										AAAATTTCTGTGGTTCCTCCT	0.483	0	146.0	125.0	132.0	6	159129365	2203	4300	6503	SO:0001583	missense	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674		15587	protein-coding gene	gene with protein product					11773082	Standard	NM_001242384	Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.458T>C	6.37:g.159129365T>C	ENSP00000297239:p.Val153Ala	Q496J4|Q496J6|Q5U3B9	ENST00000297239.9	37	CCDS56458.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015870	0.54468	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239	T;T	0.20200	2.22;2.09	4.59	4.59	0.56863	.	0.255560	0.31709	N	0.007186	T	0.27559	0.0677	M	0.81802	2.56	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.69142	0.872;0.962	T	0.36065	-0.9763	10	0.09843	T	0.71	.	10.3708	0.44053	0.0:0.0:0.0:1.0	.	153;153	Q4VX76;Q4VX76-2	SYTL3_HUMAN;.	A	153	ENSP00000353631:V153A;ENSP00000297239:V153A	ENSP00000297239:V153A	V	+	2	0	SYTL3	159049353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.177000	0.58276	1.714000	0.51371	0.533000	0.62120	GTG	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1				-16	41						7		20	
RP11-707M1.1	0	broad.mit.edu	hg19	11	49831634	49831634	+	RNA	SNP	G	G	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr11:49831634G>C	ENST00000527477.1	+	0	1859																					TTACACTGCAGTATGTCCCAA	0.433	0																																				11.37:g.49831634G>C			ENST00000527477.1	37																																																																																				RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2		47.316364	0	3	74	0	0	1	0		15	47.685111	23	0.394737
NFIC	4782	broad.mit.edu	hg19	19	3382229	3382229	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr19:3382229G>C	ENST00000589123.1	+	2	643	c.523G>C	c.(523-525)Gtg>Ctg	p.V175L	NFIC_ENST00000346156.5_Missense_Mutation_p.V175L|NFIC_ENST00000395111.3_Missense_Mutation_p.V175L|NFIC_ENST00000590282.1_Missense_Mutation_p.V184L|NFIC_ENST00000341919.3_Missense_Mutation_p.V184L|NFIC_ENST00000586919.1_Missense_Mutation_p.V175L|NFIC_ENST00000443272.2_Missense_Mutation_p.V184L	NM_001245005.1|NM_205843.2	NP_001231934.1|NP_995315.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	184		DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)	GGCCTACTTCGTGCGTGAGCG	0.687	0	50.0	47.0	48.0	19	3382229	2181	4245	6426	SO:0001583	missense	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905		7786	protein-coding gene	gene with protein product		600729		NFI	3398920, 7590749	Standard	NM_205843	Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.550G>C	19.37:g.3382229G>C	ENSP00000396843:p.Val184Leu	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	ENST00000443272.2	37	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941260	0.34283	0.0	3.53E-4	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.53640	0.61;0.79;0.61	4.05	1.44	0.22558	CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.165621	0.39759	N	0.001269	T	0.37376	0.1001	L	0.54323	1.7	0.44254	D	0.997104	B;B;P;B;B	0.36199	0.132;0.036;0.543;0.401;0.068	B;B;B;B;B	0.35240	0.062;0.011;0.198;0.198;0.046	T	0.20840	-1.0263	10	0.51188	T	0.08	-20.0143	6.4113	0.21692	0.3859:0.0:0.6141:0.0	.	184;184;175;184;175	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	L	175;175;175;184;184;184	ENSP00000378543:V175L;ENSP00000301935:V175L;ENSP00000342194:V184L	ENSP00000269778:V184L	V	+	1	0	NFIC	3333229	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	4.798000	0.62510	0.824000	0.34613	-0.229000	0.12294	GTG	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1		77.966312	0	-24	66	0	0	1	0	NM_005597	25	78.119885	31	0.446429
PRR19	284338	broad.mit.edu	hg19	19	42814091	42814091	+	Missense_Mutation	SNP	C	C	T	rs139508954	byFrequency	TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr19:42814091C>T	ENST00000499536.2	+	1	1166	c.355C>T	c.(355-357)Cgg>Tgg	p.R119W	PRR19_ENST00000598490.1_Missense_Mutation_p.R119W|PRR19_ENST00000341747.3_Missense_Mutation_p.R119W			A6NJB7	PRR19_HUMAN	proline rich 19	119					NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)			ACCAGCCCCACGGTCCAGGGA	0.677	0	34.0	44.0	41.0	19	42814091	2203	4300	6503	SO:0001583	missense	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368		33728	protein-coding gene	gene with protein product						Standard	NM_199285	Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.355C>T	19.37:g.42814091C>T	ENSP00000445247:p.Arg119Trp	A8K663|B3KW48|Q6P584	ENST00000499536.2	37	CCDS33036.1	.	.	.	.	.	.	.	.	.	.	C	5.945	0.358429	0.11239	4.54E-4	0.0	ENSG00000188368	ENST00000341747;ENST00000499536	.	.	.	4.46	3.39	0.38822	.	0.000000	0.36200	N	0.002730	T	0.15262	0.0368	N	0.08118	0	0.09310	N	1	P;P	0.51653	0.947;0.947	B;B	0.40101	0.319;0.237	T	0.07770	-1.0755	9	0.62326	D	0.03	-15.1264	10.4465	0.44497	0.0:0.8023:0.1977:0.0	.	119;119	A6NJB7;A6NJB7-2	PRR19_HUMAN;.	W	119	.	ENSP00000342709:R119W	R	+	1	2	PRR19	47505931	0.003000	0.15002	0.002000	0.10522	0.004000	0.04260	0.830000	0.27462	1.183000	0.42943	0.561000	0.74099	CGG	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1		55.376077	0	-2	47	0	0	1	0	NM_199285	17	55.376077	17	0.500000
UTRN	7402	broad.mit.edu	hg19	6	145095480	145095480	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr6:145095480G>A	ENST00000367545.3	+	59	8612	c.8612G>A	c.(8611-8613)aGa>aAa	p.R2871K	UTRN_ENST00000367526.4_Missense_Mutation_p.R426K	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2871	Interaction with SYNM.	muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	AAAATCCGAAGACTACAAAAA	0.318	0	105.0	104.0	104.0	6	145095480	2203	4300	6503	SO:0001583	missense	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818		12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL	1426262	Standard	NM_007124	Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8612G>A	6.37:g.145095480G>A	ENSP00000356515:p.Arg2871Lys	Q5SYY1|Q5SZ57|Q9UJ40	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016344	0.93404	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.64618	-0.11;-0.11	5.93	5.93	0.95920	EF-hand domain, type 1 (1);	0.000000	0.52532	D	0.000063	T	0.62696	0.2449	M	0.76838	2.35	0.35015	D	0.757282	B	0.23854	0.092	B	0.33620	0.167	T	0.65179	-0.6231	10	0.72032	D	0.01	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	2871	P46939	UTRO_HUMAN	K	2871;426	ENSP00000356515:R2871K;ENSP00000356496:R426K	ENSP00000356496:R426K	R	+	2	0	UTRN	145137173	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.984000	0.88150	2.826000	0.97356	0.655000	0.94253	AGA	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		103.401448	0	0	81	0	0	1	0		32	103.433392	29	0.524590
PKHD1L1	93035	broad.mit.edu	hg19	8	110456078	110456078	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr8:110456078G>A	ENST00000378402.5	+	37	4842	c.4738G>A	c.(4738-4740)Gaa>Aaa	p.E1580K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1580	IPT/TIG 8.	immune response	cytosol|extracellular space|integral to membrane	receptor activity	NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		AACAGTAAATGAACTAATAAC	0.328	0	106.0	103.0	104.0	8	110456078	1821	4075	5896	SO:0001583	missense	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038		20313	protein-coding gene	gene with protein product		607843			12620974	Standard	NM_177531	Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4738G>A	8.37:g.110456078G>A	ENSP00000367655:p.Glu1580Lys	Q567P2|Q9UF27	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788446	0.70337	.	.	ENSG00000205038	ENST00000378402	T	0.76709	-1.04	5.77	5.77	0.91146	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.206516	0.41396	D	0.000892	T	0.81230	0.4779	M	0.65975	2.015	0.34312	D	0.685574	P	0.39624	0.681	P	0.45232	0.474	D	0.85126	0.0972	10	0.40728	T	0.16	.	17.8364	0.88699	0.0:0.0:1.0:0.0	.	1580	Q86WI1	PKHL1_HUMAN	K	1580	ENSP00000367655:E1580K	ENSP00000367655:E1580K	E	+	1	0	PKHD1L1	110525254	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	5.985000	0.70556	2.884000	0.98904	0.655000	0.94253	GAA	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		1.155397	0	-23	83	0	0	1	0	NM_177531	7	15.980304	77	0.083333
IGLL1	3543	broad.mit.edu	hg19	22	23922214	23922214	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e	g.chr22:23922214delG	ENST00000330377.2	-	1	281	c.164delC	c.(163-165)cctfs	p.P55fs	IGLL1_ENST00000249053.3_Frame_Shift_Del_p.P55fs	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	55		immune response	extracellular region|membrane		kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12					GCTTCCTCCAGGGGCTCCAGG	0.692	0	5.0	6.0	6.0	22	23922214	2042	4079	6121	SO:0001589	frameshift_variant	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322	"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL	3139558, 2511029	Standard	NM_020070	Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.164delC	22.37:g.23922214delG	ENSP00000329312:p.Pro55fs	Q0P681	ENST00000330377.2	37	CCDS13809.1																																																																																			IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	.	.		4	9					NM_020070	2		4	0.33
HTR1E	3354	hgsc.bcm.edu	hg19	6	87725769	87725769	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VD-A8KJ-01A-11D-A39W-08	TCGA-VD-A8KJ-10A-01D-A39Z-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	15c021da-3f38-4fa4-9184-ffce52fd71ba	24d291a9-1886-47da-99f3-124a94a9671e																										GTAAACTTACACAGACTTTCT	0.478	0	141.0	145.0	144.0	6	87725769	2203	4300	6503	SO:0001589	frameshift_variant		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830	"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""		1608964	Standard	NM_000865	Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.717delA	6.37:g.87725769delA	ENSP00000307766:p.Thr239fs	E1P503|Q9P1Y1	ENST00000305344.5	37	CCDS5006.1																																																																																			HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2				63	218					NM_000865	27		75	
