Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
RECQL5	9400	broad.mit.edu	hg19	17	73623546	73623546	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr17:73623546C>T	ENST00000317905.5	-	20	3091	c.2932G>A	c.(2932-2934)Gag>Aag	p.E978K	RECQL5_ENST00000423245.2_Missense_Mutation_p.E951K|RECQL5_ENST00000443199.2_5'UTR	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	978		DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding	breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)		GCTTCGCTCTCGCACCGGGCC	0.622	0	69.0	79.0	76.0	17	73623546	2033	4176	6209	SO:0001583	missense	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469		9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781			9878247	Standard	NM_004259	Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.2932G>A	17.37:g.73623546C>T	ENSP00000317636:p.Glu978Lys	Q9H0B1|Q9P1W7|Q9UNC8	ENST00000317905.5	37	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501993	0.64298	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	T	0.61510	0.1	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.75525	0.3861	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.945;0.967;0.999	T	0.76958	-0.2766	10	0.56958	D	0.05	-30.6965	18.7978	0.92003	0.0:1.0:0.0:0.0	.	978;951;174	O94762;Q6P4G0;Q6FIC9	RECQ5_HUMAN;.;.	K	573;978;978	ENSP00000317636:E978K	ENSP00000317636:E978K	E	-	1	0	RECQL5	71135141	1.000000	0.71417	0.968000	0.41197	0.841000	0.47740	6.362000	0.73077	2.447000	0.82792	0.563000	0.77884	GAG	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1		45.045476	0	-24	101	0	0	1	0	NM_004259	17	48.559916	49	0.257576
LYRM9	201229	broad.mit.edu	hg19	17	26207284	26207284	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr17:26207284G>C	ENST00000460380.2	-	3	295	c.235C>G	c.(235-237)Ctg>Gtg	p.L79V	LYRM9_ENST00000379102.3_Intron|RP11-138P22.1_ENST00000581901.1_RNA|LYRM9_ENST00000508862.1_Intron|RP1-66C13.4_ENST00000582441.1_Intron|LYRM9_ENST00000503642.1_Missense_Mutation_p.L79V|LYRM9_ENST00000379103.3_Intron					LYR motif containing 9												GCAGAGCCCAGGGGCCAAGCA	0.532	0	63.0	73.0	70.0	17	26207284	2058	4217	6275	SO:0001583	missense	BC018092	CCDS45631.1	17q11.2	2014-06-05	2012-10-23	2012-10-23	ENSG00000232859	ENSG00000232859	"""LYR motif containing"""	27314	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 108"""	C17orf108	12477932	Standard	NM_001076680	Approved	HSD24	uc002gzx.3	A8MSI8	OTTHUMG00000132829	ENST00000460380.2:c.235C>G	17.37:g.26207284G>C	ENSP00000464378:p.Leu79Val	A6NJT7|Q6X7B8	ENST00000460380.2	37		.	.	.	.	.	.	.	.	.	.	G	7.191	0.591509	0.13812	.	.	ENSG00000232859	ENST00000503642	.	.	.	4.55	3.33	0.38152	.	.	.	.	.	T	0.31513	0.0799	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.18524	-1.0334	7	0.87932	D	0	.	8.4321	0.32764	0.1295:0.0:0.8705:0.0	.	88	D6RAR2	.	V	88	.	ENSP00000421807:L88V	L	-	1	2	C17orf108	23231411	0.001000	0.12720	0.003000	0.11579	0.009000	0.06853	0.423000	0.21313	2.075000	0.62263	0.655000	0.94253	CTG	LYRM9-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000256295.4		10.125106	0	-2	10	0	0	1	0	NM_001076680	3	10.125106	3	0.500000
SEL1L3	23231	broad.mit.edu	hg19	4	25819797	25819797	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr4:25819797G>C	ENST00000399878.3	-	9	1649	c.1527C>G	c.(1525-1527)agC>agG	p.S509R	SEL1L3_ENST00000502949.1_Missense_Mutation_p.S356R|SEL1L3_ENST00000264868.5_Missense_Mutation_p.S474R	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	509			integral to membrane	binding	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14					CCTGGAACAAGCTGGGGTGTT	0.537	0	72.0	74.0	73.0	4	25819797	1965	4159	6124	SO:0001583	missense	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490		29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""				9872452	Standard	XM_005248143	Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1527C>G	4.37:g.25819797G>C	ENSP00000382767:p.Ser509Arg	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	ENST00000399878.3	37	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.485927	0.26686	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.14391	2.7;2.72;2.51	5.95	2.91	0.33838	.	0.523323	0.23881	N	0.043648	T	0.11239	0.0274	L	0.51422	1.61	0.09310	N	1	B	0.28552	0.215	B	0.23275	0.045	T	0.21965	-1.0230	10	0.25106	T	0.35	-7.5726	8.2079	0.31467	0.281:0.0:0.719:0.0	.	509	Q68CR1	SE1L3_HUMAN	R	509;474;356	ENSP00000382767:S509R;ENSP00000264868:S474R;ENSP00000425438:S356R	ENSP00000264868:S474R	S	-	3	2	SEL1L3	25428895	0.669000	0.27502	0.082000	0.20525	0.513000	0.34164	0.845000	0.27668	0.867000	0.35654	0.655000	0.94253	AGC	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1		16.175053	0	-3	16	0	0	1	0	NM_015187	5	16.175053	5	0.500000
STIP1	10963	broad.mit.edu	hg19	11	63971545	63971545	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr11:63971545A>G	ENST00000358794.5	+	14	2273	c.1720A>G	c.(1720-1722)Ata>Gta	p.I574V	STIP1_ENST00000305218.4_Missense_Mutation_p.I527V|STIP1_ENST00000538945.1_Missense_Mutation_p.I503V	NM_001282652.1	NP_001269581.1	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1	527		axon guidance|response to stress	Golgi apparatus|nucleus		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27					GAATCCTGTAATAGCACAGAA	0.463	0	151.0	138.0	143.0	11	63971545	2201	4297	6498	SO:0001583	missense	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439	"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""		1569099	Standard	NM_006819	Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000358794.5:c.1720A>G	11.37:g.63971545A>G	ENSP00000351646:p.Ile574Val	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	ENST00000358794.5	37		.	.	.	.	.	.	.	.	.	.	A	11.76	1.734688	0.30774	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.11495	2.77;3.04;2.81	5.34	5.34	0.76211	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.07908	0.0198	N	0.12182	0.205	0.80722	D	1	P;B	0.39862	0.692;0.391	B;B	0.42495	0.389;0.13	T	0.43861	-0.9365	10	0.11794	T	0.64	-25.6402	14.599	0.68427	1.0:0.0:0.0:0.0	.	503;527	F5H0T1;P31948	.;STIP1_HUMAN	V	574;527;503	ENSP00000351646:I574V;ENSP00000305958:I527V;ENSP00000445957:I503V	ENSP00000305958:I527V	I	+	1	0	STIP1	63728121	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	8.196000	0.89725	2.164000	0.68074	0.459000	0.35465	ATA	STIP1-010	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000396930.1		104.982074	0	-3	112	0	0	1	0	NM_006819	32	106.119576	53	0.376471
KAT6A	7994	broad.mit.edu	hg19	8	41790274	41790274	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr8:41790274T>C	ENST00000396930.3	-	18	6007	c.5464A>G	c.(5464-5466)Aac>Gac	p.N1822D	KAT6A_ENST00000265713.2_Missense_Mutation_p.N1822D|KAT6A_ENST00000406337.1_Missense_Mutation_p.N1822D	NM_001099412.1	NP_001092882.1	Q92794	MYST3_HUMAN	K(lysine) acetyltransferase 6A	1822		histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding							GATGTGAGGTTCATGGTAGTG	0.542	0	187.0	168.0	175.0	8	41790274	2203	4300	6503	SO:0001583	missense	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3	8849440, 8782817	Standard	NM_001099412	Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.5464A>G	8.37:g.41790274T>C	ENSP00000380136:p.Asn1822Asp	Q76L81	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	10.14	1.268958	0.23221	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.68624	-0.34;-0.34;-0.34	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	T	0.57873	0.2083	L	0.27053	0.805	0.58432	D	0.999993	P	0.52316	0.952	B	0.43194	0.411	T	0.63866	-0.6540	10	0.59425	D	0.04	-22.8583	15.9132	0.79488	0.0:0.0:0.0:1.0	.	1822	Q92794	KAT6A_HUMAN	D	1822	ENSP00000265713:N1822D;ENSP00000385888:N1822D;ENSP00000380136:N1822D	ENSP00000265713:N1822D	N	-	1	0	KAT6A	41909431	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.542000	0.82095	2.148000	0.66965	0.533000	0.62120	AAC	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1		93.568160	0	-13	70	0	0	1	0	NM_006766	29	93.732144	36	0.446154
SLC19A1	6573	broad.mit.edu	hg19	21	46950865	46950865	+	Missense_Mutation	SNP	C	C	T	rs56138890		TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr21:46950865C>T	ENST00000311124.4	-	4	1122	c.970G>A	c.(970-972)Gcg>Acg	p.A324T	SLC19A1_ENST00000380010.4_Missense_Mutation_p.A324T|SLC19A1_ENST00000567670.1_Missense_Mutation_p.A324T|SLC19A1_ENST00000485649.2_Missense_Mutation_p.A284T	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	324		folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity	endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	ACGAAGCCCGCGGCGAAGGAC	0.711	0	14.0	14.0	14.0	21	46950865	2191	4272	6463	SO:0001583	missense	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638	"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424			9570943	Standard	NM_194255	Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000380010.4:c.970G>A	21.37:g.46950865C>T	ENSP00000369347:p.Ala324Thr	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	ENST00000380010.4	37	CCDS56218.1	.	.	.	.	.	.	.	.	.	.	c	19.41	3.823174	0.71143	.	.	ENSG00000173638	ENST00000380014;ENST00000311124;ENST00000380010;ENST00000485649	D;D;D	0.81908	-1.55;-1.55;-1.55	4.16	4.16	0.48862	Major facilitator superfamily domain, general substrate transporter (1);	0.056197	0.64402	N	0.000001	D	0.90532	0.7033	M	0.76938	2.355	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.997;1.0;0.997	D	0.91568	0.5269	10	0.56958	D	0.05	-35.1012	15.397	0.74805	0.0:1.0:0.0:0.0	.	284;346;324;324	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	T	71;324;324;284	ENSP00000308895:A324T;ENSP00000369347:A324T;ENSP00000441772:A284T	ENSP00000308895:A324T	A	-	1	0	SLC19A1	45775293	1.000000	0.71417	0.295000	0.24960	0.199000	0.23934	6.964000	0.76061	2.034000	0.60081	0.289000	0.19496	GCG	SLC19A1-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000206797.1		2.703999	0	-1	32	0	0	1	0		3	7.244018	26	0.103448
LRRC16A	55604	broad.mit.edu	hg19	6	25500413	25500413	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr6:25500413G>C	ENST00000329474.6	+	17	1713	c.1345G>C	c.(1345-1347)Gct>Cct	p.A449P		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	449		actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50					ATTGGGCCTGGCTTGTAATCA	0.428	0	157.0	144.0	148.0	6	25500413	1893	4121	6014	SO:0001583	missense	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691		21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16	19846667	Standard	NM_017640	Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1345G>C	6.37:g.25500413G>C	ENSP00000331983:p.Ala449Pro	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	ENST00000329474.6	37	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.291781	0.80914	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.54866	0.55	5.37	3.55	0.40652	.	0.049679	0.85682	D	0.000000	T	0.57710	0.2072	M	0.83483	2.645	0.80722	D	1	D;D;D	0.63880	0.977;0.993;0.987	P;P;P	0.57960	0.83;0.83;0.799	T	0.63120	-0.6708	10	0.54805	T	0.06	.	10.4624	0.44587	0.0699:0.0:0.7959:0.1342	.	449;449;449	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	P	449	ENSP00000331983:A449P	ENSP00000331983:A449P	A	+	1	0	LRRC16A	25608392	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.410000	0.66381	0.716000	0.32124	0.563000	0.77884	GCT	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2		43.375143	0	9	39	0	0	1	0	NM_017640	13	43.383791	12	0.520000
ZNF680	340252	broad.mit.edu	hg19	7	64004737	64004737	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr7:64004737C>T	ENST00000309683.6	-	2	255	c.104G>A	c.(103-105)cGg>cAg	p.R35Q	ZNF680_ENST00000447137.2_Missense_Mutation_p.R35Q|ZNF680_ENST00000476563.1_Intron	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	35	KRAB.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)			ATATAAATTCCGTTGTGCAGT	0.438	0	155.0	159.0	158.0	7	64004737	2203	4300	6503	SO:0001583	missense	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041	"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""				12477932	Standard	NM_178558	Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000447137.2:c.104G>A	7.37:g.64004737C>T	ENSP00000393506:p.Arg35Gln	B3KVJ4|Q6ZNF3|Q8NC79	ENST00000447137.2	37	CCDS47594.1	.	.	.	.	.	.	.	.	.	.	N	0.016	-1.527136	0.00959	.	.	ENSG00000173041	ENST00000309683;ENST00000447137	T;T	0.02763	4.17;4.17	0.665	-0.96	0.10340	Krueppel-associated box (4);	.	.	.	.	T	0.01489	0.0048	N	0.21142	0.635	0.09310	N	1	B;B	0.29646	0.081;0.253	B;B	0.22880	0.024;0.042	T	0.45629	-0.9248	8	0.05436	T	0.98	.	.	.	.	.	35;35	Q6ZNF3;Q8NEM1	.;ZN680_HUMAN	Q	35	ENSP00000309330:R35Q;ENSP00000393506:R35Q	ENSP00000309330:R35Q	R	-	2	0	ZNF680	63642172	0.001000	0.12720	0.014000	0.15608	0.011000	0.07611	-0.180000	0.09754	-0.429000	0.07329	-0.350000	0.07774	CGG	ZNF680-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000344571.2		-13.820319	0	-71	215	0	0	1	0	NM_178558	5	11.016772	107	0.044643
PDIA5	10954	broad.mit.edu	hg19	3	122821618	122821618	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr3:122821618A>G	ENST00000316218.7	+	5	457	c.362A>G	c.(361-363)gAa>gGa	p.E121G		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	121		cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)	TTTCATACTGAATATAACCGA	0.403	0	142.0	124.0	130.0	3	122821618	2203	4300	6503	SO:0001583	missense	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""		7556671	Standard	NM_006810	Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.362A>G	3.37:g.122821618A>G	ENSP00000323313:p.Glu121Gly	D3DN95|Q9BV43	ENST00000316218.7	37	CCDS3020.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.233782	0.58886	.	.	ENSG00000065485	ENST00000316218;ENST00000484644	T	0.25085	1.82	4.97	4.97	0.65823	Thioredoxin-like fold (1);	0.109692	0.64402	D	0.000009	T	0.26919	0.0659	L	0.48362	1.52	0.44908	D	0.99792	P	0.36162	0.54	B	0.39771	0.309	T	0.04115	-1.0976	10	0.46703	T	0.11	.	12.261	0.54651	1.0:0.0:0.0:0.0	.	121	Q14554	PDIA5_HUMAN	G	121;25	ENSP00000323313:E121G	ENSP00000323313:E121G	E	+	2	0	PDIA5	124304308	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.695000	0.61767	2.080000	0.62538	0.460000	0.39030	GAA	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1		53.368952	0	14	68	0	0	1	0	NM_006810	17	53.508705	22	0.435897
MAP3K12	7786	broad.mit.edu	hg19	12	53880791	53880791	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr12:53880791G>A	ENST00000267079.2	-	3	511	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C	MAP3K12_ENST00000547035.1_Missense_Mutation_p.R129C|MAP3K12_ENST00000547488.1_Missense_Mutation_p.R129C|MAP3K12_ENST00000547151.1_5'UTR	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	96		histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37					CAGACAGGGCGCAGGCAGCCA	0.602	0	82.0	67.0	72.0	12	53880791	2203	4300	6503	SO:0001583	missense	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK	8037767	Standard	NM_006301	Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000547035.1:c.385C>T	12.37:g.53880791G>A	ENSP00000448689:p.Arg129Cys	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	ENST00000547035.1	37	CCDS55831.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316940	0.60524	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.77489	-1.09;-1.1;-1.1	4.73	4.73	0.59995	.	0.000000	0.42821	D	0.000645	T	0.78848	0.4348	L	0.27053	0.805	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;P	0.67900	0.954;0.899	T	0.80710	-0.1261	10	0.87932	D	0	.	10.797	0.46466	0.0:0.0:0.6951:0.3049	.	129;96	G3V1Y2;Q12852	.;M3K12_HUMAN	C	96;129;129	ENSP00000267079:R96C;ENSP00000449038:R129C;ENSP00000448689:R129C	ENSP00000267079:R96C	R	-	1	0	MAP3K12	52167058	0.958000	0.32768	1.000000	0.80357	0.994000	0.84299	1.747000	0.38298	2.353000	0.79882	0.462000	0.41574	CGC	MAP3K12-005	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000406270.1		-4.616330	0	10	60	0	0	1	0	NM_006301	3	6.877454	52	0.054545
HMGXB4	10042	broad.mit.edu	hg19	22	35661472	35661472	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr22:35661472C>A	ENST00000216106.5	+	5	1219	c.1091C>A	c.(1090-1092)cCc>cAc	p.P364H	HMGXB4_ENST00000444518.2_Missense_Mutation_p.P255H	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	364		endosome to lysosome transport|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	NURF complex	DNA binding	breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					GGCCCTCCTCCCAGCATCCCA	0.517	0	74.0	77.0	76.0	22	35661472	2203	4300	6503	SO:0001583	missense	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281	"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1	10329004, 10591208, 20511232	Standard	NM_001003681	Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1091C>A	22.37:g.35661472C>A	ENSP00000216106:p.Pro364His	O75672|O75673|Q9UMT5	ENST00000216106.5	37	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.529083	0.27387	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.52057	0.68;2.19;0.69;2.19	5.74	4.73	0.59995	.	0.509257	0.24054	N	0.041970	T	0.28167	0.0695	N	0.14661	0.345	0.33438	D	0.582035	P	0.45283	0.855	B	0.37091	0.241	T	0.47611	-0.9104	10	0.87932	D	0	-11.8579	10.4023	0.44237	0.0:0.8555:0.0:0.1445	.	364	Q9UGU5	HMGX4_HUMAN	H	255;255;255;364	ENSP00000401658:P255H;ENSP00000398302:P255H;ENSP00000415500:P255H;ENSP00000216106:P364H	ENSP00000216106:P364H	P	+	2	0	HMGXB4	33991472	0.998000	0.40836	0.989000	0.46669	0.462000	0.32619	3.083000	0.50136	2.712000	0.92718	0.650000	0.86243	CCC	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2		86.831972	1	-11	57	0	1.2476e-16	1	1.28225e-16	NM_005487	27	87.586145	15	0.642857
UBR4	23352	broad.mit.edu	hg19	1	19473374	19473374	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr1:19473374G>A	ENST00000375267.2	-	52	7753	c.7750C>T	c.(7750-7752)Cgc>Tgc	p.R2584C	UBR4_ENST00000375217.2_Missense_Mutation_p.R2584C|UBR4_ENST00000375254.3_Missense_Mutation_p.R2584C|UBR4_ENST00000375226.2_Missense_Mutation_p.R2595C			Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2584		interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	TTGTTGGGGCGCATGATGGCA	0.532	0	230.0	214.0	220.0	1	19473374	2203	4300	6503	SO:0001583	missense	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481	"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1	14702039, 10718198, 16055722	Standard	XM_005245802	Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.7750C>T	1.37:g.19473374G>A	ENSP00000364403:p.Arg2584Cys	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942569	0.73672	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.39787	1.26;1.25;1.39;1.06	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.61451	0.2348	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.61783	-0.6992	10	0.87932	D	0	.	16.0062	0.80363	0.0:0.0:0.8575:0.1425	.	2584	Q5T4S7	UBR4_HUMAN	C	2584;2584;2584;2595;199;1305	ENSP00000364403:R2584C;ENSP00000364416:R2584C;ENSP00000364365:R2584C;ENSP00000364374:R2595C	ENSP00000364365:R2584C	R	-	1	0	UBR4	19345961	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.891000	0.63185	2.817000	0.96982	0.563000	0.77884	CGC	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1		-34.145054	0	-7	208	0	0	1	0	NM_020765	4	7.628042	162	0.024096
OGN	4969	broad.mit.edu	hg19	9	95147973	95147973	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr9:95147973G>T	ENST00000262551.4	-	7	1246	c.826C>A	c.(826-828)Cca>Aca	p.P276T	CENPP_ENST00000375587.3_Intron|OGN_ENST00000375561.5_Missense_Mutation_p.P276T	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	276			extracellular space|proteinaceous extracellular matrix	growth factor activity	central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13					AGGACGATTGGATTGCCCTCC	0.403	0	147.0	139.0	142.0	9	95147973	2203	4300	6503	SO:0001583	missense	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809	"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""		2372374	Standard	NM_033014	Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.826C>A	9.37:g.95147973G>T	ENSP00000262551:p.Pro276Thr	Q6FIB0|Q9UF90|Q9UNK5	ENST00000262551.4	37	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283429	0.80803	.	.	ENSG00000106809	ENST00000262551;ENST00000375561	D;D	0.83673	-1.75;-1.75	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.91277	0.7250	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.91505	0.5222	10	0.66056	D	0.02	.	19.6241	0.95671	0.0:0.0:1.0:0.0	.	334;276	B4DI63;P20774	.;MIME_HUMAN	T	276	ENSP00000262551:P276T;ENSP00000364711:P276T	ENSP00000262551:P276T	P	-	1	0	OGN	94187794	1.000000	0.71417	0.947000	0.38551	0.617000	0.37484	9.835000	0.99442	2.708000	0.92522	0.650000	0.86243	CCA	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1		-4.183354	1	-24	84	0	0.000602214	1	0.000602214	NM_024416	5	9.876158	68	0.068493
PPP1R12C	54776	broad.mit.edu	hg19	19	55602889	55602889	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr19:55602889T>C	ENST00000263433.3	-	22	2315	c.2300A>G	c.(2299-2301)aAg>aGg	p.K767R	PPP1R12C_ENST00000435544.2_Missense_Mutation_p.K692R|PPP1R12C_ENST00000376393.2_Missense_Mutation_p.K704R	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	767			cytoplasm		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)	ATTCTCATCCTTGAGGCGCTG	0.637	0	60.0	55.0	57.0	19	55602889	2203	4300	6503	SO:0001583	missense	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3	11399775	Standard	NM_017607	Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.2300A>G	19.37:g.55602889T>C	ENSP00000263433:p.Lys767Arg		ENST00000263433.3	37	CCDS12916.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.902556	0.52227	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.15718	2.4;2.4;2.4	4.2	3.17	0.36434	.	0.145923	0.42821	D	0.000646	T	0.31009	0.0783	L	0.58810	1.83	0.30710	N	0.749401	D;P;D	0.69078	0.997;0.873;0.997	D;B;D	0.73380	0.98;0.411;0.98	T	0.13818	-1.0495	10	0.87932	D	0	.	5.7809	0.18306	0.0:0.1213:0.0:0.8787	.	692;765;767	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	R	767;704;692	ENSP00000263433:K767R;ENSP00000365573:K704R;ENSP00000387833:K692R	ENSP00000263433:K767R	K	-	2	0	PPP1R12C	60294701	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	3.603000	0.54074	1.683000	0.51011	0.459000	0.35465	AAG	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2		51.300471	0	-2	45	0	0	1	0	NM_017607	16	51.307465	15	0.516129
SLC40A1	30061	broad.mit.edu	hg19	2	190428516	190428516	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr2:190428516T>C	ENST00000261024.2	-	7	1622	c.1196A>G	c.(1195-1197)gAc>gGc	p.D399G		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	399		anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding	endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)		AACGGACAAGTCCAGGGGGCT	0.428	0	78.0	77.0	77.0	2	190428516	2203	4300	6503	SO:0001583	missense	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449	"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3	10828623	Standard	NM_014585	Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1196A>G	2.37:g.190428516T>C	ENSP00000261024:p.Asp399Gly	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	ENST00000261024.2	37	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.931013	0.92389	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.93906	-3.31	6.02	6.02	0.97574	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.96318	0.8799	M	0.78049	2.395	0.80722	D	1	D	0.67145	0.996	D	0.66196	0.942	D	0.96125	0.9088	10	0.49607	T	0.09	-33.6668	16.542	0.84395	0.0:0.0:0.0:1.0	.	399	Q9NP59	S40A1_HUMAN	G	399;134	ENSP00000261024:D399G	ENSP00000261024:D399G	D	-	2	0	SLC40A1	190136761	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.025000	0.88777	2.304000	0.77564	0.528000	0.53228	GAC	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		73.833352	0	-11	50	0	0	1	0		23	73.837571	24	0.489362
KRT83	3889	broad.mit.edu	hg19	12	52710711	52710711	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr12:52710711T>C	ENST00000293670.3	-	5	909	c.847A>G	c.(847-849)Atc>Gtc	p.I283V		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	283	Coil 2.|Rod.	epidermis development	keratin filament	structural molecule activity	NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)	TGTGCCTTGATCTCGGCAACG	0.582	0	175.0	145.0	155.0	12	52710711	2203	4300	6503	SO:0001583	missense	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523	"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3	9084137, 16831889	Standard	NM_002282	Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.847A>G	12.37:g.52710711T>C	ENSP00000293670:p.Ile283Val	A1A4S9|B2RC21|Q6NT21|Q9NSB3	ENST00000293670.3	37	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	T	4.896	0.166519	0.09339	.	.	ENSG00000170523	ENST00000293670	D	0.89270	-2.49	3.9	3.9	0.45041	Filament (1);	0.000000	0.42053	U	0.000761	T	0.80914	0.4715	L	0.37800	1.135	0.36185	D	0.849683	B	0.28233	0.204	B	0.37692	0.256	T	0.72090	-0.4395	10	0.02654	T	1	.	4.7787	0.13192	0.0:0.2834:0.0:0.7166	.	283	P78385	KRT83_HUMAN	V	283	ENSP00000293670:I283V	ENSP00000293670:I283V	I	-	1	0	KRT83	50996978	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	5.993000	0.70616	1.544000	0.49359	0.459000	0.35465	ATC	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1		7.955240	0	-29	108	0	0	1	0	NM_002282	8	16.268038	53	0.131148
WDR41	55255	broad.mit.edu	hg19	5	76788029	76788029	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr5:76788029A>C	ENST00000296679.4	-	1	392	c.17T>G	c.(16-18)aTc>aGc	p.I6S	WDR41_ENST00000507029.1_Missense_Mutation_p.I6S	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	6					NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)	GCCTCCCCCGATCAGCCATCG	0.706	0	42.0	45.0	44.0	5	76788029	2203	4300	6503	SO:0001583	missense	AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253	"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product					12477932	Standard	NM_018268	Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.17T>G	5.37:g.76788029A>C	ENSP00000296679:p.Ile6Ser	B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	ENST00000296679.4	37	CCDS4038.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.920822	0.73213	.	.	ENSG00000164253	ENST00000296679;ENST00000507029;ENST00000511791;ENST00000514559;ENST00000511036	T;T;T;T;T	0.59224	0.39;0.92;1.15;0.35;0.28	4.02	4.02	0.46733	.	0.418213	0.25981	N	0.027077	T	0.38188	0.1031	N	0.14661	0.345	0.80722	D	1	P;B	0.45348	0.856;0.181	B;B	0.38156	0.266;0.134	T	0.46693	-0.9173	10	0.87932	D	0	-3.0539	11.6016	0.51006	1.0:0.0:0.0:0.0	.	6;6	B4DT55;Q9HAD4	.;WDR41_HUMAN	S	6	ENSP00000296679:I6S;ENSP00000424287:I6S;ENSP00000423540:I6S;ENSP00000426937:I6S;ENSP00000422510:I6S	ENSP00000296679:I6S	I	-	2	0	WDR41	76823785	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.877000	0.63086	1.805000	0.52779	0.374000	0.22700	ATC	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220014.2		46.248309	0	-12	42	0	0	1	0	NM_018268	14	46.277244	16	0.466667
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		127.249806	0	-21	91	0	0	1	0	NM_002072	38	127.274374	41	0.481013
SNHG14	0	broad.mit.edu	hg19	15	25321125	25321125	+	RNA	SNP	T	T	G			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr15:25321125T>G	ENST00000549804.2	+	0	1109				SNORD116-11_ENST00000383882.1_RNA																	TTGAACAAAATGAGTGAAAAC	0.443	0	111.0	100.0	104.0	15	25321125	876	1991	2867					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078	"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1	23771028	Standard		Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25321125T>G			ENST00000549804.2	37																																																																																				SNHG14-012	KNOWN	non_canonical_other|basic	antisense	processed_transcript	OTTHUMT00000408278.2		62.223338	0	-56	149	0	0	1	0		19	62.245036	21	0.475000
ZBTB8A	653121	broad.mit.edu	hg19	1	33058775	33058775	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr1:33058775C>G	ENST00000373510.4	+	3	472	c.243C>G	c.(241-243)gaC>gaG	p.D81E	RP1-27O5.3_ENST00000480336.1_3'UTR|ZBTB8A_ENST00000316459.4_Missense_Mutation_p.D81E	NM_001040441.1	NP_001035531.1	Q96BR9	ZBT8A_HUMAN	zinc finger and BTB domain containing 8A	81	BTB.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	cervix(2)|large_intestine(2)|lung(2)|prostate(1)	7					TTATCTTGGACTTCGTATATT	0.413	0	113.0	108.0	110.0	1	33058775	2203	4300	6503	SO:0001583	missense	AF548353	CCDS30664.1	1p34.3	2013-01-08	2009-03-25	2009-03-25	ENSG00000160062	ENSG00000160062	"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24172	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 8"""	ZBTB8	12477932	Standard	NM_001040441	Approved	BOZF1, FLJ90065, ZNF916A	uc001bvn.3	Q96BR9	OTTHUMG00000007855	ENST00000373510.4:c.243C>G	1.37:g.33058775C>G	ENSP00000362609:p.Asp81Glu	Q8IUL5|Q8IWR9|Q8N2Y5|Q96BX0	ENST00000373510.4	37	CCDS30664.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.640850	0.67244	.	.	ENSG00000160062	ENST00000373510;ENST00000316459	T;T	0.70045	-0.45;-0.45	5.32	4.39	0.52855	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	U	0.000000	T	0.69940	0.3167	L	0.37630	1.12	0.43953	D	0.996624	D;D	0.89917	1.0;0.988	D;D	0.97110	1.0;0.968	T	0.64803	-0.6321	10	0.27785	T	0.31	-16.0751	9.3611	0.38197	0.0:0.8499:0.0:0.1501	.	81;81	Q96BR9;D3DPQ1	ZBT8A_HUMAN;.	E	81	ENSP00000362609:D81E;ENSP00000317561:D81E	ENSP00000317561:D81E	D	+	3	2	ZBTB8A	32831362	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	0.687000	0.25407	2.651000	0.90000	0.585000	0.79938	GAC	ZBTB8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021665.2		0.381265	0	-1	134	0	0	1	0	NM_144621	9	21.028093	105	0.078947
MUC16	94025	broad.mit.edu	hg19	19	8999436	8999436	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr19:8999436T>C	ENST00000397910.4	-	56	40942	c.40739A>G	c.(40738-40740)gAg>gGg	p.E13580G	MUC16_ENST00000380951.5_Missense_Mutation_p.E221G	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13582	SEA 10.	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590					GGGGCCCAGCTCAGTGATGCT	0.572	0	235.0	197.0	210.0	19	8999436	2063	4208	6271	SO:0001583	missense	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143	"""Mucins"""	15582	protein-coding gene	gene with protein product		606154			11369781	Standard	XM_006722941	Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40739A>G	19.37:g.8999436T>C	ENSP00000381008:p.Glu13580Gly	Q6ZQW5|Q96RK2	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.899|8.899	0.955939|0.955939	0.18507|0.18507	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.29655|.	1.56;1.56|.	3.48|3.48	-1.19|-1.19	0.09585|0.09585	SEA (2);|.	.|.	.|.	.|.	.|.	T|T	0.53254|0.53254	0.1785|0.1785	M|M	0.65975|0.65975	2.015|2.015	.|.	.|.	.|.	B;D|.	0.53745|.	0.134;0.962|.	B;D|.	0.66716|.	0.063;0.946|.	T|T	0.58086|0.58086	-0.7698|-0.7698	7|4	.|.	.|.	.|.	.|.	7.319|7.319	0.26517|0.26517	0.0:0.4982:0.0:0.5018|0.0:0.4982:0.0:0.5018	.|.	21225;13580|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	G|G	13580;221|420	ENSP00000381008:E13580G;ENSP00000370338:E221G|.	.|.	E|S	-|-	2|1	0|0	MUC16|MUC16	8860436|8860436	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.020000|0.020000	0.10135|0.10135	-0.642000|-0.642000	0.05427|0.05427	-0.468000|-0.468000	0.06922|0.06922	0.454000|0.454000	0.30748|0.30748	GAG|AGC	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		143.329073	0	-48	333	0	0	1	0	NM_024690	56	157.634179	177	0.240343
NREP	9315	broad.mit.edu	hg19	5	111066659	111066659	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr5:111066659C>T	ENST00000379671.3	-	5	430	c.166G>A	c.(166-168)Gaa>Aaa	p.E56K	NREP_ENST00000455559.2_Missense_Mutation_p.E56K|NREP_ENST00000446294.2_Missense_Mutation_p.E56K|NREP_ENST00000450761.2_Missense_Mutation_p.E56K|NREP_ENST00000509427.1_Missense_Mutation_p.E56K|STARD4-AS1_ENST00000513221.1_RNA|NREP_ENST00000447165.2_Missense_Mutation_p.E56K|NREP_ENST00000507742.1_5'UTR|NREP_ENST00000509979.1_3'UTR|NREP_ENST00000395634.3_Missense_Mutation_p.E100K|NREP_ENST00000515855.1_3'UTR|NREP_ENST00000508870.1_Missense_Mutation_p.E56K|NREP_ENST00000509025.1_Intron|NREP_ENST00000419114.2_Missense_Mutation_p.E56K|STARD4-AS1_ENST00000500779.2_RNA|NREP_ENST00000257435.7_Missense_Mutation_p.E56K|NREP_ENST00000453526.2_Missense_Mutation_p.E56K	NM_001142478.1	NP_001135950.1	Q16612	NP311_HUMAN	neuronal regeneration related protein	56			cytoplasm								GAGCGGAGTTCACTGCTGCCC	0.478	0	168.0	147.0	154.0	5	111066659	2202	4300	6502	SO:0001583	missense	AF119859	CCDS4105.1, CCDS47255.1	5q22.1	2012-12-07	2012-12-07	2012-01-23	ENSG00000134986	ENSG00000134986		16834	protein-coding gene	gene with protein product	"""neuronal protein 3.1"""	607332	"""chromosome 5 open reading frame 13"", ""neuronal regeneration related protein homolog (rat)"""	C5orf13	8261136, 10981724, 15485502	Standard	NM_004772	Approved	P311, D4S114, PRO1873, PTZ17, SEZ17	uc011cvr.2	Q16612	OTTHUMG00000128795	ENST00000379671.3:c.166G>A	5.37:g.111066659C>T	ENSP00000368993:p.Glu56Lys	B2RDN8|B7Z5D2|D3DSZ8	ENST00000379671.3	37	CCDS4105.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635706	0.29068	.	.	ENSG00000134986	ENST00000379671;ENST00000257435;ENST00000447165;ENST00000446294;ENST00000395634;ENST00000450761;ENST00000419114;ENST00000509427;ENST00000453526;ENST00000455559;ENST00000508870;ENST00000513100	T;T;T;T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.38	5.38	0.77491	.	0.455843	0.20888	N	0.083874	T	0.55226	0.1907	.	.	.	0.19300	N	0.999973	P;P;B	0.42078	0.77;0.77;0.322	P;P;B	0.48598	0.505;0.583;0.142	T	0.50268	-0.8848	9	0.38643	T	0.18	-0.6437	19.1289	0.93397	0.0:1.0:0.0:0.0	.	56;100;56	D6RIC9;B7Z5D2;Q16612	.;.;NP311_HUMAN	K	56;56;56;56;100;56;56;56;56;56;56;56	ENSP00000368993:E56K;ENSP00000257435:E56K;ENSP00000408839:E56K;ENSP00000402965:E56K;ENSP00000378996:E100K;ENSP00000416617:E56K;ENSP00000399766:E56K;ENSP00000422630:E56K;ENSP00000403383:E56K;ENSP00000392559:E56K;ENSP00000427149:E56K;ENSP00000427476:E56K	ENSP00000257435:E56K	E	-	1	0	C5orf13	111094558	0.349000	0.24870	0.020000	0.16555	0.948000	0.59901	3.573000	0.53856	2.523000	0.85059	0.655000	0.94253	GAA	NREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250722.1		101.174741	0	-12	65	0	0	1	0	NM_004772	33	101.205669	30	0.523810
NPR1	4881	broad.mit.edu	hg19	1	153658320	153658320	+	Silent	SNP	C	C	T			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr1:153658320C>T	ENST00000368680.3	+	9	2116	c.1644C>T	c.(1642-1644)ggC>ggT	p.G548G		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)	548	Protein kinase.	body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity	NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		CCACAGAGGGCCAGTTCCAAG	0.562	0	67.0	59.0	62.0	1	153658320	2203	4300	6503	SO:0001819	synonymous_variant	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418		7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA	1979052	Standard	NM_000906	Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1644C>T	1.37:g.153658320C>T		B0ZBF0|Q5SR08|Q6P4Q3	ENST00000368680.3	37	CCDS1051.1																																																																																			NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1		76.001443	0	-12	82	0	0	1	0	NM_000906	27	76.717383	42	0.391304
IFT140	9742	broad.mit.edu	hg19	16	1574691	1574691	+	Silent	SNP	C	C	T	rs151293332		TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr16:1574691C>T	ENST00000426508.2	-	24	3366	c.3003G>A	c.(3001-3003)gcG>gcA	p.A1001A	IFT140_ENST00000361339.5_Silent_p.A195A	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140 homolog (Chlamydomonas)	1001					breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)			TGGCTATTTGCGCAGCCTAGA	0.632	0	57.0	60.0	59.0	16	1574691	2199	4300	6499	SO:0001819	synonymous_variant	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535	"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2	9628581	Standard	NM_014714	Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000361339.5:c.585G>A	16.37:g.1574691C>T		A2A2A8|D3DU75|O60332|Q9UG52	ENST00000361339.5	37																																																																																				IFT140-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432772.1		-1.905916	0	-9	53	0	0	1	0	NM_014714	3	6.577931	41	0.068182
TGM4	7047	broad.mit.edu	hg19	3	44952846	44952846	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr3:44952846A>C	ENST00000296125.4	+	13	1929	c.1861A>C	c.(1861-1863)Aag>Cag	p.K621Q		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	621		peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	GACTGACGTCAAGTTCTCTTT	0.478	0	152.0	142.0	145.0	3	44952846	2203	4300	6503	SO:0001583	missense	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""		7665178, 7916568	Standard	NM_003241	Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1861A>C	3.37:g.44952846A>C	ENSP00000296125:p.Lys621Gln	Q16707|Q96QN4	ENST00000296125.4	37	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	A	9.577	1.122484	0.20877	.	.	ENSG00000163810	ENST00000296125	T	0.68025	-0.3	2.72	1.33	0.21861	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.141093	0.30126	U	0.010344	T	0.47581	0.1453	L	0.33485	1.01	0.22066	N	0.999383	B	0.30973	0.302	B	0.29663	0.105	T	0.25293	-1.0136	10	0.16420	T	0.52	.	8.4649	0.32949	0.6368:0.3632:0.0:0.0	.	621	P49221	TGM4_HUMAN	Q	621	ENSP00000296125:K621Q	ENSP00000296125:K621Q	K	+	1	0	TGM4	44927850	0.783000	0.28701	0.226000	0.23910	0.097000	0.18754	1.203000	0.32284	0.991000	0.38814	0.460000	0.39030	AAG	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2		135.162893	0	-28	100	0	0	1	0	NM_003241	41	135.607544	55	0.427083
SLIT2	9353	broad.mit.edu	hg19	4	20543158	20543158	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr4:20543158G>A	ENST00000504154.1	+	20	2311	c.2059G>A	c.(2059-2061)Gga>Aga	p.G687R	SLIT2_ENST00000503837.1_Missense_Mutation_p.G683R|SLIT2_ENST00000503823.1_Missense_Mutation_p.G679R|SLIT2_ENST00000273739.5_Missense_Mutation_p.G691R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	687	LRRCT 3.	apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116					AATTGTCACGGGAAATCCTAG	0.438	0	114.0	103.0	107.0	4	20543158	2203	4300	6503	SO:0001583	missense	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147		11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3	9813312, 18269211	Standard	XM_005248211	Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2059G>A	4.37:g.20543158G>A	ENSP00000422591:p.Gly687Arg	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717663	0.89205	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.80738	-1.41;-1.41;-1.34;-1.4	5.91	5.91	0.95273	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89199	0.6647	M	0.62088	1.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88716	0.3226	10	0.62326	D	0.03	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	679;687	O94813-3;O94813	.;SLIT2_HUMAN	R	679;687;691;683;683	ENSP00000427548:G679R;ENSP00000422591:G687R;ENSP00000273739:G691R;ENSP00000422261:G683R	ENSP00000273739:G691R	G	+	1	0	SLIT2	20152256	1.000000	0.71417	0.978000	0.43139	0.909000	0.53808	9.471000	0.97696	2.794000	0.96219	0.655000	0.94253	GGA	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		-4.809987	0	9	76	0	0	1	0		3	6.678549	52	0.054545
SHPK	23729	broad.mit.edu	hg19	17	3514063	3514063	+	Silent	SNP	G	G	A			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr17:3514063G>A	ENST00000225519.3	-	7	1330	c.1228C>T	c.(1228-1230)Ctg>Ttg	p.L410L		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	410		carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity	breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)	ATGGAGTGCAGGTTCTGAACA	0.632	0	122.0	123.0	123.0	17	3514063	2203	4300	6503	SO:0001819	synonymous_variant	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL	10673275, 18186520	Standard	NM_013276	Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.1228C>T	17.37:g.3514063G>A		B2R640|Q8WUH3	ENST00000225519.3	37	CCDS11030.1																																																																																			SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2		123.454648	0	-13	112	0	0	1	0		38	123.566422	32	0.542857
LAMA1	284217	broad.mit.edu	hg19	18	6999964	6999964	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr18:6999964T>C	ENST00000389658.3	-	31	4508	c.4415A>G	c.(4414-4416)cAc>cGc	p.H1472R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1472	Laminin EGF-like 16.	axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)			ACGGAAATCGTGGTCCCCTTC	0.423	0	77.0	68.0	71.0	18	6999964	2203	4300	6503	SO:0001583	missense	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680	"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA	2591971	Standard	NM_005559	Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4415A>G	18.37:g.6999964T>C	ENSP00000374309:p.His1472Arg		ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	5.540	0.284495	0.10513	.	.	ENSG00000101680	ENST00000389658	T	0.62364	0.03	5.43	-2.46	0.06461	EGF-like, laminin (3);	1.471490	0.03930	N	0.285182	T	0.45216	0.1331	N	0.19112	0.55	0.09310	N	1	B	0.25719	0.132	B	0.31101	0.124	T	0.24870	-1.0148	10	0.15499	T	0.54	.	7.4081	0.27001	0.0:0.2705:0.1162:0.6132	.	1472	P25391	LAMA1_HUMAN	R	1472	ENSP00000374309:H1472R	ENSP00000374309:H1472R	H	-	2	0	LAMA1	6989964	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	0.464000	0.21988	-0.581000	0.05937	-0.242000	0.12053	CAC	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1		7.886176	0	-14	22	0	0	1	0	NM_005559	4	9.979212	18	0.181818
ARHGAP39	80728	broad.mit.edu	hg19	8	145773633	145773634	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-VD-AA8M-01A-11D-A39W-08	TCGA-VD-AA8M-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	944a308f-a7f5-4601-8de6-a7b13fd87ff6	0e406133-a743-4957-991f-d050adb9f6a2	g.chr8:145773633_145773634delGG	ENST00000276826.5	-	4	1037_1038	c.836_837delCC	c.(835-837)gccfs	p.A279fs	ARHGAP39_ENST00000540274.1_Frame_Shift_Del_p.A279fs|ARHGAP39_ENST00000377307.2_Frame_Shift_Del_p.A279fs			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	279	Pro-rich.	axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity	NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22					CTGGGAGCTCGGCCCTCTTCAG	0.693	0									SO:0001589	frameshift_variant		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799	"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880			15755809	Standard	XM_005272344	Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.836_837delCC	8.37:g.145773633_145773634delGG	ENSP00000276826:p.Ala279fs	B4E1I1	ENST00000276826.5	37																																																																																				ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1	.	.		0	9						3		5	0.38
