Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
CEP95	90799	broad.mit.edu	hg19	17	62530713	62530713	+	Missense_Mutation	SNP	A	A	C			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr17:62530713A>C	ENST00000556440.2	+	17	2438	c.1928A>C	c.(1927-1929)aAg>aCg	p.K643T	CEP95_ENST00000553412.1_Missense_Mutation_p.K479T	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	643			centrosome|spindle pole	protein binding	endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13					CAAGACTTCAAGGACTGCATT	0.438	0	74.0	73.0	74.0	17	62530713	1935	4143	6078	SO:0001583	missense	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890		25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45	21399614	Standard	NM_138363	Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1928A>C	17.37:g.62530713A>C	ENSP00000450461:p.Lys643Thr	B4DMD2|Q96M81	ENST00000556440.2	37	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.303703	0.60305	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.45276	0.97;0.9	5.75	4.65	0.58169	.	0.194559	0.53938	D	0.000058	T	0.49287	0.1548	M	0.62723	1.935	0.34727	D	0.729379	D;D	0.55800	0.973;0.973	P;P	0.51657	0.559;0.676	T	0.64723	-0.6340	10	0.72032	D	0.01	-10.2392	9.4469	0.38703	0.8611:0.0:0.1389:0.0	.	643;643	A8K3H2;Q96GE4	.;CEP95_HUMAN	T	578;643;479	ENSP00000450461:K643T;ENSP00000450906:K479T	ENSP00000438458:K578T	K	+	2	0	CEP95	59961175	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	1.783000	0.38664	1.057000	0.40506	0.528000	0.53228	AAG	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2		23.393320	0	11	63	0	0	1	0	NM_138363	8	23.863304	15	0.347826
GPR87	0	broad.mit.edu	hg19	3	151012731	151012731	+	Missense_Mutation	SNP	A	A	C			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr3:151012731A>C	ENST00000260843.4	-	3	767	c.303T>G	c.(301-303)gaT>gaG	p.D101E	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	101			integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		CAAATCCTGCATCATGGACTA	0.383	0	132.0	131.0	131.0	3	151012731	2203	4300	6503	SO:0001583	missense	AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271	"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95	11273702	Standard	NM_023915	Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.303T>G	3.37:g.151012731A>C	ENSP00000260843:p.Asp101Glu	Q5KU35|Q96JZ8|Q9BXC2	ENST00000260843.4	37	CCDS3157.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263596	0.59431	.	.	ENSG00000138271	ENST00000260843	T	0.38240	1.15	5.31	-8.55	0.00908	GPCR, rhodopsin-like superfamily (1);	0.131721	0.49916	D	0.000132	T	0.38054	0.1026	M	0.80508	2.5	0.09310	N	0.99999	P	0.49447	0.924	P	0.47864	0.559	T	0.47262	-0.9131	10	0.23302	T	0.38	-4.0025	13.9406	0.64052	0.2591:0.0:0.6434:0.0975	.	101	Q9BY21	GPR87_HUMAN	E	101	ENSP00000260843:D101E	ENSP00000260843:D101E	D	-	3	2	GPR87	152495421	0.003000	0.15002	0.008000	0.14137	0.843000	0.47879	-0.922000	0.04004	-1.751000	0.01326	-0.290000	0.09829	GAT	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357788.1		63.218361	0	37	109	0	0	1	0		19	63.521761	27	0.413043
ASXL3	80816	broad.mit.edu	hg19	18	31323330	31323330	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr18:31323330C>T	ENST00000269197.5	+	12	3518	c.3518C>T	c.(3517-3519)gCc>gTc	p.A1173V		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3 (Drosophila)	1173		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43					AACAAGTCTGCCCACCTCCGG	0.443	0	46.0	45.0	45.0	18	31323330	1921	4137	6058	SO:0001583	missense	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431		29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713	11214970	Standard	NM_030632	Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3518C>T	18.37:g.31323330C>T	ENSP00000269197:p.Ala1173Val	Q6ZMX6|Q96MU3|Q9UFC5	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	9.525	1.109348	0.20714	.	.	ENSG00000141431	ENST00000269197	T	0.51574	0.7	5.38	1.57	0.23409	.	2.345140	0.01510	N	0.017865	T	0.35711	0.0941	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30937	-0.9961	10	0.41790	T	0.15	.	10.9295	0.47209	0.0:0.7583:0.0:0.2417	.	1173	Q9C0F0	ASXL3_HUMAN	V	1173	ENSP00000269197:A1173V	ENSP00000269197:A1173V	A	+	2	0	ASXL3	29577328	0.042000	0.20092	0.025000	0.17156	0.938000	0.57974	0.819000	0.27308	0.406000	0.25560	0.655000	0.94253	GCC	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		27.672531	0	25	52	0	0	1	0		9	27.716102	11	0.450000
USP49	25862	broad.mit.edu	hg19	6	41766669	41766669	+	Splice_Site	SNP	T	T	G			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr6:41766669T>G	ENST00000394253.3	-	6	2000		c.e6-2		USP49_ENST00000373009.3_Splice_Site|USP49_ENST00000373010.1_Splice_Site|USP49_ENST00000297229.2_Splice_Site|USP49_ENST00000373006.1_Splice_Site			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49			ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		CCAGACCACCTAGAACATGGA	0.413	1	71.0	64.0	67.0	6	41766669	2203	4300	6503	SO:0001630	splice_region_variant	AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663	"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""		14715245	Standard	NM_018561	Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1671-2A>C	6.37:g.41766669T>G		Q5T3D9|Q5T3E0|Q96CK4	ENST00000394253.3	37		.	.	.	.	.	.	.	.	.	.	T	23.5	4.424080	0.83667	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8428	0.78864	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP49	41874647	1.000000	0.71417	0.937000	0.37676	0.986000	0.74619	8.040000	0.89188	2.234000	0.73211	0.533000	0.62120	.	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3		-8.218775	0	-8	69	0	0	1	0	NM_018561	6	7.055018	75	0.074074
SLC26A5	375611	broad.mit.edu	hg19	7	103050935	103050935	+	Translation_Start_Site	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr7:103050935C>T	ENST00000354356.4	-	0	798				SLC26A5_ENST00000393723.1_Missense_Mutation_p.R211H|SLC26A5_ENST00000393729.1_Missense_Mutation_p.R174H|SLC26A5_ENST00000393727.1_Missense_Mutation_p.R211H|SLC26A5_ENST00000356767.4_Missense_Mutation_p.R211H|SLC26A5_ENST00000393735.2_Missense_Mutation_p.R211H|SLC26A5_ENST00000393730.1_Missense_Mutation_p.R211H|SLC26A5_ENST00000432958.2_Missense_Mutation_p.R211H|SLC26A5_ENST00000339444.6_Missense_Mutation_p.R211H|SLC26A5_ENST00000306312.3_Missense_Mutation_p.R211H			P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5			regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity	endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43					GGTAAACCCACGGACCAGAGG	0.413	0	70.0	69.0	69.0	7	103050935	2203	4300	6503			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615	"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES	10821263	Standard	NM_206883	Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000354356.4:c.-800G>A	7.37:g.103050935C>T		Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	ENST00000354356.4	37		.	.	.	.	.	.	.	.	.	.	C	24.6	4.553733	0.86231	.	.	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12	5.72	5.72	0.89469	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.95987	0.8693	M	0.78637	2.42	0.80722	D	1	P;D;P;D;D	0.76494	0.909;0.999;0.733;0.996;0.997	P;D;P;P;P	0.66497	0.634;0.944;0.501;0.839;0.907	D	0.95899	0.8913	10	0.72032	D	0.01	.	19.885	0.96909	0.0:1.0:0.0:0.0	.	211;211;211;211;211	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	H	211;211;211;211;211;211;174;211;211	ENSP00000342396:R211H;ENSP00000349210:R211H;ENSP00000377336:R211H;ENSP00000304783:R211H;ENSP00000377331:R211H;ENSP00000389733:R211H;ENSP00000377330:R174H;ENSP00000377328:R211H;ENSP00000377324:R211H	ENSP00000304783:R211H	R	-	2	0	SLC26A5	102838171	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.667000	0.68067	2.708000	0.92522	0.591000	0.81541	CGT	SLC26A5-201	KNOWN	basic	protein_coding	protein_coding			35.525122	0	25	64	0	0	1	0	NM_198999	11	35.534470	12	0.478261
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		117.132570	0	38	150	0	0	1	0	NM_002072	35	117.233656	41	0.460526
DHRS7B	25979	broad.mit.edu	hg19	17	21092103	21092103	+	Silent	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr17:21092103C>T	ENST00000395511.3	+	6	1019	c.699C>T	c.(697-699)acC>acT	p.T233T	DHRS7B_ENST00000579303.1_Silent_p.T218T|DHRS7B_ENST00000581463.1_Silent_p.T53T	NM_015510.4	NP_056325.2	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	233			integral to membrane|peroxisomal membrane	binding|oxidoreductase activity	endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|pancreas(2)	7					TTGAGGTGACCGTCATCAGCC	0.537	0	133.0	109.0	117.0	17	21092103	2203	4300	6503	SO:0001819	synonymous_variant	BC004126	CCDS11215.1	17p12	2011-09-20				ENSG00000109016	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	24547	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 1"""				10810093, 11230166, 19027726	Standard	NM_015510	Approved	DKFZp566O084, MGC8916, CGI-93, SDR32C1	uc002gyo.3	Q6IAN0		ENST00000581463.1:c.159C>T	17.37:g.21092103C>T		B5MEF4|Q6UX59|Q9BTF9|Q9UFM6|Q9Y3A1	ENST00000581463.1	37																																																																																				DHRS7B-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000444090.2		98.917696	0	28	138	0	0	1	0	NM_015510	31	99.165742	40	0.436620
UBR4	23352	broad.mit.edu	hg19	1	19492233	19492233	+	Silent	SNP	G	G	A	rs143052374		TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr1:19492233G>A	ENST00000375267.2	-	30	4131	c.4128C>T	c.(4126-4128)atC>atT	p.I1376I	UBR4_ENST00000375254.3_Silent_p.I1376I|UBR4_ENST00000375217.2_Silent_p.I1376I|UBR4_ENST00000375226.2_Silent_p.I1376I			Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1376		interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	ATTCCTCCAGGATGGATTCAT	0.433	0	76.0	74.0	75.0	1	19492233	2203	4300	6503	SO:0001819	synonymous_variant	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481	"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1	14702039, 10718198, 16055722	Standard	XM_005245802	Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4128C>T	1.37:g.19492233G>A		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	ENST00000375254.3	37	CCDS189.1																																																																																			UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1		46.316831	0	17	68	0	0	1	0	NM_020765	15	46.685447	23	0.394737
ARSD	414	broad.mit.edu	hg19	X	2825571	2825571	+	Missense_Mutation	SNP	A	A	G			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chrX:2825571A>G	ENST00000381154.1	-	10	1598	c.1523T>C	c.(1522-1524)gTg>gCg	p.V508A		NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	508			lysosome	arylsulfatase activity|metal ion binding	large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			GTGATGGGTCACGCCCTCCCC	0.677	0	18.0	19.0	19.0	X	2825571	2191	4288	6479	SO:0001583	missense	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756	"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002			7720070	Standard	NM_001669	Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1523T>C	X.37:g.2825571A>G	ENSP00000370546:p.Val508Ala	Q9UHJ8	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	a	14.07	2.426690	0.43020	.	.	ENSG00000006756	ENST00000381154;ENST00000458014	D;D	0.94092	-3.35;-3.35	3.03	3.03	0.35002	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.64402	U	0.000003	D	0.96024	0.8705	M	0.83012	2.62	0.47819	D	0.999526	D	0.76494	0.999	D	0.70016	0.967	D	0.95553	0.8622	10	0.66056	D	0.02	.	10.7922	0.46440	1.0:0.0:0.0:0.0	.	508	P51689	ARSD_HUMAN	A	508;110	ENSP00000370546:V508A;ENSP00000409180:V110A	ENSP00000370546:V508A	V	-	2	0	ARSD	2835571	0.999000	0.42202	0.015000	0.15790	0.007000	0.05969	7.544000	0.82117	0.951000	0.37770	0.424000	0.28305	GTG	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		6.349936	0	-4	10	0	0	1	0		2	6.349936	2	0.500000
SETX	23064	broad.mit.edu	hg19	9	135163946	135163946	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr9:135163946G>A	ENST00000372169.2	-	16	6381	c.6199C>T	c.(6199-6201)Cac>Tac	p.H2067Y	SETX_ENST00000224140.5_Missense_Mutation_p.H2067Y|SETX_ENST00000393220.1_Missense_Mutation_p.H2067Y			Q7Z333	SETX_HUMAN	senataxin	2067		cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	CTCATTCTGTGGTTTACTTGG	0.373	0	121.0	118.0	119.0	9	135163946	2202	4300	6502	SO:0001583	missense	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290		445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1	9497266, 11022012	Standard	NM_015046	Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6199C>T	9.37:g.135163946G>A	ENSP00000224140:p.His2067Tyr	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156871	0.78114	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.35	4.44	0.53790	.	0.000000	0.64402	D	0.000001	D	0.89086	0.6615	M	0.65975	2.015	0.37277	D	0.907687	D;D;D	0.89917	0.957;1.0;0.999	D;D;D	0.87578	0.966;0.998;0.994	D	0.90900	0.4768	10	0.72032	D	0.01	.	12.5512	0.56227	0.0816:0.0:0.9184:0.0	.	2067;2067;2067	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	Y	2067;309;2067;2067	ENSP00000224140:H2067Y;ENSP00000409143:H309Y;ENSP00000361242:H2067Y;ENSP00000376913:H2067Y	ENSP00000224140:H2067Y	H	-	1	0	SETX	134153767	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.193000	0.50997	2.671000	0.90904	0.650000	0.86243	CAC	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3		55.651606	0	40	111	0	0	1	0	NM_015046	18	55.826979	13	0.580645
PLD2	5338	broad.mit.edu	hg19	17	4722777	4722777	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr17:4722777G>A	ENST00000263088.6	+	23	2493	c.2362G>A	c.(2362-2364)Gcc>Acc	p.A788T	PLD2_ENST00000572940.1_Missense_Mutation_p.A788T	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	788	Catalytic.	cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity	autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					CAGTGAGCTGGCCGTGCTGAT	0.607	0	100.0	74.0	83.0	17	4722777	2203	4300	6503	SO:0001583	missense	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384			9858823, 9582313	Standard	NM_002663	Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.2362G>A	17.37:g.4722777G>A	ENSP00000263088:p.Ala788Thr	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	ENST00000263088.6	37	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	G	34	5.336125	0.95758	.	.	ENSG00000129219	ENST00000263088	T	0.23552	1.9	4.41	4.41	0.53225	.	0.060781	0.64402	D	0.000004	T	0.58764	0.2145	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.69289	-0.5184	10	0.72032	D	0.01	-7.6039	14.5126	0.67797	0.0:0.0:1.0:0.0	.	788;788	O14939-2;O14939	.;PLD2_HUMAN	T	788	ENSP00000263088:A788T	ENSP00000263088:A788T	A	+	1	0	PLD2	4669743	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.147000	0.94646	2.294000	0.77228	0.563000	0.77884	GCC	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3		22.126358	0	-6	30	0	0	1	0	NM_002663	7	22.198981	5	0.583333
NBEAL2	23218	broad.mit.edu	hg19	3	47041744	47041744	+	Silent	SNP	G	G	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr3:47041744G>A	ENST00000450053.3	+	27	4334	c.4155G>A	c.(4153-4155)caG>caA	p.Q1385Q	NBEAL2_ENST00000292309.5_Silent_p.Q1201Q|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1385				binding	NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)	CAGCCAGCCAGCCCGGCACTC	0.652	0	39.0	45.0	43.0	3	47041744	2102	4212	6314	SO:0001819	synonymous_variant	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796	"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169				Standard	NM_015175	Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4155G>A	3.37:g.47041744G>A		O60288|Q6P994|Q6UX91|Q8NAC9	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	5.485	0.274490	0.10403	.	.	ENSG00000160796	ENST00000416683	.	.	.	5.48	1.15	0.20763	.	.	.	.	.	T	0.57917	0.2086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52056	-0.8626	4	.	.	.	.	9.8571	0.41092	0.3452:0.0:0.6548:0.0	.	.	.	.	N	673	.	.	S	+	2	0	NBEAL2	47016748	1.000000	0.71417	0.999000	0.59377	0.644000	0.38419	0.930000	0.28858	0.297000	0.22615	-0.258000	0.10820	AGC	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3		50.371641	0	27	78	0	0	1	0	XM_291064	17	50.487025	13	0.566667
FKBP9	11328	broad.mit.edu	hg19	7	33028245	33028245	+	Silent	SNP	G	G	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr7:33028245G>A	ENST00000242209.4	+	6	1189	c.1020G>A	c.(1018-1020)ggG>ggA	p.G340G	FKBP9_ENST00000538443.1_Silent_p.G202G|FKBP9_ENST00000538336.1_Silent_p.G393G|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000490776.2_Silent_p.G108G|FKBP9_ENST00000489038.1_3'UTR	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	340	PPIase FKBP-type 3.	protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity	central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)		CTCACCTGGGGTATGGAGAGG	0.512	0	114.0	98.0	103.0	7	33028245	2203	4300	6503	SO:0001819	synonymous_variant	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642	"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""		12036304	Standard	NM_007270	Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1020G>A	7.37:g.33028245G>A		B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	ENST00000242209.4	37	CCDS5439.1																																																																																			FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1		36.695379	0	19	50	0	0	1	0	NM_007270	12	36.820022	16	0.428571
PPP1R3A	5506	broad.mit.edu	hg19	7	113519490	113519490	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr7:113519490C>T	ENST00000284601.3	-	4	1725	c.1657G>A	c.(1657-1659)Gca>Aca	p.A553T		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	553		glycogen metabolic process	integral to membrane		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121					CCAATCCCTGCCACACTTATT	0.418	0	103.0	96.0	98.0	7	113519490	2203	4300	6503	SO:0001583	missense	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3	7926294	Standard	NM_002711	Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1657G>A	7.37:g.113519490C>T	ENSP00000284601:p.Ala553Thr	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994753	0.35226	.	.	ENSG00000154415	ENST00000284601	T	0.16597	2.33	5.72	3.89	0.44902	.	0.804958	0.11529	N	0.554903	T	0.09379	0.0231	N	0.14661	0.345	0.09310	N	1	B	0.17667	0.023	B	0.12837	0.008	T	0.21724	-1.0237	10	0.36615	T	0.2	-0.4916	4.5998	0.12348	0.167:0.5848:0.0:0.2482	.	553	Q16821	PPR3A_HUMAN	T	553	ENSP00000284601:A553T	ENSP00000284601:A553T	A	-	1	0	PPP1R3A	113306726	0.000000	0.05858	0.029000	0.17559	0.019000	0.09904	0.631000	0.24568	1.554000	0.49487	0.655000	0.94253	GCA	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1		53.534194	0	78	143	0	0	1	0	NM_002711	18	54.620908	34	0.346154
SLC12A7	10723	broad.mit.edu	hg19	5	1060463	1060463	+	Missense_Mutation	SNP	C	C	A	rs143654475		TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr5:1060463C>A	ENST00000264930.5	-	21	2886	c.2843G>T	c.(2842-2844)cGa>cTa	p.R948L		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	948		potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		ACGTACCTCTCGCTCCTGCTC	0.562	0	172.0	139.0	150.0	5	1060463	2203	4300	6503	SO:0001583	missense	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504	"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879			10347194	Standard	NM_006598	Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2843G>T	5.37:g.1060463C>A	ENSP00000264930:p.Arg948Leu	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948571	0.53186	.	.	ENSG00000113504	ENST00000264930	T	0.46451	0.87	4.22	4.22	0.49857	.	0.105103	0.64402	D	0.000004	T	0.47322	0.1439	M	0.78223	2.4	0.58432	D	0.999991	B	0.31910	0.346	B	0.33121	0.158	T	0.55451	-0.8139	10	0.54805	T	0.06	.	15.1183	0.72423	0.0:1.0:0.0:0.0	.	948	Q9Y666	S12A7_HUMAN	L	948	ENSP00000264930:R948L	ENSP00000264930:R948L	R	-	2	0	SLC12A7	1113463	0.998000	0.40836	0.818000	0.32626	0.054000	0.15201	6.830000	0.75319	1.911000	0.55334	0.467000	0.42956	CGA	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2		56.381986	1	34	124	0	2.39556e-15	1	2.39556e-15	NM_006598	20	56.902952	31	0.392157
SLC2A8	29988	broad.mit.edu	hg19	9	130169508	130169508	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr9:130169508G>A	ENST00000373371.3	+	10	1503	c.1414G>A	c.(1414-1416)Gcc>Acc	p.A472T	SLC2A8_ENST00000373360.3_3'UTR|SLC2A8_ENST00000373352.1_Missense_Mutation_p.A209T	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	472			cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity	cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11					ACAAATCACAGCCCATTTTGA	0.557	0	75.0	72.0	73.0	9	130169508	2203	4300	6503	SO:0001583	missense	AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856	"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""		10671487, 10821868	Standard	NM_014580	Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.1414G>A	9.37:g.130169508G>A	ENSP00000362469:p.Ala472Thr	Q8WUZ9|Q9NSC4	ENST00000373371.3	37	CCDS6870.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085018	0.76642	.	.	ENSG00000136856	ENST00000373371;ENST00000373352	T;T	0.74106	-0.81;-0.81	5.24	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.80166	0.4573	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74714	-0.3572	10	0.14656	T	0.56	.	12.1113	0.53840	0.0861:0.0:0.9139:0.0	.	472	Q9NY64	GTR8_HUMAN	T	472;209	ENSP00000362469:A472T;ENSP00000362450:A209T	ENSP00000362450:A209T	A	+	1	0	SLC2A8	129209329	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.167000	0.94773	2.445000	0.82738	0.655000	0.94253	GCC	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054177.1		73.395407	0	5	108	0	0	1	0	NM_014580	24	73.433822	27	0.470588
E2F7	144455	ucsc.edu	hg19	12	77419664	77419664	+	Missense_Mutation	SNP	C	C	A			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54																										GATGGTAAGACCATGCAAGGG	0.527	0	43.0	48.0	46.0	12	77419664	2203	4300	6503	SO:0001583	missense	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891		23820	protein-coding gene	gene with protein product		612046			12893818	Standard	NM_203394	Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.2239G>T	12.37:g.77419664C>A	ENSP00000323246:p.Val747Phe	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	C	7.465	0.645496	0.14451	.	.	ENSG00000165891	ENST00000322886;ENST00000339887	T	0.16597	2.33	5.92	4.07	0.47477	.	0.354113	0.29745	N	0.011308	T	0.11623	0.0283	L	0.33485	1.01	0.80722	D	1	B	0.24533	0.105	B	0.20384	0.029	T	0.11916	-1.0568	10	0.45353	T	0.12	-12.8649	5.1359	0.14934	0.1727:0.6522:0.0:0.1751	.	747	Q96AV8	E2F7_HUMAN	F	747;234	ENSP00000323246:V747F	ENSP00000323246:V747F	V	-	1	0	E2F7	75943795	0.997000	0.39634	0.992000	0.48379	0.079000	0.17450	0.434000	0.21494	0.810000	0.34279	-0.136000	0.14681	GTC	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1				19	55					XM_084871	4		15	
EIF1AX	1964	broad.mit.edu	hg19	X	20156713	20156713	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chrX:20156713C>T	ENST00000379607.5	-	2	247	c.44G>A	c.(43-45)gGt>gAt	p.G15D	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	15			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					CTCATTCTTACCCCTGCGTCT	0.308	0	164.0	152.0	156.0	X	20156713	2203	4300	6503	SO:0001583	missense	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.44G>A	X.37:g.20156713C>T	ENSP00000368927:p.Gly15Asp	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551056	0.65311	.	.	ENSG00000173674	ENST00000379607	T	0.45276	0.9	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.75953	0.3920	H	0.96175	3.78	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.85102	0.0958	9	0.87932	D	0	-6.0481	17.661	0.88193	0.0:1.0:0.0:0.0	.	15	P47813	IF1AX_HUMAN	D	15	ENSP00000368927:G15D	ENSP00000368927:G15D	G	-	2	0	EIF1AX	20066634	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGT	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		45.422944	0	-69	119	0	0	1	0		12	45.422699	0	1.000000
IGHV1-46	0	broad.mit.edu	hg19	14	106967230	106967230	+	RNA	SNP	C	C	T			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr14:106967230C>T	ENST00000390622.2	-	0	473																					AGGGGCCTGTCGCACCCAGTG	0.557	0	132.0	125.0	128.0	14	106967230	1939	4133	6072			X92343		14q32.33	2012-02-08			ENSG00000211962	ENSG00000211962	"""Immunoglobulins / IGH locus"""	5554	other	immunoglobulin gene						Standard	NG_001019	Approved				OTTHUMG00000151963		14.37:g.106967230C>T			ENST00000390622.2	37																																																																																				IGHV1-46-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000324609.1		99.576673	0	53	241	0	0	1	0	NG_001019	33	100.588028	53	0.383721
LINC00482	0	broad.mit.edu	hg19	17	79278931	79278931	+	RNA	DEL	G	G	-			TCGA-WC-A87U-01A-11D-A39W-08	TCGA-WC-A87U-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	78dac82e-48e6-44ae-9035-141deebe52b9	f817a8e1-3381-49dd-a7d9-5fb92e91ff54	g.chr17:79278931delG	ENST00000332012.5	-	0	662					NR_038080.1																GTGCCTTCGAGGGCCTGGTTG	0.667	0	15.0	16.0	15.0	17	79278931	2026	4186	6212			AK096740		17q25.3	2012-10-12	2011-09-01	2011-09-01	ENSG00000185168	ENSG00000185168	"""Long non-coding RNAs"""	26816	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 55"""	C17orf55		Standard	NR_038080	Approved	FLJ39421	uc002kac.1	Q8N8I6			17.37:g.79278931delG			ENST00000332012.5	37																																																																																				LINC00482-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000439605.1	.	.		5	15					NM_178519	2		4	0.33
