Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
GPR101	83550	broad.mit.edu	hg19	X	136113492	136113492	+	Silent	SNP	G	G	A			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chrX:136113492G>A	ENST00000298110.1	-	1	341	c.342C>T	c.(340-342)ttC>ttT	p.F114F		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	114			integral to membrane|plasma membrane	G-protein coupled receptor activity	autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)				TGGCGAAGGCGAACAGGTGGG	0.622	0	77.0	57.0	63.0	X	136113492	2203	4300	6503	SO:0001819	synonymous_variant	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370	"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393			11574155	Standard	NM_054021	Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.342C>T	X.37:g.136113492G>A		Q5JSM8|Q8NG93	ENST00000298110.1	37	CCDS14662.1																																																																																			GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		45.655241	0	-7	24	0	0	1	0		14	46.015072	8	0.636364
UBR5	51366	broad.mit.edu	hg19	8	103289313	103289313	+	Silent	SNP	A	A	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr8:103289313A>G	ENST00000520539.1	-	45	7002	c.6396T>C	c.(6394-6396)acT>acC	p.T2132T	UBR5_ENST00000521922.1_Silent_p.T2126T|UBR5_ENST00000220959.4_Silent_p.T2132T	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2132		cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding	NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)		TTGAACTCTCAGTTTCTTCTG	0.423	0	186.0	170.0	175.0	8	103289313	2203	4300	6503	SO:0001819	synonymous_variant	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517	"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1	10030672, 16055722	Standard	NM_015902	Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000521922.1:c.6378T>C	8.37:g.103289313A>G		B2RP24|J3KMW7|O94970|Q9NPL3	ENST00000521922.1	37																																																																																				UBR5-003	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000380199.1		142.772287	0	-36	88	0	0	1	0	NM_015902	51	146.413256	101	0.335526
TRAV3	0	broad.mit.edu	hg19	14	22192114	22192114	+	RNA	SNP	C	C	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr14:22192114C>T	ENST00000390425.2	+	0	155																					CAATCCCGCCCGCCGTGAGCT	0.587	0	115.0	115.0	115.0	14	22192114	1935	4126	6061			AE000658		14q11.2	2012-02-07	2008-09-12		ENSG00000211777	ENSG00000211777	"""T cell receptors / TRA locus"""	12128	other	T cell receptor gene			"""T cell receptor alpha variable 3"""		8188290	Standard	NG_001332	Approved				OTTHUMG00000168981		14.37:g.22192114C>T			ENST00000390425.2	37																																																																																				TRAV3-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000401876.1		-5.155015	0	19	128	0	0	1	0	NG_001332	4	8.432654	63	0.059701
SSX5	6758	broad.mit.edu	hg19	X	48054516	48054516	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chrX:48054516C>G	ENST00000311798.1	-	3	171	c.119G>C	c.(118-120)aGt>aCt	p.S40T	SSX5_ENST00000376923.1_Intron|SSX5_ENST00000347757.1_Intron	NM_021015.3	NP_066295.3	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	23	KRAB-related.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18					CCAGAACGGACTGAGATTCAC	0.537	0	84.0	74.0	78.0	X	48054516	2203	4299	6502	SO:0001583	missense	BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583		11339	protein-coding gene	gene with protein product		300327				Standard	NM_021015	Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000311798.1:c.119G>C	X.37:g.48054516C>G	ENSP00000312415:p.Ser40Thr	Q5JQ59|Q5JQ60|Q96AW3	ENST00000311798.1	37	CCDS14288.1	.	.	.	.	.	.	.	.	.	.	N	0	-2.791560	0.00077	.	.	ENSG00000165583	ENST00000311798	T	0.09630	2.96	0.843	-1.69	0.08186	.	.	.	.	.	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.38866	-0.9641	7	0.33940	T	0.23	.	.	.	.	.	40	O60225-2	.	T	40	ENSP00000312415:S40T	ENSP00000312415:S40T	S	-	2	0	SSX5	47939460	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	-0.102000	0.10956	-0.826000	0.04284	-1.180000	0.01717	AGT	SSX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056465.1		89.840436	0	-20	68	0	0	1	0	NM_021015	29	92.911887	65	0.308511
TSC22D3	1831	broad.mit.edu	hg19	X	107018505	107018505	+	Silent	SNP	G	G	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chrX:107018505G>T	ENST00000372383.4	-	1	512	c.145C>A	c.(145-147)Cgg>Agg	p.R49R	TSC22D3_ENST00000514426.1_5'UTR|TSC22D3_ENST00000506081.1_Silent_p.R49R|TSC22D3_ENST00000372384.2_Silent_p.R49R|TSC22D3_ENST00000315660.4_Silent_p.R49R	NM_198057.2	NP_932174.1	Q99576	T22D3_HUMAN	TSC22 domain family, member 3	0	AP1-binding (By similarity).			sequence-specific DNA binding transcription factor activity	breast(1)|large_intestine(2)|lung(3)	6					TGCAGCTGCCGAAAGTTGCTC	0.607	0	82.0	68.0	73.0	X	107018505	2203	4300	6503	SO:0001819	synonymous_variant	Z50781	CCDS14530.1, CCDS14531.1, CCDS35365.1	Xq22.3	2008-02-15	2005-03-01	2005-03-03	ENSG00000157514	ENSG00000157514		3051	protein-coding gene	gene with protein product	"""glucocorticoid-induced leucine zipper"""	300506	"""delta sleep inducing peptide, immunoreactor"""	DSIPI	8982256	Standard	XM_005262098	Approved	DIP, GILZ, TSC-22R, hDIP	uc004enh.3	Q99576	OTTHUMG00000022168	ENST00000372383.4:c.145C>A	X.37:g.107018505G>T		Q5H9S3|Q5JRI9|Q6FIH6|Q8NAI1|Q8WVB9|Q9UBN5|Q9UG13	ENST00000372383.4	37	CCDS14530.1																																																																																			TSC22D3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057846.2		153.109964	1	-47	69	0	2.74224e-37	1	3.00341e-37	NM_198057	48	153.631065	34	0.585366
FCGR2A	2212	broad.mit.edu	hg19	1	161487879	161487879	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr1:161487879G>T	ENST00000271450.6	+	7	933	c.895G>T	c.(895-897)Gat>Tat	p.D299Y	FCGR2A_ENST00000367972.4_Missense_Mutation_p.D298Y|FCGR2A_ENST00000486608.1_3'UTR|RP11-25K21.6_ENST00000537821.2_RNA	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	299			integral to membrane|plasma membrane	IgG binding|receptor activity	autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		ACCTACTGACGATGATAAAAA	0.443	1	70.0	70.0	70.0	1	161487879	2202	4293	6495	SO:0001583	missense	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2	2139735	Standard	NM_021642	Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.895G>T	1.37:g.161487879G>T	ENSP00000271450:p.Asp299Tyr	Q8WUN1|Q8WW64	ENST00000271450.6	37	CCDS44264.1	.	.	.	.	.	.	.	.	.	.	.	8.527	0.870108	0.17322	.	.	ENSG00000143226	ENST00000367972;ENST00000271450;ENST00000537821;ENST00000461298	T;T	0.02682	4.2;4.2	0.565	-0.483	0.12075	.	5.152060	0.01233	U	0.008401	T	0.01800	0.0057	N	0.08118	0	0.25218	N	0.989926	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.44112	-0.9349	8	0.66056	D	0.02	.	.	.	.	.	299;298	P12318;P12318-2	FCG2A_HUMAN;.	Y	298;299;34;34	ENSP00000356949:D298Y;ENSP00000271450:D299Y	ENSP00000271450:D299Y	D	+	1	0	FCGR2A	159754503	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.132000	0.10467	-0.258000	0.09446	-0.251000	0.11542	GAT	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3		47.594395	1	-41	46	0	5.61819e-17	1	5.61819e-17	NM_021642	16	48.530766	30	0.347826
GALE	2582	ucsc.edu	hg19	1	24123572	24123572	+	Silent	SNP	A	A	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05																										GGGGATCCTCACCAATGCAGC	0.587	0	78.0	65.0	69.0	1	24123572	2203	4300	6503	SO:0001819	synonymous_variant	BC050685	CCDS242.1	1p36-p35	2012-10-02	2004-11-17		ENSG00000117308	ENSG00000117308	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4116	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 1E, member 1"", ""UDP-glucose 4-epimerase"""	606953	"""galactose-4-epimerase, UDP-"""		8593531, 19027726	Standard	NM_001127621	Approved	SDR1E1	uc009vqo.1	Q14376	OTTHUMG00000002958	ENST00000374497.3:c.594T>C	1.37:g.24123572A>G			ENST00000374497.3	37	CCDS242.1																																																																																			GALE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008232.1				0	16					NM_000403	4		15	
ZAN	7455	broad.mit.edu	hg19	7	100345181	100345181	+	RNA	SNP	C	C	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr7:100345181C>T	ENST00000542585.1	+	0	1088				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000348028.3_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA	NM_003386.1	NP_003377.1	Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)			binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)		AGGGAGTATCCGGAAACACAC	0.517	0	105.0	99.0	101.0	7	100345181	1971	4137	6108			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839		12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""		9799793, 17033959	Standard	NM_003386	Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100345181C>T		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	C	14.71	2.616430	0.46736	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.02236	4.38;4.38;4.38	4.19	2.37	0.29283	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.631401	0.13198	N	0.406231	T	0.03783	0.0107	M	0.79475	2.455	0.80722	D	1	P;P	0.38729	0.591;0.644	B;B	0.35931	0.136;0.214	T	0.39251	-0.9623	10	0.87932	D	0	.	5.1566	0.15038	0.2039:0.691:0.0:0.1051	.	314;314	F5H0T8;Q9Y493	.;ZAN_HUMAN	W	314	ENSP00000445943:R314W;ENSP00000445091:R314W;ENSP00000444427:R314W	ENSP00000423579:R314W	R	+	1	2	ZAN	100183117	1.000000	0.71417	0.998000	0.56505	0.437000	0.31866	1.130000	0.31393	0.696000	0.31696	0.650000	0.86243	CGG	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1		46.517687	0	-5	67	0	0	1	0	NM_003386	15	46.972240	24	0.384615
TFAP2B	7021	broad.mit.edu	hg19	6	50805696	50805696	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr6:50805696C>T	ENST00000263046.4	+	6	1023	c.857C>T	c.(856-858)tCg>tTg	p.S286L	TFAP2B_ENST00000393655.3_Missense_Mutation_p.S277L			Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	277		nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)				AGAGCCAAATCGAAAAATGGG	0.428	0	83.0	94.0	90.0	6	50805696	2203	4300	6503	SO:0001583	missense	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196		11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""		7555706, 8661133	Standard	NM_003221	Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.830C>T	6.37:g.50805696C>T	ENSP00000377265:p.Ser277Leu	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	ENST00000393655.3	37	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	C	34	5.315280	0.95655	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.97041	-4.22;-4.22	5.63	5.63	0.86233	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.88842	2.985	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.99338	1.0911	10	0.87932	D	0	-11.5258	20.0471	0.97613	0.0:1.0:0.0:0.0	.	277	Q92481	AP2B_HUMAN	L	277;286	ENSP00000377265:S277L;ENSP00000263046:S286L	ENSP00000263046:S286L	S	+	2	0	TFAP2B	50913655	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.815000	0.96918	0.561000	0.74099	TCG	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3		5.233562	0	-44	86	0	0	1	0	NM_003221	11	24.883518	107	0.093220
SF3B1	23451	broad.mit.edu	hg19	2	198267360	198267360	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr2:198267360T>G	ENST00000335508.6	-	14	2088	c.1997A>C	c.(1996-1998)aAg>aCg	p.K666T		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		TTGTACAATCTTAATACCAGT	0.413	19	116.0	116.0	116.0	2	198267360	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1997A>C	2.37:g.198267360T>G	ENSP00000335321:p.Lys666Thr	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736206	0.89482	.	.	ENSG00000115524	ENST00000335508	T	0.65549	-0.16	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85208	0.5644	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89754	0.3942	10	0.87932	D	0	.	15.938	0.79729	0.0:0.0:0.0:1.0	.	666	O75533	SF3B1_HUMAN	T	666	ENSP00000335321:K666T	ENSP00000335321:K666T	K	-	2	0	SF3B1	197975605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.877000	0.87225	2.167000	0.68274	0.459000	0.35465	AAG	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		91.199480	0	-9	60	0	0	1	0		28	91.199480	28	0.500000
FAT4	79633	broad.mit.edu	hg19	4	126373735	126373735	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr4:126373735C>T	ENST00000394329.3	+	9	11577	c.11564C>T	c.(11563-11565)gCg>gTg	p.A3855V	FAT4_ENST00000335110.5_Missense_Mutation_p.A2153V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3855	EGF-like 1.	homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355					CCAGGATATGCGGGTAGCTGG	0.473	2	89.0	89.0	89.0	4	126373735	2203	4300	6503	SO:0001583	missense	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159	"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""		15003449	Standard	NM_024582	Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11564C>T	4.37:g.126373735C>T	ENSP00000377862:p.Ala3855Val	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	11.18	1.563763	0.27915	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.91792	-2.91;-2.39	5.41	5.41	0.78517	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.627735	0.12030	U	0.506062	T	0.82056	0.4954	N	0.11023	0.085	0.09310	N	1	P;P;P	0.37997	0.516;0.614;0.516	B;B;B	0.28139	0.086;0.038;0.086	T	0.73701	-0.3900	10	0.37606	T	0.19	.	12.3484	0.55134	0.285:0.715:0.0:0.0	.	2153;3855;3855	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	3855;2153	ENSP00000377862:A3855V;ENSP00000335169:A2153V	ENSP00000335169:A2153V	A	+	2	0	FAT4	126593185	0.206000	0.23470	0.011000	0.14972	0.505000	0.33919	3.842000	0.55858	2.527000	0.85204	0.561000	0.74099	GCG	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2		29.504346	0	2	42	0	0	1	0	NM_024582	11	32.180581	34	0.244444
LRRC66	339977	broad.mit.edu	hg19	4	52861873	52861873	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr4:52861873C>G	ENST00000343457.3	-	4	1321	c.1315G>C	c.(1315-1317)Gag>Cag	p.E439Q		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	439			integral to membrane		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58					AGATGGGTCTCTGGGTGTGGT	0.547	0	108.0	115.0	113.0	4	52861873	2055	4191	6246	SO:0001583	missense	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993		34299	protein-coding gene	gene with protein product						Standard	XM_005265739	Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1315G>C	4.37:g.52861873C>G	ENSP00000341944:p.Glu439Gln		ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	6.511	0.462436	0.12342	.	.	ENSG00000188993	ENST00000343457	T	0.41758	0.99	4.5	-4.04	0.04010	.	1.367370	0.04698	N	0.415285	T	0.22085	0.0532	N	0.08118	0	0.09310	N	1	B	0.23937	0.094	B	0.21708	0.036	T	0.31530	-0.9940	10	0.51188	T	0.08	-0.1784	7.5302	0.27679	0.1576:0.5978:0.0:0.2446	.	439	Q68CR7	LRC66_HUMAN	Q	439	ENSP00000341944:E439Q	ENSP00000341944:E439Q	E	-	1	0	LRRC66	52556630	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.180000	0.03088	-0.311000	0.08754	-0.474000	0.04947	GAG	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1		125.899902	0	3	132	0	0	1	0	NM_001024611	42	130.755490	97	0.302158
DLL1	28514	broad.mit.edu	hg19	6	170594480	170594480	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr6:170594480G>T	ENST00000366756.3	-	7	1227	c.894C>A	c.(892-894)tgC>tgA	p.C298*		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	298	EGF-like 3.	cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding	NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)	CTCCATTCTTGCAGGGCTTAT	0.547	0	149.0	127.0	134.0	6	170594480	2203	4300	6503	SO:0001587	stop_gained	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719		2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""			Standard	NM_005618	Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.894C>A	6.37:g.170594480G>T	ENSP00000355718:p.Cys298*	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	ENST00000366756.3	37	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	G	39	7.640945	0.98406	.	.	ENSG00000198719	ENST00000366756	.	.	.	5.08	1.65	0.23941	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2723	0.43489	0.2274:0.0:0.7726:0.0	.	.	.	.	X	298	.	ENSP00000355718:C298X	C	-	3	2	DLL1	170436405	1.000000	0.71417	0.973000	0.42090	0.986000	0.74619	2.293000	0.43558	0.100000	0.17581	-0.471000	0.05019	TGC	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		94.409052	1	-6	51	0	1.88708e-17	1	1.97286e-17		29	95.545806	14	0.674419
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		57.705608	0	-22	90	0	0	1	0	NM_002072	19	59.234369	39	0.327586
SNX18	112574	broad.mit.edu	hg19	5	53839202	53839202	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9E5-01A-11D-A39W-08	TCGA-V4-A9E5-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5d231e0-a1cb-491f-aefe-5b9013e11d6c	e246f8fd-514c-4062-9a56-d9f7dd8c8e05	g.chr5:53839202A>G	ENST00000381410.4	+	2	2005	c.1815A>G	c.(1813-1815)atA>atG	p.I605M	SNX18_ENST00000343017.6_3'UTR	NM_001102575.1	NP_001096045.1	Q96RF0	SNX18_HUMAN	sorting nexin 18	458	BAR.	cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding	endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)			AACAAATAATATTTTTCCAAA	0.348	0	60.0	58.0	59.0	5	53839202	1826	4084	5910	SO:0001583	missense	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996	"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1	16782399, 17761170	Standard	NM_052870	Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000381410.4:c.1815A>G	5.37:g.53839202A>G	ENSP00000370817:p.Ile605Met	B4E2B3|H7BXX3|Q05BB3|Q0VG02	ENST00000381410.4	37	CCDS43317.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.455669	0.26161	.	.	ENSG00000178996	ENST00000381410	T	0.13778	2.56	5.71	4.54	0.55810	.	.	.	.	.	T	0.12433	0.0302	.	.	.	0.80722	D	1	B	0.32693	0.38	B	0.35550	0.205	T	0.08472	-1.0720	8	0.48119	T	0.1	.	6.1392	0.20251	0.5818:0.1552:0.0:0.263	.	605	Q96RF0-2	.	M	605	ENSP00000370817:I605M	ENSP00000370817:I605M	I	+	3	3	SNX18	53874959	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.763000	0.38461	0.963000	0.38082	0.528000	0.53228	ATA	SNX18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214073.2		22.548956	0	-10	78	0	0	1	0		9	26.519998	37	0.195652
