Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
MORC2	22880	broad.mit.edu	hg19	22	31332573	31332573	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr22:31332573C>T	ENST00000397641.3	-	17	2070	c.1662G>A	c.(1660-1662)atG>atA	p.M554I	MORC2_ENST00000215862.4_Missense_Mutation_p.M492I|MORC2_ENST00000469915.1_5'UTR			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2					ATP binding|zinc ion binding	breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21					CCTGCGTCTTCATGTCCTTTC	0.522	0	182.0	160.0	168.0	22	31332573	2203	4300	6503	SO:0001583	missense	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422		23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1	14607086	Standard	XM_005261391	Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.1662G>A	22.37:g.31332573C>T	ENSP00000380763:p.Met554Ile	B2RNB1|Q9UF28|Q9Y6V2	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	C	7.654	0.683441	0.14907	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.10763	2.84;2.84	6.06	-2.67	0.06059	.	0.748873	0.13033	N	0.419189	T	0.04137	0.0115	N	0.14661	0.345	0.27746	N	0.944305	B	0.02656	0.0	B	0.01281	0.0	T	0.42050	-0.9474	10	0.17832	T	0.49	.	2.7326	0.05231	0.098:0.2662:0.1835:0.4523	.	554	Q9Y6X9	MORC2_HUMAN	I	554;492	ENSP00000380763:M554I;ENSP00000215862:M492I	ENSP00000215862:M492I	M	-	3	0	MORC2	29662573	0.000000	0.05858	0.775000	0.31657	0.852000	0.48524	-0.770000	0.04705	-0.014000	0.14175	-0.140000	0.14226	ATG	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2		179.840751	0	19	128	0	0	1	0	NM_014941	58	179.857344	61	0.487395
ZSWIM1	90204	broad.mit.edu	hg19	20	44511331	44511331	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr20:44511331A>G	ENST00000372523.1	+	2	195	c.100A>G	c.(100-102)Atg>Gtg	p.M34V	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.M34V	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	34				zinc ion binding	breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)			GGCCCTGACAATGCTGAATGG	0.512	0	126.0	109.0	115.0	20	44511331	2203	4300	6503	SO:0001583	missense	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612	"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162		Standard	NM_080603	Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.100A>G	20.37:g.44511331A>G	ENSP00000361601:p.Met34Val	Q5JZH2|Q9BR12|Q9BV30	ENST00000372523.1	37	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	A	7.834	0.720395	0.15372	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.21734	1.99;1.99	5.38	-0.816	0.10839	.	0.470223	0.17595	N	0.168629	T	0.09642	0.0237	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39702	-0.9601	10	0.06757	T	0.87	-17.3984	7.5248	0.27650	0.2912:0.1641:0.5447:0.0	.	34	Q9BR11	ZSWM1_HUMAN	V	34	ENSP00000361601:M34V;ENSP00000361598:M34V	ENSP00000361598:M34V	M	+	1	0	ZSWIM1	43944738	0.110000	0.22057	0.103000	0.21229	0.962000	0.63368	0.362000	0.20284	-0.064000	0.13043	0.533000	0.62120	ATG	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2		4.151599	0	-8	61	0	0	1	0	NM_080603	5	12.385091	46	0.098039
TBX6	6911	broad.mit.edu	hg19	16	30102139	30102139	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr16:30102139C>T	ENST00000553607.1	-	2	986	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	TBX6_ENST00000395224.2_Missense_Mutation_p.R98Q|TBX6_ENST00000279386.2_Missense_Mutation_p.R98Q			O95947	TBX6_HUMAN	T-box 6	98		anatomical structure morphogenesis|mesoderm development|multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9					CCATAGCTCCCGGTTCTCCAG	0.637	0	45.0	47.0	47.0	16	30102139	2197	4300	6497	SO:0001583	missense	AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922	"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427			9888994, 9933572	Standard	NM_004608	Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.293G>A	16.37:g.30102139C>T	ENSP00000378650:p.Arg98Gln	Q8TAS4|Q9HA44	ENST00000395224.2	37	CCDS10670.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341371	0.41498	.	.	ENSG00000149922	ENST00000395224;ENST00000279386;ENST00000553607	D;D;D	0.87650	-2.28;-2.28;-2.28	5.07	2.81	0.32909	p53-like transcription factor, DNA-binding (1);	0.590849	0.16409	N	0.215671	T	0.79263	0.4416	L	0.43701	1.375	0.23841	N	0.996697	B;B	0.06786	0.001;0.0	B;B	0.04013	0.0;0.001	T	0.64322	-0.6435	10	0.29301	T	0.29	.	6.1134	0.20114	0.0:0.5161:0.0:0.4839	.	98;98	O95947;Q9HA44	TBX6_HUMAN;.	Q	98	ENSP00000378650:R98Q;ENSP00000279386:R98Q;ENSP00000461223:R98Q	ENSP00000279386:R98Q	R	-	2	0	TBX6	30009640	0.614000	0.27017	1.000000	0.80357	0.984000	0.73092	0.069000	0.14552	1.135000	0.42183	0.561000	0.74099	CGG	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255157.2		71.553322	0	-24	44	0	0	1	0	NM_004608, NM_080758	22	71.640546	18	0.550000
DSCAML1	57453	broad.mit.edu	hg19	11	117307958	117307958	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr11:117307958C>T	ENST00000321322.6	-	26	4781	c.4780G>A	c.(4780-4782)Ggg>Agg	p.G1594R	DSCAML1_ENST00000527706.1_Missense_Mutation_p.G1324R	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1534		axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	AACACCTCCCCGGAGCTGTTG	0.652	0	88.0	87.0	87.0	11	117307958	2201	4296	6497	SO:0001583	missense		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782			11453658	Standard	NM_020693	Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4780G>A	11.37:g.117307958C>T	ENSP00000315465:p.Gly1594Arg	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	3.374	-0.127761	0.06753	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.52295	0.67;0.67	4.63	1.69	0.24217	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28466	0.0704	N	0.19112	0.55	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.22173	-1.0224	9	0.15952	T	0.53	.	8.7128	0.34393	0.0:0.5143:0.0:0.4857	.	1534	Q8TD84	DSCL1_HUMAN	R	1324;1594;1301	ENSP00000434335:G1324R;ENSP00000315465:G1594R	ENSP00000315465:G1594R	G	-	1	0	DSCAML1	116813168	0.000000	0.05858	0.004000	0.12327	0.555000	0.35460	0.153000	0.16323	0.139000	0.18822	-0.140000	0.14226	GGG	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2		9.529748	0	-3	92	0	0	1	0	NM_020693	6	14.686703	36	0.142857
PYGL	5836	broad.mit.edu	hg19	14	51379761	51379761	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr14:51379761C>T	ENST00000216392.7	-	13	1938	c.1606G>A	c.(1606-1608)Gcc>Acc	p.A536T	PYGL_ENST00000532462.1_Missense_Mutation_p.A536T|PYGL_ENST00000544180.2_Missense_Mutation_p.A502T|RP11-218E20.5_ENST00000557343.1_RNA	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	536		glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				TTCACCTTGGCGAGTTCCCGG	0.483	0	86.0	83.0	84.0	14	51379761	2203	4300	6503	SO:0001583	missense		CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""		2877458	Standard	NM_002863	Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.1606G>A	14.37:g.51379761C>T	ENSP00000216392:p.Ala536Thr	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	ENST00000216392.7	37	CCDS32080.1	.	.	.	.	.	.	.	.	.	.	C	7.971	0.749023	0.15710	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.93019	-3.15;-3.15;-3.15	5.82	-6.63	0.01807	.	0.652426	0.17325	N	0.178356	D	0.91171	0.7219	M	0.80746	2.51	0.27767	N	0.943603	B;B;B	0.13594	0.006;0.008;0.006	B;B;B	0.21151	0.013;0.033;0.002	T	0.73685	-0.3905	10	0.23302	T	0.38	-1.1614	16.8285	0.85937	0.2662:0.6684:0.0:0.0654	.	502;502;536	F5H816;B4DUB7;P06737	.;.;PYGL_HUMAN	T	536;502;536	ENSP00000431657:A536T;ENSP00000443787:A502T;ENSP00000216392:A536T	ENSP00000216392:A536T	A	-	1	0	PYGL	50449511	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-1.458000	0.02372	-1.117000	0.02965	-0.152000	0.13540	GCC	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3		0.698723	0	-12	25	0	0	1	0	NM_002863	3	6.527590	31	0.088235
KDM1A	23028	broad.mit.edu	hg19	1	23377001	23377001	+	Silent	SNP	T	T	C			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr1:23377001T>C	ENST00000400181.4	+	4	803	c.699T>C	c.(697-699)atT>atC	p.I233I	KDM1A_ENST00000356634.3_Silent_p.I213I|KDM1A_ENST00000542151.1_Silent_p.I233I|RP1-184J9.2_ENST00000427154.1_RNA	NM_001009999.2	NP_001009999.1	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	213	SWIRM.	blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding	breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23					TTCTTTTCATTAGAAACCGCA	0.378	0	109.0	106.0	107.0	1	23377001	2203	4300	6503	SO:0001819	synonymous_variant	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487	"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1	9628581, 12493763	Standard	NM_015013	Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000400181.4:c.699T>C	1.37:g.23377001T>C		A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	ENST00000400181.4	37	CCDS53278.1																																																																																			KDM1A-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008881.2		-12.245007	0	-16	64	0	0	1	0	NM_015013	3	6.845041	79	0.036585
CRISPLD2	83716	broad.mit.edu	hg19	16	84940226	84940226	+	Missense_Mutation	SNP	G	G	A	rs147087796		TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr16:84940226G>A	ENST00000262424.5	+	15	1696	c.1472G>A	c.(1471-1473)cGg>cAg	p.R491Q	CRISPLD2_ENST00000567845.1_Missense_Mutation_p.R490Q	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	491			extracellular region|transport vesicle		endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18					AAGGCCTTCCGGATCTTTGCT	0.537	0	68.0	72.0	70.0	16	84940226	2199	4300	6499	SO:0001583	missense	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196		25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2	11230166	Standard	NM_031476	Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.1472G>A	16.37:g.84940226G>A	ENSP00000262424:p.Arg491Gln	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	ENST00000262424.5	37	CCDS10949.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748468	0.89753	2.27E-4	0.0	ENSG00000103196	ENST00000262424	D	0.89415	-2.51	5.03	5.03	0.67393	LCCL (1);	0.000000	0.64402	D	0.000001	D	0.89466	0.6723	L	0.56769	1.78	0.80722	D	1	D	0.63880	0.993	P	0.50136	0.632	D	0.89192	0.3551	10	0.44086	T	0.13	.	14.2425	0.65966	0.0:0.0:1.0:0.0	.	491	Q9H0B8	CRLD2_HUMAN	Q	491	ENSP00000262424:R491Q	ENSP00000262424:R491Q	R	+	2	0	CRISPLD2	83497727	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	4.819000	0.62664	2.495000	0.84180	0.655000	0.94253	CGG	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2		23.048823	0	-23	96	0	0	1	0	NM_031476	11	29.949701	55	0.166667
ADAMTSL1	92949	broad.mit.edu	hg19	9	18906784	18906784	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr9:18906784G>A	ENST00000380548.4	+	28	5395	c.5056G>A	c.(5056-5058)Ggc>Agc	p.G1686S	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.G387S	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1686	TSP type-1 9.		proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)	TGGCAACTACGGCTTCCAGTC	0.647	0	44.0	58.0	53.0	9	18906784	2134	4224	6358	SO:0001583	missense	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031	"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94	9628581, 11805097	Standard	NM_001040272	Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.5056G>A	9.37:g.18906784G>A	ENSP00000369921:p.Gly1686Ser	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	35	5.487289	0.96323	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239	T;T	0.71461	-0.57;-0.57	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	D	0.89476	0.6726	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.92365	0.5900	10	0.87932	D	0	.	19.2299	0.93834	0.0:0.0:1.0:0.0	.	1187;387;1686	A2A344;Q8N6G6-6;Q8N6G6	.;.;ATL1_HUMAN	S	1686;387;390	ENSP00000369921:G1686S;ENSP00000369918:G387S	ENSP00000325584:G390S	G	+	1	0	ADAMTSL1	18896784	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.765000	0.98953	2.549000	0.85964	0.563000	0.77884	GGC	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		47.421517	0	1	46	0	0	1	0		15	47.480776	18	0.454545
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	A	rs121913492		TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr9:80409488T>A	ENST00000286548.4	-	5	848	c.626A>T	c.(625-627)cAa>cTa	p.Q209L	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7L	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>T	9.37:g.80409488T>A	ENSP00000286548:p.Gln209Leu	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985495	0.93044	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97573	0.9205	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99402	1.0928	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	L	209;7	ENSP00000286548:Q209L;ENSP00000443197:Q7L	ENSP00000286548:Q209L	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		130.401597	0	-14	98	0	0	1	0	NM_002072	40	130.412738	38	0.512821
DDX3Y	8653	broad.mit.edu	hg19	Y	15028513	15028513	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chrY:15028513C>A	ENST00000336079.3	+	14	1682	c.1576C>A	c.(1576-1578)Cgt>Agt	p.R526S	DDX3Y_ENST00000360160.4_Missense_Mutation_p.R526S	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked	526	Helicase C-terminal.		cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|RNA binding	kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5					ATATGTGCATCGTATTGGCCG	0.383	0									SO:0001583	missense	AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048	"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY	9381176	Standard	NM_004660	Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.1576C>A	Y.37:g.15028513C>A	ENSP00000336725:p.Arg526Ser	B4DK29|B4DXX7|Q8IYV7	ENST00000336079.3	37	CCDS14782.1																																																																																			DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088407.1		-7.228567	1	100	100	0	0.004672	1	0.00495515	NM_004660	3	6.496441	60	0.047619
ITPR3	3710	broad.mit.edu	hg19	6	33654821	33654821	+	Silent	SNP	G	G	A			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr6:33654821G>A	ENST00000374316.5	+	45	7075	c.6015G>A	c.(6013-6015)gaG>gaA	p.E2005E	ITPR3_ENST00000605930.1_Silent_p.E2005E			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2005		activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					CTCTGATGGAGAGCCGGCATG	0.642	0	64.0	60.0	61.0	6	33654821	2202	4294	6496	SO:0001819	synonymous_variant	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433	"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""		8081734, 8288584	Standard	NM_002224	Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6015G>A	6.37:g.33654821G>A		Q14649|Q5TAQ2	ENST00000374316.5	37	CCDS4783.1																																																																																			ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2		210.928338	0	-11	89	0	0	1	0	NM_002224	64	213.469147	31	0.673684
SF3B1	23451	broad.mit.edu	hg19	2	198267484	198267484	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr2:198267484G>A	ENST00000335508.6	-	14	1964	c.1873C>T	c.(1873-1875)Cgt>Tgt	p.R625C		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		GTTGTGTTACGGACATACTCA	0.433	5	93.0	90.0	91.0	2	198267484	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1873C>T	2.37:g.198267484G>A	ENSP00000335321:p.Arg625Cys	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873082	0.72180	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.90331	0.6975	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.93337	0.6706	10	0.87932	D	0	.	15.2676	0.73675	0.0:0.0:0.7451:0.2549	.	625	O75533	SF3B1_HUMAN	C	625	ENSP00000335321:R625C	ENSP00000335321:R625C	R	-	1	0	SF3B1	197975729	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.689000	0.61723	1.444000	0.47605	-0.182000	0.12963	CGT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		82.390636	0	15	69	0	0	1	0		27	82.674802	36	0.428571
C6orf89	221477	broad.mit.edu	hg19	6	36882388	36882388	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr6:36882388C>T	ENST00000480824.2	+	6	908	c.614C>T	c.(613-615)gCg>gTg	p.A205V	C6orf89_ENST00000510325.2_Missense_Mutation_p.A99V|C6orf89_ENST00000355190.3_Missense_Mutation_p.A212V|C6orf89_ENST00000359359.2_Missense_Mutation_p.A99V|C6orf89_ENST00000373685.1_Missense_Mutation_p.A205V			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	205			integral to membrane		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15					TACCCTGAGGCGACAGAAGGC	0.507	0	176.0	185.0	182.0	6	36882388	2203	4300	6503	SO:0001583	missense	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663		21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""				21857995, 23460338	Standard	NM_152734	Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000355190.3:c.635C>T	6.37:g.36882388C>T	ENSP00000347322:p.Ala212Val	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	ENST00000355190.3	37	CCDS4827.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.649076	0.00785	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685	.	.	.	5.03	-8.82	0.00810	.	1.015020	0.07871	N	0.967887	T	0.02304	0.0071	N	0.00538	-1.39	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.43750	-0.9372	9	0.02654	T	1	0.7461	19.7373	0.96212	0.0:0.7959:0.0:0.2041	.	205;212	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	V	99;99;212;205	.	ENSP00000347322:A212V	A	+	2	0	C6orf89	36990366	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-1.279000	0.02807	-2.514000	0.00502	-1.821000	0.00599	GCG	C6orf89-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040385.2		400.906685	0	-15	156	0	0	1	0	NM_152734	125	403.290764	78	0.615764
ACVRL1	94	broad.mit.edu	hg19	12	52309169	52309169	+	Silent	SNP	G	G	A			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr12:52309169G>A	ENST00000550683.1	+	6	1076	c.975G>A	c.(973-975)gcG>gcA	p.A325A	ACVRL1_ENST00000419526.2_Silent_p.A137A|ACVRL1_ENST00000388922.4_Silent_p.A311A	NM_001077401.1	NP_001070869.1	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	311	Protein kinase.	blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	GCGGCCTGGCGCACCTGCACG	0.607	0	56.0	51.0	53.0	12	52309169	2203	4300	6503	SO:0001819	synonymous_variant	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567		175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2	8397373, 8640225	Standard	NM_000020	Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000419526.2:c.411G>A	12.37:g.52309169G>A		A6NGA8	ENST00000419526.2	37																																																																																				ACVRL1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404524.1		37.666777	0	-1	42	0	0	1	0		13	38.079454	21	0.382353
NPHP4	261734	broad.mit.edu	hg19	1	6012777	6012777	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr1:6012777delG	ENST00000378156.4	-	7	1058	c.793delC	c.(793-795)cagfs	p.Q265fs	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	265		actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity	NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)	AAGTGGTCCTGGACGTGGAGC	0.637	0	18.0	19.0	19.0	1	6012777	1855	4084	5939	SO:0001589	frameshift_variant	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697		19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215			11920287, 12205563	Standard	XR_244787	Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.793delC	1.37:g.6012777delG	ENSP00000367398:p.Gln265fs	Q8IWC0	ENST00000378156.4	37	CCDS44052.1																																																																																			NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2	.	.		1	7						2		4	0.33
PHLPP1	23239	broad.mit.edu	hg19	18	60587193	60587193	+	Splice_Site	DEL	T	T	-			TCGA-V4-A9EA-01A-11D-A39W-08	TCGA-V4-A9EA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	659c2982-58c3-495b-b6b1-4d0093e192ca	bde25877-be56-49ff-955c-cd602a35f6ef	g.chr18:60587193delT	ENST00000400316.4	+	10	3051	c.1270delT	c.(1270-1272)tta>ta	p.L424fs	PHLPP1_ENST00000262719.5_Splice_Site_p.L936fs	NM_194449.3	NP_919431.2	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	936		apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity	endometrium(2)|kidney(2)|lung(13)	17					TTTATACAGCTTATTTTGTAA	0.393	0	29.0	26.0	27.0	18	60587193	1802	4070	5872	SO:0001630	splice_region_variant	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP	10570941, 15808505	Standard	NM_194449	Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2805-1T>-	18.37:g.60587193delT		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	ENST00000262719.5	37	CCDS45881.2																																																																																			PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	.	.		4	11					NM_194449	2		4	0.33
