Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
BTNL3	10917	broad.mit.edu	hg19	5	180432727	180432727	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr5:180432727C>T	ENST00000342868.6	+	8	1440	c.1256C>T	c.(1255-1257)tCc>tTc	p.S419F		NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	419	B30.2/SPRY.	lipid metabolic process	integral to membrane		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)		GGGACCATCTCCTTCTTCAAT	0.478	0	114.0	110.0	111.0	5	180432727	1908	4119	6027	SO:0001583	missense	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903	"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192			10429365	Standard	NM_197975	Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.1256C>T	5.37:g.180432727C>T	ENSP00000341787:p.Ser419Phe	Q496L7|Q9Y2C7	ENST00000342868.6	37	CCDS47358.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.251992	0.59212	.	.	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.68765	-0.35	2.74	2.74	0.32292	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.85392	0.5686	H	0.95294	3.65	0.34179	D	0.670675	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.995	D	0.90559	0.4514	9	0.87932	D	0	.	11.2087	0.48784	0.0:1.0:0.0:0.0	.	385;419	C9JDC2;Q6UXE8	.;BTNL3_HUMAN	F	419;385	ENSP00000341787:S419F	ENSP00000341787:S419F	S	+	2	0	BTNL3	180365333	0.993000	0.37304	0.094000	0.20943	0.130000	0.20726	2.307000	0.43682	1.253000	0.44018	0.174000	0.16983	TCC	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2		69.448570	0	16	89	0	0	1	0	NM_197975	22	69.467396	24	0.478261
VWA5A	4013	broad.mit.edu	hg19	11	123988499	123988499	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr11:123988499A>G	ENST00000456829.2	+	4	414	c.163A>G	c.(163-165)Atg>Gtg	p.M55V	VWA5A_ENST00000392744.4_Missense_Mutation_p.M71V|VWA5A_ENST00000361352.5_Missense_Mutation_p.M55V|VWA5A_ENST00000392748.1_Missense_Mutation_p.M55V|VWA5A_ENST00000449321.1_Missense_Mutation_p.M55V|VWA5A_ENST00000360334.4_Missense_Mutation_p.M55V	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	55	VIT.				autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47					TGTGTTCCCCATGGATGAAGA	0.443	0	151.0	153.0	152.0	11	123988499	2201	4299	6500	SO:0001583	missense	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002		6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A	9417908, 14504409	Standard	NM_001130142	Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000392744.4:c.211A>G	11.37:g.123988499A>G	ENSP00000376501:p.Met71Val	Q6UN19|Q6UN20|Q9BVF8	ENST00000392744.4	37		.	.	.	.	.	.	.	.	.	.	A	13.87	2.365114	0.41902	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16	5.6	4.48	0.54585	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.103318	0.64402	D	0.000001	T	0.11707	0.0285	N	0.12853	0.265	0.35310	D	0.783829	B;B	0.16166	0.005;0.016	B;B	0.28305	0.015;0.088	T	0.09796	-1.0658	10	0.49607	T	0.09	-46.0508	5.2844	0.15692	0.7296:0.181:0.0894:0.0	.	71;55	B4DHS6;O00534	.;VMA5A_HUMAN	V	55;55;55;55;55;55;55;71	ENSP00000407726:M55V;ENSP00000353485:M55V;ENSP00000376504:M55V;ENSP00000355070:M55V;ENSP00000404683:M55V;ENSP00000376501:M71V	ENSP00000353485:M55V	M	+	1	0	VWA5A	123493709	0.982000	0.34865	1.000000	0.80357	0.969000	0.65631	1.223000	0.32527	2.140000	0.66376	0.533000	0.62120	ATG	VWA5A-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000387278.1		98.592821	0	25	130	0	0	1	0	NM_014622	32	98.742877	39	0.450704
SH3RF2	153769	broad.mit.edu	hg19	5	145427382	145427382	+	Silent	SNP	C	C	T			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr5:145427382C>T	ENST00000511217.1	+	5	1159	c.1107C>T	c.(1105-1107)gcC>gcT	p.A369A	SH3RF2_ENST00000359120.4_Silent_p.A369A			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	369				ligase activity|protein phosphatase 1 binding|zinc ion binding	breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		ATTCCACAGCCGTGGTCAGTC	0.542	0	154.0	128.0	137.0	5	145427382	2203	4300	6503	SO:0001819	synonymous_variant	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463	"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39	22128169	Standard	NM_152550	Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1107C>T	5.37:g.145427382C>T		A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	ENST00000511217.1	37	CCDS4280.1																																																																																			SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1		73.353313	0	-16	51	0	0	1	0	NM_152550	22	73.401091	19	0.536585
MC2R	0	broad.mit.edu	hg19	18	13885067	13885067	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr18:13885067G>A	ENST00000327606.3	-	2	631	c.451C>T	c.(451-453)Ctt>Ttt	p.L151F		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	151		G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding	breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					ATGACCGTAAGCACCACCACA	0.577	0	130.0	107.0	115.0	18	13885067	2203	4300	6503	SO:0001583	missense		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231	"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397			8390157	Standard	NM_001291911	Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.451C>T	18.37:g.13885067G>A	ENSP00000333821:p.Leu151Phe	A8K016|Q3MI45|Q504X6	ENST00000327606.3	37	CCDS11869.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606582	0.28623	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T	0.73047	-0.71	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.83008	0.5161	M	0.80422	2.495	0.29368	N	0.864217	D	0.89917	1.0	D	0.85130	0.997	T	0.80211	-0.1476	10	0.87932	D	0	.	10.5734	0.45212	0.1498:0.0:0.8502:0.0	.	151	Q01718	ACTHR_HUMAN	F	151	ENSP00000333821:L151F	ENSP00000333821:L151F	L	-	1	0	MC2R	13875067	0.519000	0.26242	0.045000	0.18777	0.001000	0.01503	0.914000	0.28624	2.469000	0.83416	0.655000	0.94253	CTT	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2		50.197173	0	0	53	0	0	1	0		16	50.253043	19	0.457143
ABCA6	23460	broad.mit.edu	hg19	17	67119475	67119475	+	Silent	SNP	A	A	G			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr17:67119475A>G	ENST00000284425.2	-	10	1515	c.1341T>C	c.(1339-1341)aaT>aaC	p.N447N		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	447		transport	integral to membrane	ATP binding|ATPase activity	breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)				TAACCTTAGCATTAGTCCTTT	0.368	0	112.0	108.0	109.0	17	67119475	2203	4300	6503	SO:0001819	synonymous_variant	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262	"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504			8894702	Standard	NM_080284	Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1341T>C	17.37:g.67119475A>G		Q6NSH9|Q8N856|Q8WWZ6	ENST00000284425.2	37	CCDS11683.1																																																																																			ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1		43.210090	0	14	55	0	0	1	0	NM_080284	15	44.317073	30	0.333333
DOCK3	1795	broad.mit.edu	hg19	3	51417579	51417579	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr3:51417579G>A	ENST00000266037.9	+	52	5547	c.5524G>A	c.(5524-5526)Gcc>Acc	p.A1842T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1842			cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	ACACTTTGACGCCTTCCACCA	0.607	0	108.0	108.0	108.0	3	51417579	1936	4129	6065	SO:0001583	missense	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538		2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""		9205841	Standard	NM_004947	Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5524G>A	3.37:g.51417579G>A	ENSP00000266037:p.Ala1842Thr	O15017	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730367	0.69074	.	.	ENSG00000088538	ENST00000266037	T	0.05199	3.48	5.8	4.93	0.64822	.	0.052912	0.85682	N	0.000000	T	0.07234	0.0183	L	0.47716	1.5	0.58432	D	0.999998	B	0.31837	0.342	B	0.24541	0.054	T	0.27673	-1.0067	10	0.30078	T	0.28	.	14.8663	0.70419	0.0686:0.0:0.9314:0.0	.	1842	Q8IZD9	DOCK3_HUMAN	T	1842	ENSP00000266037:A1842T	ENSP00000266037:A1842T	A	+	1	0	DOCK3	51392619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.790000	0.69038	1.470000	0.48102	0.561000	0.74099	GCC	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5		25.216820	0	-6	30	0	0	1	0	NM_004947	8	26.431323	1	0.888889
NEDD9	4739	broad.mit.edu	hg19	6	11213718	11213718	+	Silent	SNP	G	G	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr6:11213718G>A	ENST00000379446.5	-	2	421	c.255C>T	c.(253-255)acC>acT	p.T85T	NEDD9_ENST00000504387.1_Silent_p.T85T|RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000379433.5_Silent_p.T85T	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	85		actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding	endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)		GTTGGCCAAAGGTCTGCTGCA	0.552	0	154.0	148.0	150.0	6	11213718	2203	4300	6503	SO:0001819	synonymous_variant	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859	"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265				Standard	NM_182966	Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.255C>T	6.37:g.11213718G>A		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	ENST00000379446.5	37	CCDS4520.1																																																																																			NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2		57.415766	0	16	98	0	0	1	0	NM_006403	19	58.141951	32	0.372549
SLC4A1	6521	broad.mit.edu	hg19	17	42335930	42335930	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr17:42335930C>A	ENST00000262418.6	-	10	1093	c.938G>T	c.(937-939)gGc>gTc	p.G313V	AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1	313		bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity	central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)	GTCCAGGAAGCCCTCTAGGGA	0.647	0	40.0	41.0	41.0	17	42335930	2202	4299	6501	SO:0001583	missense		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939	"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD	8434259	Standard	NM_000342	Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.938G>T	17.37:g.42335930C>A	ENSP00000262418:p.Gly313Val	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	N	12.17	1.858642	0.32791	.	.	ENSG00000004939	ENST00000262418	T	0.67865	-0.29	4.5	2.51	0.30379	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.320832	0.32416	N	0.006133	T	0.66954	0.2842	L	0.52364	1.645	0.44635	D	0.997611	D;B	0.56968	0.978;0.284	P;B	0.57204	0.815;0.188	T	0.65438	-0.6168	10	0.72032	D	0.01	.	4.0537	0.09806	0.0:0.4817:0.168:0.3502	.	313;313	E2RVJ0;P02730	.;B3AT_HUMAN	V	313	ENSP00000262418:G313V	ENSP00000262418:G313V	G	-	2	0	SLC4A1	39691456	0.965000	0.33210	0.341000	0.25589	0.227000	0.25037	2.095000	0.41729	0.535000	0.28714	0.306000	0.20318	GGC	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1		37.469495	1	0	22	0	5.50884e-06	1	5.50884e-06	NM_000342	13	37.500811	15	0.464286
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		62.262923	0	12	93	0	0	1	0	NM_002067	21	63.129194	36	0.368421
GSTA4	2941	broad.mit.edu	hg19	6	52849353	52849353	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr6:52849353A>T	ENST00000541324.1	-	3	309	c.44T>A	c.(43-45)aTg>aAg	p.M15K	GSTA4_ENST00000370960.1_Missense_Mutation_p.M15K|GSTA4_ENST00000486559.1_5'UTR|GSTA4_ENST00000370959.1_Missense_Mutation_p.M108K			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	108	GST N-terminal.	glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity	endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				GAAAGGATGCATGATAAGCAG	0.423	0	135.0	116.0	122.0	6	52849353	2203	4300	6503	SO:0001583	missense	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""		9480897	Standard	NM_001512	Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.323T>A	6.37:g.52849353A>T	ENSP00000359998:p.Met108Lys	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	ENST00000370959.1	37	CCDS4948.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154369	0.38021	.	.	ENSG00000170899	ENST00000370963;ENST00000541324;ENST00000370960;ENST00000370959;ENST00000457564	T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51	5.0	3.83	0.44106	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.558985	0.21306	N	0.076723	T	0.00784	0.0026	L	0.35542	1.07	0.41028	D	0.985137	B	0.06786	0.001	B	0.09377	0.004	T	0.50659	-0.8802	10	0.30078	T	0.28	-12.824	8.2267	0.31572	0.8407:0.0:0.1593:0.0	.	108	O15217	GSTA4_HUMAN	K	108;15;15;108;15	ENSP00000360002:M108K;ENSP00000439439:M15K;ENSP00000359999:M15K;ENSP00000359998:M108K;ENSP00000394228:M15K	ENSP00000359998:M108K	M	-	2	0	GSTA4	52957312	0.033000	0.19621	0.997000	0.53966	0.984000	0.73092	0.656000	0.24948	0.835000	0.34877	0.455000	0.32223	ATG	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1		117.129240	0	8	114	0	0	1	0	NM_001512	38	117.669803	53	0.417582
TRAV8-2	0	broad.mit.edu	hg19	14	22314952	22314952	+	RNA	SNP	G	G	C			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr14:22314952G>C	ENST00000390434.3	+	0	234																					CCATGCTCCTGCTGCTCGTCC	0.527	0	113.0	112.0	112.0	14	22314952	2031	4218	6249			AE000659		14q11.2	2012-02-07			ENSG00000211786	ENSG00000211786	"""T cell receptors / TRA locus"""	12147	other	T cell receptor gene					8188290	Standard	NG_001332	Approved				OTTHUMG00000168991		14.37:g.22314952G>C			ENST00000390434.3	37																																																																																				TRAV8-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000401889.1		55.469113	0	-14	74	0	0	1	0	NG_001332	17	55.665343	23	0.425000
FAM161A	84140	broad.mit.edu	hg19	2	62066857	62066857	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr2:62066857T>C	ENST00000404929.1	-	3	1293	c.1282A>G	c.(1282-1284)Act>Gct	p.T428A	FAM161A_ENST00000405894.3_Missense_Mutation_p.T428A	NM_001201543.1	NP_001188472.1	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	428		response to stimulus|visual perception	centrosome		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25					AAATCAGGAGTTGGGCACCTA	0.463	0	121.0	110.0	114.0	2	62066857	1911	4121	6032	SO:0001583	missense		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264		25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28	10507729, 20705278, 20705279	Standard	NM_032180	Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000404929.1:c.1282A>G	2.37:g.62066857T>C	ENSP00000385158:p.Thr428Ala	B4DJV7|Q9H8R2	ENST00000404929.1	37	CCDS56120.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.944426	0.34283	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.21734	1.99;1.99	5.67	0.161	0.14977	.	0.829500	0.11062	N	0.603908	T	0.11623	0.0283	N	0.25144	0.715	0.09310	N	1	B;B	0.13145	0.007;0.005	B;B	0.16289	0.015;0.005	T	0.35748	-0.9776	10	0.23302	T	0.38	-3.2393	5.5361	0.17011	0.0:0.2378:0.283:0.4792	.	428;428	Q3B820;Q3B820-3	F161A_HUMAN;.	A	428	ENSP00000385158:T428A;ENSP00000385893:T428A	ENSP00000385158:T428A	T	-	1	0	FAM161A	61920361	0.007000	0.16637	0.001000	0.08648	0.279000	0.26890	0.101000	0.15251	0.040000	0.15660	0.528000	0.53228	ACT	FAM161A-005	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325541.2		114.375297	0	26	131	0	0	1	0	NM_032180	36	115.994141	63	0.363636
ZNF845	91664	broad.mit.edu	hg19	19	53855032	53855032	+	Silent	SNP	A	A	G			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr19:53855032A>G	ENST00000458035.1	+	4	1221	c.1104A>G	c.(1102-1104)tcA>tcG	p.S368S	ZNF845_ENST00000595091.1_Silent_p.S368S	NM_138374.1	NP_612383.1	Q96IR2	ZN845_HUMAN	zinc finger protein 845	368		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26					GTTTCAAATCAAACCTTGAAA	0.403	0	31.0	30.0	30.0	19	53855032	692	1591	2283	SO:0001819	synonymous_variant	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799	"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product						Standard	NM_138374	Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1104A>G	19.37:g.53855032A>G			ENST00000595091.1	37	CCDS46170.1																																																																																			ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1		2.801436	0	-13	58	0	0	1	0	XM_039908	3	6.360424	22	0.120000
IL22RA1	58985	ucsc.edu	hg19	1	24463667	24463667	+	Silent	SNP	G	G	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da																										TGGCTGACCGGCCTCCCGCAC	0.612	0	64.0	58.0	60.0	1	24463667	2203	4300	6503	SO:0001819	synonymous_variant	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677	"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R	10875937	Standard	NM_021258	Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.309C>T	1.37:g.24463667G>A		A8K839|B2R9Y9|Q9HB22	ENST00000270800.1	37	CCDS247.1																																																																																			IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1				-8	51						4		30	
ZNF654	55279	ucsc.edu	hg19	3	88190009	88190009	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da																										TCTTAGTATGCCAAAACGCAG	0.363	0	115.0	105.0	108.0	3	88190009	1856	4104	5960	SO:0001583	missense	AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105		25612	protein-coding gene	gene with protein product						Standard	NM_018293	Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.1549C>A	3.37:g.88190009C>A	ENSP00000312141:p.Pro517Thr	Q9H791|Q9NV14	ENST00000309495.5	37	CCDS46874.1	.	.	.	.	.	.	.	.	.	.	c	19.49	3.836653	0.71373	.	.	ENSG00000175105	ENST00000309495	T	0.18338	2.22	5.48	5.48	0.80851	.	.	.	.	.	T	0.32526	0.0832	L	0.29908	0.895	0.50632	D	0.999882	D	0.89917	1.0	D	0.77004	0.989	T	0.04565	-1.0942	9	0.72032	D	0.01	.	18.3314	0.90270	0.0:1.0:0.0:0.0	.	517	Q8IZM8	ZN654_HUMAN	T	517	ENSP00000312141:P517T	ENSP00000312141:P517T	P	+	1	0	ZNF654	88272699	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.985000	0.76193	2.560000	0.86352	0.574000	0.79327	CCA	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2				-9	90					NM_018293	4		38	
NPHP3	27031	broad.mit.edu	hg19	3	132411619	132411619	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr3:132411619G>A	ENST00000337331.5	-	17	2440	c.2354C>T	c.(2353-2355)tCa>tTa	p.S785L	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	785		maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding	NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42					CATCAGTTCTGATTCACTCAC	0.383	0	112.0	98.0	103.0	3	132411619	2203	4300	6503	SO:0001583	missense	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971	"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002			12872122, 15381417	Standard	NM_153240	Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2354C>T	3.37:g.132411619G>A	ENSP00000338766:p.Ser785Leu	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	ENST00000337331.5	37	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022318	0.75275	.	.	ENSG00000113971	ENST00000393144;ENST00000337331	D	0.91792	-2.91	5.3	5.3	0.74995	.	0.138123	0.50627	D	0.000116	D	0.90007	0.6880	L	0.59436	1.845	0.80722	D	1	P	0.35077	0.483	B	0.30943	0.122	D	0.89970	0.4093	10	0.52906	T	0.07	-15.7516	17.1141	0.86684	0.0:0.0:1.0:0.0	.	785	Q7Z494	NPHP3_HUMAN	L	65;785	ENSP00000338766:S785L	ENSP00000338766:S785L	S	-	2	0	NPHP3	133894309	1.000000	0.71417	0.703000	0.30354	0.971000	0.66376	7.619000	0.83057	2.470000	0.83445	0.585000	0.79938	TCA	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2		49.378007	0	7	46	0	0	1	0	NM_153240	14	51.581613	1	0.933333
NXF4	0	broad.mit.edu	hg19	X	101805202	101805203	+	RNA	INS	-	-	C			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chrX:101805202_101805203insC	ENST00000360035.2	+	0	221					NR_002216.1										endometrium(2)|lung(8)	10					AGCTTCCCTGACCCCTTTTGTT	0.485	0											AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970		8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""		11566096	Standard	NR_002216	Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101805206_101805206dupC			ENST00000360035.2	37																																																																																				NXF4-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000095720.1	.	.		-8	8						2		4	0.33
RAP1GAP2	23108	broad.mit.edu	hg19	17	2699865	2699865	+	Splice_Site	DEL	G	G	-			TCGA-V4-A9EQ-01A-11D-A39W-08	TCGA-V4-A9EQ-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	da7b9dab-d5d2-42f1-b156-c627cf9f987c	a505db24-f411-4532-9291-41073c0938da	g.chr17:2699865delG	ENST00000254695.8	+	1	134	c.44delG	c.(43-45)tgg>tg	p.W15fs	RAP1GAP2_ENST00000540393.2_Intron|RAP1GAP2_ENST00000366401.4_Splice_Site_p.W15fs|RAP1GAP2_ENST00000542807.1_Splice_Site_p.W15fs	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	15		regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity	endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11					GGCTTCGGATGGTGGGTGACA	0.622	0	16.0	19.0	18.0	17	2699865	1912	4088	6000	SO:0001630	splice_region_variant	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359		29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4	15632203	Standard	NM_015085	Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.44+1G>-	17.37:g.2699865delG		B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	ENST00000254695.8	37	CCDS45573.1																																																																																			RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2	.	.		6	10						2		4	0.33
