Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
CHD5	26038	broad.mit.edu	hg19	1	6214772	6214772	+	Silent	SNP	C	C	T	rs141326175		TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr1:6214772C>T	ENST00000262450.3	-	5	792	c.693G>A	c.(691-693)ccG>ccA	p.P231P	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	231		chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	GGGGCACCTGCGGGGGGCTGA	0.687	0	25.0	21.0	22.0	1	6214772	2180	4276	6456	SO:0001819	synonymous_variant	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254	"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771			11889561, 12592387	Standard	NM_015557	Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.693G>A	1.37:g.6214772C>T		A8KAP8|A8MQ44|D3DSH9|O60740	ENST00000262450.3	37	CCDS57.1																																																																																			CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2		86.569169	0	-5	36	0	0	1	0	NM_015557	29	86.625299	33	0.467742
MRPL24	79590	broad.mit.edu	hg19	1	156708205	156708205	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr1:156708205G>A	ENST00000361531.2	-	3	345	c.209C>T	c.(208-210)gCc>gTc	p.A70V	MRPL24_ENST00000368211.4_Missense_Mutation_p.A70V			Q96A35	RM24_HUMAN	mitochondrial ribosomal protein L24	70	KOW.	translation	mitochondrion|ribosome	structural constituent of ribosome	endometrium(1)|large_intestine(1)|lung(4)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)				CTGCTTCCCGGCATCCTTGCC	0.567	0	211.0	194.0	200.0	1	156708205	2203	4300	6503	SO:0001583	missense	AB051341	CCDS1155.1	1q23.1	2012-11-14			ENSG00000143314	ENSG00000143314	"""Mitochondrial ribosomal proteins / large subunits"""	14037	protein-coding gene	gene with protein product		611836				Standard	NM_145729	Approved	MRP-L18	uc001fpx.1	Q96A35	OTTHUMG00000041296	ENST00000361531.2:c.209C>T	1.37:g.156708205G>A	ENSP00000354525:p.Ala70Val	D3DVC8|Q53G65|Q53HT0|Q5SYZ9|Q5SZ00|Q5SZ02|Q96Q70|Q9H7G3	ENST00000361531.2	37	CCDS1155.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458233	0.63401	.	.	ENSG00000143314	ENST00000361531;ENST00000368211;ENST00000434558;ENST00000412846	.	.	.	5.57	4.6	0.57074	KOW (2);Translation protein SH3-like (1);Ribosomal protein L24/L26, conserved site (1);Ribosomal protein L24, SH3-like (1);	0.109682	0.64402	D	0.000007	T	0.40322	0.1112	M	0.67397	2.05	0.41365	D	0.987454	P	0.39352	0.669	B	0.31016	0.123	T	0.55866	-0.8073	9	0.72032	D	0.01	-17.5247	12.9383	0.58327	0.0:0.0:0.8372:0.1628	.	70	Q96A35	RM24_HUMAN	V	70	.	ENSP00000354525:A70V	A	-	2	0	MRPL24	154974829	0.996000	0.38824	0.984000	0.44739	0.912000	0.54170	2.423000	0.44705	2.633000	0.89246	0.650000	0.86243	GCC	MRPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098955.1		-33.644007	0	-12	162	0	0	1	0	NM_145729	4	6.688249	157	0.024845
EIF1AX	1964	broad.mit.edu	hg19	X	20156735	20156735	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chrX:20156735C>T	ENST00000379607.5	-	2	225	c.22G>A	c.(22-24)Gga>Aga	p.G8R	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	8			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					TTTTTACCTCCTTTACCTGAT	0.308	0	135.0	126.0	129.0	X	20156735	2203	4300	6503	SO:0001583	missense	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.22G>A	X.37:g.20156735C>T	ENSP00000368927:p.Gly8Arg	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722807	0.68959	.	.	ENSG00000173674	ENST00000379607	T	0.47528	0.84	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.79143	0.4396	H	0.96365	3.81	0.80722	D	1	D	0.67145	0.996	D	0.79784	0.993	D	0.86825	0.2007	9	0.87932	D	0	-2.5166	17.661	0.88193	0.0:1.0:0.0:0.0	.	8	P47813	IF1AX_HUMAN	R	8	ENSP00000368927:G8R	ENSP00000368927:G8R	G	-	1	0	EIF1AX	20066656	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGA	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		125.655225	0	-34	126	0	0	1	0		41	126.293036	58	0.414141
AC009499.1	0	broad.mit.edu	hg19	2	33952778	33952778	+	RNA	SNP	C	C	T			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr2:33952778C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																	GGGGAAGTTGCGCCAAAACAA	0.597	0																																				2.37:g.33952778C>T			ENST00000366209.2	37																																																																																				AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA	OTTHUMT00000325406.1		2.508308	0	-7	20	0	0	1	0		3	6.543945	24	0.111111
ETS1	2113	broad.mit.edu	hg19	11	128426243	128426243	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr11:128426243A>G	ENST00000392668.4	-	3	241	c.157T>C	c.(157-159)Ttt>Ctt	p.F53L	ETS1_ENST00000525404.1_5'UTR	NM_001143820.1	NP_001137292.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1		PNT.	cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)	TCATCCCAAAAGGGGTAGCAA	0.448	0	155.0	134.0	140.0	11	128426243	1566	3579	5145	SO:0001583	missense		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954		3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2	1522903	Standard	NM_005238	Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000392668.4:c.157T>C	11.37:g.128426243A>G	ENSP00000376436:p.Phe53Leu	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	ENST00000392668.4	37	CCDS44767.1	.	.	.	.	.	.	.	.	.	.	A	4.254	0.046125	0.08243	.	.	ENSG00000134954	ENST00000392668	T	0.08546	3.08	5.91	-0.172	0.13327	.	31.137600	0.02836	U	0.127298	T	0.04003	0.0112	.	.	.	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.36696	-0.9737	9	0.02654	T	1	.	9.9312	0.41523	0.4387:0.0:0.5613:0.0	.	53	Q6N087	.	L	53	ENSP00000376436:F53L	ENSP00000376436:F53L	F	-	1	0	ETS1	127931453	0.028000	0.19301	0.100000	0.21137	0.969000	0.65631	0.081000	0.14823	-0.052000	0.13311	0.533000	0.62120	TTT	ETS1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386267.2		-8.734257	0	7	55	0	0	1	0	NM_005238	3	6.394711	65	0.044118
APC	324	broad.mit.edu	hg19	5	112170678	112170678	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr5:112170678T>G	ENST00000457016.1	+	15	2154	c.1774T>G	c.(1774-1776)Tta>Gta	p.L592V	APC_ENST00000508376.2_Missense_Mutation_p.L592V|APC_ENST00000257430.4_Missense_Mutation_p.L592V|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	592	Leu-rich.	canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)	ATTGAGTGCCTTATGGAATTT	0.388	1	179.0	149.0	159.0	5	112170678	2202	4300	6502	SO:0001583	missense	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""		1651563	Standard	NM_001127511	Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1774T>G	5.37:g.112170678T>G	ENSP00000413133:p.Leu592Val	D3DT03|Q15162|Q15163|Q93042	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.477506	0.84640	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08	5.93	4.77	0.60923	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.87172	0.6111	M	0.86651	2.83	0.80722	D	1	P;P	0.52463	0.953;0.953	P;P	0.59546	0.816;0.859	D	0.88373	0.2996	10	0.87932	D	0	-12.9742	11.7181	0.51666	0.0:0.0686:0.0:0.9314	.	594;592	Q4LE70;P25054	.;APC_HUMAN	V	592;574;592;592;592	ENSP00000413133:L592V;ENSP00000423224:L574V;ENSP00000257430:L592V;ENSP00000427089:L592V;ENSP00000423828:L592V	ENSP00000257430:L592V	L	+	1	2	APC	112198577	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.392000	0.59659	1.077000	0.40990	0.533000	0.62120	TTA	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2		116.843499	0	-19	75	0	0	1	0	NM_000038	38	116.868395	41	0.481013
ARPC2	10109	broad.mit.edu	hg19	2	219093472	219093472	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr2:219093472G>A	ENST00000295685.10	+	3	382	c.121G>A	c.(121-123)Gtc>Atc	p.V41I	ARPC2_ENST00000315717.5_Missense_Mutation_p.V41I	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	41		cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton	cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)	TTTCGATGGGGTCCTCTATCA	0.413	0	105.0	104.0	105.0	2	219093472	2203	4300	6503	SO:0001583	missense	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466	"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""		9359840, 9230079	Standard	NM_005731	Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.121G>A	2.37:g.219093472G>A	ENSP00000295685:p.Val41Ile	Q92801|Q9P1D4	ENST00000295685.10	37	CCDS2410.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138944	0.77775	.	.	ENSG00000163466	ENST00000315717;ENST00000420104;ENST00000295685	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.71710	0.3372	M	0.84082	2.675	0.80722	D	1	B	0.22211	0.066	B	0.18871	0.023	T	0.70960	-0.4730	9	0.54805	T	0.06	.	19.2755	0.94030	0.0:0.0:1.0:0.0	.	41	O15144	ARPC2_HUMAN	I	41	.	ENSP00000295685:V41I	V	+	1	0	ARPC2	218801717	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.657000	0.98554	2.865000	0.98341	0.655000	0.94253	GTC	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256777.2		61.196109	0	-14	43	0	0	1	0	NM_005731	20	61.216900	22	0.476190
SNAPC4	6621	broad.mit.edu	hg19	9	139276418	139276418	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr9:139276418C>A	ENST00000298532.2	-	17	2543	c.2175G>T	c.(2173-2175)caG>caT	p.Q725H		NM_003086.2	NP_003077.2	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex, polypeptide 4, 190kDa	725		snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)	GCTGCCCACTCTGGGTGGCTC	0.677	1	21.0	22.0	21.0	9	139276418	2197	4292	6489	SO:0001583	missense	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684		11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""		9418884	Standard	XM_005266096	Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.2175G>T	9.37:g.139276418C>A	ENSP00000298532:p.Gln725His		ENST00000298532.2	37	CCDS6998.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.912303	0.33721	.	.	ENSG00000165684	ENST00000298532	T	0.25912	1.77	4.08	2.21	0.28008	.	8.448780	0.00559	N	0.000277	T	0.28797	0.0714	L	0.43152	1.355	0.09310	N	1	P	0.51653	0.947	P	0.44732	0.459	T	0.16837	-1.0389	10	0.49607	T	0.09	-6.1184	7.2401	0.26092	0.0:0.789:0.0:0.211	.	725	Q5SXM2	SNPC4_HUMAN	H	725	ENSP00000298532:Q725H	ENSP00000298532:Q725H	Q	-	3	2	SNAPC4	138396239	0.000000	0.05858	0.003000	0.11579	0.149000	0.21700	-0.235000	0.09016	0.198000	0.20407	0.462000	0.41574	CAG	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1		35.055769	1	12	26	0	0.000151284	1	0.000156012	NM_003086	13	35.174223	17	0.433333
DNAH10	196385	broad.mit.edu	hg19	12	124257432	124257432	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr12:124257432C>T	ENST00000409039.3	+	4	290	c.265C>T	c.(265-267)Cct>Tct	p.P89S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	89	Stem (By similarity).	microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	GCTCTGTACCCCTCTTCCCGA	0.458	0	175.0	171.0	172.0	12	124257432	1953	4159	6112	SO:0001583	missense	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653	"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""			Standard	NM_207437	Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.265C>T	12.37:g.124257432C>T	ENSP00000386770:p.Pro89Ser	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	2.619	-0.288952	0.05605	.	.	ENSG00000197653	ENST00000409039	T	0.20069	2.1	5.93	3.86	0.44501	.	.	.	.	.	T	0.09335	0.0230	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.38542	-0.9656	9	0.07482	T	0.82	.	4.2262	0.10582	0.0:0.5848:0.1886:0.2266	.	89	Q8IVF4	DYH10_HUMAN	S	89	ENSP00000386770:P89S	ENSP00000386770:P89S	P	+	1	0	DNAH10	122823385	0.000000	0.05858	0.061000	0.19648	0.003000	0.03518	0.485000	0.22324	1.487000	0.48415	0.655000	0.94253	CCT	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		-33.147555	0	-20	98	0	0	1	0		4	7.471722	158	0.024691
LILRA3	0	broad.mit.edu	hg19	19	54802705	54802705	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr19:54802705A>T	ENST00000391745.1	-	9	1103	c.787T>A	c.(787-789)Tgt>Agt	p.C263S	LILRA3_ENST00000251390.3_Missense_Mutation_p.C246S|LILRA3_ENST00000391744.3_Missense_Mutation_p.C182S					leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3						NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)	TCAGAGCCACACTGGAAGGTC	0.602	0	66.0	60.0	62.0	19	54802705	2193	4153	6346	SO:0001583	missense	U91926		19q13.4	2013-01-11					"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818			9278324, 9548455	Standard	XM_006710242	Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000391744.3:c.544T>A	19.37:g.54802705A>T	ENSP00000375624:p.Cys182Ser	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	ENST00000391744.3	37	CCDS54317.1	.	.	.	.	.	.	.	.	.	.	A	12.59	1.984695	0.35036	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	D;D;D	0.94537	-3.45;-3.45;-3.45	1.79	0.7	0.18099	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.324006	0.22997	N	0.053132	D	0.98046	0.9356	H	0.99770	4.765	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91919	0.5546	10	0.72032	D	0.01	.	4.6785	0.12724	0.6648:0.3352:0.0:0.0	.	246;246	E7EU74;Q8N6C8	.;LIRA3_HUMAN	S	246;182;263	ENSP00000251390:C246S;ENSP00000375624:C182S;ENSP00000375625:C263S	ENSP00000251390:C246S	C	-	1	0	LILRA3	59494517	0.000000	0.05858	0.019000	0.16419	0.027000	0.11550	0.149000	0.16243	0.159000	0.19401	0.473000	0.43528	TGT	LILRA3-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000140237.1		51.506625	0	2	64	0	0	1	0		19	52.552832	35	0.351852
SHPK	23729	broad.mit.edu	hg19	17	3513993	3513993	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr17:3513993G>A	ENST00000225519.3	-	7	1400	c.1298C>T	c.(1297-1299)gCg>gTg	p.A433V		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	433		carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity	breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)	CCTGGACAGCGCACTCCCACT	0.612	0	158.0	155.0	156.0	17	3513993	2203	4300	6503	SO:0001583	missense	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL	10673275, 18186520	Standard	NM_013276	Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.1298C>T	17.37:g.3513993G>A	ENSP00000225519:p.Ala433Val	B2R640|Q8WUH3	ENST00000225519.3	37	CCDS11030.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037917	0.93630	.	.	ENSG00000197417	ENST00000225519	T	0.13420	2.59	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.31670	0.0804	M	0.81682	2.555	0.80722	D	1	D	0.71674	0.998	P	0.52454	0.699	T	0.22591	-1.0212	10	0.56958	D	0.05	-19.7998	16.9394	0.86213	0.0:0.0:1.0:0.0	.	433	Q9UHJ6	SHPK_HUMAN	V	433	ENSP00000225519:A433V	ENSP00000225519:A433V	A	-	2	0	SHPK	3460742	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.626000	0.90969	2.314000	0.78098	0.563000	0.77884	GCG	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2		184.904621	0	-45	105	0	0	1	0		60	184.952150	55	0.521739
KRCC1	51315	broad.mit.edu	hg19	2	88327530	88327530	+	Missense_Mutation	SNP	C	C	T	rs61734751	byFrequency	TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr2:88327530C>T	ENST00000347055.3	-	4	946	c.553G>A	c.(553-555)Gag>Aag	p.E185K		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	185	Lys-rich.				cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7					TCAATTTCCTCGCAGCTTTTT	0.408	0	117.0	125.0	122.0	2	88327530	2203	4300	6503	SO:0001583	missense	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086		28039	protein-coding gene	gene with protein product					12477932	Standard	XM_005264360	Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.553G>A	2.37:g.88327530C>T	ENSP00000340083:p.Glu185Lys	Q3B7J7	ENST00000347055.3	37	CCDS2000.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.21	2.467147	0.43839	0.005447	0.0	ENSG00000172086	ENST00000347055	T	0.35973	1.28	5.98	5.11	0.69529	.	0.339027	0.28203	N	0.016202	T	0.50120	0.1597	M	0.71581	2.175	0.39798	D	0.97252	D	0.89917	1.0	D	0.77004	0.989	T	0.60601	-0.7231	10	0.56958	D	0.05	-21.1108	13.3095	0.60371	0.0:0.924:0.0:0.076	.	185	Q9NPI7	KRCC1_HUMAN	K	185	ENSP00000340083:E185K	ENSP00000340083:E185K	E	-	1	0	KRCC1	88108645	0.996000	0.38824	0.813000	0.32504	0.004000	0.04260	3.835000	0.55805	1.548000	0.49413	-0.133000	0.14855	GAG	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252664.1		54.738919	0	-22	135	0	0	1	0	NM_016618	21	59.160782	61	0.256098
PTGER2	5732	broad.mit.edu	hg19	14	52781318	52781318	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr14:52781318T>C	ENST00000245457.5	+	1	206	c.52T>C	c.(52-54)Tgg>Cgg	p.W18R	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	18			integral to plasma membrane	prostaglandin E receptor activity	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				GACGCGACAGTGGCTTCCCCC	0.652	0	18.0	22.0	21.0	14	52781318	2196	4292	6488	SO:0001583	missense		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384	"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""		8250933, 7759114	Standard	NM_000956	Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.52T>C	14.37:g.52781318T>C	ENSP00000245457:p.Trp18Arg	D3DSC0|Q52LG8	ENST00000245457.5	37	CCDS9708.1	.	.	.	.	.	.	.	.	.	.	T	12.25	1.881161	0.33255	.	.	ENSG00000125384	ENST00000245457	D	0.83837	-1.77	5.04	2.6	0.31112	.	0.763029	0.13124	N	0.412005	T	0.76793	0.4037	M	0.73598	2.24	0.28614	N	0.908536	B	0.31730	0.337	B	0.23574	0.047	T	0.64330	-0.6433	10	0.26408	T	0.33	-0.9863	4.4199	0.11476	0.1725:0.0952:0.0:0.7323	.	18	P43116	PE2R2_HUMAN	R	18	ENSP00000245457:W18R	ENSP00000245457:W18R	W	+	1	0	PTGER2	51851068	0.003000	0.15002	0.795000	0.32087	0.935000	0.57460	0.999000	0.29757	0.322000	0.23283	0.397000	0.26171	TGG	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1		34.662236	0	6	25	0	0	1	0		13	35.384074	24	0.351351
RELN	5649	broad.mit.edu	hg19	7	103205756	103205756	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr7:103205756G>C	ENST00000424685.2	-	34	5338	c.5179C>G	c.(5179-5181)Cgg>Ggg	p.R1727G	RELN_ENST00000428762.1_Missense_Mutation_p.R1727G|RELN_ENST00000343529.5_Missense_Mutation_p.R1727G			P78509	RELN_HUMAN	reelin	1727		axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	ACAGTGATCCGCTTCCAATTC	0.438	1	123.0	111.0	115.0	7	103205756	2203	4300	6503	SO:0001583	missense		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056		9957	protein-coding gene	gene with protein product		600514			9049633	Standard	NM_005045	Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5179C>G	7.37:g.103205756G>C	ENSP00000392423:p.Arg1727Gly	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090837	0.76756	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.50813	1.34;0.73;1.34	6.02	4.09	0.47781	Neuraminidase (1);	0.053048	0.64402	D	0.000001	T	0.70272	0.3205	M	0.84585	2.705	0.48341	D	0.999639	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.979	T	0.76160	-0.3061	10	0.87932	D	0	.	12.891	0.58071	0.0:0.0:0.4962:0.5038	.	1727;1727	P78509-2;P78509	.;RELN_HUMAN	G	1727	ENSP00000392423:R1727G;ENSP00000345694:R1727G;ENSP00000388446:R1727G	ENSP00000345694:R1727G	R	-	1	2	RELN	102992992	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.045000	0.49838	1.518000	0.48934	0.655000	0.94253	CGG	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1		-10.267851	0	-23	51	0	0	1	0	NM_005045	4	8.587090	82	0.046512
EPC2	26122	broad.mit.edu	hg19	2	149528843	149528843	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr2:149528843A>G	ENST00000258484.6	+	10	1641	c.1607A>G	c.(1606-1608)cAg>cGg	p.Q536R		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	536		chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)	CTAAATTTACAGGACAGTGAT	0.383	0	122.0	117.0	118.0	2	149528843	1884	4100	5984	SO:0001583	missense	AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999		24543	protein-coding gene	gene with protein product		611000				Standard	NM_015630	Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1607A>G	2.37:g.149528843A>G	ENSP00000258484:p.Gln536Arg	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.719089	0.48622	.	.	ENSG00000135999	ENST00000258484	T	0.18810	2.19	5.36	4.12	0.48240	.	0.078676	0.53938	D	0.000047	T	0.17280	0.0415	L	0.40543	1.245	0.80722	D	1	B	0.26975	0.165	B	0.23574	0.047	T	0.04440	-1.0951	10	0.33141	T	0.24	-2.1473	12.2419	0.54546	0.8581:0.1419:0.0:0.0	.	536	Q52LR7	EPC2_HUMAN	R	536	ENSP00000258484:Q536R	ENSP00000258484:Q536R	Q	+	2	0	EPC2	149245313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.598000	0.54038	2.140000	0.66376	0.460000	0.39030	CAG	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1		135.162543	0	1	71	0	0	1	0	NM_015630	45	135.340820	54	0.454545
ELMO2	63916	broad.mit.edu	hg19	20	45014869	45014869	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr20:45014869G>C	ENST00000372176.1	-	9	775	c.307C>G	c.(307-309)Cag>Gag	p.Q103E	ELMO2_ENST00000290246.6_Missense_Mutation_p.Q191E|ELMO2_ENST00000445496.2_Missense_Mutation_p.Q8E|ELMO2_ENST00000439931.2_Missense_Mutation_p.Q191E|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000396391.1_Missense_Mutation_p.Q191E|ELMO2_ENST00000352077.2_Missense_Mutation_p.Q189E			Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	191		apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding	breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)			AGGGACCTCTGAAGGATTGAC	0.527	0	134.0	119.0	124.0	20	45014869	2203	4300	6503	SO:0001583	missense	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598	"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""		11595183	Standard	NM_133171	Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.571C>G	20.37:g.45014869G>C	ENSP00000290246:p.Gln191Glu	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292915	0.60086	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000352077;ENST00000450812	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;1.66;0.96;0.96	4.85	4.85	0.62838	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	L	0.60455	1.87	0.80722	D	1	B;P;P	0.37370	0.127;0.592;0.592	B;B;B	0.37091	0.173;0.241;0.241	T	0.27400	-1.0075	10	0.24483	T	0.36	-26.912	17.1413	0.86754	0.0:0.0:1.0:0.0	.	191;191;191	B4DRL5;E9PBG2;Q96JJ3	.;.;ELMO2_HUMAN	E	191;103;191;191;8;189;191	ENSP00000290246:Q191E;ENSP00000361249:Q103E;ENSP00000379673:Q191E;ENSP00000396519:Q191E;ENSP00000409920:Q8E;ENSP00000326172:Q189E;ENSP00000416181:Q191E	ENSP00000290246:Q191E	Q	-	1	0	ELMO2	44448276	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.657000	0.98554	2.526000	0.85167	0.591000	0.81541	CAG	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1		60.037340	0	4	82	0	0	1	0	NM_022086	21	63.625109	56	0.272727
DNAJC8	22826	broad.mit.edu	hg19	1	28555506	28555506	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr1:28555506A>G	ENST00000263697.4	-	2	133	c.107T>C	c.(106-108)gTt>gCt	p.V36A	DNAJC8_ENST00000489277.1_5'UTR	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	36		nuclear mRNA splicing, via spliceosome|protein folding	nucleoplasm	heat shock protein binding|unfolded protein binding	kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)	CGAAGTTAGAACCGAGTCTCT	0.353	0	106.0	93.0	97.0	1	28555506	1821	4088	5909	SO:0001583	missense	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698	"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product					11147971	Standard	NM_014280	Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.107T>C	1.37:g.28555506A>G	ENSP00000263697:p.Val36Ala	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	ENST00000263697.4	37	CCDS41292.1	.	.	.	.	.	.	.	.	.	.	A	18.46	3.628755	0.67015	.	.	ENSG00000126698	ENST00000263697	T	0.20463	2.07	5.16	5.16	0.70880	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.25082	0.0609	L	0.51422	1.61	0.80722	D	1	P	0.47545	0.897	P	0.45794	0.493	T	0.01762	-1.1279	10	0.29301	T	0.29	-28.1862	13.9683	0.64223	1.0:0.0:0.0:0.0	.	36	O75937	DNJC8_HUMAN	A	36	ENSP00000263697:V36A	ENSP00000263697:V36A	V	-	2	0	DNAJC8	28428093	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.670000	0.83925	1.948000	0.56530	0.459000	0.35465	GTT	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009860.1		137.617233	0	-8	80	0	0	1	0	NM_014280	43	137.802390	52	0.452632
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		165.651661	0	-35	77	0	0	1	0	NM_002072	50	165.734665	44	0.531915
ST6GAL2	84620	broad.mit.edu	hg19	2	107459605	107459605	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr2:107459605G>A	ENST00000409382.3	-	2	1439	c.829C>T	c.(829-831)Cgg>Tgg	p.R277W	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R277W|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.R277W	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	277		growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65					ACCAGGCGCCGCCAGCCCAGC	0.731	0	4.0	6.0	5.0	2	107459605	1647	3523	5170	SO:0001583	missense	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2		Standard	NM_032528	Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.829C>T	2.37:g.107459605G>A	ENSP00000386942:p.Arg277Trp	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972296	0.74246	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.31247	1.5;1.5;1.5	4.72	3.84	0.44239	.	1.117690	0.06782	N	0.785500	T	0.50803	0.1637	L	0.61218	1.895	0.37477	D	0.915859	D;D	0.76494	0.999;0.996	P;P	0.58970	0.711;0.849	T	0.36696	-0.9737	10	0.66056	D	0.02	-5.3243	12.1198	0.53885	0.0:0.5885:0.4115:0.0	.	277;277	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	W	277	ENSP00000355273:R277W;ENSP00000386942:R277W;ENSP00000387332:R277W	ENSP00000355273:R277W	R	-	1	2	ST6GAL2	106826037	0.997000	0.39634	0.899000	0.35326	0.562000	0.35680	2.060000	0.41394	1.108000	0.41662	0.563000	0.77884	CGG	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1		13.971455	0	5	9	0	0	1	0	NM_032528	5	14.257919	2	0.714286
AMOTL2	51421	broad.mit.edu	hg19	3	134076564	134076564	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr3:134076564C>T	ENST00000514516.1	-	10	2675	c.2497G>A	c.(2497-2499)Gtg>Atg	p.V833M	AMOTL2_ENST00000513145.1_Missense_Mutation_p.V773M|AMOTL2_ENST00000249883.5_Missense_Mutation_p.V776M|AMOTL2_ENST00000422605.2_Missense_Mutation_p.V775M	NM_001278683.1	NP_001265612.1	Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	775					endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19					AGTATCTCCACCATGTCTGAC	0.507	0	230.0	188.0	202.0	3	134076564	2203	4300	6503	SO:0001583	missense	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019		17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658				Standard	NM_016201	Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000514516.1:c.2497G>A	3.37:g.134076564C>T	ENSP00000424765:p.Val833Met	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	ENST00000514516.1	37		.	.	.	.	.	.	.	.	.	.	C	25.3	4.621815	0.87460	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145	T;T;T;T	0.25085	1.88;1.87;1.82;1.87	5.28	5.28	0.74379	.	0.074219	0.52532	D	0.000068	T	0.48241	0.1489	L	0.50333	1.59	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.47355	-0.9124	10	0.87932	D	0	-29.9867	18.9412	0.92605	0.0:1.0:0.0:0.0	.	773;776;833	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	M	776;775;833;773	ENSP00000249883:V776M;ENSP00000409999:V775M;ENSP00000424765:V833M;ENSP00000425475:V773M	ENSP00000249883:V776M	V	-	1	0	AMOTL2	135559254	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.472000	0.66768	2.450000	0.82876	0.655000	0.94253	GTG	AMOTL2-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357274.2		152.358930	0	-36	130	0	0	1	0	NM_016201	52	155.020087	94	0.356164
RASL12	51285	broad.mit.edu	hg19	15	65347374	65347374	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr15:65347374T>G	ENST00000220062.4	-	5	940	c.664A>C	c.(664-666)Aac>Cac	p.N222H	RASL12_ENST00000434605.2_Missense_Mutation_p.N211H|RASL12_ENST00000421977.3_Missense_Mutation_p.N203H	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	222		small GTPase mediated signal transduction	membrane	GTP binding|GTPase activity	lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4					GAGAGCGTGTTGAAGGTGCAG	0.682	0	39.0	36.0	37.0	15	65347374	2202	4299	6501	SO:0001583	missense	AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710		30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""				12107412	Standard	NM_016563	Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.664A>C	15.37:g.65347374T>G	ENSP00000220062:p.Asn222His	B2RC29|B4DJW2|B4DU82	ENST00000220062.4	37	CCDS10200.1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.845022	0.32606	.	.	ENSG00000103710	ENST00000220062;ENST00000421977;ENST00000434605	T;T;T	0.80824	-0.39;-1.42;-0.28	4.94	3.8	0.43715	.	0.163249	0.43747	D	0.000524	T	0.74076	0.3669	N	0.24115	0.695	0.31444	N	0.671621	B;D;B	0.55385	0.013;0.971;0.006	B;P;B	0.50440	0.005;0.641;0.008	T	0.76647	-0.2882	10	0.87932	D	0	.	9.3012	0.37847	0.0:0.0832:0.0:0.9168	.	211;203;222	B4DU82;B4DJW2;Q9NYN1	.;.;RASLC_HUMAN	H	222;203;211	ENSP00000220062:N222H;ENSP00000390028:N203H;ENSP00000412787:N211H	ENSP00000220062:N222H	N	-	1	0	RASL12	63134427	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	2.204000	0.42761	0.834000	0.34852	0.413000	0.27773	AAC	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256782.2		41.843972	0	0	20	0	0	1	0	NM_016563	14	42.009271	19	0.424242
FOXG1	2290	broad.mit.edu	hg19	14	29236624	29236626	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chr14:29236624_29236626delCAC	ENST00000382535.3	+	2	508_510	c.139_141delCAC	c.(139-141)cacdel	p.H57del	FOXG1_ENST00000313071.4_In_Frame_Del_p.H57del			P55316	FOXG1_HUMAN	forkhead box G1	57	His-rich.	axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	ccacccccagcaccaccaccacc	0.744	0									SO:0001651	inframe_deletion		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165	"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A	7959731, 17260156	Standard	NM_005249	Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.139_141delCAC	14.37:g.29236633_29236635delCAC	ENSP00000339004:p.His57del	A6NFY2|P55315|Q14488|Q86XT7	ENST00000313071.4	37	CCDS9636.1																																																																																			FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3	.	.		-1	15						2		4	0.33
HUWE1	10075	broad.mit.edu	hg19	X	53589168	53589170	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-V4-A9EY-01A-11D-A39W-08	TCGA-V4-A9EY-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7eba7e19-10a9-4b6b-bd1c-70968842e77a	3dbe8380-1f81-4953-8b71-a7f1e9b374a0	g.chrX:53589168_53589170delCTC	ENST00000342160.3	-	53	7697_7699	c.7240_7242delGAG	c.(7240-7242)gagdel	p.E2414del	HUWE1_ENST00000262854.6_In_Frame_Del_p.E2414del			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2414	Glu-rich.	base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153					CCTGAGTGTGCTCCTCCTCATCC	0.493	0									SO:0001651	inframe_deletion	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758		30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""		9205841, 10998601	Standard	NM_031407	Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7240_7242delGAG	X.37:g.53589174_53589176delCTC	ENSP00000340648:p.Glu2414del	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	ENST00000342160.3	37	CCDS35301.1																																																																																			HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	.	.		-5	30					XM_497119	15		50	0.23
