Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	A	rs121913492		TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr9:80409488T>A	ENST00000286548.4	-	5	848	c.626A>T	c.(625-627)cAa>cTa	p.Q209L	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7L	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>T	9.37:g.80409488T>A	ENSP00000286548:p.Gln209Leu	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985495	0.93044	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97573	0.9205	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99402	1.0928	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	L	209;7	ENSP00000286548:Q209L;ENSP00000443197:Q7L	ENSP00000286548:Q209L	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		105.765010	0	6	118	0	0	1	0	NM_002072	33	106.107274	44	0.428571
APMAP	57136	broad.mit.edu	hg19	20	24952175	24952175	+	Silent	SNP	C	C	T			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr20:24952175C>T	ENST00000217456.2	-	5	749	c.459G>A	c.(457-459)ctG>ctA	p.L153L	APMAP_ENST00000447138.1_Silent_p.L153L	NM_020531.2	NP_065392.1			adipocyte plasma membrane associated protein												CACGGATACCCAGGGGTCTCC	0.488	0	94.0	96.0	95.0	20	24952175	2203	4300	6503	SO:0001819	synonymous_variant	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474		13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3	10945474, 11583587, 20552250	Standard	NM_020531	Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.459G>A	20.37:g.24952175C>T		A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	ENST00000217456.2	37	CCDS13166.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287554	0.23478	.	.	ENSG00000101474	ENST00000451442	.	.	.	5.47	2.15	0.27550	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.9306	5.5048	0.16848	0.4281:0.4737:0.0:0.0981	.	.	.	.	X	138	.	.	W	-	2	0	C20orf3	24900175	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.218000	0.32467	0.646000	0.30693	0.561000	0.74099	TGG	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2		-6.453858	0	11	102	0	0	1	0	NM_020531	4	9.054166	70	0.054054
PKP4	8502	broad.mit.edu	hg19	2	159499162	159499162	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr2:159499162G>C	ENST00000389757.3	+	11	1985	c.1860G>C	c.(1858-1860)ttG>ttC	p.L620F	PKP4_ENST00000389759.3_Missense_Mutation_p.L620F	NM_001005476.1	NP_001005476.1	Q99569	PKP4_HUMAN	plakophilin 4	620		cell adhesion	desmosome	protein binding	breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61					CTGCCTTGTTGCGACTGTTGA	0.413	0	160.0	161.0	161.0	2	159499162	2203	4300	6503	SO:0001583	missense	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283	"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276			9342840, 8937994	Standard	NM_003628	Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1860G>C	2.37:g.159499162G>C	ENSP00000374409:p.Leu620Phe	Q86W91	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663943	0.47572	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.71817	-0.6;-0.6	5.87	4.07	0.47477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80518	0.4638	M	0.74881	2.28	0.52501	D	0.999951	D;D;D;B;D	0.76494	0.999;0.999;0.999;0.218;0.999	D;D;D;B;D	0.81914	0.995;0.988;0.968;0.211;0.989	T	0.80013	-0.1560	10	0.48119	T	0.1	-5.9841	8.015	0.30376	0.3289:0.0:0.6711:0.0	.	472;575;620;620;471	Q6LCG8;Q4W5T8;Q99569-2;Q99569;F8W7E2	.;.;.;PKP4_HUMAN;.	F	471;620;620	ENSP00000374407:L620F;ENSP00000374409:L620F	ENSP00000374407:L620F	L	+	3	2	PKP4	159207408	0.561000	0.26578	1.000000	0.80357	0.988000	0.76386	0.093000	0.15086	1.478000	0.48253	0.655000	0.94253	TTG	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		-8.234492	0	9	99	0	0	1	0		3	6.613910	64	0.044776
PITPNM2	57605	broad.mit.edu	hg19	12	123476344	123476344	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr12:123476344C>T	ENST00000280562.5	-	16	2711	c.2506G>A	c.(2506-2508)Gcg>Acg	p.A836T	PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000542749.1_Intron|PITPNM2_ENST00000320201.4_Intron			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	812	DDHD.	metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding	NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)	CAGGTGGGCGCGGGAACAGGC	0.682	0	19.0	19.0	19.0	12	123476344	875	1990	2865	SO:0001583	missense	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975		21044	protein-coding gene	gene with protein product		608920			10022914	Standard	XM_005253582	Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000280562.5:c.2506G>A	12.37:g.123476344C>T	ENSP00000280562:p.Ala836Thr	Q9P271	ENST00000280562.5	37		.	.	.	.	.	.	.	.	.	.	C	9.553	1.116365	0.20795	.	.	ENSG00000090975	ENST00000280562	T	0.35605	1.3	5.26	3.43	0.39272	.	.	.	.	.	T	0.21674	0.0522	.	.	.	0.80722	D	1	B	0.13594	0.008	B	0.09377	0.004	T	0.04752	-1.0929	8	0.14252	T	0.57	.	9.9923	0.41879	0.0:0.7798:0.0:0.2202	.	836	Q9BZ72-2	.	T	836	ENSP00000280562:A836T	ENSP00000280562:A836T	A	-	1	0	PITPNM2	122042297	0.998000	0.40836	0.994000	0.49952	0.965000	0.64279	1.734000	0.38166	0.599000	0.29845	0.542000	0.68232	GCG	PITPNM2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000401341.1		22.802300	0	6	28	0	0	1	0	NM_020845	8	23.060506	13	0.380952
GNB1	2782	broad.mit.edu	hg19	1	1718829	1718829	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr1:1718829C>G	ENST00000378609.4	-	11	1295	c.964G>C	c.(964-966)Gac>Cac	p.D322H		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	322		cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity	breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)	ATGCCATCGTCAGTCACGCCC	0.567	0	108.0	95.0	100.0	1	1718829	2203	4300	6503	SO:0001583	missense	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369	"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380				Standard	NM_002074	Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.964G>C	1.37:g.1718829C>G	ENSP00000367872:p.Asp322His	B1AJZ7|P04697|P04901|Q1RMY8	ENST00000378609.4	37	CCDS34.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485217	0.84854	.	.	ENSG00000078369	ENST00000378609;ENST00000455156;ENST00000378606	T	0.60040	0.22	5.74	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045379	0.85682	D	0.000000	T	0.53722	0.1814	N	0.20401	0.57	0.80722	D	1	P	0.39443	0.674	P	0.48552	0.581	T	0.59815	-0.7383	10	0.72032	D	0.01	-20.8821	13.7624	0.62975	0.0:0.9266:0.0:0.0734	.	322	P62873	GBB1_HUMAN	H	322;222;322	ENSP00000367872:D322H	ENSP00000367869:D322H	D	-	1	0	GNB1	1708689	1.000000	0.71417	0.397000	0.26308	0.892000	0.51952	7.600000	0.82769	1.444000	0.47605	0.561000	0.74099	GAC	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3		38.661183	0	-1	86	0	0	1	0	NM_002074	13	39.748205	27	0.325000
TRIM67	440730	broad.mit.edu	hg19	1	231299743	231299743	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr1:231299743T>C	ENST00000444294.3	+	1	1886	c.1028T>C	c.(1027-1029)aTg>aCg	p.M343T	TRIM67_ENST00000449018.3_Missense_Mutation_p.M281T|TRIM67_ENST00000366652.2_Missense_Mutation_p.M343T|TRIM67_ENST00000366653.5_Missense_Mutation_p.M343T	NM_001004342.3	NP_001004342.3	Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	343			cytoplasm|cytoskeleton	zinc ion binding	breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)			CTGGGGGCCATGTGGAAGCAG	0.627	0	13.0	15.0	15.0	1	231299743	2043	4186	6229	SO:0001583	missense	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283	"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""			Standard	NM_001004342	Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1028T>C	1.37:g.231299743T>C	ENSP00000355613:p.Met343Thr	Q5TER7|Q5TER8|Q7Z4K7	ENST00000366653.5	37	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	T	11.72	1.724198	0.30593	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	4.72	3.61	0.41365	.	0.277517	0.42420	N	0.000720	T	0.41119	0.1145	L	0.45581	1.43	0.42088	D	0.991287	B	0.25563	0.129	B	0.23419	0.046	T	0.19031	-1.0318	10	0.24483	T	0.36	.	7.9114	0.29793	0.0:0.1096:0.0:0.8904	.	343	Q6ZTA4	TRI67_HUMAN	T	343;343;281;343	ENSP00000412124:M343T;ENSP00000355612:M343T;ENSP00000400163:M281T;ENSP00000355613:M343T	ENSP00000355612:M343T	M	+	2	0	TRIM67	229366366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.499000	0.60380	0.846000	0.35142	0.459000	0.35465	ATG	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3		7.720212	0	0	14	0	0	1	0	NM_001004342	3	8.232311	8	0.272727
BAP1	8314	hgsc.bcm.edu	hg19	3	52437791	52437791	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032																										TGAGAGGTCCTTCTGGGACTC	0.597	0	76.0	78.0	77.0	3	52437791	2203	4300	6503	SO:0001583	missense	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1370A>G	3.37:g.52437791T>C	ENSP00000417132:p.Lys457Arg	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.986900	0.35036	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61158	0.17;0.13	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.152572	0.64402	D	0.000015	T	0.38585	0.1046	N	0.12182	0.205	0.48341	D	0.999633	B	0.21753	0.06	B	0.17433	0.018	T	0.27434	-1.0074	10	0.38643	T	0.18	.	10.8637	0.46842	0.0:0.0697:0.0:0.9303	.	457	Q92560	BAP1_HUMAN	R	457;439	ENSP00000417132:K457R;ENSP00000296288:K439R	ENSP00000296288:K439R	K	-	2	0	BAP1	52412831	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.355000	0.52262	2.323000	0.78572	0.533000	0.62120	AAG	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1				-7	49						20		3	
TNIP1	10318	broad.mit.edu	hg19	5	150411884	150411884	+	Missense_Mutation	SNP	C	C	G			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr5:150411884C>G	ENST00000389378.2	-	17	2428	c.1840G>C	c.(1840-1842)Gtg>Ctg	p.V614L	TNIP1_ENST00000520931.1_Missense_Mutation_p.V561L|TNIP1_ENST00000521423.1_5'UTR|TNIP1_ENST00000315050.7_Missense_Mutation_p.V614L|TNIP1_ENST00000522226.1_Missense_Mutation_p.V614L|TNIP1_ENST00000518977.1_Missense_Mutation_p.V614L|TNIP1_ENST00000523200.1_Missense_Mutation_p.V550L|TNIP1_ENST00000524280.1_Intron|TNIP1_ENST00000521591.1_Missense_Mutation_p.V614L|TNIP1_ENST00000523338.1_Missense_Mutation_p.V614L	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	614	Pro-rich.	defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding	NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		GGGTCCATCACTTGGGAGCTC	0.517	0	99.0	92.0	94.0	5	150411884	2203	4300	6503	SO:0001583	missense	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18						16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714			9923610, 11090181	Standard	NM_001252385	Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1840G>C	5.37:g.150411884C>G	ENSP00000374029:p.Val614Leu	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	ENST00000389378.2	37	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314889	0.40996	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000523200	T;T;T;T;T;T;T;T	0.15256	2.44;2.47;2.47;2.45;2.47;2.47;2.45;2.48	3.83	2.95	0.34219	.	0.429335	0.23416	N	0.048402	T	0.21921	0.0528	M	0.63428	1.95	0.21064	N	0.999797	B;B;P;P	0.50443	0.122;0.122;0.849;0.935	B;B;P;P	0.48334	0.081;0.081;0.477;0.574	T	0.06285	-1.0835	10	0.38643	T	0.18	-18.1186	8.1111	0.30916	0.0:0.7433:0.1598:0.0969	.	504;550;614;614	A4F1X7;E7ET96;A4F1W9;Q15025	.;.;.;TNIP1_HUMAN	L	561;614;614;614;507;576;614;614;614;550	ENSP00000429891:V561L;ENSP00000374029:V614L;ENSP00000317891:V614L;ENSP00000428243:V614L;ENSP00000428187:V614L;ENSP00000430760:V614L;ENSP00000430971:V614L;ENSP00000431105:V550L	ENSP00000317891:V614L	V	-	1	0	TNIP1	150392077	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	1.468000	0.35332	0.589000	0.29677	-1.134000	0.01955	GTG	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1		46.449692	0	-14	29	0	0	1	0	NM_006058	14	46.457141	15	0.482759
VSIG10	54621	ucsc.edu	hg19	12	118533585	118533585	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032																										GAGTAACATTCTCATGAACTT	0.483	0	49.0	54.0	52.0	12	118533585	2041	4196	6237	SO:0001583	missense		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product					12477932	Standard	NM_019086	Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.114G>T	12.37:g.118533585C>A	ENSP00000352172:p.Glu38Asp	Q9NWQ7	ENST00000359236.5	37	CCDS44992.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.237621	0.22711	.	.	ENSG00000176834	ENST00000359236;ENST00000538357	T;T	0.22945	1.93;1.93	4.67	2.72	0.32119	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.411595	0.18800	N	0.130807	T	0.20088	0.0483	L	0.39692	1.235	0.09310	N	1	B	0.18166	0.026	B	0.23275	0.045	T	0.18366	-1.0339	10	0.49607	T	0.09	-11.6077	7.5988	0.28065	0.0:0.6495:0.2568:0.0938	.	38	Q8N0Z9	VSI10_HUMAN	D	38	ENSP00000352172:E38D;ENSP00000442861:E38D	ENSP00000352172:E38D	E	-	3	2	VSIG10	117017968	0.015000	0.18098	0.067000	0.19924	0.908000	0.53690	-0.141000	0.10327	0.562000	0.29204	0.655000	0.94253	GAG	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2				-3	22					NM_019086	4		14	
UBE2N	7334	broad.mit.edu	hg19	12	93804623	93804623	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr12:93804623C>T	ENST00000318066.2	-	3	682	c.305G>A	c.(304-306)cGc>cAc	p.R102H	UBE2N_ENST00000549833.1_Missense_Mutation_p.R39H|UBE2N_ENST00000550657.1_3'UTR|UBE2N_ENST00000552442.1_Intron	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	102		DNA double-strand break processing|double-strand break repair via homologous recombination|histone ubiquitination|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of DNA repair|positive regulation of histone modification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity|postreplication repair|protein K63-linked ubiquitination|proteolysis|regulation of histone ubiquitination|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-MMS2 complex|UBC13-UEV1A complex|ubiquitin ligase complex	ATP binding|ubiquitin binding|ubiquitin-protein ligase activity	endometrium(3)|liver(2)|lung(5)	10					CAGAACTGTGCGGATCTGCAG	0.498	0	112.0	98.0	103.0	12	93804623	2203	4300	6503	SO:0001583	missense	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889	"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""		8902611	Standard	NM_003348	Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000549833.1:c.116G>A	12.37:g.93804623C>T	ENSP00000450260:p.Arg39His	Q16781|Q53Y81	ENST00000549833.1	37		.	.	.	.	.	.	.	.	.	.	C	19.61	3.859080	0.71834	.	.	ENSG00000177889	ENST00000318066;ENST00000549833	T;T	0.38560	1.13;1.13	5.94	5.06	0.68205	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.52853	0.1760	M	0.86953	2.85	0.80722	D	1	B	0.28082	0.2	B	0.31390	0.129	T	0.57694	-0.7767	9	0.56958	D	0.05	.	15.1265	0.72486	0.0:0.9325:0.0:0.0675	.	102	P61088	UBE2N_HUMAN	H	102;39	ENSP00000316176:R102H;ENSP00000450260:R39H	ENSP00000316176:R102H	R	-	2	0	UBE2N	92328754	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.328000	0.79160	1.528000	0.49103	0.650000	0.86243	CGC	UBE2N-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000407712.1		-9.433165	0	0	125	0	0	1	0	NM_003348	3	6.537237	68	0.042254
KCNV1	27012	broad.mit.edu	hg19	8	110984746	110984746	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr8:110984746G>C	ENST00000524391.1	-	3	1764	c.732C>G	c.(730-732)atC>atG	p.I244M	KCNV1_ENST00000297404.1_Missense_Mutation_p.I244M			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	244			voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity	breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)		CATACTCCAGGATTTCCAGCA	0.522	0	75.0	68.0	71.0	8	110984746	2203	4300	6503	SO:0001583	missense	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164			8670833, 16382104	Standard	NM_014379	Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.732C>G	8.37:g.110984746G>C	ENSP00000435954:p.Ile244Met	Q9UHJ4	ENST00000524391.1	37	CCDS6314.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485236	0.26598	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.98792	-5.14;-5.14	5.55	2.75	0.32379	Ion transport (1);	0.435059	0.23896	N	0.043493	D	0.96706	0.8925	L	0.49513	1.565	0.31001	N	0.720293	B	0.32425	0.371	B	0.39119	0.291	D	0.94230	0.7475	10	0.23302	T	0.38	.	8.0752	0.30712	0.3116:0.0:0.6884:0.0	.	244	Q6PIU1	KCNV1_HUMAN	M	244;244;120	ENSP00000435954:I244M;ENSP00000297404:I244M	ENSP00000297404:I244M	I	-	3	3	KCNV1	111053922	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.981000	0.29526	0.682000	0.31407	0.557000	0.71058	ATC	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1		64.332866	0	-19	47	0	0	1	0	NM_014379	22	66.898657	51	0.301370
MYO1F	4542	broad.mit.edu	hg19	19	8620657	8620657	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr19:8620657C>T	ENST00000338257.8	-	2	294	c.27G>A	c.(25-27)tgG>tgA	p.W9*		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	9	Myosin head-like.		unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42					TGTGGCTCTGCCAGTGGAAGC	0.642	0	63.0	69.0	67.0	19	8620657	2063	4203	6266	SO:0001587	stop_gained	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347	"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480			9119401, 8884266	Standard	NM_012335	Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.27G>A	19.37:g.8620657C>T	ENSP00000344871:p.Trp9*	Q8WWN7	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	C	37	6.115757	0.97296	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	.	.	.	3.98	3.98	0.46160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8059	0.69956	0.0:1.0:0.0:0.0	.	.	.	.	X	54;9	.	ENSP00000304899:W54X	W	-	3	0	MYO1F	8526657	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.393000	0.79851	2.059000	0.61396	0.455000	0.32223	TGG	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		1.510549	0	-17	39	0	0	1	0		3	6.554616	28	0.096774
PRELID1P1	0	broad.mit.edu	hg19	6	126965451	126965453	+	RNA	DEL	CCA	CCA	-			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr6:126965451_126965453delCCA	ENST00000567272.1	+	0	818_820																					TGTAGCCAGCCCACCACCACCAC	0.552	0													6q22.32	2012-04-23			ENSG00000217325	ENSG00000217325		43886	pseudogene	pseudogene						Standard	NG_022903	Approved				OTTHUMG00000015520		6.37:g.126965460_126965462delCCA			ENST00000567272.1	37																																																																																				PRELID1P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000436205.1	.	.		-1	8					NG_022903	2		4	0.33
AP2M1	1173	broad.mit.edu	hg19	3	183894841	183894841	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr3:183894841delC	ENST00000382456.3	+	2	374	c.60delC	c.(58-60)tacfs	p.Y20fs	AP2M1_ENST00000292807.5_Frame_Shift_Del_p.Y20fs|AP2M1_ENST00000439647.1_Frame_Shift_Del_p.Y20fs|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000411763.2_Frame_Shift_Del_p.Y20fs	NM_001025205.1	NP_001020376.1	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	20		axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity	endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		CCCGAGTCTACCGAGATGACA	0.587	0	40.0	45.0	43.0	3	183894841	2021	4190	6211	SO:0001589	frameshift_variant	U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203		564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1	8595912	Standard	NM_004068	Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000382456.3:c.60delC	3.37:g.183894841delC	ENSP00000371894:p.Tyr20fs	A6NE12|D3DNT1|P20172|P53679	ENST00000382456.3	37	CCDS43178.1																																																																																			AP2M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346011.1	.	.		3	23					NM_004068	2		4	0.33
TYRP1	7306	broad.mit.edu	hg19	9	12704605	12704606	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr9:12704605_12704606insGG	ENST00000388918.5	+	6	1290_1291	c.1161_1162insGG	c.(1162-1164)gggfs	p.G388fs	TYRP1_ENST00000381136.2_Frame_Shift_Ins_p.G98fs|RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381137.2_Frame_Shift_Ins_p.G97fs	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	388		melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity	NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)	TGAATGGAACAGGGGGACAAAC	0.465	1									SO:0001589	frameshift_variant	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165		12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2	9434945	Standard	NM_000550	Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.1164_1165dupGG	9.37:g.12704608_12704609dupGG	ENSP00000373570:p.Gly388fs	P78468|P78469|Q13721|Q15679	ENST00000388918.5	37	CCDS34990.1																																																																																			TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	.	.		12	93					NM_000550	22		70	0.23
BAP1	8314	broad.mit.edu	hg19	3	52437795	52437795	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V4-A9F0-01A-11D-A39W-08	TCGA-V4-A9F0-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5f288b49-acca-40d6-ac9a-cac04d1f87e5	f87d55ec-e854-405b-8e88-18e4ef68e032	g.chr3:52437795delG	ENST00000460680.1	-	13	1837	c.1366delC	c.(1366-1368)cagfs	p.Q456fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.Q438fs	NM_004656.2	NP_004647.1	Q92560	BAP1_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	456		monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	AGGTCCTTCTGGGACTCTTTG	0.597	0	77.0	79.0	78.0	3	52437795	2203	4300	6503	SO:0001589	frameshift_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1366delC	3.37:g.52437795delG	ENSP00000417132:p.Gln456fs	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	.	.		-9	47						20		4	0.83
