Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
BMP6	654	broad.mit.edu	hg19	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118		BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)				cagcagcagcagcTGCCTCGC	0.731	1									SO:0001583	missense	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162	"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR	1427904, 1453478	Standard	NM_001718	Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	6.37:g.7727541A>T	ENSP00000283147:p.Gln118Leu	Q5TCP3	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1		3.103468	0	-15	11	0	0	1	0	NM_001718	3	7.643600	26	0.103448
ZNF555	148254	broad.mit.edu	hg19	19	2852695	2852695	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr19:2852695G>A	ENST00000334241.4	+	4	770	c.632G>A	c.(631-633)cGt>cAt	p.R211H	ZNF555_ENST00000591539.1_Missense_Mutation_p.R210H|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	211		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	ACCTTTCCTCGTACTTCCTCC	0.448	1	126.0	106.0	112.0	19	2852695	2203	4300	6503	SO:0001583	missense	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300	"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product					12477932	Standard	NM_152791	Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000591539.1:c.629G>A	19.37:g.2852695G>A	ENSP00000467893:p.Arg210His	A8KA89|K7EQM2|Q8NA46|Q96MP1	ENST00000591539.1	37	CCDS59329.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316525	0.23908	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.36340	1.26	3.4	0.557	0.17260	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12860	0.0312	N	0.03917	-0.325	0.09310	N	1	B;B	0.24920	0.045;0.114	B;B	0.15052	0.007;0.012	T	0.30090	-0.9990	9	0.15952	T	0.53	.	5.2387	0.15460	0.1361:0.384:0.4798:0.0	.	211;210	Q8NEP9;A8KA89	ZN555_HUMAN;.	H	211;210	ENSP00000334853:R211H	ENSP00000334853:R211H	R	+	2	0	ZNF555	2803695	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-2.943000	0.00682	0.096000	0.17463	0.561000	0.74099	CGT	ZNF555-003	NOVEL	NAGNAG_splice_site|basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000452242.2		78.333283	0	-31	83	0	0	1	0	NM_152791	26	79.252247	43	0.376812
BPI	671	broad.mit.edu	hg19	20	36954747	36954747	+	Silent	SNP	C	C	G			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr20:36954747C>G	ENST00000262865.4	+	10	1175	c.1086C>G	c.(1084-1086)acC>acG	p.T362T	BPI_ENST00000489102.1_3'UTR|CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	362		defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding	kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			TGCAGCCCACCGGCCTTACCT	0.592	0	90.0	72.0	78.0	20	36954747	2203	4300	6503	SO:0001819	synonymous_variant	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425	"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195			8432532	Standard	NM_001725	Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.1086C>G	20.37:g.36954747C>G		B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	ENST00000262865.4	37	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	C	3.442	-0.113799	0.06881	.	.	ENSG00000101425	ENST00000417318	.	.	.	4.52	-9.05	0.00730	.	.	.	.	.	T	0.15955	0.0384	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.09574	-1.0668	4	.	.	.	-0.0388	2.7084	0.05167	0.2925:0.3936:0.0742:0.2397	.	.	.	.	R	188	.	.	P	+	2	0	BPI	36388161	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-6.459000	0.00065	-3.126000	0.00237	-0.128000	0.14901	CCG	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2		21.923407	0	6	32	0	0	1	0	NM_001725	7	21.977753	9	0.437500
PRDM4	11108	broad.mit.edu	hg19	12	108133200	108133200	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr12:108133200G>A	ENST00000228437.5	-	11	2512	c.2053C>T	c.(2053-2055)Cgg>Tgg	p.R685W	RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	685		cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20					TCCTGCCTCCGCATAAACAAC	0.517	0	183.0	145.0	158.0	12	108133200	2203	4300	6503	SO:0001583	missense	AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851	"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780			10552934	Standard	NM_012406	Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.2053C>T	12.37:g.108133200G>A	ENSP00000228437:p.Arg685Trp	Q9UFA6	ENST00000228437.5	37	CCDS9115.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604815	0.87157	.	.	ENSG00000110851	ENST00000228437	T	0.08008	3.14	5.44	5.44	0.79542	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.051322	0.85682	D	0.000000	T	0.20981	0.0505	L	0.31804	0.96	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.01087	-1.1456	10	0.59425	D	0.04	-3.5745	19.2785	0.94042	0.0:0.0:1.0:0.0	.	685	Q9UKN5	PRDM4_HUMAN	W	685	ENSP00000228437:R685W	ENSP00000228437:R685W	R	-	1	2	PRDM4	106657330	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.220000	0.58567	2.541000	0.85698	0.650000	0.86243	CGG	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1		-2.011866	0	-25	40	0	0	1	0	NM_012406	3	6.477655	41	0.068182
RAB38	23682	broad.mit.edu	hg19	11	87882992	87882992	+	Missense_Mutation	SNP	A	A	C			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr11:87882992A>C	ENST00000243662.6	-	2	416	c.334T>G	c.(334-336)Tta>Gta	p.L112V		NM_022337.2	NP_071732.1	P57729	RAB38_HUMAN	RAB38, member RAS oncogene family	112		protein transport|small GTPase mediated signal transduction	melanosome|plasma membrane	GTP binding|GTPase activity	large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)			GGGAGACTTAACTTGGAGTCC	0.463	0	185.0	179.0	181.0	11	87882992	2201	4299	6500	SO:0001583	missense	AF235022	CCDS8281.1	11q14	2008-05-14			ENSG00000123892	ENSG00000123892	"""RAB, member RAS oncogene"""	9776	protein-coding gene	gene with protein product		606281			10910072	Standard	NM_022337	Approved	NY-MEL-1	uc001pcj.2	P57729	OTTHUMG00000167288	ENST00000243662.6:c.334T>G	11.37:g.87882992A>C	ENSP00000243662:p.Leu112Val	Q53XK7	ENST00000243662.6	37	CCDS8281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.483|0.483	-0.878893|-0.878893	0.02550|0.02550	.|.	.|.	ENSG00000123892|ENSG00000123892	ENST00000243662|ENST00000526372	T|.	0.76578|.	-1.03|.	5.38|5.38	4.25|4.25	0.50352|0.50352	Small GTP-binding protein domain (1);|.	0.149194|.	0.41823|.	D|.	0.000805|.	T|T	0.18045|0.18045	0.0433|0.0433	N|N	0.01048|0.01048	-1.04|-1.04	0.53688|0.53688	D|D	0.999979|0.999979	B|.	0.06786|.	0.001|.	B|.	0.11329|.	0.006|.	T|T	0.06991|0.06991	-1.0796|-1.0796	9|5	.|.	.|.	.|.	-10.546|-10.546	9.8389|9.8389	0.40987|0.40987	0.857:0.0:0.143:0.0|0.857:0.0:0.143:0.0	.|.	112|.	P57729|.	RAB38_HUMAN|.	V|G	112|110	ENSP00000243662:L112V|.	.|.	L|V	-|-	1|2	2|0	RAB38|RAB38	87522640|87522640	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.914000|0.914000	0.54420|0.54420	2.614000|2.614000	0.46359|0.46359	0.892000|0.892000	0.36259|0.36259	-0.353000|-0.353000	0.07706|0.07706	TTA|GTT	RAB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394015.2		121.233052	0	-46	131	0	0	1	0		41	124.902941	87	0.320312
PDGFRA	5156	broad.mit.edu	hg19	4	55153609	55153609	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr4:55153609G>A	ENST00000257290.5	+	19	2906	c.2575G>A	c.(2575-2577)Gtg>Atg	p.V859M	FIP1L1_ENST00000507166.1_Missense_Mutation_p.V619M	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	859	Protein kinase.	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		CTTTCTGCCCGTGAAGTGGAT	0.502	0	250.0	229.0	236.0	4	55153609	2203	4300	6503	SO:0001583	missense	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490				Standard	NM_006206	Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2575G>A	4.37:g.55153609G>A	ENSP00000257290:p.Val859Met	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027316	0.93518	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	D;D	0.84589	-1.87;-1.87	5.84	5.84	0.93424	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.29522	U	0.011903	D	0.90103	0.6908	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	D	0.90334	0.4354	10	0.87932	D	0	.	20.1466	0.98079	0.0:0.0:1.0:0.0	.	859	P16234	PGFRA_HUMAN	M	619;859	ENSP00000423325:V619M;ENSP00000257290:V859M	ENSP00000423325:V619M	V	+	1	0	FIP1L1;PDGFRA	54848366	1.000000	0.71417	0.982000	0.44146	0.935000	0.57460	7.795000	0.85887	2.779000	0.95612	0.591000	0.81541	GTG	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2		66.429028	0	-22	117	0	0	1	0	NM_006206	25	72.108576	75	0.250000
FLNC	2318	broad.mit.edu	hg19	7	128486478	128486478	+	Missense_Mutation	SNP	G	G	C			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr7:128486478G>C	ENST00000325888.8	+	23	4349	c.4088G>C	c.(4087-4089)gGc>gCc	p.G1363A	FLNC_ENST00000346177.6_Missense_Mutation_p.G1363A	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1363		cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128					CTGGAGGGTGGCTTGGTCAAC	0.627	0	51.0	57.0	55.0	7	128486478	2057	4176	6233	SO:0001583	missense	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591		3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2	7689010, 8088838	Standard	NM_001458	Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4088G>C	7.37:g.128486478G>C	ENSP00000327145:p.Gly1363Ala	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287808	0.40494	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.91631	-2.88;-2.88	5.07	5.07	0.68467	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92522	0.7625	L	0.31120	0.905	0.58432	D	0.99999	D;B	0.89917	1.0;0.08	D;B	0.91635	0.999;0.252	D	0.90047	0.4146	10	0.18710	T	0.47	.	15.114	0.72384	0.0:0.1521:0.8479:0.0	.	1363;1363	Q14315-2;Q14315	.;FLNC_HUMAN	A	1363	ENSP00000327145:G1363A;ENSP00000344002:G1363A	ENSP00000327145:G1363A	G	+	2	0	FLNC	128273714	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	4.802000	0.62539	2.360000	0.80028	0.555000	0.69702	GGC	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		36.860630	0	1	65	0	0	1	0		13	38.080353	28	0.317073
IGHG3	0	broad.mit.edu	hg19	14	106235678	106235678	+	RNA	SNP	T	T	C			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr14:106235678T>C	ENST00000390551.2	-	0	1028																					CACCTGCTCTTGTCCACGGTG	0.597	0	172.0	188.0	183.0	14	106235678	2077	4223	6300			M12958		14q32.33	2012-10-02			ENSG00000211897	ENSG00000211897	"""Immunoglobulins / IGH locus"""	5527	other	immunoglobulin gene		147120			6808505	Standard	NG_001019	Approved			P01860	OTTHUMG00000152539		14.37:g.106235678T>C		A2NU35	ENST00000390551.2	37																																																																																				IGHG3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene	OTTHUMT00000326654.1		-19.641624	0	-64	181	0	0	1	0	NG_001019	8	15.582082	155	0.049080
P2RX1	5023	hgsc.bcm.edu	hg19	17	3802232	3802232	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45																										ACTCACCTTGCCGTCCACCAG	0.532	0	209.0	162.0	178.0	17	3802232	2203	4300	6503	SO:0001583	missense	X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405	"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845			8834001	Standard	NM_002558	Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.962G>A	17.37:g.3802232C>T	ENSP00000225538:p.Gly321Asp	Q9UK84	ENST00000225538.3	37	CCDS11040.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302093	0.81136	.	.	ENSG00000108405	ENST00000225538	T	0.21031	2.03	4.44	4.44	0.53790	.	0.113110	0.64402	D	0.000017	T	0.55273	0.1910	M	0.91972	3.26	0.58432	D	0.999992	D	0.89917	1.0	D	0.80764	0.994	T	0.67538	-0.5645	10	0.87932	D	0	-15.6533	16.5954	0.84795	0.0:1.0:0.0:0.0	.	321	P51575	P2RX1_HUMAN	D	321	ENSP00000225538:G321D	ENSP00000225538:G321D	G	-	2	0	P2RX1	3748981	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.827000	0.69300	2.462000	0.83206	0.561000	0.74099	GGC	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438391.1				-30	136					NM_002558	6		143	
RGL4	266747	ucsc.edu	hg19	22	24036582	24036582	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45																										CATCGTCTCTGCTCTGTGCAG	0.567	0	157.0	104.0	122.0	22	24036582	2203	4300	6503	SO:0001583	missense		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496		31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214			9178890, 10851075	Standard	NM_153615	Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000401461.1:c.553G>T	22.37:g.24036582G>T	ENSP00000383951:p.Ala185Ser	Q495L8	ENST00000401461.1	37		.	.	.	.	.	.	.	.	.	.	g	20.2	3.947389	0.73672	.	.	ENSG00000159496	ENST00000401461;ENST00000290691;ENST00000382833;ENST00000423392	T;T;T	0.40476	1.03;1.03;1.03	2.07	2.07	0.26955	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.223543	0.30969	N	0.008504	T	0.57095	0.2030	M	0.65498	2.005	0.34186	D	0.671476	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.71656	0.974;0.961;0.974;0.974	T	0.69986	-0.4996	10	0.87932	D	0	.	10.2172	0.43175	0.0:0.0:1.0:0.0	.	185;185;321;321	E7EW79;Q495L8;E9PH87;Q8IZJ4	.;.;.;RGDSR_HUMAN	S	185;321;321;321	ENSP00000383951:A185S;ENSP00000290691:A321S;ENSP00000402142:A321S	ENSP00000290691:A321S	A	+	1	0	RGL4	22366582	1.000000	0.71417	0.023000	0.16930	0.011000	0.07611	6.042000	0.70996	1.471000	0.48121	0.537000	0.68136	GCT	RGL4-003	PUTATIVE	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000319712.2				-24	22					NM_153615	4		21	
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		66.238237	0	-28	53	0	0	1	0	NM_002067	22	66.800936	34	0.392857
FGF18	8817	broad.mit.edu	hg19	5	170863117	170863117	+	Silent	SNP	C	C	T			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr5:170863117C>T	ENST00000274625.5	+	3	634	c.90C>T	c.(88-90)aaC>aaT	p.N30N		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	30		cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding	endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		CCGAGGAGAACGTGGACTTCC	0.632	0	70.0	61.0	64.0	5	170863117	2203	4300	6503	SO:0001819	synonymous_variant	AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427		3674	protein-coding gene	gene with protein product		603726			9660775, 9742123	Standard	NM_003862	Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.90C>T	5.37:g.170863117C>T		D3DQL7|Q6UWF1	ENST00000274625.5	37	CCDS4378.1																																																																																			FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252857.2		15.604818	0	-13	14	0	0	1	0	NM_033649, NM_003862	7	18.534876	28	0.200000
IGSF9	57549	broad.mit.edu	hg19	1	159901298	159901298	+	Silent	SNP	G	G	A			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr1:159901298G>A	ENST00000368094.1	-	12	1655	c.1458C>T	c.(1456-1458)tgC>tgT	p.C486C	IGSF9_ENST00000493195.1_Intron|IGSF9_ENST00000361509.3_Silent_p.C470C	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	486	Ig-like 5.		cell junction|integral to membrane|synapse		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)		TGCTGGCACTGCATTCCCAGT	0.642	0	56.0	56.0	56.0	1	159901298	2203	4300	6503	SO:0001819	synonymous_variant	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738			11991715	Standard	NM_020789	Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1458C>T	1.37:g.159901298G>A			ENST00000368094.1	37	CCDS44254.1																																																																																			IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1		0.102506	0	-4	37	0	0	1	0	NM_020789	3	6.712379	34	0.081081
PCGF6	84108	broad.mit.edu	hg19	10	105073982	105073983	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V4-A9F3-01A-11D-A39W-08	TCGA-V4-A9F3-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	db55542d-beda-4fca-940d-069ce03a806b	fc14e8c5-08c0-42ef-b693-432d1b2aed45	g.chr10:105073982_105073983insA	ENST00000369847.3	-	9	1023_1024	c.956_957insT	c.(955-957)ctafs	p.L319fs	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Frame_Shift_Ins_p.L244fs	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	319		negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)	GGATTTCCCTTAGAGTTTGATA	0.381	0									SO:0001589	frameshift_variant	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374	"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134	12167161	Standard	NM_032154	Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.957dupT	10.37:g.105073983_105073983dupA	ENSP00000358862:p.Leu319fs	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	ENST00000369847.3	37	CCDS31275.1																																																																																			PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	.	.		-18	91					NM_032154	33		84	0.28
