Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
DNAH11	8701	broad.mit.edu	hg19	7	21611562	21611562	+	Missense_Mutation	SNP	A	A	G	rs34832072		TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr7:21611562A>G	ENST00000328843.6	+	8	1595	c.1564A>G	c.(1564-1566)Act>Gct	p.T522A	DNAH11_ENST00000409508.3_Missense_Mutation_p.T522A			Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	522	Stem (By similarity).	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230					TAAACAGAGCACTTATGACCC	0.368	0	74.0	73.0	73.0	7	21611562	1844	4079	5923	SO:0001583	missense	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04				"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""		9256245	Standard	NM_001277115	Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.1564A>G	7.37:g.21611562A>G	ENSP00000475939:p.Thr522Ala	Q9UJ82	ENST00000409508.3	37		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	A	8.997	0.979171	0.18812	5.42E-4	0.0	ENSG00000105877	ENST00000328843	T	0.56444	0.46	5.36	5.36	0.76844	Dynein heavy chain, domain-1 (1);	0.517458	0.19639	N	0.109488	T	0.50888	0.1642	M	0.66297	2.02	0.32812	D	0.501522	B	0.16802	0.019	B	0.22152	0.038	T	0.56962	-0.7892	10	0.14252	T	0.57	.	14.3138	0.66434	1.0:0.0:0.0:0.0	.	522	Q96DT5	DYH11_HUMAN	A	522	ENSP00000330671:T522A	ENSP00000330671:T522A	T	+	1	0	DNAH11	21578087	0.085000	0.21516	0.986000	0.45419	0.674000	0.39518	1.208000	0.32345	2.026000	0.59711	0.533000	0.62120	ACT	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6		33.953627	0	6	35	0	0	1	0	NM_003777	10	34.173038	6	0.625000
GNB1	2782	broad.mit.edu	hg19	1	1735887	1735887	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr1:1735887C>T	ENST00000378609.4	-	7	732	c.401G>A	c.(400-402)cGc>cAc	p.R134H		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	134		cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity	breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)	ACGACTCACGCGCACGTTCCC	0.493	0	79.0	69.0	72.0	1	1735887	2203	4300	6503	SO:0001583	missense	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369	"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380				Standard	NM_002074	Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.401G>A	1.37:g.1735887C>T	ENSP00000367872:p.Arg134His	B1AJZ7|P04697|P04901|Q1RMY8	ENST00000378609.4	37	CCDS34.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078615	0.76528	.	.	ENSG00000078369	ENST00000378609;ENST00000455156;ENST00000378606;ENST00000434686;ENST00000439272	T;T;T	0.01388	4.95;4.95;4.95	5.52	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053601	0.64402	D	0.000001	T	0.02727	0.0082	L	0.48218	1.51	0.80722	D	1	P	0.46952	0.887	P	0.45660	0.489	T	0.57476	-0.7805	10	0.66056	D	0.02	-16.9547	13.3066	0.60355	0.0:0.9242:0.0:0.0758	.	134	P62873	GBB1_HUMAN	H	134;34;134;134;121	ENSP00000367872:R134H;ENSP00000392765:R134H;ENSP00000399741:R121H	ENSP00000367869:R134H	R	-	2	0	GNB1	1725747	1.000000	0.71417	0.462000	0.27118	0.642000	0.38348	7.556000	0.82233	1.335000	0.45486	0.655000	0.94253	CGC	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3		47.993721	0	12	56	0	0	1	0	NM_002074	16	48.200317	22	0.421053
PSIP1	11168	broad.mit.edu	hg19	9	15506612	15506612	+	Silent	SNP	A	A	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr9:15506612A>T	ENST00000380733.4	-	3	439	c.96T>A	c.(94-96)gcT>gcA	p.A32A	PSIP1_ENST00000397519.2_Silent_p.A32A|PSIP1_ENST00000380716.4_Silent_p.A32A|PSIP1_ENST00000380738.4_Silent_p.A32A|PSIP1_ENST00000380715.1_Silent_p.A32A|PSIP1_ENST00000484265.1_5'UTR			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	32	PWWP.	initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity	breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)	GTGGCTTTACAGCTCCATCAG	0.348	0	106.0	113.0	110.0	9	15506612	2203	4300	6503	SO:0001819	synonymous_variant	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985		9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2	9822615, 9885563	Standard	NM_033222	Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.96T>A	9.37:g.15506612A>T		D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	ENST00000380733.4	37	CCDS6479.1																																																																																			PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1		-7.331429	0	13	85	0	0	1	0	NM_033222	3	6.674917	61	0.046875
PTPRD	5789	broad.mit.edu	hg19	9	8389348	8389348	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr9:8389348C>T	ENST00000381196.4	-	34	4813	c.4270G>A	c.(4270-4272)Gcc>Acc	p.A1424T	PTPRD_ENST00000537002.1_Missense_Mutation_p.A1014T|PTPRD_ENST00000486161.1_Missense_Mutation_p.A1017T|PTPRD_ENST00000397606.3_Missense_Mutation_p.A1017T|PTPRD_ENST00000360074.4_Missense_Mutation_p.A1411T|PTPRD_ENST00000355233.5_Missense_Mutation_p.A1018T|PTPRD_ENST00000358503.5_Missense_Mutation_p.A1402T|PTPRD_ENST00000397617.3_Missense_Mutation_p.A1017T|PTPRD_ENST00000540109.1_Missense_Mutation_p.A1424T|PTPRD_ENST00000397611.3_Missense_Mutation_p.A1014T|PTPRD_ENST00000356435.5_Missense_Mutation_p.A1424T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1424	Tyrosine-protein phosphatase 1.	transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	GCAATATAGGCATTTTGCTTC	0.443	0	190.0	178.0	182.0	9	8389348	2203	4300	6503	SO:0001583	missense	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598			7896816, 8355697	Standard	NM_002839	Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4270G>A	9.37:g.8389348C>T	ENSP00000370593:p.Ala1424Thr	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	35	5.535045	0.96460	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.65	5.65	0.86999	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.58623	0.2135	M	0.73430	2.235	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.998;0.998;0.998;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.975;0.987;0.987;0.987;0.993;0.977;0.993;0.999;0.998	T	0.56366	-0.7991	9	.	.	.	.	19.7173	0.96127	0.0:1.0:0.0:0.0	.	1017;1008;1017;1018;1014;1014;1411;1424;1424	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	1424;1424;1411;1402;1018;1017;1014;1014;895;1424;1017;1017	ENSP00000370593:A1424T;ENSP00000348812:A1424T;ENSP00000353187:A1411T;ENSP00000351293:A1402T;ENSP00000347373:A1018T;ENSP00000380741:A1017T;ENSP00000380735:A1014T;ENSP00000440515:A1014T;ENSP00000438164:A1424T;ENSP00000417093:A1017T;ENSP00000380731:A1017T	.	A	-	1	0	PTPRD	8379348	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.776000	0.85560	2.661000	0.90470	0.555000	0.69702	GCC	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		2.593658	0	14	126	0	0	1	0		9	19.821060	92	0.089109
NHS	4810	broad.mit.edu	hg19	X	17744069	17744069	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chrX:17744069G>A	ENST00000380060.3	+	6	2118	c.1780G>A	c.(1780-1782)Gtc>Atc	p.V594I	NHS_ENST00000398097.3_Missense_Mutation_p.V438I	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	594			nucleus		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)				CACGGCTGGCGTCCTCCTTAG	0.592	0	76.0	62.0	67.0	X	17744069	2203	4300	6503	SO:0001583	missense		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158		7820	protein-coding gene	gene with protein product		300457				Standard	NM_001136024	Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.1780G>A	X.37:g.17744069G>A	ENSP00000369400:p.Val594Ile	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900314	0.52227	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.48201	0.82;0.84	5.86	5.0	0.66597	.	0.170372	0.51477	D	0.000094	T	0.60689	0.2288	M	0.66939	2.045	0.51482	D	0.999925	P;B;B;D	0.71674	0.48;0.178;0.178;0.998	B;B;B;P	0.58130	0.071;0.042;0.042;0.833	T	0.59867	-0.7373	10	0.33940	T	0.23	-12.6421	14.0633	0.64812	0.0738:0.0:0.9262:0.0	.	615;436;438;594	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	I	594;438;436	ENSP00000369400:V594I;ENSP00000381170:V438I	ENSP00000369397:V436I	V	+	1	0	NHS	17653990	1.000000	0.71417	0.841000	0.33234	0.764000	0.43329	9.476000	0.97823	1.235000	0.43724	0.600000	0.82982	GTC	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1		136.520751	0	10	108	0	0	1	0	NM_198270	43	136.605540	49	0.467391
SCRIB	23513	broad.mit.edu	hg19	8	144887324	144887324	+	Silent	SNP	A	A	G			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr8:144887324A>G	ENST00000356994.2	-	19	2634	c.2628T>C	c.(2626-2628)atT>atC	p.I876I	SCRIB_ENST00000320476.3_Silent_p.I876I|SCRIB_ENST00000377533.3_Silent_p.I795I	NM_182706.4	NP_874365	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	876	Interaction with ARHGEF7.|PDZ 2.	activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding	NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)		TCCCACCAGCAATGCTGAAGC	0.721	0	9.0	11.0	11.0	8	144887324	2072	4184	6256	SO:0001819	synonymous_variant	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900		30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""		11027293, 14681682	Standard	NM_182706	Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000356994.2:c.2628T>C	8.37:g.144887324A>G		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	ENST00000356994.2	37	CCDS6412.1																																																																																			SCRIB-002	NOVEL	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382214.2		6.516331	0	-10	20	0	0	1	0	NM_015356	3	7.772127	12	0.200000
PSD3	23362	broad.mit.edu	hg19	8	18729316	18729316	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr8:18729316G>T	ENST00000440756.2	-	3	1160	c.1058C>A	c.(1057-1059)tCa>tAa	p.S353*	PSD3_ENST00000523619.1_Nonsense_Mutation_p.S288*|PSD3_ENST00000327040.8_Nonsense_Mutation_p.S353*			Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	353		regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity	endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)	TAAACTACTTGAATTACACAA	0.468	0	140.0	140.0	140.0	8	18729316	2002	4179	6181	SO:0001587	stop_gained	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011	"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440				Standard	NM_206909	Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1058C>A	8.37:g.18729316G>T	ENSP00000324127:p.Ser353*	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445975	0.84101	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000523619	.	.	.	5.49	4.61	0.57282	.	0.908148	0.09099	N	0.848816	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0009	0.41929	0.0929:0.0:0.9071:0.0	.	.	.	.	X	353;353;288	.	ENSP00000324127:S353X	S	-	2	0	PSD3	18773596	0.374000	0.25081	0.007000	0.13788	0.026000	0.11368	2.036000	0.41165	1.322000	0.45245	0.563000	0.77884	TCA	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1		-6.226506	1	15	93	0	0.115264	1	0.115264	NM_015310	3	6.384103	56	0.050847
EIF1AX	1964	broad.mit.edu	hg19	X	20156713	20156713	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chrX:20156713C>T	ENST00000379607.5	-	2	247	c.44G>A	c.(43-45)gGt>gAt	p.G15D	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	15			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					CTCATTCTTACCCCTGCGTCT	0.308	0	164.0	152.0	156.0	X	20156713	2203	4300	6503	SO:0001583	missense	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.44G>A	X.37:g.20156713C>T	ENSP00000368927:p.Gly15Asp	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551056	0.65311	.	.	ENSG00000173674	ENST00000379607	T	0.45276	0.9	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.75953	0.3920	H	0.96175	3.78	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.85102	0.0958	9	0.87932	D	0	-6.0481	17.661	0.88193	0.0:1.0:0.0:0.0	.	15	P47813	IF1AX_HUMAN	D	15	ENSP00000368927:G15D	ENSP00000368927:G15D	G	-	2	0	EIF1AX	20066634	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGT	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		39.163719	0	23	211	0	0	1	0		16	43.707518	53	0.231884
XRCC3	7517	broad.mit.edu	hg19	14	104169547	104169547	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr14:104169547A>G	ENST00000553264.1	-	5	1320	c.524T>C	c.(523-525)tTt>tCt	p.F175S	XRCC3_ENST00000555832.1_5'UTR|XRCC3_ENST00000554913.1_Missense_Mutation_p.F175S|XRCC3_ENST00000352127.7_Missense_Mutation_p.F175S|XRCC3_ENST00000445556.1_Missense_Mutation_p.F175S|XRCC3_ENST00000555055.1_Missense_Mutation_p.F175S|XRCC3_ENST00000554974.1_Intron			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	175		DNA recombination|DNA repair	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity	endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)	CTGGCTGCCAAATCGGAGCTT	0.617	0	56.0	44.0	48.0	14	104169547	2197	4293	6490	SO:0001583	missense	AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215		12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675			7603995	Standard	NM_001100118	Approved		uc001ynz.4	O43542		ENST00000553264.1:c.524T>C	14.37:g.104169547A>G	ENSP00000451974:p.Phe175Ser	O43568|Q9BU18	ENST00000553264.1	37	CCDS9984.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029618	0.54790	.	.	ENSG00000126215	ENST00000554913;ENST00000352127;ENST00000553264;ENST00000555055;ENST00000445556	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	4.7	3.55	0.40652	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	L	0.53617	1.68	0.58432	D	0.999999	P	0.46912	0.886	P	0.56474	0.799	T	0.46965	-0.9153	10	0.52906	T	0.07	-13.2926	10.0182	0.42027	0.9181:0.0:0.0819:0.0	.	175	O43542	XRCC3_HUMAN	S	175	ENSP00000451362:F175S;ENSP00000343392:F175S;ENSP00000451974:F175S;ENSP00000452598:F175S;ENSP00000412990:F175S	ENSP00000343392:F175S	F	-	2	0	XRCC3	103239300	1.000000	0.71417	0.003000	0.11579	0.006000	0.05464	6.989000	0.76219	0.637000	0.30526	-0.411000	0.06167	TTT	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414631.1		22.825393	0	-9	13	0	0	1	0	NM_005432	7	22.825393	7	0.500000
OR51L1	119682	broad.mit.edu	hg19	11	5020297	5020297	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr11:5020297C>A	ENST00000321543.1	+	1	85	c.85C>A	c.(85-87)Ctc>Atc	p.L29I		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	29		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	TCATTCTTGGCTCTCCATCCT	0.433	0	238.0	219.0	225.0	11	5020297	2201	4298	6499	SO:0001583	missense	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798	"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product						Standard	NM_001004755	Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.85C>A	11.37:g.5020297C>A	ENSP00000322156:p.Leu29Ile	Q6IFE5	ENST00000321543.1	37	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.982072	0.00448	.	.	ENSG00000176798	ENST00000321543	T	0.16457	2.34	5.58	3.71	0.42584	.	0.185056	0.26331	N	0.024985	T	0.05410	0.0143	N	0.03281	-0.365	0.22858	N	0.998647	B	0.18013	0.025	B	0.21360	0.034	T	0.42241	-0.9463	10	0.02654	T	1	.	5.5935	0.17313	0.145:0.64:0.14:0.075	.	29	Q8NGJ5	O51L1_HUMAN	I	29	ENSP00000322156:L29I	ENSP00000322156:L29I	L	+	1	0	OR51L1	4976873	0.711000	0.27906	0.998000	0.56505	0.035000	0.12851	-0.201000	0.09464	0.903000	0.36546	-0.175000	0.13238	CTC	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1		-3.212275	1	4	112	0	0.00198382	1	0.00207007	NM_001004755	7	15.031318	90	0.072165
AZI1	22994	broad.mit.edu	hg19	17	79166611	79166611	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr17:79166611G>A	ENST00000269392.4	-	19	2610	c.2363C>T	c.(2362-2364)gCg>gTg	p.A788V	AZI1_ENST00000374782.3_Intron|AZI1_ENST00000450824.2_Missense_Mutation_p.A785V|AZI1_ENST00000575907.1_Intron	NM_014984.2	NP_055799.2	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1	788		cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		ctgctgcagcgcccactgctc	0.736	0	14.0	17.0	16.0	17	79166611	2093	4201	6294	SO:0001583	missense																									ENST00000450824.2:c.2354C>T	17.37:g.79166611G>A	ENSP00000393583:p.Ala785Val	A6NHI8|B2RN11|Q96F50	ENST00000450824.2	37	CCDS45808.1	.	.	.	.	.	.	.	.	.	.	G	7.075	0.569045	0.13560	.	.	ENSG00000141577	ENST00000450824;ENST00000269392	T;T	0.15952	2.38;2.39	3.32	1.19	0.21007	.	0.153292	0.43260	N	0.000586	T	0.13114	0.0318	L	0.48362	1.52	0.80722	D	1	B;B	0.29378	0.243;0.045	B;B	0.23419	0.046;0.012	T	0.08207	-1.0733	10	0.42905	T	0.14	-8.9622	8.3592	0.32348	0.2079:0.0:0.7921:0.0	.	788;785	Q9UPN4;Q9UPN4-2	AZI1_HUMAN;.	V	785;788	ENSP00000393583:A785V;ENSP00000269392:A788V	ENSP00000269392:A788V	A	-	2	0	AZI1	76781206	0.961000	0.32948	0.543000	0.28128	0.547000	0.35210	2.848000	0.48278	0.110000	0.17919	-0.444000	0.05651	GCG	AZI1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439201.1		28.035555	0	11	44	0	0	1	0		10	28.076363	12	0.454545
BRD1	23774	broad.mit.edu	hg19	22	50216676	50216676	+	Silent	SNP	T	T	C			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr22:50216676T>C	ENST00000216267.8	-	1	1776	c.1290A>G	c.(1288-1290)gcA>gcG	p.A430A	BRD1_ENST00000542442.1_Silent_p.A69A|BRD1_ENST00000457780.2_Silent_p.A430A|BRD1_ENST00000404760.1_Silent_p.A430A|BRD1_ENST00000459821.1_5'UTR|BRD1_ENST00000342989.5_5'UTR|BRD1_ENST00000404034.1_Silent_p.A430A	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	430		histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding	endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)	TAGCCTTTTTTGCCTTCTTCC	0.517	0	152.0	155.0	154.0	22	50216676	2203	4300	6503	SO:0001819	synonymous_variant	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425		1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""		10591208, 10602503	Standard	NM_014577	Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1290A>G	22.37:g.50216676T>C		A6ZJA4	ENST00000216267.8	37	CCDS14080.1																																																																																			BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1		223.639596	0	-10	193	0	0	1	0	NM_014577	67	224.051575	52	0.563025
COL2A1	1280	broad.mit.edu	hg19	12	48372483	48372483	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr12:48372483G>T	ENST00000380518.3	-	42	2956	c.2792C>A	c.(2791-2793)gCt>gAt	p.A931D	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.A862D	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	931	Triple-helical region.	axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding	NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			GTCTCCTCGAGCACCTTTGGG	0.637	0	29.0	31.0	30.0	12	48372483	2203	4299	6502	SO:0001583	missense	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219	"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM	1677770	Standard	NM_033150	Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.2792C>A	12.37:g.48372483G>T	ENSP00000369889:p.Ala931Asp	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422086	0.43020	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.94376	-3.41;-3.41	5.46	-0.683	0.11335	.	0.411674	0.22850	N	0.054869	D	0.82426	0.5034	N	0.05199	-0.095	0.30228	N	0.796188	B;B	0.25609	0.13;0.037	B;B	0.25884	0.064;0.029	T	0.71889	-0.4456	10	0.33141	T	0.24	.	11.1015	0.48177	0.4511:0.0:0.5489:0.0	.	862;931	P02458-1;P02458	.;CO2A1_HUMAN	D	931;862;862	ENSP00000369889:A931D;ENSP00000338213:A862D	ENSP00000338213:A862D	A	-	2	0	COL2A1	46658750	0.000000	0.05858	0.953000	0.39169	0.991000	0.79684	0.002000	0.13061	-0.448000	0.07128	0.655000	0.94253	GCT	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2		54.949551	1	-10	41	0	1.99824e-07	1	2.17989e-07	NM_001844	18	54.955726	17	0.514286
GLTSCR1L	23506	broad.mit.edu	hg19	6	42821420	42821420	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr6:42821420G>A	ENST00000314073.5	+	8	2166	c.1990G>A	c.(1990-1992)Gca>Aca	p.A664T	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.A664T					GLTSCR1-like												CTTAGGAACCGCACAACCACA	0.428	0	151.0	130.0	137.0	6	42821420	2203	4300	6503	SO:0001583	missense	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624		21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240		Standard	XM_005248972	Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1990G>A	6.37:g.42821420G>A	ENSP00000313933:p.Ala664Thr	A1L3W2|Q5TFZ3|Q92514	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	G	7.063	0.566769	0.13560	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.44881	0.91;0.91	4.88	-8.72	0.00845	.	1.206860	0.05800	N	0.611940	T	0.09247	0.0228	L	0.36672	1.1	0.09310	N	0.999996	B	0.10296	0.003	B	0.06405	0.002	T	0.12451	-1.0547	10	0.12103	T	0.63	5.0E-4	9.9784	0.41797	0.4926:0.0938:0.4136:0.0	.	664	Q6AI39	K0240_HUMAN	T	664	ENSP00000313933:A664T;ENSP00000377723:A664T	ENSP00000313933:A664T	A	+	1	0	KIAA0240	42929398	0.000000	0.05858	0.004000	0.12327	0.496000	0.33645	-1.124000	0.03260	-1.616000	0.01572	-0.369000	0.07265	GCA	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3		-8.228927	0	-1	70	0	0	1	0	NM_015349	3	6.334829	63	0.045455
ZC3H7A	29066	broad.mit.edu	hg19	16	11846640	11846640	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr16:11846640G>A	ENST00000396516.2	-	21	2808	c.2611C>T	c.(2611-2613)Cag>Tag	p.Q871*	ZC3H7A_ENST00000575984.1_Nonsense_Mutation_p.Q67*|ZC3H7A_ENST00000355758.4_Nonsense_Mutation_p.Q871*			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	871			nucleus	nucleic acid binding|zinc ion binding	breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25					CCCTGCCACTGCTTCTCACTG	0.517	0	137.0	108.0	118.0	16	11846640	2197	4300	6497	SO:0001587	stop_gained	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299	"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7	11042152	Standard	NM_014153	Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2611C>T	16.37:g.11846640G>A	ENSP00000379773:p.Gln871*	D3DUG5|Q9NPE9	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	G	49	16.042092	0.99852	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.8439	0.92196	0.0:0.0:1.0:0.0	.	.	.	.	X	871	.	ENSP00000347999:Q871X	Q	-	1	0	ZC3H7A	11754141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.688000	0.91661	0.591000	0.81541	CAG	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1		75.534157	0	-20	99	0	0	1	0	NM_014153	26	76.184555	40	0.393939
HIATL2	84278	hgsc.bcm.edu	hg19	9	99711843	99711843	+	RNA	SNP	C	C	A			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0																										TCACCATGGGCTGATCCTCAT	0.488	0									SO:0001583	missense	BC005058		9q22.33	2008-09-12	2008-09-12		ENSG00000196312	ENSG00000196312		23672	protein-coding gene	gene with protein product					12477932	Standard	NR_002894	Approved	MGC12945	uc004aws.3	Q5VZR4	OTTHUMG00000020317	ENST00000602917.1:c.389G>T	9.37:g.99711843C>A	ENSP00000473444:p.Ser130Ile	Q9BSG7	ENST00000602917.1	37		.	.	.	.	.	.	.	.	.	.	.	12.57	1.976373	0.34848	.	.	ENSG00000196312	ENST00000375223	D	0.81996	-1.56	1.44	0.487	0.16842	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.51477	D	0.000091	D	0.87736	0.6252	.	.	.	0.46564	D	0.999102	D	0.65815	0.995	D	0.72625	0.978	D	0.84714	0.0736	9	0.87932	D	0	.	5.7346	0.18059	0.0:0.7998:0.0:0.2002	.	130	Q5VZR4	HIAL2_HUMAN	I	130	ENSP00000364371:S130I	ENSP00000364371:S130I	S	-	2	0	HIATL2	98751664	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	3.489000	0.53237	0.170000	0.19704	0.184000	0.17185	AGC	HIATL2-001	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053305.3				-45	118					NM_032318	122		216	
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		62.501612	0	0	81	0	0	1	0	NM_002067	20	62.598132	16	0.555556
ZNF628	89887	broad.mit.edu	hg19	19	55993184	55993184	+	Silent	SNP	C	C	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr19:55993184C>T	ENST00000391718.2	+	3	1177	c.612C>T	c.(610-612)ctC>ctT	p.L204L	ZNF628_ENST00000598519.1_Silent_p.L208L	NM_033113.2	NP_149104.3	Q5EBL2	ZN628_HUMAN	zinc finger protein 628	204			nucleus	DNA binding|zinc ion binding	endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)	GCTGCCCGCTCTGCCCCAAGA	0.736	0	14.0	14.0	14.0	19	55993184	2197	4272	6469	SO:0001819	synonymous_variant	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483	"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671				Standard	NM_033113	Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.624C>T	19.37:g.55993184C>T		Q86X34	ENST00000598519.1	37	CCDS33116.3																																																																																			ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2		15.574655	0	0	10	0	0	1	0	XM_058964	5	15.574655	5	0.500000
HHEX	3087	broad.mit.edu	hg19	10	94452507	94452507	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr10:94452507C>T	ENST00000282728.5	+	3	2388	c.589C>T	c.(589-591)Cag>Tag	p.Q197*	HHEX_ENST00000492654.2_Nonsense_Mutation_p.Q25*|HHEX_ENST00000472590.2_Nonsense_Mutation_p.Q25*	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	197		anterior/posterior pattern formation|B cell differentiation|cell cycle|DNA conformation change|negative regulation of angiogenesis|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of vascular endothelial growth factor receptor signaling pathway|poly(A)+ mRNA export from nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|Wnt receptor signaling pathway	cytoplasm|nucleus|protein-DNA complex	DNA bending activity|eukaryotic initiation factor 4E binding|protein homodimerization activity|repressing transcription factor binding|sequence-specific DNA binding|TBP-class protein binding|transcription regulatory region DNA binding	kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10					GAGACTAAAACAGGTATGGAC	0.428	0	123.0	119.0	120.0	10	94452507	2203	4300	6503	SO:0001587	stop_gained	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804	"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX	8096636, 8103988	Standard	NM_002729	Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000472590.2:c.73C>T	10.37:g.94452507C>T	ENSP00000450017:p.Gln25*	B1AQ17|Q96CE9	ENST00000472590.2	37		.	.	.	.	.	.	.	.	.	.	C	46	12.659512	0.99686	.	.	ENSG00000152804	ENST00000282728;ENST00000472590;ENST00000492654	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-4.5893	17.3563	0.87336	0.0:1.0:0.0:0.0	.	.	.	.	X	197;25;25	.	ENSP00000282728:Q197X	Q	+	1	0	HHEX	94442487	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.499000	0.81566	2.343000	0.79666	0.484000	0.47621	CAG	HHEX-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000049403.2		55.317612	0	-3	91	0	0	1	0		19	56.143615	33	0.365385
CRLF1	9244	broad.mit.edu	hg19	19	18704909	18704909	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V4-A9F7-01A-11D-A39W-08	TCGA-V4-A9F7-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1d9802da-a92a-4d0d-88a6-a112243f998e	42b09782-87dc-46fb-a791-471c0d18a3b0	g.chr19:18704909delC	ENST00000392386.3	-	8	1414	c.1221delG	c.(1219-1221)gggfs	p.G407fs	CRLF1_ENST00000594325.1_Intron	NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	407		negative regulation of neuron apoptosis|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	cytokine binding|protein heterodimerization activity|receptor activity	central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9					AGGGCAGGATCCCCTCGTCCT	0.687	0	12.0	11.0	11.0	19	18704909	2178	4277	6455	SO:0001589	frameshift_variant	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016	"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237			9686600	Standard	NM_004750	Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.1221delG	19.37:g.18704909delC	ENSP00000376188:p.Gly407fs	Q9UHH5	ENST00000392386.3	37	CCDS32962.1																																																																																			CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1	.	.		6	7						2		4	0.33
