Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
MROH1	727957	broad.mit.edu	hg19	8	145235339	145235339	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr8:145235339G>A	ENST00000528919.1	+	6	596	c.475G>A	c.(475-477)Gtc>Atc	p.V159I	MROH1_ENST00000398656.4_Missense_Mutation_p.V159I|MROH1_ENST00000423230.2_Missense_Mutation_p.V159I|MROH1_ENST00000326134.5_Missense_Mutation_p.V159I|MROH1_ENST00000534366.1_Missense_Mutation_p.V159I	NM_032450.2	NP_115826			maestro heat-like repeat family member 1												GTTCGGCGTAGTCCCCTTCCT	0.692	0	97.0	101.0	100.0	8	145235339	2177	4250	6427	SO:0001583	missense		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832	"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A	11347906	Standard	NM_032450	Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.475G>A	8.37:g.145235339G>A	ENSP00000435565:p.Val159Ile	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	ENST00000528919.1	37	CCDS47938.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239463	0.58995	.	.	ENSG00000179832	ENST00000423230;ENST00000398656;ENST00000534366;ENST00000528919;ENST00000326134;ENST00000356585	T;T;T;T;T	0.06371	3.31;3.31;3.31;3.31;3.31	5.42	3.62	0.41486	Armadillo-type fold (1);	0.000000	0.64402	U	0.000020	T	0.20007	0.0481	M	0.75447	2.3	0.80722	D	1	D;P;P;D;D	0.76494	0.999;0.911;0.911;0.972;0.965	D;B;B;D;P	0.74348	0.983;0.232;0.232;0.918;0.856	T	0.01566	-1.1323	10	0.26408	T	0.33	.	10.1834	0.42982	0.1652:0.0:0.8348:0.0	.	159;159;159;159;159	Q8NDA8-2;E9PHY8;Q8NDA8;Q8NDA8-4;Q8NDA8-5	.;.;HTR7A_HUMAN;.;.	I	159;159;159;159;159;91	ENSP00000388174:V159I;ENSP00000381649:V159I;ENSP00000436636:V159I;ENSP00000435565:V159I;ENSP00000321737:V159I	ENSP00000321737:V159I	V	+	1	0	HEATR7A	145307327	1.000000	0.71417	0.990000	0.47175	0.017000	0.09413	7.060000	0.76692	0.769000	0.33313	-0.258000	0.10820	GTC	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1		183.866039	0	-16	72	0	0	1	0	NM_032450	61	183.873240	59	0.508333
SLC30A1	7779	broad.mit.edu	hg19	1	211749275	211749275	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr1:211749275T>C	ENST00000367001.4	-	2	1108	c.979A>G	c.(979-981)Ata>Gta	p.I327V		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	327		cadmium ion transmembrane transport|cellular calcium ion homeostasis|cellular zinc ion homeostasis|negative regulation of calcium ion import|negative regulation of neurotransmitter secretion|negative regulation of zinc ion import	integral to membrane|T-tubule	calcium channel inhibitor activity|zinc ion transmembrane transporter activity	central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)	TAAAGAAGTATACAAACCATT	0.318	0	105.0	111.0	109.0	1	211749275	2203	4300	6503	SO:0001583	missense	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385	"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1		Standard	NM_021194	Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.979A>G	1.37:g.211749275T>C	ENSP00000355968:p.Ile327Val	Q0VAK9|Q9BZF6	ENST00000367001.4	37	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878797	0.72294	.	.	ENSG00000170385	ENST00000367001	T	0.66995	-0.24	5.44	5.44	0.79542	.	0.047895	0.85682	D	0.000000	T	0.75824	0.3902	L	0.45352	1.415	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.75872	-0.3164	10	0.44086	T	0.13	-10.9073	15.4963	0.75653	0.0:0.0:0.0:1.0	.	327	Q9Y6M5	ZNT1_HUMAN	V	327	ENSP00000355968:I327V	ENSP00000355968:I327V	I	-	1	0	SLC30A1	209815898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.748000	0.85085	2.061000	0.61500	0.460000	0.39030	ATA	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		123.504658	0	1	110	0	0	1	0		40	123.805805	51	0.439560
NDUFAF6	137682	broad.mit.edu	hg19	8	96064453	96064453	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr8:96064453C>T	ENST00000396113.1	+	14	1642	c.592C>T	c.(592-594)Cag>Tag	p.Q198*	NDUFAF6_ENST00000396111.2_Nonsense_Mutation_p.Q198*|NDUFAF6_ENST00000542894.1_Nonsense_Mutation_p.Q238*|NDUFAF6_ENST00000396124.4_Nonsense_Mutation_p.Q290*|NDUFAF6_ENST00000286687.4_Nonsense_Mutation_p.Q138*			Q330K2	CH038_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 6	290		biosynthetic process	mitochondrion	transferase activity							TGCTTTTCTTCAGACGGTAAG	0.348	0	124.0	111.0	115.0	8	96064453	1835	4085	5920	SO:0001587	stop_gained	BC028166	CCDS6266.2	8q22.1	2013-10-21	2012-05-08	2012-05-08	ENSG00000156170	ENSG00000156170	"""Mitochondrial respiratory chain complex assembly factors"""	28625	protein-coding gene	gene with protein product		612392	"""chromosome 8 open reading frame 38"""	C8orf38	22019594, 23509070	Standard	NM_152416	Approved	MGC40214	uc003yhj.3	Q330K2	OTTHUMG00000150173	ENST00000396113.1:c.592C>T	8.37:g.96064453C>T	ENSP00000379419:p.Gln198*	A8MT28|A8MWF0|B4DQ45|Q8N6U6	ENST00000396113.1	37		.	.	.	.	.	.	.	.	.	.	C	32	5.193284	0.94960	.	.	ENSG00000156170	ENST00000396113;ENST00000396111;ENST00000542894;ENST00000396124;ENST00000286687	.	.	.	5.64	5.64	0.86602	.	20.480600	0.00166	N	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-11.8906	7.5839	0.27980	0.1658:0.752:0.0:0.0822	.	.	.	.	X	198;198;238;290;138	.	ENSP00000286687:Q138X	Q	+	1	0	C8orf38	96133629	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.430000	0.44766	2.657000	0.90304	0.655000	0.94253	CAG	NDUFAF6-003	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000316699.1		141.578748	0	29	123	0	0	1	0	NM_152416	48	142.077809	64	0.428571
C16orf62	57020	broad.mit.edu	hg19	16	19621674	19621674	+	Silent	SNP	A	A	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr16:19621674A>C	ENST00000438132.3	+	12	1275	c.1227A>C	c.(1225-1227)acA>acC	p.T409T	C16orf62_ENST00000251143.5_Silent_p.T320T|C16orf62_ENST00000448695.1_Silent_p.T170T|C16orf62_ENST00000417362.2_Silent_p.T320T|C16orf62_ENST00000543152.1_Silent_p.T69T|C16orf62_ENST00000542263.1_Silent_p.T409T	NM_020314.5	NP_064710.4	Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	320			integral to membrane		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36					CCCGGTTGACATGCATGATCA	0.522	0	106.0	81.0	90.0	16	19621674	2197	4300	6497	SO:0001819	synonymous_variant		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544		24641	protein-coding gene	gene with protein product					10493829	Standard	NM_020314	Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000438132.3:c.1227A>C	16.37:g.19621674A>C		A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	ENST00000438132.3	37	CCDS32397.2																																																																																			C16orf62-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397058.2		41.175076	0	2	28	0	0	1	0	NM_020314	13	41.211169	11	0.541667
XKR4	114786	broad.mit.edu	hg19	8	56015469	56015469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr8:56015469C>T	ENST00000327381.6	+	1	521	c.421C>T	c.(421-423)Cag>Tag	p.Q141*		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4				integral to membrane		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)		CCTGCGCGGCCAGCGCTGGTG	0.637	0	59.0	46.0	50.0	8	56015469	2203	4299	6502	SO:0001587	stop_gained	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579		29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""			Standard	NM_052898	Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.421C>T	8.37:g.56015469C>T	ENSP00000328326:p.Gln141*	Q96PZ8	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	C	39	7.798905	0.98495	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	.	.	.	5.18	5.18	0.71444	.	1.250970	0.05505	N	0.559163	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-5.3005	18.6859	0.91563	0.0:1.0:0.0:0.0	.	.	.	.	X	141	.	ENSP00000328326:Q141X	Q	+	1	0	XKR4	56178023	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.879000	0.69690	2.406000	0.81754	0.650000	0.86243	CAG	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2		10.828176	0	-27	61	0	0	1	0	NM_052898	12	25.742621	91	0.116505
RYR1	6261	broad.mit.edu	hg19	19	38951204	38951204	+	Silent	SNP	C	C	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr19:38951204C>T	ENST00000355481.4	+	20	2681	c.2550C>T	c.(2548-2550)ttC>ttT	p.F850F	RYR1_ENST00000360985.3_Silent_p.F850F|RYR1_ENST00000359596.3_Silent_p.F850F	NM_000540.2|NM_001042723.1	NP_000531.2|NP_001036188.1	P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	850	6 X approximate repeats.	muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		ACACCGACTTCGTGCCCTGCC	0.637	0	41.0	44.0	43.0	19	38951204	2203	4300	6503	SO:0001819	synonymous_variant	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218	"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO	1862346, 16621918	Standard	NM_000540	Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2550C>T	19.37:g.38951204C>T		Q16314|Q16368|Q9NPK1|Q9P1U4	ENST00000359596.3	37	CCDS33011.1																																																																																			RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		59.456684	0	-7	64	0	0	1	0		21	61.528975	46	0.313433
TRPV2	51393	broad.mit.edu	hg19	17	16320989	16320989	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr17:16320989T>G	ENST00000338560.7	+	2	406	c.7T>G	c.(7-9)Tca>Gca	p.S3A	TRPV2_ENST00000577397.1_5'UTR	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	3	Required for interaction with SLC50A1 (By similarity).	sensory perception	integral to plasma membrane|melanosome	calcium channel activity	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)	TAGGATGACCTCACCCTCCAG	0.582	0	72.0	61.0	65.0	17	16320989	2203	4300	6503	SO:0001583	missense	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688	"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676			10201375, 16382100	Standard	NM_016113	Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.7T>G	17.37:g.16320989T>G	ENSP00000342222:p.Ser3Ala	A6NML2|A8K0Z0|Q9Y670	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	T	4.878	0.163160	0.09287	.	.	ENSG00000187688	ENST00000338560	D	0.88046	-2.33	5.29	-2.48	0.06423	.	1.305430	0.05349	N	0.531535	T	0.82033	0.4949	L	0.44542	1.39	0.09310	N	0.999996	B	0.27229	0.172	B	0.25140	0.058	T	0.69045	-0.5249	10	0.62326	D	0.03	-0.1787	9.8456	0.41026	0.1069:0.0:0.5186:0.3745	.	3	Q9Y5S1	TRPV2_HUMAN	A	3	ENSP00000342222:S3A	ENSP00000342222:S3A	S	+	1	0	TRPV2	16261714	0.001000	0.12720	0.030000	0.17652	0.013000	0.08279	0.147000	0.16202	-0.513000	0.06496	-1.871000	0.00553	TCA	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2		4.236573	0	-6	78	0	0	1	0	NM_016113	8	18.050588	76	0.095238
BAP1	8314	broad.mit.edu	hg19	3	52442542	52442542	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr3:52442542T>C	ENST00000460680.1	-	4	674	c.203A>G	c.(202-204)gAt>gGt	p.D68G	BAP1_ENST00000296288.5_Missense_Mutation_p.D68G	NM_004656.2	NP_004647.1	Q92560	BAP1_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	68		monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	CACGGACGTATCATCCACCAA	0.502	0	66.0	55.0	59.0	3	52442542	2202	4300	6502	SO:0001583	missense	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.203A>G	3.37:g.52442542T>C	ENSP00000417132:p.Asp68Gly	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852084	0.71719	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.53857	0.6;0.6	5.43	5.43	0.79202	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.332135	0.36066	N	0.002808	T	0.30039	0.0752	N	0.02142	-0.665	0.58432	D	0.999999	B	0.18461	0.028	B	0.20384	0.029	T	0.18366	-1.0339	10	0.54805	T	0.06	-4.0493	15.4677	0.75416	0.0:0.0:0.0:1.0	.	68	Q92560	BAP1_HUMAN	G	68	ENSP00000417132:D68G;ENSP00000296288:D68G	ENSP00000296288:D68G	D	-	2	0	BAP1	52417582	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	8.005000	0.88553	2.061000	0.61500	0.533000	0.62120	GAT	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		35.816669	0	5	17	0	0	1	0		10	37.315062	1	0.909091
ARHGEF40	55701	broad.mit.edu	hg19	14	21548919	21548919	+	Missense_Mutation	SNP	G	G	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr14:21548919G>T	ENST00000298694.4	+	12	2601	c.2474G>T	c.(2473-2475)cGt>cTt	p.R825L	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.R825L			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	825		regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9					CTGCGATTCCGTGCTTTCAGC	0.637	0	56.0	51.0	53.0	14	21548919	2203	4300	6503	SO:0001583	missense		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801	"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018			16143467	Standard	NM_001278529	Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2474G>T	14.37:g.21548919G>T	ENSP00000298694:p.Arg825Leu	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200219	0.58126	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02552	4.32;4.25	5.14	4.17	0.49024	.	0.140337	0.32640	N	0.005826	T	0.02342	0.0072	N	0.19112	0.55	0.29799	N	0.832577	P;P	0.44690	0.626;0.841	B;B	0.41917	0.37;0.127	T	0.36601	-0.9741	10	0.40728	T	0.16	.	7.7204	0.28729	0.114:0.0:0.886:0.0	.	825;825	Q8TER5-4;Q8TER5	.;ARH40_HUMAN	L	825	ENSP00000298694:R825L;ENSP00000298693:R825L	ENSP00000298693:R825L	R	+	2	0	ARHGEF40	20618759	0.913000	0.31002	0.998000	0.56505	0.994000	0.84299	1.078000	0.30754	2.649000	0.89929	0.655000	0.94253	CGT	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		21.787477	1	-11	39	0	0.000673444	1	0.000673444		8	23.262127	22	0.266667
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		112.622501	0	-27	85	0	0	1	0	NM_002072	35	112.694629	40	0.466667
DZIP1L	199221	ucsc.edu	hg19	3	137822328	137822328	+	Silent	SNP	G	G	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead																										GGTAGCTGTGGGTGCCTGTCT	0.647	0	49.0	47.0	48.0	3	137822328	2203	4300	6503	SO:0001819	synonymous_variant	AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163		26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""		12477932	Standard	NM_173543	Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.486C>T	3.37:g.137822328G>A		C9JUG5|Q96M38	ENST00000327532.2	37	CCDS3096.1																																																																																			DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1				-4	67					NM_173543	4		22	
MED12	9968	broad.mit.edu	hg19	X	70339611	70339611	+	Missense_Mutation	SNP	C	C	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chrX:70339611C>T	ENST00000333646.6	+	3	479	c.280C>T	c.(280-282)Ccc>Tcc	p.P94S	MED12_ENST00000374102.1_Missense_Mutation_p.P94S|MED12_ENST00000374080.3_Missense_Mutation_p.P94S	NM_005120.2	NP_005111.2	Q93074	MED12_HUMAN	mediator complex subunit 12	94		androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)				TCGCAGGAAGCCCCAAGTGAA	0.493	0	47.0	44.0	45.0	X	70339611	1951	4131	6082	SO:0001583	missense	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634		11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1	9225980, 10198638, 17334363, 20507344	Standard	NM_005120	Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.280C>T	X.37:g.70339611C>T	ENSP00000363193:p.Pro94Ser	O15410|O75557|Q9UHV6|Q9UND7	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	12.58	1.979662	0.34942	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.57436	0.4;0.41;0.41;0.47	5.73	2.93	0.34026	.	0.267486	0.37261	N	0.002166	T	0.54711	0.1875	L	0.29908	0.895	0.43719	D	0.996197	P;D;P	0.89917	0.715;1.0;0.878	P;D;P	0.91635	0.805;0.999;0.792	T	0.45145	-0.9281	10	0.26408	T	0.33	-1.1292	8.0157	0.30379	0.0:0.7222:0.1287:0.1491	.	94;94;94	F5H3Y1;Q93074-3;Q93074	.;.;MED12_HUMAN	S	94;94;94;94;62	ENSP00000333125:P94S;ENSP00000363215:P94S;ENSP00000363193:P94S;ENSP00000414203:P62S	ENSP00000333125:P94S	P	+	1	0	MED12	70256336	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	3.854000	0.55949	0.248000	0.21435	0.600000	0.82982	CCC	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1		44.422420	0	-19	13	0	0	1	0	NM_005120	12	44.422176	0	1.000000
ADAMTS12	81792	broad.mit.edu	hg19	5	33576198	33576198	+	Silent	SNP	G	G	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr5:33576198G>A	ENST00000504830.1	-	19	4268	c.3933C>T	c.(3931-3933)ggC>ggT	p.G1311G	ADAMTS12_ENST00000352040.3_Silent_p.G1226G	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1311	Spacer 2.	proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216					CAGAGCCGTGGCCGTTTGTGA	0.473	0	113.0	113.0	113.0	5	33576198	2203	4300	6503	SO:0001819	synonymous_variant	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""		11279086	Standard	NM_030955	Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3933C>T	5.37:g.33576198G>A		A2RRN9|A5D6V6|Q6UWL3	ENST00000504830.1	37	CCDS34140.1																																																																																			ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2		11.982244	0	12	119	0	0	1	0	NM_030955	13	29.004555	102	0.113043
SMCR8	140775	broad.mit.edu	hg19	17	18221249	18221249	+	Missense_Mutation	SNP	C	C	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr17:18221249C>A	ENST00000406438.3	+	1	2626	c.2146C>A	c.(2146-2148)Cag>Aag	p.Q716K		NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	716					breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21					ATTCATCCGCCAGTACCCCTT	0.562	0	84.0	65.0	72.0	17	18221249	2203	4300	6503	SO:0001583	missense	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994		17921	protein-coding gene	gene with protein product					11997338, 23248642	Standard	NM_144775	Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.2146C>A	17.37:g.18221249C>A	ENSP00000385025:p.Gln716Lys	A5PKZ5|Q3ZCN0|Q6PJL3	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038515	0.93630	.	.	ENSG00000176994	ENST00000406438	T	0.23950	1.88	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	L	0.43152	1.355	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.21245	-1.0251	10	0.59425	D	0.04	-19.7916	20.5827	0.99408	0.0:1.0:0.0:0.0	.	716	Q8TEV9	SMCR8_HUMAN	K	716	ENSP00000385025:Q716K	ENSP00000385025:Q716K	Q	+	1	0	SMCR8	18161974	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.398000	0.79919	2.941000	0.99782	0.655000	0.94253	CAG	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2		41.075122	1	-14	60	0	4.75885e-15	1	5.12491e-15	NM_144775	16	44.361449	46	0.258065
MB21D1	115004	broad.mit.edu	hg19	6	74134996	74134996	+	Missense_Mutation	SNP	A	A	G			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr6:74134996A>G	ENST00000370315.3	-	5	1617	c.1523T>C	c.(1522-1524)aTt>aCt	p.I508T	MB21D1_ENST00000370318.1_Intron	NM_138441.2	NP_612450.2	Q8N884	M21D1_HUMAN	Mab-21 domain containing 1	508					central_nervous_system(1)|large_intestine(4)|lung(1)	6					TTCATATTCAATTTGCTTTGT	0.299	0	36.0	36.0	36.0	6	74134996	2203	4299	6502	SO:0001583	missense	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430		21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150		Standard	NM_138441	Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1523T>C	6.37:g.74134996A>G	ENSP00000359339:p.Ile508Thr	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	ENST00000370315.3	37	CCDS4978.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.438861	0.63067	.	.	ENSG00000164430	ENST00000370315;ENST00000296913	T	0.09163	3.01	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.24661	0.0598	M	0.79123	2.44	0.46678	D	0.999154	D	0.89917	1.0	D	0.91635	0.999	T	0.01405	-1.1363	10	0.41790	T	0.15	-19.2525	14.7073	0.69200	1.0:0.0:0.0:0.0	.	508	Q8N884	M21D1_HUMAN	T	508;491	ENSP00000359339:I508T	ENSP00000296913:I491T	I	-	2	0	MB21D1	74191717	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	5.419000	0.66435	2.219000	0.72066	0.528000	0.53228	ATT	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5		75.063826	0	-52	54	0	0	1	0	NM_138441	24	75.444926	34	0.413793
DYNC1I2	1781	broad.mit.edu	hg19	2	172600667	172600667	+	Silent	SNP	T	T	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr2:172600667T>C	ENST00000534253.2	+	16	1813	c.1645T>C	c.(1645-1647)Ttg>Ctg	p.L549L	DYNC1I2_ENST00000340296.4_Silent_p.L523L|DYNC1I2_ENST00000508530.1_Silent_p.L523L|DYNC1I2_ENST00000409773.1_Silent_p.L549L|DYNC1I2_ENST00000409317.1_Silent_p.L543L|DYNC1I2_ENST00000409197.1_Silent_p.L523L|DYNC1I2_ENST00000358002.6_Silent_p.L541L|DYNC1I2_ENST00000410079.3_Silent_p.L541L|DYNC1I2_ENST00000397119.3_Silent_p.L549L|DYNC1I2_ENST00000263811.4_Silent_p.L543L|DYNC1I2_ENST00000409453.1_Silent_p.L549L			Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	549		G2/M transition of mitotic cell cycle|interspecies interaction between organisms|microtubule-based movement|transport	centrosome|cytosol|dynein complex|microtubule|vesicle	microtubule motor activity	breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)		CATGGGGAGATTGGATTTGTG	0.368	0	72.0	66.0	68.0	2	172600667	1832	4083	5915	SO:0001819	synonymous_variant	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380	"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2	10049579, 16260502	Standard	NM_001378	Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000340296.4:c.1567T>C	2.37:g.172600667T>C		B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	ENST00000340296.4	37																																																																																				DYNC1I2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000334613.1		8.486561	0	-3	32	0	0	1	0	NM_001378	4	11.236034	21	0.160000
IQGAP2	10788	broad.mit.edu	hg19	5	75969313	75969313	+	Silent	SNP	A	A	G			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr5:75969313A>G	ENST00000274364.6	+	25	3405	c.3108A>G	c.(3106-3108)acA>acG	p.T1036T	IQGAP2_ENST00000379730.3_Silent_p.T538T|IQGAP2_ENST00000396234.3_Silent_p.T532T|IQGAP2_ENST00000502745.1_Silent_p.T532T	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1036	Ras-GAP.	small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)	AAGCTCTAACATACCCAGAAG	0.413	0	104.0	101.0	102.0	5	75969313	2203	4300	6503	SO:0001819	synonymous_variant	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703		6111	protein-coding gene	gene with protein product		605401			8756646	Standard	XM_005248409	Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3108A>G	5.37:g.75969313A>G		A8K4V1|B7Z8A4|J3KR91	ENST00000274364.6	37	CCDS34188.1																																																																																			IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1		8.914557	0	4	83	0	0	1	0	NM_006633	9	21.028226	72	0.111111
B4GALT4	8702	broad.mit.edu	hg19	3	118945808	118945808	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr3:118945808G>A	ENST00000467604.1	-	4	725	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W	B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000359213.3_Missense_Mutation_p.R112W|B4GALT4_ENST00000483209.1_Missense_Mutation_p.R112W|B4GALT4_ENST00000393765.2_Missense_Mutation_p.R112W|B4GALT4_ENST00000471675.1_Intron|B4GALT4_ENST00000460321.1_5'UTR			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	112		membrane lipid metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding|N-acetyllactosamine synthase activity	breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	GGGCGATACCGGCCTCTGGAC	0.502	0	120.0	111.0	114.0	3	118945808	2203	4300	6503	SO:0001583	missense	AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578	"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015			9597550	Standard	NM_003778	Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.334C>T	3.37:g.118945808G>A	ENSP00000420161:p.Arg112Trp	Q68D68|Q9BSW3|Q9C078	ENST00000483209.1	37	CCDS2986.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040308	0.55003	.	.	ENSG00000121578	ENST00000483209;ENST00000467604;ENST00000359213;ENST00000393765;ENST00000475803;ENST00000479150	T;T;T;T;T;T	0.54071	1.57;1.57;1.57;1.57;1.57;0.59	6.02	6.02	0.97574	.	0.389342	0.29009	N	0.013436	T	0.67230	0.2871	M	0.76170	2.325	0.43145	D	0.994904	D	0.89917	1.0	P	0.56788	0.806	T	0.68773	-0.5320	10	0.52906	T	0.07	-8.285	14.3748	0.66867	0.0:0.0:0.8524:0.1476	.	112	O60513	B4GT4_HUMAN	W	112	ENSP00000420161:R112W;ENSP00000417226:R112W;ENSP00000352144:R112W;ENSP00000377360:R112W;ENSP00000417188:R112W;ENSP00000417958:R112W	ENSP00000352144:R112W	R	-	1	2	B4GALT4	120428498	1.000000	0.71417	0.980000	0.43619	0.028000	0.11728	4.499000	0.60380	2.865000	0.98341	0.655000	0.94253	CGG	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354925.2		66.710541	0	-29	50	0	0	1	0	NM_003778	20	67.449796	10	0.666667
N4BP2	55728	broad.mit.edu	hg19	4	40146262	40146262	+	Missense_Mutation	SNP	A	A	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr4:40146262A>C	ENST00000261435.6	+	16	5401	c.4985A>C	c.(4984-4986)cAt>cCt	p.H1662P		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1662			cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60					GGTACTCTTCATGAGCAGAAG	0.433	0	121.0	114.0	117.0	4	40146262	2203	4300	6503	SO:0001583	missense	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177		29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""				10718198, 11717310	Standard	NM_018177	Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4985A>C	4.37:g.40146262A>C	ENSP00000261435:p.His1662Pro	A0AVR3|Q9NVK2|Q9P2D4	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893299	0.72524	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.25579	1.79	5.15	5.15	0.70609	Domain of unknown function DUF1771 (1);	0.123240	0.53938	D	0.000057	T	0.54775	0.1879	M	0.82323	2.585	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.62435	-0.6855	10	0.87932	D	0	-8.5331	14.9703	0.71229	1.0:0.0:0.0:0.0	.	1645;1662	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	P	1662;1582	ENSP00000261435:H1662P	ENSP00000261435:H1662P	H	+	2	0	N4BP2	39822657	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	8.862000	0.92283	1.925000	0.55765	0.374000	0.22700	CAT	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2		187.676904	0	21	145	0	0	1	0	NM_018177	57	187.726607	52	0.522936
CCDC89	220388	broad.mit.edu	hg19	11	85397134	85397134	+	Missense_Mutation	SNP	T	T	G			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr11:85397134T>G	ENST00000316398.3	-	1	186	c.40A>C	c.(40-42)Atg>Ctg	p.M14L		NM_152723.1	NP_689936.1	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	14			cytoplasm|nucleus		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	15		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)			GGGGTGTCCATCCTGGGAGCC	0.522	0	65.0	69.0	68.0	11	85397134	2203	4299	6502	SO:0001583	missense	AK095478	CCDS8270.1	11q14.1	2006-03-16			ENSG00000179071	ENSG00000179071		26762	protein-coding gene	gene with protein product					12477932	Standard	NM_152723	Approved	FLJ38159	uc001pau.1	Q8N998	OTTHUMG00000166976	ENST00000316398.3:c.40A>C	11.37:g.85397134T>G	ENSP00000320649:p.Met14Leu		ENST00000316398.3	37	CCDS8270.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.534471	0.45073	.	.	ENSG00000179071	ENST00000316398	.	.	.	5.24	5.24	0.73138	.	0.195088	0.26317	N	0.025070	T	0.45316	0.1336	M	0.68317	2.08	0.30703	N	0.750139	P	0.50943	0.94	P	0.46850	0.529	T	0.56848	-0.7911	8	.	.	.	-14.4867	8.8192	0.35016	0.0:0.0845:0.0:0.9155	.	14	Q8N998	CCD89_HUMAN	L	14	.	.	M	-	1	0	CCDC89	85074782	0.988000	0.35896	0.988000	0.46212	0.643000	0.38383	2.299000	0.43611	2.188000	0.69820	0.533000	0.62120	ATG	CCDC89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392182.1		20.182070	0	7	98	0	0	1	0	NM_152723	11	28.484983	61	0.152778
NCKAP5L	57701	broad.mit.edu	hg19	12	50189953	50189953	+	Missense_Mutation	SNP	G	G	A			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr12:50189953G>A	ENST00000335999.6	-	8	1891	c.1690C>T	c.(1690-1692)Cgg>Tgg	p.R564W		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	560	Pro-rich.				central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18					AAGGTGCTCCGAGAAAGGTCC	0.617	0	28.0	31.0	30.0	12	50189953	2064	4191	6255	SO:0001583	missense	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566		29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602		Standard	NM_001037806	Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1690C>T	12.37:g.50189953G>A	ENSP00000337998:p.Arg564Trp	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	ENST00000335999.6	37	CCDS41781.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.88|11.88	1.771135|1.771135	0.31320|0.31320	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000335999;ENST00000354423|ENST00000433948	T|.	0.47177|.	0.85|.	4.82|4.82	2.66|2.66	0.31614|0.31614	.|.	0.164213|.	0.29383|.	N|.	0.012313|.	T|T	0.36110|0.36110	0.0955|0.0955	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	D;D|.	0.89917|.	0.999;1.0|.	P;D|.	0.68483|.	0.881;0.958|.	T|T	0.34453|0.34453	-0.9828|-0.9828	10|6	0.66056|0.72032	D|D	0.02|0.01	-18.4741|-18.4741	13.6948|13.6948	0.62572|0.62572	0.0:0.0:0.6836:0.3163|0.0:0.0:0.6836:0.3163	.|.	560;560|.	E2QRB5;Q9HCH0-2|.	.;.|.	W|L	564;560|278	ENSP00000337998:R564W|.	ENSP00000337998:R564W|ENSP00000402619:S278L	R|S	-|-	1|2	2|0	NCKAP5L|NCKAP5L	48476220|48476220	0.000000|0.000000	0.05858|0.05858	0.977000|0.977000	0.42913|0.42913	0.784000|0.784000	0.44337|0.44337	-0.029000|-0.029000	0.12329|0.12329	0.579000|0.579000	0.29504|0.29504	-1.367000|-1.367000	0.01198|0.01198	CGG|TCG	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2		49.901121	0	-17	31	0	0	1	0	XM_035497	16	49.907555	17	0.484848
SPEG	10290	broad.mit.edu	hg19	2	220344823	220344823	+	Missense_Mutation	SNP	T	T	C			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr2:220344823T>C	ENST00000312358.7	+	25	5435	c.5303T>C	c.(5302-5304)aTt>aCt	p.I1768T	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1768	Protein kinase 1.	muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	GCACCCGAGATTGTCAATCAG	0.607	0	81.0	86.0	84.0	2	220344823	2097	4234	6331	SO:0001583	missense	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195	"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1	8663449, 10973969	Standard	NM_005876	Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5303T>C	2.37:g.220344823T>C	ENSP00000311684:p.Ile1768Thr	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	t	15.03	2.711137	0.48517	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.67345	-0.26	4.55	3.36	0.38483	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.169966	0.27922	N	0.017320	T	0.79058	0.4382	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.79876	-0.1618	10	0.87932	D	0	.	10.6646	0.45723	0.1436:0.0:0.0:0.8564	.	1768	Q15772	SPEG_HUMAN	T	1768	ENSP00000311684:I1768T	ENSP00000265327:I1768T	I	+	2	0	SPEG	220053067	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.740000	0.84986	0.851000	0.35264	0.492000	0.49549	ATT	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2		65.664276	0	-8	50	0	0	1	0	NM_005876	21	66.431277	35	0.375000
TAPT1-AS1	0	broad.mit.edu	hg19	4	16309149	16309149	+	RNA	DEL	A	A	-			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr4:16309149delA	ENST00000573950.1	+	0	434																					GGTGGAGGGGAAAAATGGAGT	0.512	0													4p15.32	2012-11-06	2012-11-06		ENSG00000263327	ENSG00000263327	"""Long non-coding RNAs"""	26832	non-coding RNA	RNA, long non-coding						Standard	NR_027696	Approved	FLJ39653			OTTHUMG00000160321		4.37:g.16309149delA			ENST00000573950.1	37																																																																																				TAPT1-AS1-004	KNOWN	basic	antisense	antisense	OTTHUMT00000439458.1	.	.		-1	5					NR_027696	2		4	0.33
GPC5	2262	broad.mit.edu	hg19	13	93518657	93518658	+	Frame_Shift_Ins	INS	-	-	T			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr13:93518657_93518658insT	ENST00000377067.3	+	8	2056_2057	c.1684_1685insT	c.(1684-1686)atafs	p.I562fs		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	562			anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)			ATTCACTCTGATAAGTGTGGTG	0.446	0									SO:0001589	frameshift_variant	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399	"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446			9070915, 20304703, 19556317, 15057823	Standard	NM_004466	Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1685dupT	13.37:g.93518658_93518658dupT	ENSP00000366267:p.Ile562fs	B2R726|O60436|Q9BX27	ENST00000377067.3	37	CCDS9468.1																																																																																			GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	.	.		11	122					NM_004466	90		59	0.60
ZFP62	643836	broad.mit.edu	hg19	5	180276131	180276131	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr5:180276131delA	ENST00000359141.6	-	3	2503	c.2184delT	c.(2182-2184)gatfs	p.D728fs	ZFP62_ENST00000512132.1_Frame_Shift_Del_p.D755fs|ZFP62_ENST00000502412.1_Frame_Shift_Del_p.D788fs|ZFP62_ENST00000506377.1_Intron	NM_152283.4	NP_689496.4	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	788		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		TCCCACACTCATCACATTCAT	0.468	0	111.0	92.0	98.0	5	180276131	692	1591	2283	SO:0001589	frameshift_variant	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670	"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""		8808410	Standard	NM_152283	Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2364delT	5.37:g.180276131delA	ENSP00000423820:p.Asp788fs	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	ENST00000502412.1	37	CCDS54955.1																																																																																			ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	.	.		5	7					NM_152283	2		4	0.33
PODXL2	50512	broad.mit.edu	hg19	3	127391153	127391153	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr3:127391153delG	ENST00000342480.6	+	8	1687	c.1648delG	c.(1648-1650)gacfs	p.D550fs		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	550		leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26					CGGCTGCCACGACAACCCCAC	0.726	0	5.0	7.0	6.0	3	127391153	1919	3802	5721	SO:0001589	frameshift_variant	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631		17936	protein-coding gene	gene with protein product	"""endoglycan"""				10722749	Standard	NM_015720	Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.1648delG	3.37:g.127391153delG	ENSP00000345359:p.Asp550fs	Q6UVY4|Q8WUV6	ENST00000342480.6	37	CCDS3044.1																																																																																			PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	.	.		3	6					NM_015720	2		4	0.33
ANKRD6	22881	broad.mit.edu	hg19	6	90327729	90327737	+	In_Frame_Del	DEL	TCTCCTTAC	TCTCCTTAC	-			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr6:90327729_90327737delTCTCCTTAC	ENST00000369408.5	+	9	1120_1128	c.771_779delTCTCCTTAC	c.(769-780)cttctccttact>ctt	p.LLT258del	ANKRD6_ENST00000485637.1_In_Frame_Del_p.LLT258del|ANKRD6_ENST00000520793.1_Intron|ANKRD6_ENST00000339746.4_In_Frame_Del_p.LLT258del|ANKRD6_ENST00000447838.2_In_Frame_Del_p.LLT258del|ANKRD6_ENST00000522441.1_In_Frame_Del_p.LLT258del	NM_001242813.1	NP_001229742.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	258				protein binding	NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)	AAGTTGCTCTTCTCCTTACTAAAGCTCCC	0.536	0									SO:0001651	inframe_deletion	AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299	"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583				Standard	NM_001242809	Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.771_779delTCTCCTTAC	6.37:g.90327729_90327737delTCTCCTTAC	ENSP00000430985:p.Leu258_Thr260del	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	ENST00000522441.1	37	CCDS56441.1																																																																																			ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1	.	.		-18	106						32		68	0.32
ING3	54556	broad.mit.edu	hg19	7	120609120	120609121	+	Frame_Shift_Ins	INS	-	-	TAAT			TCGA-V4-A9F8-01A-11D-A39W-08	TCGA-V4-A9F8-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5401ee40-458b-4fc4-a5ed-074be012c429	62f5b5ee-e92a-431f-93bb-b25314d6aead	g.chr7:120609120_120609121insTAAT	ENST00000315870.5	+	9	918_919	c.770_771insTAAT	c.(769-774)aataatfs	p.-258fs	ING3_ENST00000431467.1_Frame_Shift_Ins_p.-243fs	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3			histone H2A acetylation|histone H4 acetylation|positive regulation of apoptosis|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Piccolo NuA4 histone acetyltransferase complex	zinc ion binding	NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)				GCATTTAAGAATAATGACTTTC	0.342	0									SO:0001589	frameshift_variant	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243	"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493			12080476	Standard	NM_019071	Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.771_774dupTAAT	7.37:g.120609121_120609124dupTAAT	ENSP00000320566:p.Asn258fs	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	ENST00000315870.5	37	CCDS5778.1																																																																																			ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	.	.		1	73					NM_019071	16		44	0.26
