Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
SIK3	23387	broad.mit.edu	hg19	11	116729379	116729379	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr11:116729379G>T	ENST00000375300.1	-	20	2663	c.2658C>A	c.(2656-2658)gaC>gaA	p.D886E	SIK3_ENST00000434315.2_Intron|SIK3_ENST00000292055.4_Missense_Mutation_p.D828E|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000446921.2_Intron			Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	828	Gln-rich.		cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57					AATGCGCCTGGTCGTAGTTAG	0.547	0	79.0	78.0	78.0	11	116729379	2201	4296	6497	SO:0001583	missense	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584		29165	protein-coding gene	gene with protein product		614776			10231032, 8889548	Standard	NM_025164	Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000375300.1:c.2658C>A	11.37:g.116729379G>T	ENSP00000364449:p.Asp886Glu	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	ENST00000375300.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.35|16.35	3.097827|3.097827	0.56075|0.56075	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055|ENST00000445177	T;T|.	0.74002|.	-0.76;-0.8|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.43747|.	U|.	0.000532|.	T|T	0.51805|0.51805	0.1696|0.1696	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P;P|.	0.38223|.	0.623;0.489|.	B;B|.	0.32289|.	0.143;0.068|.	T|T	0.46331|0.46331	-0.9199|-0.9199	10|5	0.39692|.	T|.	0.17|.	.|.	19.5356|19.5356	0.95253|0.95253	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	828;828|.	Q9Y2K2-3;Q9Y2K2|.	.;SIK3_HUMAN|.	E|T	886;828|928	ENSP00000364449:D886E;ENSP00000292055:D828E|.	ENSP00000292055:D828E|.	D|P	-|-	3|1	2|0	SIK3|SIK3	116234589|116234589	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.731000|6.731000	0.74785|0.74785	2.596000|2.596000	0.87737|0.87737	0.655000|0.655000	0.94253|0.94253	GAC|CCA	SIK3-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000142858.1		117.746644	1	-28	65	0	4.14481e-20	1	5.4537e-20	NM_025164	38	117.771358	41	0.481013
GBA2	57704	broad.mit.edu	hg19	9	35741704	35741704	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:35741704G>A	ENST00000378094.4	-	4	1264	c.751C>T	c.(751-753)Cgt>Tgt	p.R251C	GBA2_ENST00000378103.3_Missense_Mutation_p.R251C|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.R257C			Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	251		bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity	NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		GTGATCTGACGGCAGGTGAGG	0.572	0	158.0	151.0	153.0	9	35741704	2203	4300	6503	SO:0001583	missense	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610		18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46	11489889, 23332916, 23332917	Standard	NM_020944	Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.751C>T	9.37:g.35741704G>A	ENSP00000367343:p.Arg251Cys	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381320	0.82792	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.38	4.48	0.54585	Beta-glucosidase, GBA2 type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84179	0.5415	M	0.91196	3.185	0.80722	D	1	P;D;P	0.89917	0.766;1.0;0.804	B;D;B	0.69307	0.158;0.963;0.244	D	0.87981	0.2743	9	0.87932	D	0	-7.9104	14.1405	0.65316	0.0722:0.0:0.9278:0.0	.	257;251;251	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	C	251;251;257	.	ENSP00000367334:R251C	R	-	1	0	GBA2	35731704	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	4.033000	0.57282	1.404000	0.46819	0.563000	0.77884	CGT	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1		210.113086	0	-21	114	0	0	1	0	NM_020944	65	210.121008	63	0.507812
PAG1	55824	broad.mit.edu	hg19	8	81888831	81888831	+	Missense_Mutation	SNP	T	T	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81888831T>G	ENST00000220597.4	-	9	1957	c.1247A>C	c.(1246-1248)gAc>gCc	p.D416A		NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid microdomains 1	416		epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		GCTCTCGTAGTCGTTCTCCTT	0.532	0	158.0	128.0	138.0	8	81888831	2203	4300	6503	SO:0001583	missense	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30					30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		10790433	Standard	XM_006716461	Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1247A>C	8.37:g.81888831T>G	ENSP00000220597:p.Asp416Ala	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	ENST00000220597.4	37	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.340158	0.81911	.	.	ENSG00000076641	ENST00000220597	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.77054	0.4074	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77846	-0.2436	9	0.44086	T	0.13	-34.4554	14.3431	0.66641	0.0:0.0:0.0:1.0	.	416	Q9NWQ8	PAG1_HUMAN	A	416	.	ENSP00000220597:D416A	D	-	2	0	PAG1	82051386	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	5.673000	0.68109	1.920000	0.55613	0.533000	0.62120	GAC	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		-10.206879	0	-17	49	0	0	1	0	NM_018440	5	10.714425	93	0.051020
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		75.537062	0	-5	76	0	0	1	0	NM_002067	26	76.105397	39	0.400000
INPP5E	56623	broad.mit.edu	hg19	9	139333192	139333192	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:139333192A>C	ENST00000371712.3	-	1	1082	c.680T>G	c.(679-681)cTg>cGg	p.L227R		NM_019892.4	NP_063945.2	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	227	13 X 4 AA repeats of P-X-X-P.		cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity	NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)	GGCCCGCACCAGGAGCGGCTG	0.692	0	11.0	14.0	13.0	9	139333192	2183	4279	6462	SO:0001583	missense	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384		21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1	10764818, 10577920, 19668216	Standard	NM_019892	Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.680T>G	9.37:g.139333192A>C	ENSP00000360777:p.Leu227Arg	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	ENST00000371712.3	37	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417168	0.25552	.	.	ENSG00000148384	ENST00000371712	D	0.97906	-4.6	3.7	2.52	0.30459	.	0.781982	0.10826	N	0.629868	D	0.96156	0.8747	L	0.60455	1.87	0.09310	N	1	D;B	0.55172	0.97;0.325	P;B	0.44696	0.458;0.06	D	0.90299	0.4328	10	0.66056	D	0.02	-19.3516	8.5999	0.33738	0.9054:0.0:0.0946:0.0	.	227;227	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	R	227	ENSP00000360777:L227R	ENSP00000360777:L227R	L	-	2	0	INPP5E	138453013	0.031000	0.19500	0.064000	0.19789	0.134000	0.20937	2.304000	0.43655	0.579000	0.29504	0.460000	0.39030	CTG	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1		21.523777	0	8	23	0	0	1	0	NM_019892	7	21.538276	8	0.466667
PAG1	55824	broad.mit.edu	hg19	8	81889006	81889006	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81889006G>A	ENST00000220597.4	-	9	1782	c.1072C>T	c.(1072-1074)Ctc>Ttc	p.L358F		NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid microdomains 1	358		epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		GTAGCATAGAGATCATTACAG	0.507	0	96.0	98.0	97.0	8	81889006	2203	4300	6503	SO:0001583	missense	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30					30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		10790433	Standard	XM_006716461	Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1072C>T	8.37:g.81889006G>A	ENSP00000220597:p.Leu358Phe	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	ENST00000220597.4	37	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269666	0.80469	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.35	5.35	0.76521	.	0.139432	0.49916	D	0.000138	T	0.75989	0.3925	M	0.67953	2.075	0.49051	D	0.999749	D	0.76494	0.999	D	0.74023	0.982	T	0.77081	-0.2720	9	0.54805	T	0.06	-19.9645	13.6026	0.62029	0.0:0.0:0.8445:0.1555	.	358	Q9NWQ8	PAG1_HUMAN	F	358	.	ENSP00000220597:L358F	L	-	1	0	PAG1	82051561	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.085000	0.64468	2.501000	0.84356	0.655000	0.94253	CTC	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		9.843739	0	7	63	0	0	1	0	NM_018440	11	26.157975	94	0.104762
CEP63	80254	broad.mit.edu	hg19	3	134278127	134278127	+	Silent	SNP	C	C	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr3:134278127C>A	ENST00000337090.3	+	14	1982	c.1809C>A	c.(1807-1809)atC>atA	p.I603I	CEP63_ENST00000383229.3_Intron|CEP63_ENST00000513612.2_Silent_p.I603I|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000354446.3_Intron|CEP63_ENST00000606977.1_Silent_p.I603I			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	603		cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding	kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27					GTCCTCAAATCAGCCCTTGCA	0.453	0	174.0	172.0	173.0	3	134278127	2203	4300	6503	SO:0001819	synonymous_variant	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923		25815	protein-coding gene	gene with protein product		614724			14654843, 24240477	Standard	NM_001042383	Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1809C>A	3.37:g.134278127C>A		D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	ENST00000337090.3	37	CCDS3086.1																																																																																			CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1		-33.749739	1	1	139	0	1	1	1	NM_025180	4	6.302497	156	0.025000
GLIS3	169792	broad.mit.edu	hg19	9	4125772	4125772	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr9:4125772C>A	ENST00000324333.10	-	2	286	c.93G>T	c.(91-93)atG>atT	p.M31I	GLIS3_ENST00000381971.3_Missense_Mutation_p.M186I	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	31		negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)	TGGCTGCATTCATTGCCCTCT	0.463	0	230.0	201.0	211.0	9	4125772	2203	4300	6503	SO:0001583	missense	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249	"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515	14500813	Standard	NM_152629	Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.558G>T	9.37:g.4125772C>A	ENSP00000371398:p.Met186Ile	B1AL19|Q1PHK5	ENST00000381971.3	37	CCDS43784.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525742	0.44969	.	.	ENSG00000107249	ENST00000324333;ENST00000381971;ENST00000477901;ENST00000478844;ENST00000481827;ENST00000478315;ENST00000462164	T;T	0.10573	2.89;2.86	5.27	5.27	0.74061	.	0.425772	0.21640	N	0.071346	T	0.08044	0.0201	N	0.14661	0.345	0.26454	N	0.97555	B;B;B	0.12013	0.005;0.005;0.003	B;B;B	0.16289	0.009;0.015;0.004	T	0.21008	-1.0258	10	0.48119	T	0.1	.	14.1821	0.65580	0.1497:0.8503:0.0:0.0	.	61;186;31	Q1PHJ1;Q8NEA6-2;Q8NEA6	.;.;GLIS3_HUMAN	I	31;186;186;31;186;31;31	ENSP00000325494:M31I;ENSP00000371398:M186I	ENSP00000325494:M31I	M	-	3	0	GLIS3	4115772	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.524000	0.53495	2.632000	0.89209	0.650000	0.86243	ATG	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354776.1		187.406679	1	-7	108	0	3.61411e-23	1	5.0196e-23	NM_152629	63	187.599349	74	0.459854
EHD3	30845	broad.mit.edu	hg19	2	31484502	31484502	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr2:31484502C>G	ENST00000322054.5	+	5	1288	c.1003C>G	c.(1003-1005)Ctg>Gtg	p.L335V	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	335		blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)				GGTCAACAACCTGGCCGAGAT	0.567	0	144.0	134.0	138.0	2	31484502	2203	4300	6503	SO:0001583	missense	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016	"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3	10673336	Standard	NM_014600	Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1003C>G	2.37:g.31484502C>G	ENSP00000327116:p.Leu335Val	B4DFR5|D6W574|Q8N514|Q9NZB3	ENST00000322054.5	37	CCDS1774.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956379	0.53293	.	.	ENSG00000013016	ENST00000322054	T	0.21734	1.99	6.04	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.48926	0.1527	H	0.94925	3.6	0.80722	D	1	D	0.63046	0.992	P	0.58577	0.841	T	0.58978	-0.7540	10	0.87932	D	0	-21.9698	7.1544	0.25628	0.0:0.722:0.0:0.278	.	335	Q9NZN3	EHD3_HUMAN	V	335	ENSP00000327116:L335V	ENSP00000327116:L335V	L	+	1	2	EHD3	31338006	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	2.600000	0.46240	1.568000	0.49683	0.561000	0.74099	CTG	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1		339.193050	0	22	125	0	0	1	0	NM_014600	108	339.682481	87	0.553846
OR5L2	26338	broad.mit.edu	hg19	11	55594926	55594926	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr11:55594926G>T	ENST00000378397.1	+	1	232	c.232G>T	c.(232-234)Gtg>Ttg	p.V78L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	78		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)			CTCAATAATTGTGCCAAAGAT	0.458	0	215.0	200.0	206.0	11	55594926	2200	4296	6496	SO:0001583	missense	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030	"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product					1370859	Standard	NM_001004739	Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.232G>T	11.37:g.55594926G>T	ENSP00000367650:p.Val78Leu	Q6IF66|Q96RB2	ENST00000378397.1	37	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	10.38	1.333860	0.24253	.	.	ENSG00000205030	ENST00000378397	T	0.01347	4.99	5.13	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	0.484376	0.17323	N	0.178425	T	0.01489	0.0048	L	0.37800	1.135	0.09310	N	1	B	0.17852	0.024	B	0.18871	0.023	T	0.43556	-0.9384	10	0.72032	D	0.01	-7.7101	7.5047	0.27538	0.4833:0.0:0.5167:0.0	.	78	Q8NGL0	OR5L2_HUMAN	L	78	ENSP00000367650:V78L	ENSP00000367650:V78L	V	+	1	0	OR5L2	55351502	0.000000	0.05858	0.632000	0.29296	0.484000	0.33280	-0.976000	0.03786	0.306000	0.22856	-0.180000	0.13094	GTG	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1		81.926459	1	5	173	0	2.87052e-16	1	3.58815e-16	NM_001004739	38	100.112822	163	0.189055
PAG1	55824	broad.mit.edu	hg19	8	81888821	81888821	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr8:81888821G>T	ENST00000220597.4	-	9	1967	c.1257C>A	c.(1255-1257)agC>agA	p.S419R		NM_018440.3	NP_060910.3	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid microdomains 1	419		epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity	breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)		AGTCACTTATGCTCTCGTAGT	0.512	0	165.0	133.0	144.0	8	81888821	2203	4300	6503	SO:0001583	missense	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30					30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""		10790433	Standard	XM_006716461	Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1257C>A	8.37:g.81888821G>T	ENSP00000220597:p.Ser419Arg	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	ENST00000220597.4	37	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743857	0.69418	.	.	ENSG00000076641	ENST00000220597	.	.	.	4.84	2.98	0.34508	.	0.092128	0.64402	D	0.000001	T	0.70954	0.3283	M	0.69823	2.125	0.48135	D	0.999596	D	0.76494	0.999	D	0.85130	0.997	T	0.72587	-0.4248	9	0.87932	D	0	-23.8918	9.0924	0.36619	0.2471:0.0:0.7529:0.0	.	419	Q9NWQ8	PAG1_HUMAN	R	419	.	ENSP00000220597:S419R	S	-	3	2	PAG1	82051376	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.990000	0.29642	1.136000	0.42199	0.655000	0.94253	AGC	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3		-8.400084	1	-29	45	0	0.00116845	1	0.00132778	NM_018440	5	10.032392	84	0.056180
APBA3	9546	hgsc.bcm.edu	hg19	19	3759879	3759879	+	Silent	SNP	A	A	G			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a																										GAGGCTCTTCAGGACCAGTCT	0.642	0	31.0	39.0	36.0	19	3759879	2201	4298	6499	SO:0001819	synonymous_variant	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132		580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262			10049767	Standard	NM_004886	Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.384T>C	19.37:g.3759879A>G		O60483|Q9UPZ2	ENST00000316757.3	37	CCDS12110.1																																																																																			APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2				-21	58						7		111	
LCE3D	84648	broad.mit.edu	hg19	1	152552268	152552268	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:152552268C>T	ENST00000368787.3	-	2	201	c.145G>A	c.(145-147)Gag>Aag	p.E49K		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	49		keratinization			breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)	CAGCCGCCCTCGGAGCTAGGG	0.672	0	48.0	57.0	54.0	1	152552268	2203	4296	6499	SO:0001583	missense	BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202	"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A	11698679	Standard	NM_032563	Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.145G>A	1.37:g.152552268C>T	ENSP00000357776:p.Glu49Lys	Q3MIL1	ENST00000368787.3	37	CCDS1014.1	.	.	.	.	.	.	.	.	.	.	C	9.089	1.001242	0.19121	.	.	ENSG00000163202	ENST00000368787	T	0.03920	3.76	3.6	2.68	0.31781	.	.	.	.	.	T	0.01765	0.0056	.	.	.	0.09310	N	1	P	0.50710	0.938	B	0.40741	0.339	T	0.46176	-0.9210	8	0.87932	D	0	.	7.1674	0.25698	0.0:0.872:0.0:0.128	.	49	Q9BYE3	LCE3D_HUMAN	K	49	ENSP00000357776:E49K	ENSP00000357776:E49K	E	-	1	0	LCE3D	150818892	0.001000	0.12720	0.111000	0.21465	0.678000	0.39670	0.483000	0.22292	0.850000	0.35239	0.655000	0.94253	GAG	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1		83.551137	0	-22	62	0	0	1	0	NM_032563	29	85.211735	54	0.349398
NELFE	7936	broad.mit.edu	hg19	6	31921529	31921529	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr6:31921529C>T	ENST00000375429.3	-	10	1248	c.1022G>A	c.(1021-1023)gGc>gAc	p.G341D	NELFE_ENST00000444811.2_Missense_Mutation_p.G311D|NELFE_ENST00000375425.5_Missense_Mutation_p.G348D	NM_002904.5	NP_002895.3			negative elongation factor complex member E												GACAGACTTGCCAGTAGCGGC	0.562	0	128.0	130.0	129.0	6	31921529	1510	2708	4218	SO:0001583	missense	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356	"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP		Standard	XM_006715205	Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.1022G>A	6.37:g.31921529C>T	ENSP00000364578:p.Gly341Asp	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	ENST00000375429.3	37	CCDS4730.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112182	0.77210	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811	T;T;T	0.48522	0.85;0.84;0.81	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.48003	0.1476	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.67145	0.996;0.982;0.982	D;P;P	0.68039	0.955;0.834;0.772	T	0.49051	-0.8979	10	0.40728	T	0.16	-28.8283	16.444	0.83910	0.0:0.8684:0.1316:0.0	.	311;336;341	B4DUN1;E9PCL7;P18615	.;.;NELFE_HUMAN	D	341;348;311	ENSP00000364578:G341D;ENSP00000364574:G348D;ENSP00000388400:G311D	ENSP00000364574:G348D	G	-	2	0	RDBP	32029508	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.094000	0.76944	1.567000	0.49668	0.655000	0.94253	GGC	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		-50.595356	0	-22	93	0	0	1	0		4	6.359201	214	0.018349
POM121	9883	broad.mit.edu	hg19	7	72398976	72398976	+	Missense_Mutation	SNP	A	A	G	rs147859349		TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr7:72398976A>G	ENST00000395270.1	+	7	1322	c.281A>G	c.(280-282)aAt>aGt	p.N94S	POM121_ENST00000257622.4_Missense_Mutation_p.N94S|POM121_ENST00000358357.3_Missense_Mutation_p.N94S|POM121_ENST00000434423.2_Missense_Mutation_p.N359S|POM121_ENST00000446813.1_Missense_Mutation_p.N94S	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	359	Pore side (Potential).|Required for targeting to the nucleus and nuclear pore complex.	carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)			CTGGTGGCCAATGGAGTCCCC	0.468	0	189.0	188.0	188.0	7	72398976	2203	4300	6503	SO:0001583	missense	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313	"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""		8335683, 9734811, 17900573	Standard	NM_172020	Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.281A>G	7.37:g.72398976A>G	ENSP00000378687:p.Asn94Ser	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	ENST00000395270.1	37	CCDS59059.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002131	0.35320	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52	3.99	3.99	0.46301	.	0.154071	0.30020	N	0.010614	T	0.13457	0.0326	L	0.57536	1.79	0.32153	N	0.584002	B;B	0.31193	0.312;0.006	B;B	0.26202	0.067;0.053	T	0.08066	-1.0740	10	0.30078	T	0.28	.	10.8045	0.46509	1.0:0.0:0.0:0.0	.	94;359	A8MXF9;Q96HA1	.;P121A_HUMAN	S	94;94;94;94;359	ENSP00000393020:N94S;ENSP00000257622:N94S;ENSP00000378687:N94S;ENSP00000351124:N94S;ENSP00000405562:N359S	ENSP00000257622:N94S	N	+	2	0	POM121	72036912	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.143000	0.64826	1.663000	0.50791	0.373000	0.22412	AAT	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1		-69.552490	0	-46	228	0	0	1	0		4	6.499716	279	0.014134
SF3B1	23451	broad.mit.edu	hg19	2	198267484	198267484	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr2:198267484G>A	ENST00000335508.6	-	14	1964	c.1873C>T	c.(1873-1875)Cgt>Tgt	p.R625C		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		GTTGTGTTACGGACATACTCA	0.433	5	93.0	90.0	91.0	2	198267484	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1873C>T	2.37:g.198267484G>A	ENSP00000335321:p.Arg625Cys	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873082	0.72180	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.90331	0.6975	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.93337	0.6706	10	0.87932	D	0	.	15.2676	0.73675	0.0:0.0:0.7451:0.2549	.	625	O75533	SF3B1_HUMAN	C	625	ENSP00000335321:R625C	ENSP00000335321:R625C	R	-	1	0	SF3B1	197975729	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.689000	0.61723	1.444000	0.47605	-0.182000	0.12963	CGT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		91.705124	0	9	63	0	0	1	0		28	91.811864	23	0.549020
SELE	6401	broad.mit.edu	hg19	1	169698338	169698338	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:169698338G>T	ENST00000333360.7	-	7	1218	c.1079C>A	c.(1078-1080)cCa>cAa	p.P360Q	SELE_ENST00000367775.1_Missense_Mutation_p.P298Q|SELE_ENST00000367776.1_Missense_Mutation_p.P360Q|SELE_ENST00000367779.4_Missense_Mutation_p.P360Q|SELE_ENST00000367774.1_Missense_Mutation_p.P360Q|SELE_ENST00000367777.1_Missense_Mutation_p.P360Q|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367781.4_Missense_Mutation_p.P360Q|SELE_ENST00000367780.4_Missense_Mutation_p.P298Q|SELE_ENST00000367782.4_Missense_Mutation_p.P360Q	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	360	Sushi 3.	actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity	breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				TTCACAAACTGGGATTTGCTG	0.428	0	86.0	83.0	84.0	1	169698338	2203	4300	6503	SO:0001583	missense	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908	"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM	1375831	Standard	NM_000450	Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1079C>A	1.37:g.169698338G>T	ENSP00000331736:p.Pro360Gln	A2RRD6|P16111	ENST00000333360.7	37	CCDS1283.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678221	0.47886	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	D;D;D;T;T;D;D;D;T	0.86562	-2.14;-2.14;-2.14;-1.08;-1.08;-2.14;-2.14;-2.14;-1.08	5.13	5.13	0.70059	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.41294	D	0.000906	D	0.96636	0.8902	H	0.99659	4.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98501	1.0614	10	0.87932	D	0	-13.107	16.1046	0.81212	0.0:0.0:1.0:0.0	.	360	P16581	LYAM2_HUMAN	Q	360;360;298;360;360;360;298;360;360	ENSP00000356755:P360Q;ENSP00000356756:P360Q;ENSP00000356754:P298Q;ENSP00000356753:P360Q;ENSP00000331736:P360Q;ENSP00000356751:P360Q;ENSP00000356749:P298Q;ENSP00000356750:P360Q;ENSP00000356748:P360Q	ENSP00000331736:P360Q	P	-	2	0	SELE	167964962	1.000000	0.71417	0.066000	0.19879	0.006000	0.05464	8.765000	0.91724	2.378000	0.81104	0.650000	0.86243	CCA	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1		55.510713	1	-16	52	0	1.28384e-07	1	1.52838e-07	NM_000450	19	56.339646	33	0.365385
GPATCH3	63906	broad.mit.edu	hg19	1	27223862	27223862	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:27223862G>T	ENST00000361720.5	-	2	829	c.806C>A	c.(805-807)cCa>cAa	p.P269Q		NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	269	Glu-rich.		intracellular	nucleic acid binding	endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)	GGGGCTGGCTGGTATATCTGC	0.517	0	180.0	181.0	181.0	1	27223862	2203	4300	6503	SO:0001583	missense	BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746	"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3		Standard	NM_022078	Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.806C>A	1.37:g.27223862G>T	ENSP00000354645:p.Pro269Gln	Q5JYH2|Q8NDJ2|Q9H9Z3	ENST00000361720.5	37	CCDS290.1	.	.	.	.	.	.	.	.	.	.	G	3.448	-0.112556	0.06881	.	.	ENSG00000198746	ENST00000361720;ENST00000536641;ENST00000374122	T	0.42900	0.96	4.65	3.74	0.42951	.	0.345073	0.30969	N	0.008508	T	0.15782	0.0380	N	0.03115	-0.41	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.10245	-1.0638	10	0.23302	T	0.38	-0.0884	3.3644	0.07198	0.2438:0.0:0.562:0.1942	.	269	Q96I76	GPTC3_HUMAN	Q	269;251;80	ENSP00000354645:P269Q	ENSP00000354645:P269Q	P	-	2	0	GPATCH3	27096449	0.037000	0.19845	0.054000	0.19295	0.085000	0.17905	0.759000	0.26461	1.165000	0.42670	0.655000	0.94253	CCA	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1		-12.179015	1	-12	121	0	0.150653	1	0.163754	NM_022078	4	7.808092	86	0.044444
KATNBL1	79768	broad.mit.edu	hg19	15	34439412	34439412	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr15:34439412G>T	ENST00000256544.3	-	7	829	c.687C>A	c.(685-687)agC>agA	p.S229R		NM_024713.2	NP_078989.1			katanin p80 subunit B-like 1												CTTCAAATTTGCTTTTAAGTA	0.333	0	59.0	60.0	60.0	15	34439412	2201	4298	6499	SO:0001583	missense	AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152		26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29	11230166	Standard	NM_024713	Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.687C>A	15.37:g.34439412G>T	ENSP00000256544:p.Ser229Arg	A8KAF6|Q2TAC0|Q9H670	ENST00000256544.3	37	CCDS10034.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780327	0.70222	.	.	ENSG00000134152	ENST00000256544;ENST00000540594	.	.	.	5.7	4.6	0.57074	.	0.070397	0.85682	D	0.000000	T	0.75729	0.3889	M	0.71036	2.16	0.49582	D	0.999802	D	0.76494	0.999	D	0.75020	0.985	T	0.77558	-0.2543	9	0.72032	D	0.01	.	11.9943	0.53191	0.1472:0.0:0.8528:0.0	.	229	Q9H079	CO029_HUMAN	R	229;133	.	ENSP00000256544:S229R	S	-	3	2	C15orf29	32226704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.573000	0.53856	2.692000	0.91855	0.591000	0.81541	AGC	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251520.1		-5.724703	1	-26	24	0	1	1	1	NM_024713	3	6.330435	54	0.052632
RP11-193H5.1	0	broad.mit.edu	hg19	1	238090905	238090905	+	RNA	DEL	C	C	-			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr1:238090905delC	ENST00000450451.1	+	0	2411					NR_027247.2																CATCCCGGTGCCACTAATGTG	0.488	0																																				1.37:g.238090905delC			ENST00000450451.1	37																																																																																				RP11-193H5.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000095477.1	.	.		-3	7						2		4	0.33
LLNLF-65H9.1	0	broad.mit.edu	hg19	19	28388014	28388015	+	RNA	INS	-	-	T			TCGA-VD-A8KA-01B-11D-A39W-08	TCGA-VD-A8KA-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2739b097-1916-48a4-b585-bb514e2dcf40	63607a4e-c047-4242-8e10-86e52e9c523a	g.chr19:28388014_28388015insT	ENST00000592806.1	+	0	163																					GGACTTCTCTGTTTTTTTTCCT	0.554	0																																				19.37:g.28388022_28388022dupT			ENST00000592806.1	37																																																																																				LLNLF-65H9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000452876.1	.	.		0	5						2		4	0.33
