Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
EIF1AX	1964	broad.mit.edu	hg19	X	20156732	20156732	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chrX:20156732C>G	ENST00000379607.5	-	2	228	c.25G>C	c.(25-27)Ggt>Cgt	p.G9R	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	9			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					CTGTTTTTACCTCCTTTACCT	0.313	0	141.0	131.0	134.0	X	20156732	2203	4300	6503	SO:0001583	missense	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.25G>C	X.37:g.20156732C>G	ENSP00000368927:p.Gly9Arg	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478585	0.63849	.	.	ENSG00000173674	ENST00000379607	T	0.47528	0.84	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.77018	0.4069	M	0.93763	3.455	0.80722	D	1	D	0.67145	0.996	D	0.79784	0.993	D	0.83927	0.0304	9	0.62326	D	0.03	-11.9247	17.661	0.88193	0.0:1.0:0.0:0.0	.	9	P47813	IF1AX_HUMAN	R	9	ENSP00000368927:G9R	ENSP00000368927:G9R	G	-	1	0	EIF1AX	20066653	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGT	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		194.341419	0	-15	152	0	0	1	0		56	202.553189	9	0.861538
PCDH10	57575	broad.mit.edu	hg19	4	134084205	134084205	+	Silent	SNP	T	T	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr4:134084205T>C	ENST00000264360.5	+	4	3697	c.2871T>C	c.(2869-2871)tcT>tcC	p.S957S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10			homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)	GGATGCCTTCTTTTGTCCCTT	0.493	1	176.0	149.0	158.0	4	134084205	2203	4300	6503	SO:0001819	synonymous_variant	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650	"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286			10835267	Standard	NM_020815	Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2871T>C	4.37:g.134084205T>C		Q4W5F6|Q96SF0	ENST00000264360.5	37	CCDS34063.1																																																																																			PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2		87.584620	0	-22	56	0	0	1	0	NM_032961	28	88.363124	44	0.388889
F12	2161	broad.mit.edu	hg19	5	176831398	176831398	+	Missense_Mutation	SNP	T	T	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr5:176831398T>A	ENST00000253496.3	-	9	865	c.817A>T	c.(817-819)Atc>Ttc	p.I273F		NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	273	Kringle.	Factor XII activation|fibrinolysis|innate immune response|positive regulation of blood coagulation|positive regulation of fibrinolysis|positive regulation of plasminogen activation|protein autoprocessing|response to misfolded protein|zymogen activation	extracellular space|plasma membrane	serine-type endopeptidase activity	central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		CACGGGCGGATGTCGTTGTCC	0.726	0	13.0	16.0	15.0	5	176831398	2194	4289	6483	SO:0001583	missense	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187		3530	protein-coding gene	gene with protein product		610619				Standard	NM_000505	Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.817A>T	5.37:g.176831398T>A	ENSP00000253496:p.Ile273Phe	P78339	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.285006	0.59867	.	.	ENSG00000131187	ENST00000253496	T	0.66815	-0.23	4.92	2.46	0.29980	Kringle (5);Kringle-like fold (1);Kringle, conserved site (1);	0.804463	0.10753	N	0.638066	T	0.53738	0.1815	L	0.33245	0.995	0.80722	D	1	B	0.32010	0.351	B	0.32149	0.141	T	0.46721	-0.9171	10	0.62326	D	0.03	.	7.0303	0.24962	0.0:0.08:0.1486:0.7714	.	273	P00748	FA12_HUMAN	F	273	ENSP00000253496:I273F	ENSP00000253496:I273F	I	-	1	0	F12	176764004	0.690000	0.27699	0.994000	0.49952	0.916000	0.54674	0.864000	0.27926	0.347000	0.23924	-0.411000	0.06167	ATC	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		30.612453	0	-6	27	0	0	1	0		11	30.984681	18	0.379310
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		253.576717	0	-5	107	0	0	1	0	NM_002072	74	255.008887	46	0.616667
CLDN2	9075	broad.mit.edu	hg19	X	106171760	106171760	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chrX:106171760G>C	ENST00000541806.1	+	2	821	c.302G>C	c.(301-303)gGc>gCc	p.G101A	CLDN2_ENST00000540876.1_Missense_Mutation_p.G101A|CLDN2_ENST00000336803.1_Missense_Mutation_p.G101A	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	101		calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity	endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9					TCTGTGGTGGGCATGAGATGC	0.572	0	134.0	107.0	116.0	X	106171760	2203	4300	6503	SO:0001583	missense	AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376	"""Claudins"""	2041	protein-coding gene	gene with protein product		300520			9892664	Standard	NM_020384	Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.302G>C	X.37:g.106171760G>C	ENSP00000441283:p.Gly101Ala	B2R6B9	ENST00000541806.1	37	CCDS14524.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843013	0.71488	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.90955	-2.76;-2.76;-2.76	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.95538	0.8550	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95899	0.8913	10	0.59425	D	0.04	.	15.266	0.73663	0.0:0.0:1.0:0.0	.	101	P57739	CLD2_HUMAN	A	101	ENSP00000441283:G101A;ENSP00000443230:G101A;ENSP00000336571:G101A	ENSP00000336571:G101A	G	+	2	0	CLDN2	106058416	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.807000	0.99171	2.195000	0.70347	0.523000	0.50628	GGC	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057815.1		-5.212945	0	-1	104	0	0	1	0		3	6.554177	53	0.053571
EFHC1	114327	broad.mit.edu	hg19	6	52319006	52319006	+	Silent	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr6:52319006C>T	ENST00000371068.5	+	5	940	c.837C>T	c.(835-837)caC>caT	p.H279H	EFHC1_ENST00000538167.1_Silent_p.H260H|EFHC1_ENST00000433625.2_Silent_p.H188H	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	279	DM10 2.		axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding	breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)				GAGAGGTCCACGAACGGAATG	0.433	0	187.0	169.0	175.0	6	52319006	2203	4300	6503	SO:0001819	synonymous_variant	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093	"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM	15258581	Standard	NM_018100	Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.837C>T	6.37:g.52319006C>T		B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	ENST00000371068.5	37	CCDS4942.1																																																																																			EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2		21.745572	0	-26	76	0	0	1	0	NM_018100	15	37.985273	104	0.126050
TPPP2	122664	broad.mit.edu	hg19	14	21498873	21498873	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr14:21498873G>A	ENST00000321760.6	+	2	281	c.133G>A	c.(133-135)Gtc>Atc	p.V45I	TPPP2_ENST00000460647.2_Missense_Mutation_p.V45I|TPPP2_ENST00000530140.2_Missense_Mutation_p.V45I|NDRG2_ENST00000403829.3_Intron	NM_173846.4	NP_776245.2	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family member 2	45			cytoplasm		endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	TGGCAAGACAGTCACCTCCAC	0.507	0	98.0	71.0	80.0	14	21498873	2203	4300	6503	SO:0001583	missense	AY072034	CCDS9566.1	14q11.2	2014-01-21	2007-05-02	2007-05-02	ENSG00000179636	ENSG00000179636		19293	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 8"""	C14orf8	15590652, 17105200	Standard	NM_173846	Approved	p25beta, p18, CT152	uc001vzh.3	P59282	OTTHUMG00000029642	ENST00000321760.6:c.133G>A	14.37:g.21498873G>A	ENSP00000317595:p.Val45Ile	Q2VYF3	ENST00000321760.6	37	CCDS9566.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543732	0.27563	.	.	ENSG00000179636	ENST00000321760;ENST00000460647;ENST00000530140;ENST00000472458;ENST00000481535	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.37	3.16	0.36331	.	0.065286	0.64402	D	0.000010	T	0.23572	0.0570	N	0.20401	0.57	0.45837	D	0.998709	B	0.13145	0.007	B	0.22753	0.041	T	0.04693	-1.0933	10	0.10902	T	0.67	-30.2782	8.2739	0.31860	0.231:0.0:0.769:0.0	.	45	P59282	TPPP2_HUMAN	I	45;45;45;45;40	ENSP00000317595:V45I;ENSP00000427504:V45I;ENSP00000435356:V45I;ENSP00000423171:V45I;ENSP00000421438:V40I	ENSP00000317595:V45I	V	+	1	0	TPPP2	20568713	1.000000	0.71417	0.858000	0.33744	0.788000	0.44548	3.417000	0.52714	1.394000	0.46624	0.655000	0.94253	GTC	TPPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073914.3		31.648567	0	-9	32	0	0	1	0	NM_173846	10	31.658942	11	0.476190
IMPG2	50939	ucsc.edu	hg19	3	100995550	100995550	+	Silent	SNP	G	G	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8																										GGAGAAGACAGTTCAGAGCTA	0.333	0	57.0	60.0	59.0	3	100995550	2203	4300	6503	SO:0001819	synonymous_variant	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148		18362	protein-coding gene	gene with protein product		607056			10542133	Standard	NM_016247	Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.541C>T	3.37:g.100995550G>A		A8MWT5|Q9UKD4|Q9UKK5	ENST00000193391.7	37	CCDS2940.1																																																																																			IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3				-22	30						4		31	
LIFR	3977	broad.mit.edu	hg19	5	38496650	38496650	+	Silent	SNP	T	T	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr5:38496650T>C	ENST00000263409.4	-	13	1881	c.1719A>G	c.(1717-1719)gtA>gtG	p.V573V	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Silent_p.V573V	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	573	Fibronectin type-III 4.	positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity	NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)				ATGAACACGATACATTGTAGG	0.383	2	184.0	157.0	166.0	5	38496650	2203	4300	6503	SO:0001819	synonymous_variant	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594	"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""		1915266	Standard	NM_001127671	Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1719A>G	5.37:g.38496650T>C		Q6LCD9	ENST00000263409.4	37	CCDS3927.1																																																																																			LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1		119.398576	0	-3	78	0	0	1	0	NM_002310	36	119.468690	41	0.467532
MYF6	4618	broad.mit.edu	hg19	12	81101600	81101600	+	Silent	SNP	T	T	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr12:81101600T>C	ENST00000228641.3	+	1	324	c.102T>C	c.(100-102)taT>taC	p.Y34Y		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	34		muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity	central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26					CTCCTTTGTATCCAGGGAGTG	0.557	0	87.0	89.0	88.0	12	81101600	2203	4300	6503	SO:0001819	synonymous_variant		CCDS9019.1	12q21	2013-05-21				ENSG00000111046	"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991			8978788	Standard	NM_002469	Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.102T>C	12.37:g.81101600T>C		B2R898|Q53X80|Q6FHI9	ENST00000228641.3	37	CCDS9019.1																																																																																			MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1		-4.053838	0	9	70	0	0	1	0	NM_002469	4	8.715564	60	0.062500
OSBPL1A	114876	broad.mit.edu	hg19	18	21746564	21746564	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr18:21746564C>T	ENST00000319481.3	-	26	2844	c.2638G>A	c.(2638-2640)Gcc>Acc	p.A880T	OSBPL1A_ENST00000357041.4_Missense_Mutation_p.A498T|OSBPL1A_ENST00000399443.3_Missense_Mutation_p.A367T	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	880		cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding	breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)				TTTTCCATGGCTCTGATGTCA	0.428	0	216.0	189.0	198.0	18	21746564	2203	4300	6503	SO:0001583	missense	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447	"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B	11279184, 10588946	Standard	NM_080597	Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2638G>A	18.37:g.21746564C>T	ENSP00000320291:p.Ala880Thr	B7Z7D3|Q9BZF5|Q9NW87	ENST00000319481.3	37	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577381	0.86645	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.37235	1.21;1.21;1.21	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71414	-0.4600	10	0.23302	T	0.38	-16.6041	19.7395	0.96220	0.0:1.0:0.0:0.0	.	880	Q9BXW6	OSBL1_HUMAN	T	880;367;498	ENSP00000320291:A880T;ENSP00000382372:A367T;ENSP00000349545:A498T	ENSP00000320291:A880T	A	-	1	0	OSBPL1A	20000562	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.740000	0.84986	2.737000	0.93849	0.585000	0.79938	GCC	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1		-13.571071	0	-44	99	0	0	1	0	NM_080597	4	7.255512	89	0.043011
CWC25	54883	broad.mit.edu	hg19	17	36971161	36971161	+	Silent	SNP	A	A	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr17:36971161A>T	ENST00000225428.5	-	3	678	c.381T>A	c.(379-381)ctT>ctA	p.L127L	CWC25_ENST00000536127.1_Silent_p.L64L	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)						central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14					CCATGTCAAGAAGGGAATTGG	0.512	0	59.0	60.0	60.0	17	36971161	1912	4126	6038	SO:0001819	synonymous_variant	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559		25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49	19941820	Standard	NM_017748	Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.381T>A	17.37:g.36971161A>T		A0JLM3|Q68DK5	ENST00000225428.5	37	CCDS45663.1																																																																																			CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6		14.136289	0	-20	24	0	0	1	0	NM_017748	6	15.863596	20	0.230769
COG1	9382	broad.mit.edu	hg19	17	71193207	71193207	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr17:71193207C>G	ENST00000299886.4	+	3	809	c.729C>G	c.(727-729)aaC>aaG	p.N243K		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	243		Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)		AACTTCTCAACCAGCCACACC	0.532	0	38.0	42.0	41.0	17	71193207	2203	4300	6503	SO:0001583	missense		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685	"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB	9927668	Standard	NM_018714	Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.729C>G	17.37:g.71193207C>G	ENSP00000299886:p.Asn243Lys	Q9NPV9|Q9P2G6	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.462976	0.26248	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.22945	1.93;1.93	5.62	0.745	0.18359	.	0.097977	0.64402	D	0.000002	T	0.19127	0.0459	L	0.57536	1.79	0.58432	D	0.99999	B;B;B	0.29085	0.232;0.148;0.232	B;B;B	0.32342	0.144;0.075;0.144	T	0.09684	-1.0663	10	0.06099	T	0.92	-13.5482	7.4234	0.27085	0.1166:0.6138:0.0:0.2696	.	243;243;243	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	K	243	ENSP00000400111:N243K;ENSP00000299886:N243K	ENSP00000299886:N243K	N	+	3	2	COG1	68704802	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.880000	0.39628	0.305000	0.22832	-0.768000	0.03414	AAC	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		49.391623	0	-9	40	0	0	1	0		16	49.823964	25	0.390244
TECTA	7007	broad.mit.edu	hg19	11	120980087	120980087	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr11:120980087G>T	ENST00000392793.1	+	4	637	c.366G>T	c.(364-366)ttG>ttT	p.L122F	TECTA_ENST00000264037.2_Missense_Mutation_p.L122F			O75443	TECTA_HUMAN	tectorin alpha	122	NIDO.	cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	CTGCCATCTTGAAAAGAGCCA	0.488	0	102.0	101.0	101.0	11	120980087	2203	4299	6502	SO:0001583	missense	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927		11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21	9503015, 9590290	Standard	NM_005422	Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.366G>T	11.37:g.120980087G>T	ENSP00000376543:p.Leu122Phe		ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.183077	0.57800	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.51817	0.69;0.69	5.57	4.6	0.57074	Nidogen, extracellular domain (2);	0.000000	0.64402	D	0.000002	T	0.76673	0.4020	M	0.93375	3.41	0.39632	D	0.970184	D	0.71674	0.998	D	0.83275	0.996	D	0.84265	0.0485	10	0.87932	D	0	.	16.8119	0.85724	0.0:0.2202:0.7798:0.0	.	122	O75443	TECTA_HUMAN	F	122	ENSP00000376543:L122F;ENSP00000264037:L122F	ENSP00000264037:L122F	L	+	3	2	TECTA	120485297	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.782000	0.38654	2.630000	0.89119	0.655000	0.94253	TTG	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1		-1.108041	1	-11	39	0	1	1	1	NM_005422	3	6.306865	37	0.075000
KBTBD4	55709	broad.mit.edu	hg19	11	47594939	47594939	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr11:47594939G>A	ENST00000533290.1	-	3	1889	c.1175C>T	c.(1174-1176)gCt>gTt	p.A392V	PTPMT1_ENST00000527079.2_3'UTR|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000526005.1_Missense_Mutation_p.A367V|KBTBD4_ENST00000395288.2_Missense_Mutation_p.A367V|KBTBD4_ENST00000430070.2_Missense_Mutation_p.A383V			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	367					NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24					CCCTGACACAGCCACCTCTAG	0.512	0	90.0	89.0	89.0	11	47594939	2201	4298	6499	SO:0001583	missense	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444	"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4	11042152	Standard	NM_018095	Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.1100C>T	11.37:g.47594939G>A	ENSP00000433340:p.Ala367Val	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	ENST00000526005.1	37	CCDS7940.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916031	0.92178	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000430070	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.8	5.8	0.92144	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.78997	0.4372	L	0.49778	1.585	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.993	D;D;D	0.72338	0.941;0.977;0.942	T	0.76825	-0.2816	10	0.45353	T	0.12	-13.8469	20.0479	0.97616	0.0:0.0:1.0:0.0	.	383;367;392	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	V	367;392;367;383	ENSP00000433340:A367V;ENSP00000436713:A392V;ENSP00000378703:A367V;ENSP00000415106:A383V	ENSP00000378703:A367V	A	-	2	0	KBTBD4	47551515	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.736000	0.93811	0.563000	0.77884	GCT	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1		-10.174693	0	-7	85	0	0	1	0	NM_016506	4	6.526016	74	0.051282
ACOX1	51	broad.mit.edu	hg19	17	73942871	73942871	+	Silent	SNP	G	G	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr17:73942871G>A	ENST00000537812.1	-	14	2475	c.1827C>T	c.(1825-1827)caC>caT	p.H609H	ACOX1_ENST00000301608.4_Silent_p.H647H|ACOX1_ENST00000293217.5_Silent_p.H647H	NM_001185039.1	NP_001171968.1	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	647		fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|prostaglandin metabolic process|very long-chain fatty acid metabolic process	peroxisomal matrix	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity|flavin adenine dinucleotide binding|protein N-terminus binding	large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					TGTAAGATTCGTGGACCTGTG	0.378	0	89.0	85.0	86.0	17	73942871	2203	4300	6503	SO:0001819	synonymous_variant	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""		8159712	Standard	NM_007292	Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000293217.5:c.1941C>T	17.37:g.73942871G>A		A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	ENST00000293217.5	37	CCDS11734.1																																																																																			ACOX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439500.2		7.748682	0	-9	35	0	0	1	0		5	12.761347	33	0.131579
STAB1	23166	broad.mit.edu	hg19	3	52537488	52537488	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr3:52537488C>T	ENST00000321725.6	+	8	899	c.823C>T	c.(823-825)Cca>Tca	p.P275S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	275		cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)	GCCCAAGGACCCATGCACTGA	0.627	0	86.0	81.0	82.0	3	52537488	2203	4300	6503	SO:0001583	missense	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327		18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560			11829752, 12077138	Standard	XM_005264973	Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.823C>T	3.37:g.52537488C>T	ENSP00000312946:p.Pro275Ser	A7E297|Q8IUH0|Q8IUH1|Q93072	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829459	0.71258	.	.	ENSG00000010327	ENST00000321725	T	0.10860	2.83	5.58	4.71	0.59529	.	0.131674	0.51477	N	0.000088	T	0.24314	0.0589	L	0.56340	1.77	0.46521	D	0.999085	D;D	0.71674	0.998;0.996	D;P	0.67103	0.949;0.856	T	0.00624	-1.1639	10	0.52906	T	0.07	.	9.9988	0.41916	0.0:0.9078:0.0:0.0922	.	275;275	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	S	275	ENSP00000312946:P275S	ENSP00000312946:P275S	P	+	1	0	STAB1	52512528	1.000000	0.71417	0.977000	0.42913	0.501000	0.33797	3.763000	0.55257	1.367000	0.46095	0.655000	0.94253	CCA	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2		3.203404	0	-6	34	0	0	1	0	NM_015136	3	7.743523	26	0.103448
CPEB3	22849	broad.mit.edu	hg19	10	93841258	93841258	+	Splice_Site	SNP	A	A	G			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr10:93841258A>G	ENST00000412050.4	-	9	1734	c.1646T>C	c.(1645-1647)gTt>gCt	p.V549A	CPEB3_ENST00000265997.4_Splice_Site_p.V563A	NM_001178137.1	NP_001171608.1	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	563	RRM 2.			nucleotide binding|RNA binding	breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)			TGCCAGTTCAACTGCAAAAAA	0.438	0	54.0	48.0	50.0	10	93841258	2203	4300	6503	SO:0001630	splice_region_variant	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864	"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606			10231032, 12672660	Standard	NM_014912	Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.1688-1T>C	10.37:g.93841258A>G		Q5T389|Q9NQJ7|Q9Y2E9	ENST00000265997.4	37	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.102857	0.56183	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.21031	2.03;2.03	5.68	5.68	0.88126	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.16769	0.0403	N	0.19112	0.55	0.80722	D	1	B;B;P	0.35872	0.004;0.39;0.525	B;B;B	0.37780	0.008;0.132;0.258	T	0.08126	-1.0737	10	0.27082	T	0.32	.	15.9299	0.79651	1.0:0.0:0.0:0.0	.	563;549;549	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	A	549;549;563	ENSP00000398310:V549A;ENSP00000265997:V563A	ENSP00000265997:V563A	V	-	2	0	CPEB3	93831238	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	9.339000	0.96797	2.162000	0.67917	0.460000	0.39030	GTT	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2		47.622264	0	-12	40	0	0	1	0	NM_014912	15	47.724439	19	0.441176
GAGE2A	729447	broad.mit.edu	hg19	X	49355851	49355851	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chrX:49355851C>T	ENST00000362097.1	+	3	216	c.133C>T	c.(133-135)Cca>Tca	p.P45S		NM_001127212.1	NP_001120684.1			G antigen 2A						endometrium(4)	4	Ovarian(276;0.236)				AGAAGGGGAACCAGCAACTCA	0.512	0									SO:0001583	missense	U19143	CCDS48114.1	Xp11.23	2009-03-17	2007-07-23	2007-07-23	ENSG00000189064	ENSG00000189064		4099	protein-coding gene	gene with protein product	"""cancer/testis antigen family 4, member 2"""	300720	"""G antigen 2"""	GAGE2	7544395	Standard	NM_001127212	Approved	CT4.2		Q6NT46	OTTHUMG00000024143	ENST00000362097.1:c.133C>T	X.37:g.49355851C>T	ENSP00000355421:p.Pro45Ser		ENST00000362097.1	37	CCDS48114.1	.	.	.	.	.	.	.	.	.	.	.	11.00	1.510698	0.27036	.	.	ENSG00000189064	ENST00000362097	T	0.13901	2.55	1.06	0.14	0.14804	.	.	.	.	.	T	0.29158	0.0725	M	0.75085	2.285	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10636	-1.0621	9	0.45353	T	0.12	.	3.2145	0.06694	0.0:0.6811:0.0:0.3189	.	45	Q6NT46	GAG2A_HUMAN	S	45	ENSP00000355421:P45S	ENSP00000355421:P45S	P	+	1	0	GAGE2A	49242795	0.000000	0.05858	0.002000	0.10522	0.259000	0.26198	0.150000	0.16263	-0.006000	0.14370	0.263000	0.19301	CCA	GAGE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060827.3		-78.045419	0	434	929	0	0	1	0		20	38.738691	490	0.039216
TTN	7273	broad.mit.edu	hg19	2	179446651	179446651	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr2:179446651A>C	ENST00000589042.1	-	315	66669	c.66445T>G	c.(66445-66447)Tat>Gat	p.Y22149D	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y13209D|TTN_ENST00000460472.2_Missense_Mutation_p.Y13084D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Y13276D|TTN_ENST00000591111.1_Missense_Mutation_p.Y20508D|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Y19581D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	20508	Fibronectin type-III 60.			ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		TCCCGAGCATAAGCGGCCTTG	0.443	0	74.0	71.0	72.0	2	179446651	1930	4133	6063	SO:0001583	missense	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.66445T>G	2.37:g.179446651A>C	ENSP00000467141:p.Tyr22149Asp	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.618337	0.28801	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63096	-0.02;0.18;0.14;0.14	5.59	5.59	0.84812	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.44993	0.1320	N	0.08118	0	0.33750	D	0.620507	P;P;D;D	0.56521	0.947;0.947;0.976;0.976	B;B;P;P	0.44597	0.355;0.355;0.454;0.454	T	0.62320	-0.6879	9	0.87932	D	0	.	10.9238	0.47180	0.8601:0.0:0.0:0.1399	.	13084;13209;13276;20508	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	19581;13084;13276;13209;13082	ENSP00000343764:Y19581D;ENSP00000434586:Y13084D;ENSP00000340554:Y13276D;ENSP00000352154:Y13209D	ENSP00000340554:Y13276D	Y	-	1	0	TTN	179154897	0.999000	0.42202	0.923000	0.36655	0.918000	0.54935	3.771000	0.55318	2.131000	0.65755	0.533000	0.62120	TAT	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		52.669268	0	9	56	0	0	1	0	NM_133378	17	53.001496	25	0.404762
KRT19P2	0	broad.mit.edu	hg19	12	95228505	95228505	+	RNA	SNP	G	G	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr12:95228505G>T	ENST00000405395.2	+	0	276					NR_036685.1																TGAGTGACAGGCAAAGCCAAT	0.552	0													12q22	2013-06-25			ENSG00000216306	ENSG00000216306		33423	pseudogene	pseudogene			"""keratin 19 pseudogene 5"""	KRT19P5		Standard	NR_036685	Approved		uc001tdk.2		OTTHUMG00000170700		12.37:g.95228505G>T			ENST00000405395.2	37																																																																																				KRT19P2-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000410053.1		15.673604	1	0	9	0	0.000602214	1	0.000616903	NT_019546	5	15.746171	7	0.416667
KCNU1	157855	broad.mit.edu	hg19	8	36692332	36692332	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr8:36692332T>C	ENST00000399881.3	+	12	1278	c.1241T>C	c.(1240-1242)aTa>aCa	p.I414T		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	414	RCK N-terminal.		voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	TGCCTGATTATAGCCAATCCT	0.418	0	123.0	120.0	121.0	8	36692332	1883	4121	6004	SO:0001583	missense	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215			16382103	Standard	NM_001031836	Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1241T>C	8.37:g.36692332T>C	ENSP00000382770:p.Ile414Thr		ENST00000399881.3	37	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.635534	0.47049	.	.	ENSG00000215262	ENST00000399881	T	0.68181	-0.31	5.9	5.9	0.94986	Potassium channel, calcium-activated, BK, alpha subunit (1);NAD(P)-binding domain (1);	0.444337	0.15220	U	0.274002	T	0.66317	0.2777	L	0.44542	1.39	0.80722	D	1	D	0.57899	0.981	P	0.46479	0.518	T	0.69558	-0.5113	10	0.87932	D	0	2.3529	15.1562	0.72743	0.0:0.0:0.0:1.0	.	414	A8MYU2	KCNU1_HUMAN	T	414	ENSP00000382770:I414T	ENSP00000382770:I414T	I	+	2	0	KCNU1	36811490	1.000000	0.71417	0.933000	0.37362	0.379000	0.30106	7.261000	0.78400	2.251000	0.74343	0.528000	0.53228	ATA	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1		12.363323	0	-2	19	0	0	1	0	NM_001031836	5	13.865343	17	0.227273
C14orf39	317761	broad.mit.edu	hg19	14	60933673	60933673	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr14:60933673C>T	ENST00000321731.3	-	10	1016	c.857G>A	c.(856-858)aGa>aAa	p.R286K		NM_174978.2	NP_777638	Q08AQ4	Q08AQ4_HUMAN	chromosome 14 open reading frame 39	286					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)	CTTTATTGGTCTTACTAATTT	0.289	0	73.0	73.0	73.0	14	60933673	2201	4289	6490	SO:0001583	missense	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008		19849	protein-coding gene	gene with protein product						Standard	NM_174978	Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.857G>A	14.37:g.60933673C>T	ENSP00000324920:p.Arg286Lys	Q08AQ4	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	c	3.836	-0.034856	0.07543	.	.	ENSG00000179008	ENST00000321731	T	0.23147	1.92	5.29	1.19	0.21007	.	0.372941	0.26832	N	0.022280	T	0.11410	0.0278	N	0.20401	0.57	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.37267	-0.9713	10	0.02654	T	1	-10.7321	7.5133	0.27585	0.0:0.6202:0.0:0.3798	.	286	Q8N1H7	S6OS1_HUMAN	K	286	ENSP00000324920:R286K	ENSP00000324920:R286K	R	-	2	0	C14orf39	60003426	0.957000	0.32711	0.019000	0.16419	0.078000	0.17371	0.704000	0.25661	0.314000	0.23086	-0.244000	0.11960	AGA	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1		0.361762	0	-5	28	0	0	1	0	NM_174978	4	8.571470	43	0.085106
BMP7	655	broad.mit.edu	hg19	20	55758828	55758828	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr20:55758828C>T	ENST00000395863.3	-	4	1413	c.908G>A	c.(907-909)cGc>cAc	p.R303H	BMP7_ENST00000450594.2_Missense_Mutation_p.R303H|BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000395864.3_Intron	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	303		BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		CGTCTTGGAGCGGTTCTGGCT	0.622	0	87.0	76.0	80.0	20	55758828	2203	4300	6503	SO:0001583	missense		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144	"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267			1427904	Standard	NM_001719	Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.908G>A	20.37:g.55758828C>T	ENSP00000379204:p.Arg303His	Q9H512|Q9NTQ7	ENST00000395863.3	37	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	C	35	5.583316	0.96578	.	.	ENSG00000101144	ENST00000395863;ENST00000450594	T;D	0.82619	-1.13;-1.63	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.89653	0.6777	L	0.55990	1.75	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.79784	0.899;0.993	D	0.90031	0.4135	10	0.66056	D	0.02	.	19.3542	0.94404	0.0:1.0:0.0:0.0	.	303;303	P18075;B1AL00	BMP7_HUMAN;.	H	303	ENSP00000379204:R303H;ENSP00000398687:R303H	ENSP00000379204:R303H	R	-	2	0	BMP7	55192235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.880000	0.69698	2.559000	0.86315	0.643000	0.83706	CGC	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		-6.889432	0	-16	100	0	0	1	0		5	9.356997	76	0.061728
QKI	9444	broad.mit.edu	hg19	6	163899930	163899930	+	Splice_Site	SNP	T	T	A			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr6:163899930T>A	ENST00000361752.3	+	3	953		c.e3+2		QKI_ENST00000453779.2_Splice_Site|QKI_ENST00000392127.2_Splice_Site|QKI_ENST00000275262.7_Splice_Site|QKI_ENST00000424802.3_Splice_Site|QKI_ENST00000361195.2_Splice_Site	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding			mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding	central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)	AAAAAAAAGGTAAGTCCTTGA	0.348	0	76.0	77.0	77.0	6	163899930	2203	4300	6503	SO:0001630	splice_region_variant	AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531		21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""		10535969	Standard	NM_006775	Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.402+2T>A	6.37:g.163899930T>A		Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	ENST00000361752.3	37	CCDS5285.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515880	0.85495	.	.	ENSG00000112531	ENST00000453779;ENST00000275262;ENST00000392127;ENST00000361752;ENST00000361195;ENST00000424802;ENST00000544436;ENST00000537041;ENST00000544823	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.526	0.75905	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	QKI	163819920	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.568000	0.82369	2.071000	0.62044	0.482000	0.46254	.	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043016.2		17.173923	0	1	62	0	0	1	0	NM_006775	14	32.805800	99	0.123894
VAV3	10451	broad.mit.edu	hg19	1	108116776	108116776	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr1:108116776A>T	ENST00000370056.4	-	26	2669	c.2395T>A	c.(2395-2397)Ttc>Atc	p.F799I	VAV3_ENST00000415432.2_Missense_Mutation_p.F239I|VAV3_ENST00000527011.1_Missense_Mutation_p.F827I|VAV3_ENST00000544443.1_Missense_Mutation_p.F203I|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	799	SH3 2.	angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	CTTGCACAGAAGTCATACCGA	0.428	0	207.0	181.0	190.0	1	108116776	2203	4300	6503	SO:0001583	missense	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215	"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""			Standard	NM_001079874	Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.2395T>A	1.37:g.108116776A>T	ENSP00000359073:p.Phe799Ile	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	A	34	5.356365	0.95854	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	T;T;T;T	0.57273	0.41;2.06;0.41;0.41	6.03	6.03	0.97812	Src homology-3 domain (4);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	M	0.86573	2.825	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.996;0.99	T	0.78471	-0.2191	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	827;231;799;239	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	I	799;827;203;239	ENSP00000359073:F799I;ENSP00000432540:F827I;ENSP00000446404:F203I;ENSP00000394897:F239I	ENSP00000359073:F799I	F	-	1	0	VAV3	107918299	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.339000	0.96797	2.302000	0.77476	0.533000	0.62120	TTC	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2		72.084150	0	-32	70	0	0	1	0	NM_006113	24	72.867536	39	0.380952
RAB20	55647	broad.mit.edu	hg19	13	111176287	111176287	+	Silent	SNP	T	T	G			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr13:111176287T>G	ENST00000267328.3	-	2	643	c.430A>C	c.(430-432)Agg>Cgg	p.R144R		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	144		protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding	endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)		TTAGGTGCCCTTGGGGAGACA	0.592	0	63.0	60.0	61.0	13	111176287	2203	4300	6503	SO:0001819	synonymous_variant	AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832	"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product					11697911	Standard	NM_017817	Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.430A>C	13.37:g.111176287T>G		Q5T9X5|Q9NX49	ENST00000267328.3	37	CCDS9512.1																																																																																			RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045760.2		63.610799	0	1	71	0	0	1	0	NM_017817	22	63.950602	31	0.415094
CR1L	1379	broad.mit.edu	hg19	1	207850747	207850747	+	Silent	SNP	C	C	T			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr1:207850747C>T	ENST00000508064.2	+	2	171	c.111C>T	c.(109-111)gtC>gtT	p.V37V	CR1L_ENST00000530905.1_3'UTR	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	37	Sushi 1.		cytoplasm|extracellular region|membrane		endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22					AATGCAATGTCCCGGAATGGC	0.398	0	126.0	117.0	120.0	1	207850747	1891	4100	5991	SO:0001819	synonymous_variant	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721	"""Complement system"""	2335	protein-coding gene	gene with protein product		605886			2295627	Standard	NM_175710	Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.111C>T	1.37:g.207850747C>T		Q32MC9|Q8NEU7	ENST00000508064.2	37	CCDS44310.1																																																																																			CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1		129.376177	0	-36	78	0	0	1	0	XM_114735	42	129.412995	46	0.477273
PVR	5817	broad.mit.edu	hg19	19	45147435	45147435	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VD-A8KE-01A-11D-A39W-08	TCGA-VD-A8KE-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	20fa98de-e044-4efb-bb0d-2f7d764ba1e0	0c4498a0-c4de-49cc-b074-53d7e482d8f8	g.chr19:45147435delG	ENST00000425690.3	+	1	338	c.39delG	c.(37-39)ctgfs	p.L13fs	PVR_ENST00000406449.4_Frame_Shift_Del_p.L13fs|PVR_ENST00000344956.4_Frame_Shift_Del_p.L13fs|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000403059.4_Frame_Shift_Del_p.L13fs	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	13		adherens junction organization|cell adhesion|cell junction assembly|interspecies interaction between organisms|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity	cell junction|cell surface|cytoplasm|extracellular space|integral to membrane|nucleus	cell adhesion molecule binding|receptor activity	large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)	CGCTGCTGCTGGTGGCGCTAC	0.751	0	7.0	9.0	8.0	19	45147435	2039	4002	6041	SO:0001589	frameshift_variant	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS	2170108	Standard	XM_005259120	Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.39delG	19.37:g.45147435delG	ENSP00000402060:p.Leu13fs	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	ENST00000425690.3	37	CCDS12640.1																																																																																			PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	.	.		3	4					NM_006505	2		4	0.33
