Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
LCP1	3936	broad.mit.edu	hg19	13	46701814	46701814	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr13:46701814G>A	ENST00000398576.2	-	19	2184	c.1796C>T	c.(1795-1797)gCc>gTc	p.A599V	LCP1_ENST00000323076.2_Missense_Mutation_p.A599V|LCP1_ENST00000435666.2_Missense_Mutation_p.A168V			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	599	Actin-binding 2.|CH 4.	regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding	breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)	TTCTGGCAGGGCATACACTCT	0.488	0	194.0	180.0	185.0	13	46701814	2203	4300	6503	SO:0001583	missense	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167	"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430			2111166	Standard	NM_002298	Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1796C>T	13.37:g.46701814G>A	ENSP00000381581:p.Ala599Val	B2R613|B4DUA0|Q5TBN4	ENST00000398576.2	37	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	G	35	5.569044	0.96540	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.95069	-3.6;-3.6;-3.6	5.72	5.72	0.89469	Calponin homology domain (5);	0.044394	0.85682	D	0.000000	D	0.96324	0.8801	M	0.72624	2.21	0.80722	D	1	P;D	0.89917	0.942;1.0	P;D	0.91635	0.859;0.999	D	0.92803	0.6258	10	0.02654	T	1	-16.4361	19.2318	0.93843	0.0:0.0:1.0:0.0	.	168;599	B4DUA0;P13796	.;PLSL_HUMAN	V	599;599;168	ENSP00000315757:A599V;ENSP00000381581:A599V;ENSP00000405134:A168V	ENSP00000315757:A599V	A	-	2	0	LCP1	45599815	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.813000	0.99286	2.865000	0.98341	0.655000	0.94253	GCC	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3		-32.542074	0	-45	108	0	0	1	0	NM_002298	4	7.205633	155	0.025157
OR7D4	125958	broad.mit.edu	hg19	19	9325198	9325198	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr19:9325198T>C	ENST00000308682.2	-	1	344	c.316A>G	c.(316-318)Atg>Gtg	p.M106V		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	106		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26					CCAGCAAACATCATTAAAAAA	0.512	0	87.0	79.0	81.0	19	9325198	2203	4300	6503	SO:0001583	missense		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667	"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P		Standard	NM_001005191	Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.316A>G	19.37:g.9325198T>C	ENSP00000310488:p.Met106Val	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	ENST00000308682.2	37	CCDS32901.1	.	.	.	.	.	.	.	.	.	.	T	0.491	-0.875508	0.02550	.	.	ENSG00000174667	ENST00000308682	T	0.03663	3.85	3.76	0.0796	0.14417	GPCR, rhodopsin-like superfamily (1);	0.891435	0.09666	N	0.771873	T	0.01254	0.0041	N	0.00980	-1.08	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47837	-0.9086	10	0.27785	T	0.31	.	3.9777	0.09481	0.5253:0.111:0.0:0.3636	.	106	Q8NG98	OR7D4_HUMAN	V	106	ENSP00000310488:M106V	ENSP00000310488:M106V	M	-	1	0	OR7D4	9186198	0.000000	0.05858	0.001000	0.08648	0.443000	0.32047	-1.968000	0.01507	0.161000	0.19458	0.358000	0.22013	ATG	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1		93.538635	0	-14	67	0	0	1	0		30	94.043634	43	0.410959
COL27A1	85301	broad.mit.edu	hg19	9	117027754	117027754	+	Splice_Site	SNP	C	C	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr9:117027754C>A	ENST00000356083.3	+	32	3783	c.3392C>A	c.(3391-3393)cCg>cAg	p.P1131Q		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1131	Collagen-like 9.|Pro-rich.|Triple-helical region.	cell adhesion		extracellular matrix structural constituent	central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80					CCAGGAGAACCGGTAAGAGCC	0.612	0	59.0	54.0	55.0	9	117027754	2203	4300	6503	SO:0001630	splice_region_variant	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739	"""Collagens"""	22986	protein-coding gene	gene with protein product		608461			12766169	Standard	NM_032888	Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3393+1C>A	9.37:g.117027754C>A		Q66K43|Q96JF7	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978473	0.53720	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.96716	-4.1	5.25	4.35	0.52113	.	.	.	.	.	D	0.95934	0.8676	L	0.39566	1.225	0.51767	D	0.999937	D	0.69078	0.997	D	0.68943	0.961	D	0.93803	0.7103	9	0.27082	T	0.32	.	9.4823	0.38908	0.0:0.9031:0.0:0.0969	.	1131	Q8IZC6	CORA1_HUMAN	Q	1131	ENSP00000348385:P1131Q	ENSP00000348385:P1131Q	P	+	2	0	COL27A1	116067575	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.442000	0.44873	1.221000	0.43506	0.591000	0.81541	CCG	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1		-4.216809	1	1	38	0	1	1	1	NM_032888	3	6.727252	50	0.056604
NUP62	23636	broad.mit.edu	hg19	19	50412426	50412426	+	Silent	SNP	G	G	C			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr19:50412426G>C	ENST00000596217.1	-	2	2526	c.639C>G	c.(637-639)acC>acG	p.T213T	NUP62_ENST00000413454.1_Silent_p.T213T|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Silent_p.T213T|NUP62_ENST00000597723.1_Silent_p.T213T|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597029.1_Silent_p.T213T|NUP62_ENST00000352066.3_Silent_p.T213T			P37198	NUP62_HUMAN	nucleoporin 62kDa	213	15 X 9 AA approximate repeats.|Ala-rich.|Thr-rich.	carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding	breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)	TGCTGGTGATGGTGGCTGTGG	0.647	0	81.0	77.0	78.0	19	50412426	2203	4300	6503	SO:0001819	synonymous_variant	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024		8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""		1915414	Standard	NM_016553	Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.639C>G	19.37:g.50412426G>C		B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	ENST00000596217.1	37	CCDS12788.1																																																																																			NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1		171.500157	0	-33	60	0	0	1	0	NM_153719	56	171.601200	49	0.533333
C5orf20	140947	broad.mit.edu	hg19	5	134782379	134782379	+	Silent	SNP	C	C	T			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr5:134782379C>T	ENST00000503143.2	-	1	659	c.420G>A	c.(418-420)ccG>ccA	p.P140P	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN	chromosome 5 open reading frame 20	140			nucleus		endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		GAACTGTGAACGGGTAGAGTC	0.517	1	137.0	147.0	143.0	5	134782379	2203	4300	6503	SO:0001819	synonymous_variant																									ENST00000503143.2:c.420G>A	5.37:g.134782379C>T			ENST00000503143.2	37	CCDS4186.1																																																																																			C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372531.1		168.744188	0	-41	102	0	0	1	0		57	170.194483	88	0.393103
STAM	8027	broad.mit.edu	hg19	10	17686366	17686366	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr10:17686366G>T	ENST00000377524.3	+	1	243	c.28G>T	c.(28-30)Gat>Tat	p.D10Y	STAM_ENST00000540523.1_5'UTR	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	10		cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity	breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26					CAATCCCTTCGATCAGGATGT	0.617	0	171.0	112.0	132.0	10	17686366	2203	4300	6503	SO:0001583	missense	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738		11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899			8780729	Standard	NM_003473	Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.28G>T	10.37:g.17686366G>T	ENSP00000366746:p.Asp10Tyr	B0YJ99|D3DRU5|Q8N6D9	ENST00000377524.3	37	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240830	0.79912	.	.	ENSG00000136738	ENST00000377524	T	0.24350	1.86	4.63	4.63	0.57726	VHS subgroup (1);ENTH/VHS (2);VHS (1);	0.156559	0.64402	D	0.000015	T	0.34221	0.0890	M	0.79805	2.47	0.80722	D	1	P	0.42039	0.769	B	0.40477	0.33	T	0.38200	-0.9672	10	0.87932	D	0	-6.4693	13.1725	0.59606	0.0:0.0:1.0:0.0	.	10	Q92783	STAM1_HUMAN	Y	10	ENSP00000366746:D10Y	ENSP00000366746:D10Y	D	+	1	0	STAM	17726372	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.420000	0.59841	2.564000	0.86499	0.591000	0.81541	GAT	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1		2.802991	1	-7	36	0	1	1	1	NM_003473	3	7.343813	26	0.103448
RERGL	79785	broad.mit.edu	hg19	12	18237495	18237495	+	Splice_Site	SNP	C	C	T			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr12:18237495C>T	ENST00000536890.1	-	4	185	c.185G>A	c.(184-186)cGc>cAc	p.R62H	RERGL_ENST00000538724.1_Silent_p.A96A|RERGL_ENST00000229002.2_Silent_p.A97A|RERGL_ENST00000541632.1_5'UTR			Q9H628	RERGL_HUMAN	RERG/RAS-like	0	Small GTPase-like.	signal transduction	membrane	GTP binding|GTPase activity	endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17					TGTAGATCAGCGCTTTTGCAA	0.383	0	142.0	139.0	140.0	12	18237495	2203	4300	6503	SO:0001630	splice_region_variant	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404		26213	protein-coding gene	gene with protein product					24127187	Standard	NM_001286201	Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000536890.1:c.184-1G>A	12.37:g.18237495C>T			ENST00000536890.1	37		.	.	.	.	.	.	.	.	.	.	T	9.276	1.046969	0.19748	0.0	2.33E-4	ENSG00000111404	ENST00000536890	D	0.96396	-4.0	4.91	2.5	0.30297	.	.	.	.	.	D	0.93848	0.8032	.	.	.	0.23563	N	0.997403	.	.	.	.	.	.	D	0.88440	0.3041	6	0.87932	D	0	.	1.8515	0.03170	0.1179:0.1684:0.1685:0.5452	.	.	.	.	H	62	ENSP00000437490:R62H	ENSP00000437490:R62H	R	-	2	0	RERGL	18128762	0.998000	0.40836	0.999000	0.59377	0.189000	0.23516	0.502000	0.22594	0.494000	0.27859	-0.516000	0.04426	CGC	RERGL-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000401200.1		-19.734115	0	-26	77	0	0	1	0	NM_024730	4	6.716314	109	0.035398
PSMB8	5696	broad.mit.edu	hg19	6	32809923	32809923	+	Silent	SNP	G	G	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr6:32809923G>A	ENST00000374881.2	-	4	802	c.513C>T	c.(511-513)ggC>ggT	p.G171G	PSMB8_ENST00000374882.3_Silent_p.G175G|PSMB8_ENST00000395339.3_Silent_p.G151G	NM_004159.4	NP_004150.1	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	175		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity	NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					TCTTATCCCAGCCACAGATCA	0.522	0	137.0	117.0	124.0	6	32809923	1511	2709	4220	SO:0001819	synonymous_variant		CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264	"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7	1529427, 10329130	Standard	XM_005275000	Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.525C>T	6.37:g.32809923G>A		B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	ENST00000374882.3	37	CCDS4757.1																																																																																			PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076617.3		-0.307338	0	-13	33	0	0	1	0	NM_148919	3	6.840141	36	0.076923
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		119.390129	0	-31	81	0	0	1	0	NM_002072	39	121.901500	75	0.342105
CENPE	1062	broad.mit.edu	hg19	4	104074328	104074328	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr4:104074328A>G	ENST00000265148.3	-	25	3202	c.3113T>C	c.(3112-3114)aTa>aCa	p.I1038T	CENPE_ENST00000380026.3_Missense_Mutation_p.I1013T	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1038		blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	TTGCTCAATTATCTCATTATC	0.313	0	132.0	127.0	129.0	4	104074328	2202	4298	6500	SO:0001583	missense	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778	"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""		7851898	Standard	NM_001286734	Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000380026.3:c.3038T>C	4.37:g.104074328A>G	ENSP00000369365:p.Ile1013Thr	A6NKY9|A8K2U7|Q4LE75	ENST00000380026.3	37		.	.	.	.	.	.	.	.	.	.	A	4.990	0.183896	0.09495	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	D;D;D	0.94280	-3.39;-3.39;-3.39	3.88	-0.12	0.13539	.	.	.	.	.	T	0.80613	0.4656	N	0.08118	0	0.09310	N	1	B;B	0.24721	0.11;0.081	B;B	0.17098	0.017;0.01	T	0.68488	-0.5395	9	0.33940	T	0.23	.	1.138	0.01759	0.5112:0.1537:0.1856:0.1495	.	1013;1038	Q02224-3;Q02224	.;CENPE_HUMAN	T	1038;1038;1013;1038	ENSP00000265148:I1038T;ENSP00000369365:I1013T;ENSP00000423981:I1038T	ENSP00000265148:I1038T	I	-	2	0	CENPE	104293777	0.001000	0.12720	0.000000	0.03702	0.039000	0.13416	0.913000	0.28611	-0.097000	0.12307	0.460000	0.39030	ATA	CENPE-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000363246.2		26.401335	0	-11	33	0	0	1	0		8	26.463529	6	0.571429
C11orf54	28970	broad.mit.edu	hg19	11	93487180	93487180	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr11:93487180C>A	ENST00000528288.1	+	5	542	c.307C>A	c.(307-309)Cag>Aag	p.Q103K	C11orf54_ENST00000540113.1_Missense_Mutation_p.Q84K|C11orf54_ENST00000354421.3_Missense_Mutation_p.Q103K|C11orf54_ENST00000528099.1_Missense_Mutation_p.Q103K|C11orf54_ENST00000331239.4_Missense_Mutation_p.Q103K	NM_014039.2	NP_054758.2	Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	103			nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding	NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)			AGGTCCATTTCAGACTCTCGG	0.338	0	90.0	102.0	98.0	11	93487180	2198	4298	6496	SO:0001583	missense	AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919		30204	protein-coding gene	gene with protein product		615810			16522806	Standard	NM_014039	Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.307C>A	11.37:g.93487180C>A	ENSP00000331209:p.Gln103Lys	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	ENST00000331239.4	37		.	.	.	.	.	.	.	.	.	.	C	4.449	0.083089	0.08533	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000531650;ENST00000524485;ENST00000527363;ENST00000526335	.	.	.	4.95	4.95	0.65309	Domain of unknown function DUF1907 (1);	0.217358	0.48286	D	0.000187	T	0.26991	0.0661	N	0.04203	-0.255	0.37889	D	0.930664	B;B;B	0.16396	0.017;0.002;0.017	B;B;B	0.16289	0.015;0.004;0.015	T	0.22277	-1.0221	9	0.11182	T	0.66	-4.599	11.2584	0.49067	0.3109:0.6891:0.0:0.0	.	103;103;103	Q9H0W9;Q9H0W9-3;A8K718	CK054_HUMAN;.;.	K	103;103;103;103;84;84;103;84;103;103	.	ENSP00000331209:Q103K	Q	+	1	0	C11orf54	93126828	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.662000	0.68032	2.586000	0.87340	0.591000	0.81541	CAG	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394671.1		-31.043220	1	-50	82	0	1	1	1	NM_014039	4	6.974547	149	0.026144
FCRL1	115350	broad.mit.edu	hg19	1	157771734	157771734	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr1:157771734C>T	ENST00000358292.3	-	5	908	c.857G>A	c.(856-858)cGc>cAc	p.R286H	FCRL1_ENST00000491942.1_Missense_Mutation_p.R286H|FCRL1_ENST00000368176.3_Missense_Mutation_p.R286H|FCRL1_ENST00000489998.1_5'UTR	NM_001159397.1	NP_001152869.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	286	Ig-like C2-type 3.		integral to membrane|plasma membrane	receptor activity	breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)		CGCCTCACTGCGCTGGGCCCC	0.562	0	79.0	84.0	82.0	1	157771734	2203	4300	6503	SO:0001583	missense	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508			11493702, 11929751	Standard	NM_052938	Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.857G>A	1.37:g.157771734C>T	ENSP00000357158:p.Arg286His	B2RE05|Q8N759|Q8NDI0|Q96PJ6	ENST00000368176.3	37	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	C	3.010	-0.204159	0.06180	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03496	3.91;3.91;3.91	5.1	-5.03	0.02973	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.308130	0.04796	N	0.432487	T	0.00967	0.0032	L	0.39514	1.22	0.09310	N	1	B;B;B	0.28291	0.206;0.055;0.086	B;B;B	0.24269	0.052;0.048;0.004	T	0.45948	-0.9226	10	0.25106	T	0.35	.	7.2503	0.26146	0.1309:0.2382:0.0:0.6308	.	286;286;286	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	H	286	ENSP00000351039:R286H;ENSP00000357158:R286H;ENSP00000418130:R286H	ENSP00000351039:R286H	R	-	2	0	FCRL1	156038358	0.103000	0.21917	0.007000	0.13788	0.266000	0.26442	-1.013000	0.03645	-0.683000	0.05190	-0.781000	0.03364	CGC	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1		115.364445	0	-41	67	0	0	1	0	NM_052938	37	115.623669	47	0.440476
VPREB3	29802	broad.mit.edu	hg19	22	24095146	24095146	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr22:24095146C>T	ENST00000248948.3	-	2	393	c.289G>A	c.(289-291)Gcc>Acc	p.A97T	VPREB3_ENST00000398465.3_Missense_Mutation_p.A81T	NM_013378.2	NP_037510.1	Q9UKI3	VPRE3_HUMAN	pre-B lymphocyte 3	97	Ig-like.		endoplasmic reticulum		large_intestine(1)|lung(1)|skin(1)	3		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)			AGGACACAGGCATTGTGGGCC	0.587	0	111.0	87.0	95.0	22	24095146	2203	4300	6503	SO:0001583	missense		CCDS13813.1	22q11.23	2013-01-11	2008-09-12		ENSG00000128218	ENSG00000128218	"""Immunoglobulin superfamily / V-set domain containing"""	12710	protein-coding gene	gene with protein product		605017			10702669, 14670953	Standard	NM_013378	Approved	8HS20	uc002zxt.3	Q9UKI3	OTTHUMG00000150738	ENST00000398465.3:c.241G>A	22.37:g.24095146C>T	ENSP00000381483:p.Ala81Thr	B2R587	ENST00000398465.3	37		.	.	.	.	.	.	.	.	.	.	C	10.18	1.278712	0.23307	.	.	ENSG00000128218	ENST00000398465;ENST00000248948	T;T	0.63580	-0.05;-0.05	5.04	2.96	0.34315	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.154834	0.30620	N	0.009222	T	0.33381	0.0861	N	0.11364	0.135	0.09310	N	1	B	0.21071	0.051	B	0.23275	0.045	T	0.26883	-1.0090	10	0.05620	T	0.96	.	6.5635	0.22499	0.0:0.6911:0.1479:0.1609	.	97	Q9UKI3	VPRE3_HUMAN	T	81;97	ENSP00000381483:A81T;ENSP00000248948:A97T	ENSP00000248948:A97T	A	-	1	0	VPREB3	22425146	0.000000	0.05858	0.007000	0.13788	0.034000	0.12701	-0.330000	0.07925	0.866000	0.35629	0.650000	0.86243	GCC	VPREB3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319880.2		73.873134	0	-18	25	0	0	1	0	NM_013378	25	73.877533	24	0.510204
IRAK3	0	broad.mit.edu	hg19	12	66638726	66638726	+	Splice_Site	SNP	A	A	G			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr12:66638726A>G	ENST00000261233.4	+	10	1507		c.e10-1		IRAK3_ENST00000457197.2_Splice_Site	NM_007199.2	NP_009130.2	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3			interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity	breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)	TATTCCTTGTAGGTAATAATG	0.318	0	58.0	59.0	59.0	12	66638726	2203	4300	6503	SO:0001630	splice_region_variant	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376		17020	protein-coding gene	gene with protein product		604459			10383454	Standard	NM_001142523	Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1087-1A>G	12.37:g.66638726A>G			ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	A	11.03	1.518000	0.27211	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.95	0.58394	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IRAK3	64924993	1.000000	0.71417	0.984000	0.44739	0.030000	0.12068	6.219000	0.72231	2.308000	0.77769	0.533000	0.62120	.	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		129.253525	0	-30	40	0	0	1	0		38	129.256475	37	0.506667
FUS	2521	broad.mit.edu	hg19	16	31193944	31193944	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr16:31193944A>G	ENST00000254108.7	+	3	254	c.149A>G	c.(148-150)tAt>tGt	p.Y50C	RP11-388M20.6_ENST00000564743.1_RNA|FUS_ENST00000568685.1_Missense_Mutation_p.Y50C|FUS_ENST00000380244.3_Missense_Mutation_p.Y50C	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	fused in sarcoma	50	Gln/Gly/Ser/Tyr-rich.	cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)	ACTTCAGGCTATGGCCAGAGC	0.522	0	101.0	95.0	97.0	16	31193944	2197	4300	6497	SO:0001583	missense	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280	"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6	2372777, 7503811, 19251628, 19251627	Standard	NM_004960	Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.149A>G	16.37:g.31193944A>G	ENSP00000254108:p.Tyr50Cys	Q9H4A8	ENST00000254108.7	37	CCDS10707.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965003	0.74131	.	.	ENSG00000089280	ENST00000254108;ENST00000394533	T	0.80653	-1.4	6.11	6.11	0.99139	.	0.157258	0.42964	D	0.000631	D	0.90024	0.6885	M	0.80616	2.505	0.52099	D	0.999941	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.996;0.998;0.996;0.997	D	0.91034	0.4866	10	0.72032	D	0.01	-7.1996	15.6822	0.77381	1.0:0.0:0.0:0.0	.	50;50;50;50;50	B4DVJ7;Q6IBQ5;P35637-2;P35637;E7EUX0	.;.;.;FUS_HUMAN;.	C	50	ENSP00000254108:Y50C	ENSP00000254108:Y50C	Y	+	2	0	FUS	31101445	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.561000	0.73955	2.343000	0.79666	0.496000	0.49642	TAT	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2		205.809815	0	-17	88	0	0	1	0	NM_004960	60	205.904320	53	0.530973
ZNF527	84503	broad.mit.edu	hg19	19	37880647	37880647	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr19:37880647A>G	ENST00000436120.2	+	5	1803	c.1696A>G	c.(1696-1698)Atc>Gtc	p.I566V	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	566		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		TTTTCATCAGATCTTGTCCCT	0.398	0	47.0	52.0	51.0	19	37880647	2197	4295	6492	SO:0001583	missense	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164	"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product					11347906	Standard	NM_032453	Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.1696A>G	19.37:g.37880647A>G	ENSP00000390179:p.Ile566Val	B4DVL5	ENST00000436120.2	37	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	A	2.283	-0.364284	0.05103	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	T	0.35605	1.3	3.84	0.108	0.14548	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34959	N	0.003556	T	0.16514	0.0397	N	0.13235	0.315	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.24297	-1.0164	10	0.16420	T	0.52	.	7.4605	0.27291	0.673:0.0:0.327:0.0	.	566;534	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	V	566;534;514	ENSP00000390179:I514V	ENSP00000325231:I534V	I	+	1	0	ZNF527	42572487	0.000000	0.05858	0.020000	0.16555	0.924000	0.55760	-0.823000	0.04443	-0.227000	0.09884	0.533000	0.62120	ATC	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1		110.908284	0	5	78	0	0	1	0	NM_032453	35	110.920762	37	0.486111
OVCH1	341350	broad.mit.edu	hg19	12	29597085	29597085	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr12:29597085T>C	ENST00000318184.5	-	24	3009	c.3010A>G	c.(3010-3012)Act>Gct	p.T1004A	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	1004		proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)				TACCCCATAGTAGTTCTGTGA	0.398	0	201.0	199.0	200.0	12	29597085	1825	4085	5910	SO:0001583	missense	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950		23080	protein-coding gene	gene with protein product					12838346	Standard	NM_183378	Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.3010A>G	12.37:g.29597085T>C	ENSP00000326708:p.Thr1004Ala		ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	T	0.016	-1.515327	0.00975	.	.	ENSG00000187950	ENST00000318184;ENST00000537054	T;T	0.33654	1.4;2.13	2.49	1.32	0.21799	CUB (2);	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	P	0.38827	0.649	B	0.33042	0.157	T	0.13872	-1.0493	9	0.05959	T	0.93	.	4.2969	0.10906	0.0:0.1687:0.0:0.8313	.	1004	Q7RTY7	OVCH1_HUMAN	A	1004;29	ENSP00000326708:T1004A;ENSP00000445480:T29A	ENSP00000326708:T1004A	T	-	1	0	OVCH1	29488352	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.318000	0.19504	0.385000	0.24970	0.460000	0.39030	ACT	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2		280.039367	0	-79	117	0	0	1	0	NM_183378	83	280.083475	89	0.482558
HEATR2	54919	broad.mit.edu	hg19	7	803563	803563	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr7:803563G>A	ENST00000297440.6	+	8	1755	c.1735G>A	c.(1735-1737)Gca>Aca	p.A579T	HEATR2_ENST00000313147.5_Missense_Mutation_p.A579T	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	579				protein binding	breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)	TGACTGGACCGCACACTCGCC	0.657	0	118.0	104.0	109.0	7	803563	2203	4300	6503	SO:0001583	missense	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818		26013	protein-coding gene	gene with protein product		614864			23040496	Standard	NM_017802	Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1735G>A	7.37:g.803563G>A	ENSP00000297440:p.Ala579Thr	Q69YL1|Q96FI9|Q9NX75	ENST00000297440.6	37	CCDS34580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.174|4.174	0.030770|0.030770	0.08101|0.08101	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000297440;ENST00000313147;ENST00000537862|ENST00000440747	T;T|.	0.64803|.	-0.12;-0.12|.	5.03|5.03	0.185|0.185	0.15096|0.15096	Armadillo-type fold (1);|.	0.590962|.	0.18530|.	N|.	0.138510|.	T|T	0.16041|0.16041	0.0386|0.0386	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.27823|.	0.12;0.19|.	B;B|.	0.15052|.	0.005;0.012|.	T|T	0.21211|0.21211	-1.0252|-1.0252	10|5	0.10902|.	T|.	0.67|.	-9.6938|-9.6938	0.8086|0.8086	0.01089|0.01089	0.2741:0.1121:0.3703:0.2434|0.2741:0.1121:0.3703:0.2434	.|.	579;325|.	Q86Y56;F5H8D4|.	HEAT2_HUMAN;.|.	T|H	579;579;325|380	ENSP00000297440:A579T;ENSP00000321451:A579T|.	ENSP00000297440:A579T|.	A|R	+|+	1|2	0|0	HEATR2|HEATR2	770089|770089	0.042000|0.042000	0.20092|0.20092	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	0.645000|0.645000	0.24782|0.24782	0.214000|0.214000	0.20742|0.20742	0.561000|0.561000	0.74099|0.74099	GCA|CGC	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1		-16.880603	0	-45	90	0	0	1	0	NM_017802	4	7.337420	101	0.038095
PDE4D	5144	broad.mit.edu	hg19	5	58289225	58289225	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr5:58289225G>C	ENST00000340635.6	-	7	1164	c.989C>G	c.(988-990)tCa>tGa	p.S330*	PDE4D_ENST00000507116.1_Nonsense_Mutation_p.S266*|PDE4D_ENST00000503258.1_Nonsense_Mutation_p.S200*|PDE4D_ENST00000502484.2_Nonsense_Mutation_p.S269*|PDE4D_ENST00000317118.8_Nonsense_Mutation_p.S39*|PDE4D_ENST00000360047.5_Nonsense_Mutation_p.S194*|PDE4D_ENST00000358923.6_Nonsense_Mutation_p.S28*|PDE4D_ENST00000546160.1_Nonsense_Mutation_p.S269*|PDE4D_ENST00000405755.2_Nonsense_Mutation_p.S208*	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	330		signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	TATAAACTCTGACACTTGATT	0.338	0	81.0	79.0	80.0	5	58289225	1817	4082	5899	SO:0001587	stop_gained		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3		Standard	NM_006203	Approved		uc003jsa.2	Q08499		ENST00000507116.1:c.797C>G	5.37:g.58289225G>C	ENSP00000424852:p.Ser266*	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	ENST00000507116.1	37	CCDS56373.1	.	.	.	.	.	.	.	.	.	.	G	33	5.197607	0.94997	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000358923;ENST00000317118;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000505453	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6271	0.91344	0.0:0.0:1.0:0.0	.	.	.	.	X	330;199;194;266;28;39;200;208;269;269;28	.	ENSP00000321739:S39X	S	-	2	0	PDE4D	58324982	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.492000	0.97957	2.644000	0.89710	0.557000	0.71058	TCA	PDE4D-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368103.2		69.771374	0	-27	41	0	0	1	0		21	69.846997	25	0.456522
CAND1	55832	broad.mit.edu	hg19	12	67705551	67705551	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr12:67705551G>A	ENST00000545606.1	+	14	3876	c.3439G>A	c.(3439-3441)Gag>Aag	p.E1147K		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	1147		cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding	NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)	CCGACTTGTTGAGCCATTACG	0.403	0	147.0	130.0	136.0	12	67705551	2203	4300	6503	SO:0001583	missense		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530		30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727			10048485, 8954946	Standard	NM_018448	Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.3439G>A	12.37:g.67705551G>A	ENSP00000442318:p.Glu1147Lys	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	G	36	5.834492	0.97003	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.68181	-0.31;-0.31	5.93	5.93	0.95920	TATA-binding protein interacting (TIP20) (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86694	0.5994	M	0.92412	3.305	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71870	0.956;0.975	D	0.88493	0.3077	9	.	.	.	-15.0934	20.3334	0.98727	0.0:0.0:1.0:0.0	.	979;1147	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	K	1147;1147;687	ENSP00000442318:E1147K;ENSP00000444089:E687K	.	E	+	1	0	CAND1	65991818	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.547000	0.98100	2.818000	0.97014	0.591000	0.81541	GAG	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1		155.939281	0	-28	75	0	0	1	0	NM_018448	50	156.101036	59	0.458716
RAET1E	0	broad.mit.edu	hg19	6	150201660	150201660	+	RNA	DEL	T	T	-			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr6:150201660delT	ENST00000606915.1	+	0	889					NR_045126.1																CGTGTGATGATTTGCTGCAGC	0.453	0									SO:0001628	intergenic_variant	AF359243	CCDS5221.1, CCDS59042.1, CCDS59043.1, CCDS59044.1	6q24.3	2011-02-09			ENSG00000164520	ENSG00000164520		16793	protein-coding gene	gene with protein product		609243			11827464	Standard	NM_139165	Approved	LETAL, bA350J20.7, ULBP4	uc003qnl.1	Q8TD07	OTTHUMG00000015796		6.37:g.150201660delT		A6YF59|Q5VYB7|Q5VYB8|Q8TEZ2|Q96L41	ENST00000532335.1	37	CCDS59043.1																																																																																			RAET1E-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000384020.1	.	.		-5	9					NM_139165	2		4	0.33
SORL1	6653	broad.mit.edu	hg19	11	121323156	121323157	+	Frame_Shift_Ins	INS	-	-	C			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr11:121323156_121323157insC	ENST00000260197.7	+	1	245_246	c.116_117insC	c.(115-120)agcgcgfs	p.A40fs	SORL1_ENST00000532451.1_3'UTR|RP11-730K11.1_ENST00000529160.1_RNA|RP11-730K11.1_ENST00000501964.1_RNA	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	40		cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity	NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)	CACGGCGGCAGCGCGCCCTTGC	0.743	0									SO:0001589	frameshift_variant	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642	"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32	9157966, 8940146	Standard	NM_003105	Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.117dupC	11.37:g.121323157_121323157dupC	ENSP00000260197:p.Ala40fs	B2RNX7|Q92856	ENST00000260197.7	37	CCDS8436.1																																																																																			SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	.	.		3	3					NM_003105	2		4	0.33
BAP1	8314	broad.mit.edu	hg19	3	52441978	52441978	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr3:52441978delG	ENST00000460680.1	-	5	842	c.371delC	c.(370-372)cctfs	p.P124fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.P124fs	NM_004656.2	NP_004647.1	Q92560	BAP1_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	124		monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	GCCTACCTCAGGGCTGAAACC	0.567	1	56.0	51.0	53.0	3	52441978	2203	4300	6503	SO:0001589	frameshift_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.371delC	3.37:g.52441978delG	ENSP00000417132:p.Pro124fs	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	.	.		-12	28						17		4	0.81
BAP1	8314	broad.mit.edu	hg19	3	52441977	52441978	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-VD-A8KK-01A-11D-A39W-08	TCGA-VD-A8KK-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	566314af-7a19-4496-8b4b-c41f57d6f106	a9ff531e-0829-40a1-af9d-c23153b5e799	g.chr3:52441977_52441978delAG	ENST00000460680.1	-	5	842_843	c.371_372delCT	c.(370-372)cctfs	p.P124fs	PHF7_ENST00000327906.3_5'Flank|BAP1_ENST00000296288.5_Frame_Shift_Del_p.P124fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.	anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	AGCCTACCTCAGGGCTGAAACC	0.564	1									SO:0001589	frameshift_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.371_372delCT	3:g.52441977_52441978delAG	ENSP00000417132:p.Pro124fs	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1		CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	6.920000e+00	4.984000e+01		-12	26						17		3	8.820000e-01
