Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
FUBP3	8939	broad.mit.edu	hg19	9	133491801	133491801	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr9:133491801A>T	ENST00000319725.9	+	7	539	c.464A>T	c.(463-465)cAt>cTt	p.H155L		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	155		positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding	NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)	CCTGGCTTTCATAATGACATA	0.488	0	75.0	74.0	74.0	9	133491801	2000	4165	6165	SO:0001583	missense	U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164		4005	protein-coding gene	gene with protein product		603536		FBP3	8940189	Standard	NM_003934	Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.464A>T	9.37:g.133491801A>T	ENSP00000318177:p.His155Leu	A3KFK8|A3KFL0|Q92946|Q9BVB6	ENST00000319725.9	37	CCDS43893.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.048870	0.55110	.	.	ENSG00000107164	ENST00000358721;ENST00000319725;ENST00000372376	T	0.39056	1.1	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.53997	0.1831	M	0.66939	2.045	0.58432	D	0.999996	P;D;D	0.56968	0.564;0.978;0.978	B;P;P	0.54856	0.391;0.762;0.762	T	0.51965	-0.8638	10	0.27785	T	0.31	-15.0649	14.4551	0.67411	1.0:0.0:0.0:0.0	.	95;155;155	Q96I24-2;A3KFK8;Q96I24	.;.;FUBP3_HUMAN	L	142;155;95	ENSP00000318177:H155L	ENSP00000318177:H155L	H	+	2	0	FUBP3	132481622	1.000000	0.71417	0.910000	0.35882	0.985000	0.73830	8.887000	0.92456	2.020000	0.59435	0.459000	0.35465	CAT	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1		31.611443	0	-28	36	0	0	1	0		11	32.970147	26	0.297297
PDE4DIP	9659	broad.mit.edu	hg19	1	144873916	144873916	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr1:144873916G>T	ENST00000369359.4	-	34	5487	c.5449C>A	c.(5449-5451)Ccc>Acc	p.P1817T	PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.P1681T|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.P1637T|PDE4DIP_ENST00000369354.3_Missense_Mutation_p.P1681T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1681		cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	GTATTCTGGGGAGTTGGCAAG	0.517	0	371.0	375.0	373.0	1	144873916	2203	4299	6502	SO:0001583	missense	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104		15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2	9455484, 11134006	Standard	NM_022359	Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369359.4:c.5449C>A	1.37:g.144873916G>T	ENSP00000358366:p.Pro1817Thr	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	ENST00000369359.4	37		.	.	.	.	.	.	.	.	.	.	G	13.89	2.371737	0.42003	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369359	T;T;T;T	0.01854	4.6;4.92;4.93;4.92	5.43	4.45	0.53987	.	.	.	.	.	T	0.02193	0.0068	L	0.43152	1.355	0.80722	D	1	D;P	0.58620	0.983;0.78	P;B	0.54544	0.755;0.335	T	0.60910	-0.7169	9	0.31617	T	0.26	.	8.2279	0.31579	0.1078:0.0:0.8922:0.0	.	1637;1681	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	T	1637;1681;1681;1817	ENSP00000327209:P1637T;ENSP00000358360:P1681T;ENSP00000358363:P1681T;ENSP00000358366:P1817T	ENSP00000327209:P1637T	P	-	1	0	PDE4DIP	143585273	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.179000	0.50887	2.810000	0.96702	0.650000	0.86243	CCC	PDE4DIP-037	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000384689.1		201.246368	1	-85	290	0	2.06477e-34	1	2.41873e-34	NM_022359	84	212.621083	205	0.290657
PAPPA	5069	broad.mit.edu	hg19	9	118949960	118949960	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr9:118949960G>A	ENST00000328252.3	+	2	1312	c.943G>A	c.(943-945)Ggc>Agc	p.G315S		NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	315	Metalloprotease.	cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98					CAATGCCCACGGCTTTCTGCT	0.552	0	80.0	75.0	77.0	9	118949960	2203	4300	6503	SO:0001583	missense		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752		8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385			7679961	Standard	NM_002581	Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.943G>A	9.37:g.118949960G>A	ENSP00000330658:p.Gly315Ser	B1AMF9|Q08371|Q68G52|Q9UDK7	ENST00000328252.3	37	CCDS6813.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	2.084	-0.410122	0.04799	.	.	ENSG00000182752	ENST00000328252	T	0.01685	4.69	5.88	0.506	0.16961	.	0.547831	0.22203	N	0.063216	T	0.01523	0.0049	L	0.38838	1.175	0.80722	D	1	B	0.21071	0.051	B	0.08055	0.003	T	0.52638	-0.8549	10	0.10636	T	0.68	-9.6888	9.5958	0.39573	0.3757:0.0:0.6243:0.0	.	315	Q13219	PAPP1_HUMAN	S	315	ENSP00000330658:G315S	ENSP00000330658:G315S	G	+	1	0	PAPPA	117989781	0.377000	0.25106	0.151000	0.22473	0.585000	0.36419	0.692000	0.25482	0.023000	0.15187	-0.126000	0.14955	GGC	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1		54.705566	0	-12	40	0	0	1	0	NM_002581	16	54.830576	12	0.571429
SLK	9748	broad.mit.edu	hg19	10	105758982	105758982	+	Missense_Mutation	SNP	A	A	G	rs148478778		TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr10:105758982A>G	ENST00000369755.3	+	6	1238	c.693A>G	c.(691-693)atA>atG	p.I231M	SLK_ENST00000335753.4_Missense_Mutation_p.I231M	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	231	Protein kinase.	apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity	kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	TGGCTGAGATAGAACCACCTC	0.403	0	80.0	77.0	78.0	10	105758982	2203	4300	6503	SO:0001583	missense		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613		11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""		3526554	Standard	NM_014720	Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.693A>G	10.37:g.105758982A>G	ENSP00000358770:p.Ile231Met	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	ENST00000369755.3	37	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.800842	0.50315	0.0	1.16E-4	ENSG00000065613	ENST00000335753;ENST00000369755	D;T	0.83992	-1.79;2.09	5.68	4.54	0.55810	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050956	0.85682	D	0.000000	T	0.66819	0.2828	N	0.11818	0.18	0.58432	D	0.999998	P;P	0.41313	0.7;0.745	B;B	0.36567	0.228;0.225	T	0.68507	-0.5390	10	0.31617	T	0.26	.	11.9191	0.52781	0.9305:0.0:0.0695:0.0	.	231;231	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	M	231	ENSP00000336824:I231M;ENSP00000358770:I231M	ENSP00000336824:I231M	I	+	3	3	SLK	105748972	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.742000	0.38248	2.162000	0.67917	0.482000	0.46254	ATA	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1		-8.935977	0	-18	72	0	0	1	0	NM_014720	3	7.036105	68	0.042254
GTF3C3	9330	broad.mit.edu	hg19	2	197657738	197657738	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr2:197657738G>A	ENST00000263956.3	-	3	442	c.353C>T	c.(352-354)gCg>gTg	p.A118V	GTF3C3_ENST00000409364.3_Missense_Mutation_p.A118V	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	118			transcription factor TFIIIC complex	DNA binding|protein binding	breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33					TACATCGCCCGCAGTGGGTTG	0.403	0	56.0	56.0	56.0	2	197657738	2203	4300	6503	SO:0001583	missense	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041	"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""		10373544	Standard	NM_001206774	Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.353C>T	2.37:g.197657738G>A	ENSP00000263956:p.Ala118Val	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621691	0.46736	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.46451	0.87;0.89	5.1	5.1	0.69264	.	0.194547	0.44097	D	0.000498	T	0.31888	0.0811	N	0.19112	0.55	0.49915	D	0.999834	B;B	0.18741	0.03;0.007	B;B	0.18263	0.021;0.003	T	0.05257	-1.0896	10	0.29301	T	0.29	-15.8657	18.7444	0.91787	0.0:0.0:1.0:0.0	.	118;118	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	V	118	ENSP00000263956:A118V;ENSP00000386465:A118V	ENSP00000263956:A118V	A	-	2	0	GTF3C3	197365983	1.000000	0.71417	0.992000	0.48379	0.796000	0.44982	6.030000	0.70903	2.652000	0.90054	0.655000	0.94253	GCG	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		-9.628519	0	-19	55	0	0	1	0		3	6.618612	69	0.041667
IGHV1OR15-9	0	broad.mit.edu	hg19	15	20170029	20170029	+	RNA	SNP	C	C	T	rs144252881	by1000genomes	TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr15:20170029C>T	ENST00000338912.5	-	0	242																					CCTGGAACTTCTGTGCATAGC	0.547	0	159.0	154.0	156.0	15	20170029	2104	4233	6337			L25542		15q11.1	2013-10-18	2008-08-22		ENSG00000188403	ENSG00000188403	"""Immunoglobulins / IGH orphons"""	5569	other	immunoglobulin gene			"""immunoglobulin heavy variable 1/OR15-9"", ""V-set and immunoglobulin domain containing 7"""	VSIG7	7959766	Standard	NG_032069	Approved	IGHV1/OR15-9, IGHV1OR159			OTTHUMG00000171652		15.37:g.20170029C>T			ENST00000338912.5	37																																																																																				IGHV1OR15-9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000414646.4		-33.084226	0	-75	112	0	0	1	0		5	9.161709	168	0.028902
PAGR1	79447	broad.mit.edu	hg19	16	29830893	29830893	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr16:29830893C>T	ENST00000320330.6	+	3	1145	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	AC009133.20_ENST00000569039.1_RNA|AC009133.12_ENST00000569809.1_RNA|AC009133.12_ENST00000564980.1_RNA|PAGR1_ENST00000609618.1_Nonsense_Mutation_p.Q195*					PAXIP1 associated glutamate-rich protein 1												AGCCCGGAGCCAGAAACGGGA	0.577	0	147.0	162.0	157.0	16	29830893	2197	4300	6497	SO:0001587	stop_gained	BC003640	CCDS10655.1	16p11.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000185928	ENSG00000185928		28707	protein-coding gene	gene with protein product	"""glutamate-rich coactivator interacting with SRC1/NCOA1"", ""PTIP-associated 1 protein"", ""glutamate-rich coactivator associated with SRC1"""	612033	"""chromosome 16 open reading frame 53"""	C16orf53	17500065, 19039327	Standard	NM_024516	Approved	MGC4606, GAS, PA1	uc002dug.4	Q9BTK6	OTTHUMG00000132117	ENST00000320330.6:c.583C>T	16.37:g.29830893C>T	ENSP00000326519:p.Gln195*	A2ICR6	ENST00000320330.6	37	CCDS10655.1	.	.	.	.	.	.	.	.	.	.	C	40	8.375036	0.98784	.	.	ENSG00000185928	ENST00000320330	.	.	.	5.82	5.82	0.92795	.	0.306842	0.33419	N	0.004933	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-21.6467	17.5892	0.87991	0.0:1.0:0.0:0.0	.	.	.	.	X	195	.	ENSP00000326519:Q195X	Q	+	1	0	C16orf53	29738394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.735000	0.47377	2.767000	0.95098	0.655000	0.94253	CAG	PAGR1-002	PUTATIVE	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000473165.1		144.266208	0	-97	193	0	0	1	0	NM_024516	54	151.449216	131	0.291892
PCDHB7	0	broad.mit.edu	hg19	5	140554081	140554081	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr5:140554081C>A	ENST00000231137.3	+	1	1839	c.1665C>A	c.(1663-1665)aaC>aaA	p.N555K		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN		555	Cadherin 5.	calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		TGGACGCCAACGACAACTCGC	0.726	0	28.0	32.0	31.0	5	140554081	2192	4283	6475	SO:0001583	missense	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212	"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333			10380929	Standard	NM_018940	Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1665C>A	5.37:g.140554081C>A	ENSP00000231137:p.Asn555Lys	A1L3Y8	ENST00000231137.3	37	CCDS4249.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.05|17.05	3.291169|3.291169	0.59976|0.59976	.|.	.|.	ENSG00000113212|ENSG00000113212	ENST00000231137|ENST00000543636	T|.	0.01745|.	4.66|.	4.3|4.3	0.795|0.795	0.18643|0.18643	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	D|D	0.85579|0.85579	0.5729|0.5729	H|H	0.98833|0.98833	4.345|4.345	0.38258|0.38258	D|D	0.941809|0.941809	D|.	0.89917|.	1.0|.	D|.	0.76575|.	0.988|.	D|D	0.83921|0.83921	0.0301|0.0301	9|5	0.87932|.	D|.	0|.	.|.	5.9973|5.9973	0.19501|0.19501	0.0:0.3365:0.0:0.6635|0.0:0.3365:0.0:0.6635	.|.	555|.	Q9Y5E2|.	PCDB7_HUMAN|.	K|K	555|338	ENSP00000231137:N555K|.	ENSP00000231137:N555K|.	N|T	+|+	3|2	2|0	PCDHB7|PCDHB7	140534265|140534265	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.966000|0.966000	0.64601|0.64601	-2.009000|-2.009000	0.01455|0.01455	0.355000|0.355000	0.24131|0.24131	0.449000|0.449000	0.29647|0.29647	AAC|ACG	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2		142.714814	1	-2	64	0	2.45108e-15	1	2.71606e-15	NM_018940	44	143.731678	26	0.628571
PRLHR	2834	broad.mit.edu	hg19	10	120353694	120353694	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr10:120353694G>A	ENST00000239032.2	-	2	1201	c.1063C>T	c.(1063-1065)Cgc>Tgc	p.R355C	PRLHR_ENST00000369169.1_Missense_Mutation_p.R355C	NM_004248.2	NP_004239	P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	355		female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity	large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)	GCTATCTTGCGGGGCCAAGCG	0.602	0	50.0	48.0	48.0	10	120353694	2203	4300	6503	SO:0001583	missense	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973	"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10	8666380, 15885496	Standard	NM_004248	Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.1063C>T	10.37:g.120353694G>A	ENSP00000358167:p.Arg355Cys	O75194|Q502U8|Q5VXR9	ENST00000369169.1	37	CCDS7606.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934272	0.34096	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.37411	1.2;1.2	4.7	3.71	0.42584	.	0.130594	0.47852	D	0.000220	T	0.46658	0.1404	L	0.53249	1.67	0.37443	D	0.914514	D	0.89917	1.0	P	0.60117	0.869	T	0.50056	-0.8872	10	0.45353	T	0.12	.	9.8449	0.41021	0.1757:0.0:0.8243:0.0	.	355	P49683	PRLHR_HUMAN	C	355	ENSP00000239032:R355C;ENSP00000358167:R355C	ENSP00000239032:R355C	R	-	1	0	PRLHR	120343684	0.407000	0.25352	0.905000	0.35620	0.015000	0.08874	2.045000	0.41250	2.445000	0.82738	0.561000	0.74099	CGC	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1		50.170072	0	6	39	0	0	1	0	NM_004248	17	50.430058	24	0.414634
GRIN2A	0	broad.mit.edu	hg19	16	9943759	9943759	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr16:9943759C>A	ENST00000396573.2	-	6	1491	c.1182G>T	c.(1180-1182)aaG>aaT	p.K394N	GRIN2A_ENST00000535259.1_Missense_Mutation_p.K237N|GRIN2A_ENST00000404927.2_Missense_Mutation_p.K394N|GRIN2A_ENST00000396575.2_Missense_Mutation_p.K394N|GRIN2A_ENST00000562109.1_Missense_Mutation_p.K394N|GRIN2A_ENST00000330684.3_Missense_Mutation_p.K394N	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	394		response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					CGGAGAAGGACTTGTACCTGG	0.582	0	134.0	109.0	118.0	16	9943759	2197	4300	6497	SO:0001583	missense		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454	"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A	9480759	Standard	XM_005255267	Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1182G>T	16.37:g.9943759C>A	ENSP00000379818:p.Lys394Asn	O00669|Q17RZ6	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	5.401	0.259122	0.10239	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.04194	3.68;3.68;3.68;3.68;3.68	5.22	0.552	0.17230	.	0.208574	0.51477	D	0.000100	T	0.01222	0.0040	N	0.00801	-1.175	0.33622	D	0.604897	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.40887	-0.9539	9	.	.	.	.	4.5616	0.12163	0.0:0.3637:0.2566:0.3797	.	237;394;394	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	N	394;394;237;394;394	ENSP00000379818:K394N;ENSP00000385872:K394N;ENSP00000441572:K237N;ENSP00000332549:K394N;ENSP00000379820:K394N	.	K	-	3	2	GRIN2A	9851260	0.774000	0.28592	1.000000	0.80357	0.994000	0.84299	-0.104000	0.10923	0.595000	0.29777	0.655000	0.94253	AAG	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		-1.745160	1	-17	50	0	0.014758	1	0.0151269		4	8.321154	50	0.074074
LUZP1	7798	broad.mit.edu	hg19	1	23417948	23417948	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr1:23417948G>A	ENST00000302291.4	-	4	3608	c.2807C>T	c.(2806-2808)cCc>cTc	p.P936L	LUZP1_ENST00000314174.5_Missense_Mutation_p.P936L|LUZP1_ENST00000374623.3_Missense_Mutation_p.P936L|LUZP1_ENST00000418342.1_Missense_Mutation_p.P936L			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	936			nucleus		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)	TCGAGTTGGGGGGTCTTCTAA	0.502	0	109.0	111.0	111.0	1	23417948	2203	4300	6503	SO:0001583	missense	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641		14985	protein-coding gene	gene with protein product		601422			8812416	Standard	NM_033631	Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2807C>T	1.37:g.23417948G>A	ENSP00000303758:p.Pro936Leu	Q5TH93|Q8N4X3|Q8TEH1	ENST00000302291.4	37	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475173	0.26511	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.15372	2.63;2.63;2.63;2.43	4.55	3.62	0.41486	.	0.766388	0.11531	N	0.554685	T	0.18718	0.0449	L	0.51422	1.61	0.39449	D	0.96737	B;B	0.26809	0.16;0.078	B;B	0.24701	0.054;0.055	T	0.04495	-1.0947	10	0.66056	D	0.02	.	11.4052	0.49894	0.0:0.0:0.819:0.181	.	936;936	Q86V48-2;Q86V48	.;LUZP1_HUMAN	L	936	ENSP00000393460:P936L;ENSP00000363752:P936L;ENSP00000303758:P936L;ENSP00000313705:P936L	ENSP00000303758:P936L	P	-	2	0	LUZP1	23290535	0.922000	0.31269	0.495000	0.27527	0.405000	0.30901	1.904000	0.39868	1.129000	0.42072	-0.515000	0.04445	CCC	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3		-21.206348	0	-12	146	0	0	1	0	NM_033631	7	13.626482	150	0.044586
C1orf127	148345	broad.mit.edu	hg19	1	11014184	11014184	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr1:11014184C>T	ENST00000377004.4	-	10	990	c.991G>A	c.(991-993)Gga>Aga	p.G331R	C1orf127_ENST00000377008.4_Missense_Mutation_p.G164R	NM_001170754.1	NP_001164225.1	B7ZLG7	B7ZLG7_HUMAN	chromosome 1 open reading frame 127	182					NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)	GGGGTTCCTCCGACTTCTTGG	0.572	0	112.0	115.0	114.0	1	11014184	2203	4300	6503	SO:0001583	missense	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262		26730	protein-coding gene	gene with protein product					14702039	Standard	NM_001170754	Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377004.4:c.991G>A	1.37:g.11014184C>T	ENSP00000366203:p.Gly331Arg	A0AVG8|A6NKM7|Q5VXJ2	ENST00000377004.4	37	CCDS53267.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.548495	0.00140	.	.	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.20738	2.06;2.05	4.94	-5.3	0.02738	.	3.475080	0.00919	N	0.002564	T	0.07593	0.0191	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.27673	-1.0067	10	0.06625	T	0.88	4.6333	5.1712	0.15110	0.0677:0.3202:0.1539:0.4583	.	182;182;164	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	R	331;164	ENSP00000366203:G331R;ENSP00000366207:G164R	ENSP00000366203:G331R	G	-	1	0	C1orf127	10936771	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.396000	0.07278	-1.710000	0.01397	-3.386000	0.00040	GGA	C1orf127-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			85.383499	0	-53	74	0	0	1	0	NM_173507	28	86.439323	47	0.373333
SH3RF1	57630	broad.mit.edu	hg19	4	170037527	170037527	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr4:170037527G>A	ENST00000284637.9	-	10	2373	c.2032C>T	c.(2032-2034)Ccc>Tcc	p.P678S	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	678			Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding	NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)	CGGCCACTGGGCTCAGCCTCC	0.577	0	72.0	62.0	65.0	4	170037527	2203	4300	6503	SO:0001583	missense	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447	"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2	9482736	Standard	NM_020870	Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2032C>T	4.37:g.170037527G>A	ENSP00000284637:p.Pro678Ser	Q05BT2|Q8IW46|Q9HAM2|Q9P234	ENST00000284637.9	37	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	G	1.489	-0.555200	0.03967	.	.	ENSG00000154447	ENST00000284637	T	0.12879	2.64	5.49	4.65	0.58169	.	0.362204	0.32473	N	0.006050	T	0.09423	0.0232	L	0.40543	1.245	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	T	0.34601	-0.9822	10	0.12430	T	0.62	-23.7601	5.7545	0.18164	0.1601:0.0:0.6441:0.1958	.	678	Q7Z6J0	SH3R1_HUMAN	S	678	ENSP00000284637:P678S	ENSP00000284637:P678S	P	-	1	0	SH3RF1	170274102	0.019000	0.18553	0.324000	0.25361	0.003000	0.03518	0.664000	0.25068	1.320000	0.45209	-0.263000	0.10527	CCC	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3		-1.831504	0	-27	28	0	0	1	0	NM_020870	3	6.315695	40	0.069767
KIAA1324L	222223	broad.mit.edu	hg19	7	86542377	86542377	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr7:86542377G>A	ENST00000444627.1	-	14	1853	c.1736C>T	c.(1735-1737)aCt>aTt	p.T579I	KIAA1324L_ENST00000490995.1_5'UTR|KIAA1324L_ENST00000297222.6_Silent_p.H385H|KIAA1324L_ENST00000450689.2_Silent_p.H625H|KIAA1324L_ENST00000416314.1_Silent_p.H458H			A8MWY0	K132L_HUMAN	KIAA1324-like	0			integral to membrane		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)				TCTCAATGTAGTGGCCTGGAG	0.552	0	161.0	134.0	143.0	7	86542377	2203	4300	6503	SO:0001583	missense	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659		21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048				Standard	NM_001142749	Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000444627.1:c.1736C>T	7.37:g.86542377G>A	ENSP00000397377:p.Thr579Ile	A4D1C9|B4DJV3|Q17RI6|Q96DP2	ENST00000444627.1	37		.	.	.	.	.	.	.	.	.	.	G	14.58	2.576656	0.45902	.	.	ENSG00000164659	ENST00000444627	T	0.16897	2.31	5.82	4.93	0.64822	.	.	.	.	.	T	0.28566	0.0707	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.00277	-1.1854	6	0.33940	T	0.23	.	14.3001	0.66341	0.072:0.0:0.928:0.0	.	.	.	.	I	579	ENSP00000397377:T579I	ENSP00000397377:T579I	T	-	2	0	KIAA1324L	86380313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.994000	0.56994	2.752000	0.94435	0.655000	0.94253	ACT	KIAA1324L-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000333839.1		-4.249452	0	-4	40	0	0	1	0	NM_152748	4	8.786290	61	0.061538
RPP38	10557	broad.mit.edu	hg19	10	15146062	15146062	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr10:15146062G>A	ENST00000378197.4	+	3	1263	c.749G>A	c.(748-750)cGg>cAg	p.R250Q	NMT2_ENST00000466201.1_Intron|RPP38_ENST00000378202.5_Missense_Mutation_p.R250Q|RPP38_ENST00000451677.1_Intron	NM_183005.4	NP_892117.1	P78345	RPP38_HUMAN	ribonuclease P/MRP 38kDa subunit	250		tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity	breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)	8					GCTGACGGTCGGCAGGCTTCT	0.393	0	54.0	59.0	57.0	10	15146062	2201	4299	6500	SO:0001583	missense	U77664	CCDS7108.1	10p13	2012-05-21			ENSG00000152464	ENSG00000152464		30329	protein-coding gene	gene with protein product		606116			9037013, 9630247	Standard	NM_183005	Approved		uc001inx.5	P78345	OTTHUMG00000017728	ENST00000378197.4:c.749G>A	10.37:g.15146062G>A	ENSP00000367439:p.Arg250Gln	B3KPY0|D3DRT8|Q53F71|Q8NHS8	ENST00000378197.4	37	CCDS7108.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.041506	0.00402	.	.	ENSG00000152464	ENST00000378203;ENST00000378202;ENST00000378197	T;T;T	0.09073	3.02;3.02;3.02	5.71	-1.81	0.07882	.	1.581750	0.03610	N	0.234684	T	0.02649	0.0080	N	0.01267	-0.92	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40664	-0.9551	10	0.10377	T	0.69	-2.3688	5.962	0.19305	0.4555:0.1435:0.401:0.0	.	250	P78345	RPP38_HUMAN	Q	250	ENSP00000367445:R250Q;ENSP00000367444:R250Q;ENSP00000367439:R250Q	ENSP00000367439:R250Q	R	+	2	0	RPP38	15186068	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.064000	0.14437	-0.274000	0.09232	-1.832000	0.00591	CGG	RPP38-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046976.1		63.659327	0	5	88	0	0	1	0	NM_006414	22	66.067308	50	0.305556
SLC39A5	283375	broad.mit.edu	hg19	12	56625257	56625257	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr12:56625257C>A	ENST00000266980.4	+	2	492	c.199C>A	c.(199-201)Cta>Ata	p.L67I	SLC39A5_ENST00000454355.2_Missense_Mutation_p.L67I	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	67		zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity	NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27					CAGCCTGGGGCTAGGCCGAGT	0.637	0	53.0	59.0	57.0	12	56625257	2203	4300	6503	SO:0001583	missense		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540	"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""			Standard	NM_173596	Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.199C>A	12.37:g.56625257C>A	ENSP00000266980:p.Leu67Ile	B2R808|Q8N6Y3	ENST00000266980.4	37	CCDS8912.2	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854619	0.71719	.	.	ENSG00000139540	ENST00000424625;ENST00000419753;ENST00000454355;ENST00000417965;ENST00000436633;ENST00000266980;ENST00000437277	T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82	4.6	3.68	0.42216	.	0.000000	0.41605	D	0.000848	T	0.42810	0.1219	M	0.64567	1.98	0.42150	D	0.991554	D	0.76494	0.999	D	0.78314	0.991	T	0.19712	-1.0297	10	0.16896	T	0.51	-6.2241	12.6317	0.56661	0.0:0.9109:0.0:0.0891	.	67	Q6ZMH5	S39A5_HUMAN	I	67;67;67;67;38;67;67	ENSP00000404155:L67I;ENSP00000402891:L67I;ENSP00000405360:L67I;ENSP00000414868:L67I;ENSP00000391711:L38I;ENSP00000266980:L67I;ENSP00000407399:L67I	ENSP00000266980:L67I	L	+	1	2	SLC39A5	54911524	0.999000	0.42202	0.997000	0.53966	0.990000	0.78478	2.565000	0.45939	2.269000	0.75478	0.561000	0.74099	CTA	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1		100.645676	1	-9	52	0	9.8876e-21	1	1.12609e-20	NM_173596	35	101.168386	49	0.416667
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		58.585534	0	-14	67	0	0	1	0	NM_002067	20	59.485132	35	0.363636
NRCAM	4897	broad.mit.edu	hg19	7	107871480	107871480	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr7:107871480T>C	ENST00000379028.3	-	8	1015	c.545A>G	c.(544-546)gAt>gGt	p.D182G	NRCAM_ENST00000413765.2_Missense_Mutation_p.D182G|NRCAM_ENST00000351718.4_Missense_Mutation_p.D176G|NRCAM_ENST00000379024.4_Missense_Mutation_p.D182G|NRCAM_ENST00000379022.4_Missense_Mutation_p.D182G|NRCAM_ENST00000425651.2_Missense_Mutation_p.D182G			Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	182	Ig-like 2.	angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65					CTTACAATTATCCATCCAAAA	0.308	0	51.0	53.0	52.0	7	107871480	2202	4300	6502	SO:0001583	missense		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581			8812479	Standard	NM_001037132	Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000379024.4:c.545A>G	7.37:g.107871480T>C	ENSP00000368310:p.Asp182Gly	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	ENST00000379024.4	37	CCDS55153.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560350	0.86335	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701	T;T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11;1.11	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.095855	0.64402	D	0.000001	T	0.55862	0.1947	M	0.62723	1.935	0.80722	D	1	P;P;P;P;P	0.50528	0.906;0.936;0.871;0.906;0.796	P;P;P;P;P	0.58013	0.615;0.831;0.648;0.615;0.581	T	0.53507	-0.8429	10	0.33141	T	0.24	.	14.8154	0.70031	0.0:0.0:0.0:1.0	.	182;182;182;176;182	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	G	182;182;182;182;176;182;182;182;176;176	ENSP00000368314:D182G;ENSP00000407858:D182G;ENSP00000325269:D176G;ENSP00000368310:D182G;ENSP00000401244:D182G;ENSP00000368308:D182G;ENSP00000390421:D176G	ENSP00000325269:D176G	D	-	2	0	NRCAM	107658716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.132000	0.65825	0.528000	0.53228	GAT	NRCAM-001	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337863.2		68.469737	0	-44	50	0	0	1	0	NM_001037132	24	71.183779	55	0.303797
CENPI	2491	broad.mit.edu	hg19	X	100357392	100357392	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chrX:100357392G>A	ENST00000372927.1	+	3	633	c.356G>A	c.(355-357)gGc>gAc	p.G119D	CENPI_ENST00000218507.5_Missense_Mutation_p.G119D|CENPI_ENST00000423383.1_Missense_Mutation_p.G119D|CENPI_ENST00000372926.1_Missense_Mutation_p.G119D	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	119		CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30					GCACTCAGTGGCAAATTTGGT	0.289	0	95.0	100.0	98.0	X	100357392	2203	4299	6502	SO:0001583	missense	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384		3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1	16622420	Standard	NM_006733	Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.356G>A	X.37:g.100357392G>A	ENSP00000362018:p.Gly119Asp	Q5JWZ9|Q96ED0	ENST00000372927.1	37	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355433	0.41700	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.17	5.17	0.71159	.	0.155066	0.64402	D	0.000018	T	0.76737	0.4029	M	0.73598	2.24	0.51233	D	0.999915	D;D	0.71674	0.998;0.998	D;D	0.71414	0.973;0.973	T	0.73820	-0.3862	9	0.20519	T	0.43	-8.0103	16.1869	0.81960	0.0:0.0:1.0:0.0	.	119;119	B4DZL4;Q92674	.;CENPI_HUMAN	D	119	.	ENSP00000218507:G119D	G	+	2	0	CENPI	100244048	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	7.002000	0.76304	2.276000	0.75962	0.538000	0.68166	GGC	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1		-10.570514	0	-39	109	0	0	1	0	NM_006733	4	6.353119	75	0.050633
ZNF341	84905	broad.mit.edu	hg19	20	32358081	32358081	+	Silent	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr20:32358081G>A	ENST00000375200.1	+	10	1970	c.1605G>A	c.(1603-1605)aaG>aaA	p.K535K	ZNF341_ENST00000342427.2_Silent_p.K528K	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	535		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31					GCCCCAAGAAGGACAATGCCG	0.647	0	101.0	75.0	84.0	20	32358081	2203	4300	6503	SO:0001819	synonymous_variant	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061	"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product						Standard	NM_001282933	Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000342427.2:c.1584G>A	20.37:g.32358081G>A		A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	ENST00000342427.2	37	CCDS13227.1																																																																																			ZNF341-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078741.2		95.146166	0	0	36	0	0	1	0		27	98.756422	5	0.843750
IGFBP3	3486	broad.mit.edu	hg19	7	45956889	45956889	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr7:45956889G>A	ENST00000275521.6	-	2	686	c.553C>T	c.(553-555)Cgc>Tgc	p.R185C	IGFBP3_ENST00000381086.5_Missense_Mutation_p.R88C|IGFBP3_ENST00000381083.4_Missense_Mutation_p.R191C|IGFBP3_ENST00000465642.1_5'UTR	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	185		negative regulation of protein phosphorylation|negative regulation of signal transduction|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of apoptosis|positive regulation of myoblast differentiation|protein phosphorylation|regulation of cell growth	nucleus	insulin-like growth factor I binding|metal ion binding|protein tyrosine phosphatase activator activity	large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					ACTTTGTAGCGCTGGCTGTCT	0.507	1	168.0	148.0	154.0	7	45956889	2203	4300	6503	SO:0001583	missense		CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674		5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732			1695633	Standard	NM_000598	Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000381083.4:c.571C>T	7.37:g.45956889G>A	ENSP00000370473:p.Arg191Cys	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	ENST00000381083.4	37	CCDS34632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.118696|4.118696	0.77323|0.77323	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000417621|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817	.|T;T;T;T	.|0.28255	.|2.32;1.66;2.32;1.62	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Thyroglobulin type-1 (1);	.|2.918300	.|0.00843	.|N	.|0.001760	T|T	0.63988|0.63988	0.2558|0.2558	M|M	0.81239|0.81239	2.535|2.535	0.45733|0.45733	D|D	0.998635|0.998635	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.66351	.|0.943;0.943;0.943	T|T	0.37709|0.37709	-0.9694|-0.9694	5|10	.|0.72032	.|D	.|0.01	-52.4084|-52.4084	15.0203|15.0203	0.71624|0.71624	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|88;185;170	.|B3KWK7;P17936;B4DN53	.|.;IBP3_HUMAN;.	V|C	46|162;185;88;171;83;191;157;75	.|ENSP00000275521:R185C;ENSP00000370476:R88C;ENSP00000370473:R191C;ENSP00000389668:R75C	.|ENSP00000275521:R185C	A|R	-|-	2|1	0|0	IGFBP3|IGFBP3	45923414|45923414	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.779000|4.779000	0.62375|0.62375	2.613000|2.613000	0.88420|0.88420	0.655000|0.655000	0.94253|0.94253	GCG|CGC	IGFBP3-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353842.1		61.975147	0	-29	98	0	0	1	0	NM_001013398	27	70.494931	94	0.223140
SHROOM2	357	broad.mit.edu	hg19	X	9864553	9864553	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chrX:9864553A>G	ENST00000380913.3	+	4	2695	c.2605A>G	c.(2605-2607)Agg>Ggg	p.R869G		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	869		apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity	breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)			CCTGCCGCGGAGGCTCGGCAC	0.637	0	22.0	21.0	21.0	X	9864553	2202	4299	6501	SO:0001583	missense	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950		630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL	7795590, 16615870	Standard	NM_001649	Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2605A>G	X.37:g.9864553A>G	ENSP00000370299:p.Arg869Gly	B9EIQ7	ENST00000380913.3	37	CCDS14135.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.822871	0.32237	.	.	ENSG00000146950	ENST00000380913	T	0.24723	1.84	5.02	-0.581	0.11713	.	0.108809	0.64402	D	0.000017	T	0.43344	0.1243	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.17715	-1.0360	10	0.72032	D	0.01	-9.3072	10.1122	0.42570	0.3654:0.5241:0.0:0.1105	.	869	Q13796	SHRM2_HUMAN	G	869	ENSP00000370299:R869G	ENSP00000370299:R869G	R	+	1	2	SHROOM2	9824553	0.994000	0.37717	0.000000	0.03702	0.005000	0.04900	1.750000	0.38329	-0.514000	0.06488	-0.371000	0.07208	AGG	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1		8.721266	0	-3	16	0	0	1	0	NM_001649	3	9.078531	7	0.300000
OR1Q1	158131	broad.mit.edu	hg19	9	125377737	125377737	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr9:125377737T>C	ENST00000297913.2	+	1	790	c.721T>C	c.(721-723)Tgc>Cgc	p.C241R	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	241		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17					CTTTTCTACCTGCGGCTCCCA	0.562	0	83.0	84.0	84.0	9	125377737	2203	4300	6503	SO:0001583	missense		CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202	"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3		Standard	NM_012364	Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.721T>C	9.37:g.125377737T>C	ENSP00000297913:p.Cys241Arg	Q6IFN4|Q8NGR7|Q96R82	ENST00000297913.2	37	CCDS35125.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767025	0.69878	.	.	ENSG00000165202	ENST00000297913	T	0.00372	7.73	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000050	T	0.02047	0.0064	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03750	-1.1007	10	0.87932	D	0	-1.414	14.8569	0.70344	0.0:0.0:0.0:1.0	.	241	Q15612	OR1Q1_HUMAN	R	241	ENSP00000297913:C241R	ENSP00000297913:C241R	C	+	1	0	OR1Q1	124417558	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.971000	0.70440	2.340000	0.79590	0.528000	0.53228	TGC	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053946.1		-8.264093	0	-17	81	0	0	1	0		4	7.009818	69	0.054795
PRKG1	5592	broad.mit.edu	hg19	10	52751284	52751284	+	Missense_Mutation	SNP	T	T	G			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr10:52751284T>G	ENST00000373985.1	+	1	167	c.110T>G	c.(109-111)gTg>gGg	p.V37G	PRKG1_ENST00000401604.2_Missense_Mutation_p.V49G	NM_001098512.2	NP_001091982.1	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	49	Dimerization.	actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)	GTGCTCCCAGTGCCCTCGACC	0.622	0	27.0	36.0	33.0	10	52751284	1911	4126	6037	SO:0001583	missense		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B	2792381, 1544322	Standard	NM_001098512	Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000373985.1:c.110T>G	10.37:g.52751284T>G	ENSP00000363097:p.Val37Gly	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	ENST00000373985.1	37		.	.	.	.	.	.	.	.	.	.	T	9.623	1.134261	0.21123	.	.	ENSG00000185532	ENST00000401604;ENST00000373985	T;T	0.68181	-0.31;-0.29	4.93	1.11	0.20524	Cyclic nucleotide-binding-like (1);	.	.	.	.	T	0.37544	0.1007	N	0.08118	0	0.34786	D	0.735233	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.23013	-1.0200	9	0.17369	T	0.5	.	3.9591	0.09403	0.0:0.2518:0.1872:0.561	.	49;49	B4DT93;Q13976	.;KGP1_HUMAN	G	49;37	ENSP00000384200:V49G;ENSP00000363097:V37G	ENSP00000363097:V37G	V	+	2	0	PRKG1	52421290	1.000000	0.71417	0.988000	0.46212	0.721000	0.41392	0.591000	0.23969	0.226000	0.20979	0.260000	0.18958	GTG	PRKG1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048102.1		18.750776	0	3	12	0	0	1	0		6	18.770570	5	0.545455
BAP1	8314	broad.mit.edu	hg19	3	52443612	52443613	+	Frame_Shift_Ins	INS	-	-	C			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr3:52443612_52443613insC	ENST00000460680.1	-	3	550_551	c.79_80insG	c.(79-81)gtgfs	p.V27fs	BAP1_ENST00000296288.5_Frame_Shift_Ins_p.V27fs	NM_004656.2	NP_004647.1	Q92560	BAP1_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	27		monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	CTCCACTTGCACCCCCTTGACA	0.629	0									SO:0001589	frameshift_variant	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.80dupG	3.37:g.52443617_52443617dupC	ENSP00000417132:p.Val27fs	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	.	.		-59	177						131		24	0.85
DHTKD1	55526	broad.mit.edu	hg19	10	12159715	12159721	+	Frame_Shift_Del	DEL	TTAACCC	TTAACCC	-			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr10:12159715_12159721delTTAACCC	ENST00000263035.4	+	14	2425_2431	c.2363_2369delTTAACCC	c.(2362-2370)tttaacccgfs	p.FNP788fs		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	788		glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)		GGAACAACATTTAACCCGGTCATTGGT	0.420	0									SO:0001589	frameshift_variant	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192		23537	protein-coding gene	gene with protein product		614984			10997877	Standard	NM_018706	Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2363_2369delTTAACCC	10.37:g.12159715_12159721delTTAACCC	ENSP00000263035:p.Phe788fs	Q68CU5|Q9BUM8|Q9HCE2	ENST00000263035.4	37	CCDS7087.1																																																																																			DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	.	.		-26	100					NM_018706	46		41	0.53
WDR34	89891	hgsc.bcm.edu	hg19	9	131396572	131396597	+	Frame_Shift_Del	DEL	GAGGGAGAGCTGCAGCGAAGTCAAGG	GAGGGAGAGCTGCAGCGAAGTCAAGG	-	rs113007289		TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08	GAGGGAGAGCTGCAGCGAAGTCAAGG	GAGGGAGAGCTGCAGCGAAGTCAAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c																										ACAGATACTTGAGGGAGAGCTGCAGCGAAGTCAAGGGAGGGGCCTG	0.597	0									SO:0001589	frameshift_variant	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333	"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363			19521662, 21953912, 24183451	Standard	NM_052844	Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.1280_1305delCCTTGACTTCGCTGCAGCTCTCCCTC	9.37:g.131396572_131396597delGAGGGAGAGCTGCAGCGAAGTCAAGG	ENSP00000361800:p.Pro427fs	Q5VXV4|Q9BV46	ENST00000372715.2	37	CCDS6906.2																																																																																			WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1				-23	83					NM_052844	13		26	
SCN8A	6334	broad.mit.edu	hg19	12	52082555	52082555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VD-A8KL-01A-11D-A39W-08	TCGA-VD-A8KL-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5b095f82-bf20-47a2-90cb-36e97c5216dd	33a04c9d-2244-4121-8621-1120b581256c	g.chr12:52082555delT	ENST00000354534.6	+	6	806	c.628delT	c.(628-630)tttfs	p.F210fs	SCN8A_ENST00000550891.1_Intron|SCN8A_ENST00000545061.1_Frame_Shift_Del_p.F210fs	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit			axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity	breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	TATAACAGAGTTTGTAAACCT	0.448	0	176.0	172.0	174.0	12	52082555	2021	4217	6238	SO:0001589	frameshift_variant	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876	"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED	7670495, 9828131, 16382098	Standard	NM_014191	Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.628delT	12.37:g.52082555delT	ENSP00000346534:p.Phe210fs	B9VWG8|O95788|Q9NYX2|Q9UPB2	ENST00000354534.6	37	CCDS44891.1																																																																																			SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	.	.		-18	101					NM_014191	9		158	0.05
