Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
TRAM1	23471	broad.mit.edu	hg19	8	71520412	71520412	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr8:71520412G>C	ENST00000262213.2	-	1	192	c.23C>G	c.(22-24)aCc>aGc	p.T8S	TRAM1_ENST00000536748.1_Intron|TRAM1_ENST00000521049.1_5'UTR	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	8		cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity	endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)		GGGGCTCTTGGTGCTTTTCTT	0.652	0	70.0	73.0	72.0	8	71520412	2203	4300	6503	SO:0001583	missense	X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167		20568	protein-coding gene	gene with protein product		605190			1315422	Standard	NM_014294	Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.23C>G	8.37:g.71520412G>C	ENSP00000262213:p.Thr8Ser	B4E0K2	ENST00000262213.2	37	CCDS6207.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310373	0.23821	.	.	ENSG00000067167	ENST00000262213	T	0.29655	1.56	4.87	0.717	0.18196	.	0.522337	0.20988	N	0.082088	T	0.12646	0.0307	N	0.05306	-0.075	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18209	-1.0344	10	0.16420	T	0.52	-0.1219	9.461	0.38785	0.0:0.4389:0.2492:0.3119	.	8	Q15629	TRAM1_HUMAN	S	8	ENSP00000262213:T8S	ENSP00000262213:T8S	T	-	2	0	TRAM1	71682966	0.973000	0.33851	0.995000	0.50966	0.983000	0.72400	0.001000	0.13038	-0.176000	0.10707	0.563000	0.77884	ACC	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1		122.381440	0	-35	71	0	0	1	0	NM_014294	37	122.496738	31	0.544118
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	A	rs121913492		TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr9:80409488T>A	ENST00000286548.4	-	5	848	c.626A>T	c.(625-627)cAa>cTa	p.Q209L	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7L	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>T	9.37:g.80409488T>A	ENSP00000286548:p.Gln209Leu	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985495	0.93044	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97573	0.9205	H	0.99347	4.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99402	1.0928	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	L	209;7	ENSP00000286548:Q209L;ENSP00000443197:Q7L	ENSP00000286548:Q209L	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		113.790378	0	-5	107	0	0	1	0	NM_002072	36	114.008097	45	0.444444
ACTB	60	broad.mit.edu	hg19	7	5568323	5568323	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr7:5568323C>T	ENST00000331789.5	-	4	582	c.391G>A	c.(391-393)Gcc>Acc	p.A131T		NM_001101.3	NP_001092.1	P60709	ACTB_HUMAN	actin, beta	131		'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton	NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)	ACGTACATGGCTGGGGTGTTG	0.587	0	102.0	104.0	103.0	7	5568323	2203	4300	6503	SO:0001583	missense	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624		132	protein-coding gene	gene with protein product		102630			1505215	Standard	NM_001101	Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.391G>A	7.37:g.5568323C>T	ENSP00000349960:p.Ala131Thr	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290822	0.59976	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713;ENST00000432588	D;D	0.96168	-3.93;-3.93	5.11	4.23	0.50019	.	0.000000	0.64402	D	0.000011	D	0.98670	0.9554	H	0.99325	4.515	0.47949	D	0.999557	D	0.89917	1.0	D	0.97110	1.0	D	0.98559	1.0640	10	0.87932	D	0	.	11.9419	0.52905	0.0:0.914:0.0:0.086	.	131	P60709	ACTB_HUMAN	T	131;131;103;50;131	ENSP00000349960:A131T;ENSP00000407473:A131T	ENSP00000440549:A50T	A	-	1	0	ACTB	5534849	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	7.622000	0.83099	1.298000	0.44778	0.650000	0.86243	GCC	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4		116.700093	0	-30	102	0	0	1	0	NM_001101	38	116.700093	38	0.500000
OLFM1	10439	ucsc.edu	hg19	9	138011665	138011665	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874																										GCTGTGGGCCGTGTACGCCAC	0.627	0	77.0	60.0	66.0	9	138011665	2203	4300	6503	SO:0001583	missense	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558		17187	protein-coding gene	gene with protein product	"""pancortin"""	605366			9039501	Standard	NM_006334	Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371796.3:c.1018G>A	9.37:g.138011665G>A	ENSP00000360861:p.Val340Met	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	ENST00000371796.3	37		.	.	.	.	.	.	.	.	.	.	G	21.7	4.190584	0.78789	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90676	-2.71;-2.71;-2.71	5.07	5.07	0.68467	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.061993	0.64402	D	0.000004	D	0.95089	0.8409	M	0.75447	2.3	0.58432	D	0.999999	D;D	0.89917	0.989;1.0	P;D	0.74348	0.874;0.983	D	0.95612	0.8673	10	0.87932	D	0	.	18.4324	0.90630	0.0:0.0:1.0:0.0	.	367;349	Q99784;Q6IMJ8	NOE1_HUMAN;.	M	349;340;367	ENSP00000252854:V349M;ENSP00000360861:V340M;ENSP00000360858:V367M	ENSP00000252854:V349M	V	+	1	0	OLFM1	137151486	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.571000	0.98176	2.357000	0.79964	0.561000	0.74099	GTG	OLFM1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000054973.1				-2	33					NM_014279	4		31	
MYBPC3	4607	broad.mit.edu	hg19	11	47358992	47358992	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr11:47358992G>T	ENST00000399249.2	-	24	2606	c.2552C>A	c.(2551-2553)gCc>gAc	p.A851D	MYBPC3_ENST00000256993.4_Missense_Mutation_p.A850D|MYBPC3_ENST00000545968.1_Missense_Mutation_p.A851D			Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	850	Fibronectin type-III 1.	cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding	breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)	CATGCCGATGGCGTTGACCGC	0.637	0	59.0	62.0	61.0	11	47358992	2143	4234	6377	SO:0001583	missense	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571	"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4	7744002, 8358441	Standard	NM_000256	Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2552C>A	11.37:g.47358992G>T	ENSP00000442795:p.Ala851Asp	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671560	0.88348	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.57436	0.4;0.4;0.4	4.6	4.6	0.57074	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67942	0.2947	L	0.54908	1.71	0.44092	D	0.996853	D	0.59357	0.985	D	0.68621	0.959	T	0.69942	-0.5008	9	0.54805	T	0.06	.	17.6256	0.88093	0.0:0.0:1.0:0.0	.	850	Q14896	MYPC3_HUMAN	D	851;851;850	ENSP00000442795:A851D;ENSP00000382193:A851D;ENSP00000256993:A850D	ENSP00000256993:A850D	A	-	2	0	MYBPC3	47315568	1.000000	0.71417	0.983000	0.44433	0.985000	0.73830	7.057000	0.76669	2.395000	0.81488	0.561000	0.74099	GCC	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		38.033255	1	-1	53	0	7.05477e-17	1	7.72665e-17		14	39.463248	31	0.311111
CANT1	124583	broad.mit.edu	hg19	17	76993313	76993313	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr17:76993313T>C	ENST00000302345.2	-	2	886	c.392A>G	c.(391-393)aAg>aGg	p.K131R	CANT1_ENST00000591773.1_Missense_Mutation_p.K131R|CANT1_ENST00000392446.5_Missense_Mutation_p.K131R	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	131		positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)		CAGGTAGCCCTTTTTCAGGTA	0.577	0	184.0	181.0	182.0	17	76993313	2203	4300	6503	SO:0001583	missense	AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302		19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165			12167635	Standard	NM_138793	Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.392A>G	17.37:g.76993313T>C	ENSP00000307674:p.Lys131Arg	B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	ENST00000302345.2	37	CCDS11760.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.501139	0.26861	.	.	ENSG00000171302	ENST00000302345;ENST00000392446;ENST00000537282;ENST00000339300	D;D	0.85773	-2.03;-2.03	5.27	4.19	0.49359	.	0.099573	0.64402	D	0.000002	T	0.71065	0.3296	N	0.20357	0.565	0.50632	D	0.999887	B	0.06786	0.001	B	0.10450	0.005	T	0.59440	-0.7454	10	0.13108	T	0.6	-30.8089	8.2417	0.31665	0.0:0.1541:0.0:0.8459	.	131	Q8WVQ1	CANT1_HUMAN	R	131;131;131;80	ENSP00000307674:K131R;ENSP00000376241:K131R	ENSP00000307674:K131R	K	-	2	0	CANT1	74504908	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.832000	0.39151	0.845000	0.35118	0.459000	0.35465	AAG	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2		-63.718880	0	-33	317	0	0	1	0	NM_138793	4	7.012107	261	0.015094
FBLN2	2199	broad.mit.edu	hg19	3	13672941	13672941	+	Silent	SNP	C	C	T			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr3:13672941C>T	ENST00000404922.3	+	16	3317	c.3198C>T	c.(3196-3198)aaC>aaT	p.N1066N	FBLN2_ENST00000492059.1_Silent_p.N1066N|FBLN2_ENST00000295760.7_Silent_p.N1019N|FBLN2_ENST00000535798.1_Silent_p.N1045N	NM_001004019.1	NP_001004019.1	P98095	FBLN2_HUMAN	fibulin 2	1033	EGF-like 10; calcium-binding.		proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)		TGACGGCCAACGGGAGGTCCT	0.642	0	28.0	30.0	29.0	3	13672941	2136	4215	6351	SO:0001819	synonymous_variant	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520	"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821			7806230	Standard	NM_001165035	Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000404922.3:c.3198C>T	3.37:g.13672941C>T		B7Z9C5|Q8IUI0|Q8IUI1	ENST00000404922.3	37	CCDS46761.1	.	.	.	.	.	.	.	.	.	.	C	9.957	1.221680	0.22457	.	.	ENSG00000163520	ENST00000295761	.	.	.	5.39	-0.778	0.10977	.	.	.	.	.	T	0.57533	0.2060	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53718	-0.8399	4	.	.	.	.	10.7163	0.46015	0.0:0.3131:0.0:0.6869	.	.	.	.	M	38	.	.	T	+	2	0	FBLN2	13647942	0.805000	0.28982	0.992000	0.48379	0.975000	0.68041	-0.086000	0.11233	-0.049000	0.13379	0.655000	0.94253	ACG	FBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340082.4		8.923121	0	-5	8	0	0	1	0	NM_001004019	3	9.032827	5	0.375000
ARAP1	116985	broad.mit.edu	hg19	11	72408531	72408531	+	Splice_Site	SNP	C	C	T			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr11:72408531C>T	ENST00000359373.5	-	21	3641	c.2790G>A	c.(2788-2790)agG>agA	p.R930R	ARAP1_ENST00000426523.1_Splice_Site_p.R685R|ARAP1_ENST00000334211.8_Splice_Site_p.R685R|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000455638.2_Splice_Site_p.R930R|ARAP1_ENST00000393609.3_Splice_Site_p.R930R|ARAP1_ENST00000429686.1_Splice_Site_p.R624R|ARAP1_ENST00000393605.3_Splice_Site_p.R690R			Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	930		actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding	cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27					TGTACAGTGTCCTGGGCCAGG	0.652	0	32.0	35.0	34.0	11	72408531	2200	4292	6492	SO:0001630	splice_region_variant	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635	"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2		Standard	NM_001040118	Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2790-1G>A	11.37:g.72408531C>T		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	ENST00000393609.3	37	CCDS41687.1																																																																																			ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1		51.466317	0	-14	30	0	0	1	0	NM_001040118	17	51.799488	25	0.404762
XIST	0	broad.mit.edu	hg19	X	73062599	73062599	+	RNA	SNP	G	G	A			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chrX:73062599G>A	ENST00000429829.1	-	0	9989					NR_001564.2																AAGAGAAAGGGCCTTGTCTGG	0.473	0	53.0	51.0	51.0	X	73062599	876	1991	2867			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807	"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E	1985261, 2034279	Standard	NR_001564	Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73062599G>A			ENST00000429829.1	37																																																																																				XIST-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000057239.1		60.802335	0	-28	16	0	0	1	0	NR_001564	17	60.802328	0	1.000000
C15orf54	400360	broad.mit.edu	hg19	15	39544396	39544396	+	Silent	SNP	G	G	A			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr15:39544396G>A	ENST00000318578.3	+	2	428	c.60G>A	c.(58-60)ccG>ccA	p.P20P	RP11-624L4.1_ENST00000558209.1_RNA|RP11-624L4.1_ENST00000560484.1_RNA|RP11-624L4.1_ENST00000561058.1_RNA|C15orf54_ENST00000561223.1_Silent_p.P20P	NM_207445.2	NP_997328.1	Q8N8G6	CO054_HUMAN	chromosome 15 open reading frame 54	20					NS(1)|haematopoietic_and_lymphoid_tissue(2)|lung(2)	5		all_cancers(109;5.39e-14)|all_epithelial(112;3.14e-12)|Lung NSC(122;9.74e-10)|all_lung(180;2.23e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;1.19e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0706)	GGGCTGAGCCGCAAAGAATTT	0.468	1	200.0	201.0	200.0	15	39544396	2200	4297	6497	SO:0001819	synonymous_variant		CCDS10049.1	15q14	2014-09-10			ENSG00000175746	ENSG00000175746		33797	protein-coding gene	gene with protein product						Standard	NM_207445	Approved	FLJ39531	uc001zkg.2	Q8N8G6	OTTHUMG00000129843	ENST00000318578.3:c.60G>A	15.37:g.39544396G>A		B7ZVZ9	ENST00000318578.3	37	CCDS10049.1																																																																																			C15orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252083.1		-51.958635	0	-12	224	0	0	1	0	NM_207445	4	6.998610	221	0.017778
RAI1	10743	broad.mit.edu	hg19	17	17697038	17697038	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr17:17697038C>A	ENST00000353383.1	+	3	1245	c.776C>A	c.(775-777)cCg>cAg	p.P259Q	RAI1_ENST00000261641.6_Missense_Mutation_p.P259Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	259	Gln-rich.		cytoplasm|nucleus	zinc ion binding	breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)	AGCCTGGCCCCGGGGCAGCGG	0.667	0	24.0	31.0	29.0	17	17697038	2155	4218	6373	SO:0001583	missense	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557		9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR	10036180	Standard	NM_030665	Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.776C>A	17.37:g.17697038C>A	ENSP00000323074:p.Pro259Gln	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502878	0.26949	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.64991	-0.13;2.59;0.48	4.77	4.77	0.60923	.	0.092628	0.46758	D	0.000265	T	0.73202	0.3557	L	0.45581	1.43	0.33911	D	0.639696	D	0.89917	1.0	D	0.70227	0.968	T	0.78986	-0.1987	10	0.39692	T	0.17	.	17.7786	0.88517	0.0:1.0:0.0:0.0	.	259	Q7Z5J4	RAI1_HUMAN	Q	259;259;259;259;259;236	ENSP00000323074:P259Q;ENSP00000379120:P259Q;ENSP00000261641:P259Q	ENSP00000261641:P259Q	P	+	2	0	RAI1	17637763	0.005000	0.15991	0.900000	0.35374	0.430000	0.31655	2.123000	0.41996	2.203000	0.70933	0.491000	0.48974	CCG	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1		-3.699134	1	-18	63	0	6.4e-05	1	6.4e-05	NM_030665	3	6.406960	47	0.060000
ZNF460	10794	broad.mit.edu	hg19	19	57803250	57803250	+	Silent	SNP	G	G	A	rs141075189		TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr19:57803250G>A	ENST00000360338.3	+	3	1663	c.1341G>A	c.(1339-1341)ccG>ccA	p.P447P	ZNF460_ENST00000537645.1_Silent_p.P406P	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	447		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	GAGAGAAGCCGTATGTATGCA	0.493	0	117.0	103.0	108.0	19	57803250	2203	4300	6503	SO:0001819	synonymous_variant	X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714	"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272	15004467	Standard	NM_006635	Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.1341G>A	19.37:g.57803250G>A		A4FU64|B4DNX9|Q2VPC7|Q6VSF8	ENST00000360338.3	37	CCDS12949.1																																																																																			ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465727.1		-5.822854	0	-22	63	0	0	1	0	NM_006635	3	6.506952	55	0.051724
OR2B3	442184	broad.mit.edu	hg19	6	29054153	29054153	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr6:29054153G>T	ENST00000377173.2	-	1	937	c.873C>A	c.(871-873)agC>agA	p.S291R		NM_001005226.2	NP_001005226.1			olfactory receptor, family 2, subfamily B, member 3						breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24					TATTTCTAAGGCTGTAGATGA	0.403	0	77.0	75.0	76.0	6	29054153	2203	4300	6503	SO:0001583	missense		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703	"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P		Standard	NM_001005226	Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.873C>A	6.37:g.29054153G>T	ENSP00000366378:p.Ser291Arg	B0UYQ1|Q5ST41|Q96R13	ENST00000377173.2	37	CCDS34358.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133853	0.37630	.	.	ENSG00000204703	ENST00000377173	T	0.39229	1.09	3.89	-1.29	0.09288	.	0.159316	0.28499	U	0.015139	T	0.26810	0.0656	M	0.84156	2.68	0.23581	N	0.997367	P	0.36683	0.565	B	0.38562	0.276	T	0.33111	-0.9881	10	0.87932	D	0	.	9.2439	0.37513	0.5349:0.0:0.4651:0.0	.	291	O76000	OR2B3_HUMAN	R	291	ENSP00000366378:S291R	ENSP00000366378:S291R	S	-	3	2	OR2B3	29162132	0.000000	0.05858	0.933000	0.37362	0.996000	0.88848	-0.137000	0.10389	-0.458000	0.07023	0.573000	0.79308	AGC	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076469.2		23.892834	1	5	47	0	4.3838e-07	1	4.58306e-07		11	28.908026	46	0.192982
SRSF7	6432	broad.mit.edu	hg19	2	38975258	38975259	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr2:38975258_38975259delAG	ENST00000313117.6	-	5	739_740	c.502_503delCT	c.(502-504)cttfs	p.L168fs	SRSF7_ENST00000446327.2_Frame_Shift_Del_p.L168fs|SRSF7_ENST00000409276.1_Frame_Shift_Del_p.L168fs	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	168	6 X 8 AA repeats of R-R-S-R-S-X-S-X.|Arg/Ser-rich (RS domain).	mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding|zinc ion binding	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12					TGATCTACGAAGAGAGATAGAT	0.371	0									SO:0001589	frameshift_variant	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875	"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7	8013463, 20516191	Standard	NM_001031684	Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.502_503delCT	2.37:g.38975262_38975263delAG	ENSP00000325905:p.Leu168fs	B4DLU6|G5E9M3|Q564D3	ENST00000313117.6	37	CCDS33183.1																																																																																			SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	.	.		-25	36					NM_001031684	9		71	0.11
TET3	200424	broad.mit.edu	hg19	2	74275098	74275099	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chr2:74275098_74275099delCC	ENST00000409262.3	+	1	1649_1650	c.1649_1650delCC	c.(1648-1650)tccfs	p.S550fs		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	550				metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					GAAATGAGGTCCCCCAGCCCCA	0.614	0									SO:0001589	frameshift_variant		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605		28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""		9455477	Standard	XM_005264187	Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1649_1650delCC	2.37:g.74275100_74275101delCC	ENSP00000386869:p.Ser550fs	A6NEI3|Q86Z24|Q8TBM9	ENST00000409262.3	37	CCDS46339.1																																																																																			TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4	.	.		-28	20						30		30	0.50
EIF1AX	1964	broad.mit.edu	hg19	X	20156735	20156737	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-VD-A8KO-01A-11D-A39W-08	TCGA-VD-A8KO-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dfd27799-23c5-4da5-b141-68f854b4cc3e	6957c5b7-6b17-458b-858d-bfe4bb3bf874	g.chrX:20156735_20156737delCTT	ENST00000379607.5	-	2	223_225	c.20_22delAAG	c.(19-24)aaagga>aga	p.7_8KG>R	EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	7			cytosol	translation initiation factor activity	endometrium(2)|lung(1)|ovary(1)|prostate(1)	5					TTTTTACCTCCTTTACCTGATGG	0.305	0									SO:0001651	inframe_deletion	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674		3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A	8106356, 9381176	Standard	NM_001412	Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.20_22delAAG	X.37:g.20156735_20156737delCTT	ENSP00000368927:p.Lys7_Gly8delinsArg	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	ENST00000379607.5	37	CCDS14196.1																																																																																			EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1	.	.		-89	71						35		2	0.95
