Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
SEC14L1	6397	broad.mit.edu	hg19	17	75208190	75208190	+	Silent	SNP	C	C	T			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr17:75208190C>T	ENST00000413679.2	+	15	2073	c.1770C>T	c.(1768-1770)aaC>aaT	p.N590N	SEC14L1_ENST00000431431.2_Silent_p.N556N|SEC14L1_ENST00000436233.4_Silent_p.N590N|SEC14L1_ENST00000443798.4_Silent_p.N590N|SEC14L1_ENST00000591437.1_Silent_p.N556N|SEC14L1_ENST00000430767.4_Silent_p.N590N|SEC14L1_ENST00000392476.2_Silent_p.N590N|SEC14L1_ENST00000585618.1_Silent_p.N590N	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	590	GOLD.	transport	Golgi apparatus|integral to membrane	binding	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31					CGGGTGGGAACAATGTGCAGC	0.532	0	134.0	147.0	143.0	17	75208190	2203	4300	6503	SO:0001819	synonymous_variant	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657		10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L	8697811	Standard	NM_001143998	Approved	PRELID4A	uc002jto.3	Q92503		ENST00000392476.2:c.1770C>T	17.37:g.75208190C>T		A8K4E8|B4DDI5|D5G3K1|Q99780	ENST00000392476.2	37	CCDS42385.1																																																																																			SEC14L1-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436239.1		197.427364	0	-28	188	0	0	1	0	NM_003003	72	202.251554	140	0.339623
LRRIQ3	127255	broad.mit.edu	hg19	1	74507165	74507165	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr1:74507165G>A	ENST00000354431.4	-	7	1641	c.1450C>T	c.(1450-1452)Cga>Tga	p.R484*	LRRIQ3_ENST00000395089.1_Nonsense_Mutation_p.R484*	NM_001105659.1	NP_001099129.1	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	484					NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73					CAAACTTGTCGTAAACTGTTC	0.318	1	126.0	120.0	122.0	1	74507165	1813	4078	5891	SO:0001587	stop_gained	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620		28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44	12477932	Standard	NM_001105659	Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1450C>T	1.37:g.74507165G>A	ENSP00000378524:p.Arg484*	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	ENST00000395089.1	37	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118333	0.77323	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	.	.	.	5.77	2.54	0.30619	.	1.024280	0.07816	N	0.958944	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	3.6426	0.08173	0.0904:0.212:0.5437:0.154	.	.	.	.	X	484	.	ENSP00000346414:R484X	R	-	1	2	LRRIQ3	74279753	0.093000	0.21703	0.020000	0.16555	0.014000	0.08584	1.136000	0.31467	0.871000	0.35750	0.585000	0.79938	CGA	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1		98.055179	0	-38	92	0	0	1	0	NM_145258	33	99.074503	53	0.383721
TTLL2	83887	broad.mit.edu	hg19	6	167754272	167754272	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr6:167754272C>T	ENST00000239587.5	+	3	972	c.884C>T	c.(883-885)gCc>gTc	p.A295V		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	295	TTL.	protein modification process		ATP binding|tubulin-tyrosine ligase activity	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)	AACAATTATGCCCATTTGACC	0.408	0	144.0	150.0	148.0	6	167754272	2203	4300	6503	SO:0001583	missense	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440	"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104	11054573	Standard	XM_006715572	Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.884C>T	6.37:g.167754272C>T	ENSP00000239587:p.Ala295Val	B2RB11|B3KS77|Q7Z6R8|Q86X22	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.251264	0.39797	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.04603	3.59	3.73	3.73	0.42828	.	0.294132	0.26700	N	0.022959	T	0.02304	0.0071	N	0.11756	0.17	0.09310	N	1	D	0.54601	0.967	P	0.55785	0.784	T	0.51725	-0.8669	10	0.13470	T	0.59	.	14.615	0.68541	0.0:1.0:0.0:0.0	.	295	Q9BWV7	TTLL2_HUMAN	V	295;222	ENSP00000239587:A295V	ENSP00000239587:A295V	A	+	2	0	TTLL2	167674262	0.988000	0.35896	0.003000	0.11579	0.003000	0.03518	3.921000	0.56454	2.073000	0.62155	0.484000	0.47621	GCC	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3		-25.220603	0	-3	181	0	0	1	0	NM_031949	4	6.736323	128	0.030303
NLRC5	84166	broad.mit.edu	hg19	16	57059885	57059885	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr16:57059885G>A	ENST00000436936.1	+	6	1255	c.1030G>A	c.(1030-1032)Gct>Act	p.A344T	NLRC5_ENST00000539144.1_Missense_Mutation_p.A344T|NLRC5_ENST00000262510.6_Missense_Mutation_p.A344T|NLRC5_ENST00000308149.7_Missense_Mutation_p.A344T			Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	344	NACHT.	defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)			CCGGGTGATGGCTACCTCCCG	0.622	0	43.0	46.0	45.0	16	57059885	2198	4300	6498	SO:0001583	missense	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853	"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537			12615073	Standard	NM_032206	Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1030G>A	16.37:g.57059885G>A	ENSP00000262510:p.Ala344Thr	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	ENST00000262510.6	37	CCDS10773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.751|9.751	1.167452|1.167452	0.21621|0.21621	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144|ENST00000538805	T;T;T;T|.	0.79141|.	-1.24;-1.24;-1.24;-1.24|.	5.48|5.48	2.66|2.66	0.31614|0.31614	NACHT nucleoside triphosphatase (1);|.	0.238547|.	0.21764|.	N|.	0.069480|.	T|T	0.19886|0.19886	0.0478|0.0478	N|N	0.08118|0.08118	0|0	0.23341|0.23341	N|N	0.99787|0.99787	B;B;B;B|.	0.25441|.	0.126;0.126;0.056;0.026|.	B;B;B;B|.	0.25140|.	0.039;0.058;0.021;0.036|.	T|T	0.22347|0.22347	-1.0219|-1.0219	10|5	0.25106|.	T|.	0.35|.	.|.	10.6177|10.6177	0.45460|0.45460	0.2271:0.0:0.7729:0.0|0.2271:0.0:0.7729:0.0	.|.	344;344;344;344|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	T|D	344|96	ENSP00000262510:A344T;ENSP00000308886:A344T;ENSP00000389739:A344T;ENSP00000441727:A344T|.	ENSP00000262510:A344T|.	A|G	+|+	1|2	0|0	NLRC5|NLRC5	55617386|55617386	1.000000|1.000000	0.71417|0.71417	0.940000|0.940000	0.37924|0.37924	0.633000|0.633000	0.38033|0.38033	1.362000|1.362000	0.34148|0.34148	0.977000|0.977000	0.38444|0.38444	0.561000|0.561000	0.74099|0.74099	GCT|GGC	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1		0.397264	0	-21	49	0	0	1	0	NM_032206	3	6.487750	32	0.085714
SPTA1	6708	broad.mit.edu	hg19	1	158605758	158605758	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr1:158605758G>A	ENST00000368147.4	-	38	5557	c.5377C>T	c.(5377-5379)Cgg>Tgg	p.R1793W		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1 (elliptocytosis 2)			actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)				TGAGCCAGCCGCAACTGGATC	0.522	0	116.0	123.0	121.0	1	158605758	1980	4160	6140	SO:0001583	missense	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554	"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""			Standard	NM_003126	Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5377C>T	1.37:g.158605758G>A	ENSP00000357129:p.Arg1793Trp	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033837	0.54896	0.0	1.2E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.56444	0.46;0.46	5.65	3.62	0.41486	.	0.000000	0.29266	N	0.012655	T	0.70736	0.3258	M	0.89840	3.065	0.50467	D	0.999872	D	0.89917	1.0	D	0.97110	1.0	T	0.78663	-0.2116	10	0.87932	D	0	.	13.3664	0.60687	0.0:0.0:0.6481:0.3519	.	1793	P02549	SPTA1_HUMAN	W	1793	ENSP00000357130:R1793W;ENSP00000357129:R1793W	ENSP00000357129:R1793W	R	-	1	2	SPTA1	156872382	1.000000	0.71417	0.987000	0.45799	0.205000	0.24178	2.658000	0.46733	1.575000	0.49775	0.655000	0.94253	CGG	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		149.055869	0	-26	106	0	0	1	0	NM_003126	50	150.837665	83	0.375940
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		64.732888	0	13	93	0	0	1	0	NM_002067	22	65.996146	41	0.349206
PREX2	80243	broad.mit.edu	hg19	8	68992730	68992730	+	Silent	SNP	G	G	T			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr8:68992730G>T	ENST00000288368.4	+	16	1972	c.1695G>T	c.(1693-1695)tcG>tcT	p.S565S	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	565	DEP 2.	G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178					GTTTTTTTTCGGATGAGGAAA	0.323	0	83.0	84.0	83.0	8	68992730	2203	4300	6503	SO:0001819	synonymous_variant	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889	"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2	15304342, 15304343	Standard	NM_024870	Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1695G>T	8.37:g.68992730G>T		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	ENST00000288368.4	37	CCDS6201.1																																																																																			PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1		136.010188	1	-13	46	0	2.77807e-22	1	2.89886e-22	NM_025170	43	136.689328	61	0.413462
STK36	27148	broad.mit.edu	hg19	2	219561571	219561571	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr2:219561571G>A	ENST00000392106.2	+	22	2780	c.2514G>A	c.(2512-2514)atG>atA	p.M838I	STK36_ENST00000440309.1_Intron|STK36_ENST00000295709.3_Intron|STK36_ENST00000392105.3_Intron			Q9NRP7	STK36_HUMAN	serine/threonine kinase 36	838		cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	ACATACACATGAGTTGTGAGG	0.458	0	104.0	101.0	102.0	2	219561571	876	1991	2867	SO:0001583	missense	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482		17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""		10806483	Standard	NM_001243313	Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000392106.2:c.2514G>A	2.37:g.219561571G>A	ENSP00000375955:p.Met838Ile		ENST00000392106.2	37		.	.	.	.	.	.	.	.	.	.	G	8.891	0.954096	0.18431	.	.	ENSG00000163482	ENST00000392106	T	0.69806	-0.43	3.67	-0.219	0.13135	.	.	.	.	.	T	0.50701	0.1631	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39057	-0.9632	6	0.25106	T	0.35	.	6.0627	0.19846	0.5113:0.0:0.4887:0.0	.	.	.	.	I	838	ENSP00000375955:M838I	ENSP00000375955:M838I	M	+	3	0	STK36	219269815	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.172000	0.16704	-0.203000	0.10251	-0.140000	0.14226	ATG	STK36-201	KNOWN	basic	protein_coding	protein_coding			106.683336	0	17	69	0	0	1	0		36	106.901962	45	0.444444
MORC3	23515	broad.mit.edu	hg19	21	37732303	37732303	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr21:37732303G>A	ENST00000400485.1	+	11	1335	c.1259G>A	c.(1258-1260)cGg>cAg	p.R420Q	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	420		cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35					CTAAAGTGGCGGAAATTACCT	0.418	1	194.0	186.0	189.0	21	37732303	2047	4223	6270	SO:0001583	missense	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256		23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3	14607086	Standard	NM_015358	Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1259G>A	21.37:g.37732303G>A	ENSP00000383333:p.Arg420Gln	A8KA92|Q9UEZ2	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	36	5.769731	0.96914	.	.	ENSG00000159256	ENST00000400485	T	0.62364	0.03	5.68	5.68	0.88126	Zinc finger, CW-type (2);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	H	0.97077	3.935	0.58432	D	0.999999	D	0.89917	1.0	D	0.75020	0.985	D	0.90690	0.4612	10	0.72032	D	0.01	-11.5603	19.805	0.96527	0.0:0.0:1.0:0.0	.	420	Q14149	MORC3_HUMAN	Q	420	ENSP00000383333:R420Q	ENSP00000383333:R420Q	R	+	2	0	MORC3	36654173	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.581000	0.98210	2.672000	0.90937	0.557000	0.71058	CGG	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1		192.060687	0	-41	113	0	0	1	0	NM_015358	61	192.563836	79	0.435714
EPG5	57724	broad.mit.edu	hg19	18	43534962	43534962	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr18:43534962T>C	ENST00000282041.5	-	2	440	c.406A>G	c.(406-408)Aag>Gag	p.K136E		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	136		autophagy			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95					GTGAAGTTCTTGGGGGTTTCT	0.483	0	104.0	98.0	100.0	18	43534962	1870	4101	5971	SO:0001583	missense	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223		29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632	10997877, 20550938	Standard	XM_005258323	Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.406A>G	18.37:g.43534962T>C	ENSP00000282041:p.Lys136Glu	A2BDF3|Q9H8C8	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708947	0.30322	.	.	ENSG00000152223	ENST00000282041	T	0.10763	2.84	5.76	-1.09	0.09904	.	1.162600	0.05964	N	0.641171	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.43327	-0.9398	10	0.21540	T	0.41	-1.3497	6.6903	0.23167	0.0:0.249:0.404:0.347	.	136;136	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	E	136	ENSP00000282041:K136E	ENSP00000282041:K136E	K	-	1	0	EPG5	41788960	0.177000	0.23109	0.040000	0.18447	0.026000	0.11368	0.697000	0.25556	-0.129000	0.11620	-0.371000	0.07208	AAG	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1		133.499155	0	-1	74	0	0	1	0	NM_020964	43	133.540280	39	0.524390
BPIFB6	128859	broad.mit.edu	hg19	20	31622051	31622051	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr20:31622051G>A	ENST00000349552.1	+	3	257	c.257G>A	c.(256-258)gGc>gAc	p.G86D		NM_174897.2	NP_777557.1	Q8NFQ5	BPIL3_HUMAN	BPI fold containing family B, member 6	86			extracellular region	lipid binding							CCTGGAGTGGGCATCTTCCAA	0.572	0	183.0	142.0	156.0	20	31622051	2203	4300	6503	SO:0001583	missense	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104	"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3	12185532, 21787333	Standard	NM_174897	Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.257G>A	20.37:g.31622051G>A	ENSP00000344929:p.Gly86Asp		ENST00000349552.1	37	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092834	0.76756	.	.	ENSG00000167104	ENST00000349552	T	0.08720	3.06	4.7	4.7	0.59300	.	0.000000	0.56097	D	0.000026	T	0.27967	0.0689	M	0.74881	2.28	0.44149	D	0.996943	D	0.89917	1.0	D	0.91635	0.999	T	0.01409	-1.1362	10	0.66056	D	0.02	.	13.1161	0.59301	0.0:0.0:1.0:0.0	.	86	Q8NFQ5	BPIB6_HUMAN	D	86	ENSP00000344929:G86D	ENSP00000344929:G86D	G	+	2	0	BPIFB6	31085712	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.939000	0.63526	2.146000	0.66826	0.561000	0.74099	GGC	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2		-36.689990	0	-11	144	0	0	1	0	NM_174897	4	7.060068	169	0.023121
BAP1	8314	broad.mit.edu	hg19	3	52442512	52442512	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr3:52442512T>C	ENST00000460680.1	-	4	704	c.233A>G	c.(232-234)aAt>aGt	p.N78S	BAP1_ENST00000296288.5_Missense_Mutation_p.N78S	NM_004656.2	NP_004647.1	Q92560	BAP1_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	78		monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	GAACATGTTATTCACAATATC	0.488	4	63.0	53.0	56.0	3	52442512	2202	4299	6501	SO:0001583	missense	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.233A>G	3.37:g.52442512T>C	ENSP00000417132:p.Asn78Ser	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.931031	0.73327	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.40756	1.02;1.02	5.52	5.52	0.82312	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.090448	0.85682	D	0.000000	T	0.41926	0.1180	N	0.25031	0.7	0.80722	D	1	P	0.41978	0.767	P	0.49361	0.608	T	0.30909	-0.9962	10	0.42905	T	0.14	-2.8537	15.6492	0.77078	0.0:0.0:0.0:1.0	.	78	Q92560	BAP1_HUMAN	S	78	ENSP00000417132:N78S;ENSP00000296288:N78S	ENSP00000296288:N78S	N	-	2	0	BAP1	52417552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	2.106000	0.64143	0.533000	0.62120	AAT	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		14.002059	0	-3	13	0	0	1	0		4	14.149697	2	0.666667
MYH6	4624	broad.mit.edu	hg19	14	23862938	23862955	+	In_Frame_Del	DEL	GTCCTTCTTGAGCTCTGA	GTCCTTCTTGAGCTCTGA	-			TCGA-VD-AA8N-01A-11D-A39W-08	TCGA-VD-AA8N-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9be75428-d098-4c1d-8a4c-884bfdbe9cc5	187c0920-5daf-4040-816e-45a8bb0846da	g.chr14:23862938_23862955delGTCCTTCTTGAGCTCTGA	ENST00000405093.3	-	22	2918_2935	c.2848_2865delTCAGAGCTCAAGAAGGAC	c.(2848-2865)tcagagctcaagaaggacdel	p.SELKKD950del	MYH6_ENST00000356287.3_In_Frame_Del_p.SELKKD950del	NM_002471.3	NP_002462.2	P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	950		adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	GGTCATCAATGTCCTTCTTGAGCTCTGAGCACTCGTCT	0.560	0									SO:0001651	inframe_deletion	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616	"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""		2144212	Standard	NM_002471	Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2848_2865delTCAGAGCTCAAGAAGGAC	14.37:g.23862938_23862955delGTCCTTCTTGAGCTCTGA	ENSP00000348634:p.Ser950_Asp955del	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	ENST00000356287.3	37	CCDS9600.1																																																																																			MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3	.	.		-38	77						12		81	0.13
