Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
BRCA1	672	broad.mit.edu	hg19	17	41244681	41244681	+	Missense_Mutation	SNP	G	G	C	rs80357961		TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr17:41244681G>C	ENST00000309486.4	-	9	3006	c.1979C>G	c.(1978-1980)tCt>tGt	p.S660C	BRCA1_ENST00000354071.3_Missense_Mutation_p.S956C|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000357654.3_Missense_Mutation_p.S956C|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.S956C|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.S909C|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.S956C|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591849.1_Intron	NM_007297.3	NP_009228.2	P38398	BRCA1_HUMAN	breast cancer 1, early onset	956		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)	TCTGAACTGAGATGATAGACA	0.393	0	120.0	119.0	120.0	17	41244681	2203	4300	6503	SO:0001583	missense	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048	"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705			1676470	Standard	NM_007300	Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2867C>G	17.37:g.41244681G>C	ENSP00000350283:p.Ser956Cys	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	ENST00000357654.3	37	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	G	8.488	0.861394	0.17178	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.04	1.78	0.24846	.	0.847511	0.10115	N	0.714129	D	0.88209	0.6375	M	0.90922	3.16	0.09310	N	1	D;D;D;D;D;P	0.76494	0.999;0.999;0.999;0.974;0.996;0.819	D;D;D;P;P;P	0.75484	0.921;0.921;0.986;0.854;0.908;0.464	T	0.73392	-0.3997	10	0.87932	D	0	.	4.9292	0.13909	0.1682:0.0:0.5368:0.295	.	956;915;956;956;956;956	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	C	956;956;956;956;660;956;909	ENSP00000350283:S956C;ENSP00000326002:S956C;ENSP00000246907:S956C;ENSP00000310938:S660C;ENSP00000418960:S956C;ENSP00000418775:S909C	ENSP00000310938:S660C	S	-	2	0	BRCA1	38498207	0.003000	0.15002	0.176000	0.23000	0.009000	0.06853	-0.005000	0.12855	0.699000	0.31761	-0.188000	0.12872	TCT	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2		-28.436974	0	-11	173	0	0	1	0	NM_007294	4	7.843319	143	0.027211
ALG1	56052	broad.mit.edu	hg19	16	5121851	5121851	+	Translation_Start_Site	SNP	A	A	G			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr16:5121851A>G	ENST00000262374.5	+	1	32	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	ALG1_ENST00000588623.1_Intron	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	1		dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity	breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)			GCCAGCCAAGATGGCGGCCTC	0.721	0	13.0	14.0	14.0	16	5121851	2188	4285	6473	SO:0001582	initiator_codon_variant	AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""		10704531	Standard	NM_019109	Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.1A>G	16.37:g.5121851A>G	ENSP00000262374:p.Met1Val	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	ENST00000262374.5	37	CCDS10528.1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.797087	0.31777	.	.	ENSG00000033011	ENST00000262374	T	0.75367	-0.93	4.81	4.81	0.61882	.	0.309916	0.36591	N	0.002506	T	0.66446	0.2790	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.11329	0.006	T	0.65961	-0.6041	9	0.87932	D	0	-29.8406	10.8028	0.46497	1.0:0.0:0.0:0.0	.	1	Q9BT22	ALG1_HUMAN	V	1	ENSP00000262374:M1V	ENSP00000262374:M1V	M	+	1	0	ALG1	5061852	.	.	1.000000	0.80357	0.109000	0.19521	.	.	1.816000	0.52996	0.454000	0.30748	ATG	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2		23.394786	0	-13	9	0	0	1	0	NM_019109	8	23.443504	10	0.444444
DNAH17	8632	broad.mit.edu	hg19	17	76563118	76563118	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr17:76563118G>A	ENST00000389840.5	-	10	1539	c.1415C>T	c.(1414-1416)gCc>gTc	p.A472V	DNAH17_ENST00000585328.1_Missense_Mutation_p.A472V					dynein, axonemal, heavy chain 17						NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		TTTGCAGTCGGCAAAAACCTT	0.567	0	68.0	57.0	61.0	17	76563118	2203	4300	6503	SO:0001583	missense	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775	"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1	9545504	Standard	NM_173628	Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.1415C>T	17.37:g.76563118G>A	ENSP00000465516:p.Ala472Val	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	8.418	0.845762	0.16963	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.56275	0.47	4.92	2.93	0.34026	.	0.643900	0.13370	N	0.393012	T	0.46092	0.1375	L	0.54323	1.7	0.24140	N	0.995735	B	0.13145	0.007	B	0.16722	0.016	T	0.34428	-0.9829	10	0.30078	T	0.28	.	9.5094	0.39067	0.168:0.0:0.832:0.0	.	174	Q9UFH2-4	.	V	472	ENSP00000374490:A472V	ENSP00000300671:A472V	A	-	2	0	DNAH17	74074713	0.865000	0.29922	0.042000	0.18584	0.248000	0.25809	3.514000	0.53422	0.609000	0.30018	0.561000	0.74099	GCC	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2		6.482257	0	4	23	0	0	1	0	NM_173628	4	9.238291	21	0.160000
SYBU	55638	broad.mit.edu	hg19	8	110590198	110590198	+	Silent	SNP	G	G	T			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr8:110590198G>T	ENST00000399066.3	-	5	1501	c.774C>A	c.(772-774)ccC>ccA	p.P258P	SYBU_ENST00000408889.3_Silent_p.P142P|SYBU_ENST00000422135.1_Silent_p.P261P|SYBU_ENST00000529690.1_Silent_p.P131P|SYBU_ENST00000446070.2_Silent_p.P260P|SYBU_ENST00000533171.1_Silent_p.P261P|SYBU_ENST00000408908.2_Silent_p.P261P|SYBU_ENST00000433638.1_Silent_p.P261P|SYBU_ENST00000528331.1_Silent_p.P142P|SYBU_ENST00000533065.1_Silent_p.P142P|SYBU_ENST00000529175.1_Silent_p.P55P|SYBU_ENST00000276646.9_Silent_p.P261P|SYBU_ENST00000424158.2_Silent_p.P266P|SYBU_ENST00000533895.1_Silent_p.P260P|SYBU_ENST00000440310.1_Silent_p.P261P|SYBU_ENST00000532779.1_Silent_p.P193P|SYBU_ENST00000528647.1_Silent_p.P260P|SYBU_ENST00000419099.1_Silent_p.P260P|SYBU_ENST00000527707.1_5'UTR	NM_001099756.1	NP_001093226.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	261	Sufficient for interaction with KIF5B.		cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane		NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30					CTGGGTTTGGGGGTCTGACAC	0.453	0	201.0	194.0	196.0	8	110590198	1986	4174	6160	SO:0001819	synonymous_variant	AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642		26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568			17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743	Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000533895.1:c.780C>A	8.37:g.110590198G>T		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	ENST00000533895.1	37	CCDS43763.1																																																																																			SYBU-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385489.1		311.629677	1	-58	117	0	3.78979e-47	1	4.09297e-47	NM_017786	96	313.810838	57	0.627451
SLC13A5	284111	broad.mit.edu	hg19	17	6594096	6594096	+	Splice_Site	SNP	A	A	T			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr17:6594096A>T	ENST00000433363.2	-	10	1671		c.e10+1		SLC13A5_ENST00000293800.6_Splice_Site|SLC13A5_ENST00000573648.1_Splice_Site|SLC13A5_ENST00000381074.4_Splice_Site	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5				integral to membrane	citrate transmembrane transporter activity	breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26					CAGGTTACTTACCATGGAGGC	0.552	0	211.0	187.0	195.0	17	6594096	2203	4300	6503	SO:0001630	splice_region_variant	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485	"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305			12445824	Standard	NM_001284510	Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1437+1T>A	17.37:g.6594096A>T		B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	ENST00000433363.2	37	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942801	0.73672	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.606	0.56523	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC13A5	6534820	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.396000	0.90190	1.920000	0.55613	0.533000	0.62120	.	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2		117.307649	0	-22	99	0	0	1	0	NM_177550	39	117.971739	56	0.410526
TMEM35	59353	broad.mit.edu	hg19	X	100349757	100349757	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chrX:100349757C>T	ENST00000372930.4	+	2	599	c.316C>T	c.(316-318)Cag>Tag	p.Q106*	TMEM35_ENST00000478351.1_3'UTR	NM_021637.2	NP_067650.1	Q53FP2	TMM35_HUMAN	transmembrane protein 35	106			cytoplasmic membrane-bounded vesicle|integral to membrane|peroxisomal membrane		NS(1)|large_intestine(3)|liver(1)|skin(1)|urinary_tract(1)	7					CTTCTTCCACCAGCTGGTCGG	0.577	0	250.0	183.0	206.0	X	100349757	2203	4300	6503	SO:0001587	stop_gained	AK024146	CCDS14478.1	Xq22	2008-02-05			ENSG00000126950	ENSG00000126950		25864	protein-coding gene	gene with protein product						Standard	NM_021637	Approved	FLJ14084	uc004egw.3	Q53FP2	OTTHUMG00000022016	ENST00000372930.4:c.316C>T	X.37:g.100349757C>T	ENSP00000362021:p.Gln106*	Q9H7Y3	ENST00000372930.4	37	CCDS14478.1	.	.	.	.	.	.	.	.	.	.	C	37	6.294758	0.97449	.	.	ENSG00000126950	ENST00000372930;ENST00000444892	.	.	.	5.51	5.51	0.81932	.	0.052538	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-34.3831	18.3931	0.90490	0.0:1.0:0.0:0.0	.	.	.	.	X	106;65	.	ENSP00000362021:Q106X	Q	+	1	0	TMEM35	100236413	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.267000	0.78462	2.284000	0.76573	0.594000	0.82650	CAG	TMEM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057508.1		141.613520	0	-22	84	0	0	1	0	NM_021637	47	141.668591	52	0.474747
FAM212A	389119	broad.mit.edu	hg19	3	49842221	49842221	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr3:49842221C>A	ENST00000333323.4	+	2	798	c.665C>A	c.(664-666)cCc>cAc	p.P222H		NM_203370.1	NP_976248.1	Q96EL1	CC054_HUMAN	family with sequence similarity 212, member A	220											CGTGCTCGGCCCCCTCAGTTC	0.657	0	78.0	84.0	82.0	3	49842221	2203	4300	6503	SO:0001583	missense	BC012170	CCDS2804.1	3p21.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000185614	ENSG00000185614		32480	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 54"""	C3orf54		Standard	NM_203370	Approved		uc003cxq.1	Q96EL1	OTTHUMG00000158268	ENST00000333323.4:c.665C>A	3.37:g.49842221C>A	ENSP00000329735:p.Pro222His		ENST00000333323.4	37	CCDS2804.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836245	0.71373	.	.	ENSG00000185614	ENST00000333323	.	.	.	5.14	5.14	0.70334	.	0.000000	0.51477	D	0.000095	T	0.74253	0.3692	L	0.44542	1.39	0.51233	D	0.999919	D	0.89917	1.0	D	0.91635	0.999	T	0.76061	-0.3097	9	0.72032	D	0.01	.	18.4034	0.90525	0.0:1.0:0.0:0.0	.	220	Q96EL1	CC054_HUMAN	H	222	.	ENSP00000329735:P222H	P	+	2	0	C3orf54	49817225	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	4.950000	0.63603	2.686000	0.91538	0.561000	0.74099	CCC	FAM212A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350514.1		153.842289	1	-26	96	0	6.9144e-35	1	7.18033e-35	NM_203370	48	162.842988	4	0.923077
CTDSP1	58190	broad.mit.edu	hg19	2	219268127	219268127	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr2:219268127A>G	ENST00000273062.2	+	6	980	c.644A>G	c.(643-645)cAt>cGt	p.H215R	CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Missense_Mutation_p.H214R	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	215	FCP1 homology.	protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding	NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	TATGTCTTCCATCCAGACAAT	0.607	0	61.0	63.0	62.0	2	219268127	2203	4300	6503	SO:0001583	missense	AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323			11950066, 12721286	Standard	NM_021198	Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.644A>G	2.37:g.219268127A>G	ENSP00000273062:p.His215Arg	C9IYG0|Q7Z5Q3|Q7Z5Q4	ENST00000273062.2	37	CCDS2416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.22|19.22	3.786513|3.786513	0.70337|0.70337	.|.	.|.	ENSG00000144579|ENSG00000144579	ENST00000443891;ENST00000273062|ENST00000452977;ENST00000428361	T;T|.	0.17691|.	2.26;2.26|.	4.64|4.64	4.64|4.64	0.57946|0.57946	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88243|0.88243	0.6384|0.6384	H|H	0.98664|0.98664	4.295|4.295	0.80722|0.80722	D|D	1|1	P;P|.	0.46277|.	0.875;0.875|.	P;P|.	0.59288|.	0.855;0.855|.	D|D	0.92137|0.92137	0.5717|0.5717	10|5	0.72032|.	D|.	0.01|.	-21.5941|-21.5941	13.051|13.051	0.58954|0.58954	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	215;214|.	Q9GZU7;C9IYG0|.	CTDS1_HUMAN;.|.	R|V	214;215|208;216	ENSP00000392248:H214R;ENSP00000273062:H215R|.	ENSP00000273062:H215R|.	H|I	+|+	2|1	0|0	CTDSP1|CTDSP1	218976371|218976371	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.763000|0.763000	0.43281|0.43281	9.273000|9.273000	0.95719|0.95719	1.724000|1.724000	0.51502|0.51502	0.402000|0.402000	0.26972|0.26972	CAT|ATC	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1		42.755984	0	-10	36	0	0	1	0	NM_182642, NM_021198	14	43.327669	24	0.368421
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	GNA11_ENST00000586180.1_3'UTR|AC005262.3_ENST00000587701.1_RNA	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		97.891640	0	-14	67	0	0	1	0	NM_002067	32	98.185519	42	0.432432
FAM13B	0	broad.mit.edu	hg19	5	137288386	137288386	+	Missense_Mutation	SNP	C	C	A			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr5:137288386C>A	ENST00000033079.3	-	16	2246	c.1795G>T	c.(1795-1797)Gat>Tat	p.D599Y	FAM13B_ENST00000420893.2_Missense_Mutation_p.D599Y|FAM13B_ENST00000425075.2_Missense_Mutation_p.D503Y	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	599		regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	endometrium(4)|kidney(2)|lung(5)	11					GCAGCAATATCACTGTAGGAG	0.333	0	96.0	101.0	99.0	5	137288386	2203	4300	6503	SO:0001583	missense	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003	"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1	11087669, 11161817	Standard	NM_016603	Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1795G>T	5.37:g.137288386C>A	ENSP00000033079:p.Asp599Tyr	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716476	0.89205	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95756	-3.8;0.53;-3.8	6.05	6.05	0.98169	.	0.048468	0.85682	D	0.000000	D	0.97892	0.9307	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.98027	1.0374	10	0.87932	D	0	-16.9519	20.2037	0.98272	0.0:1.0:0.0:0.0	.	503;599;599	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	Y	599;503;599	ENSP00000033079:D599Y;ENSP00000394669:D503Y;ENSP00000388521:D599Y	ENSP00000033079:D599Y	D	-	1	0	FAM13B	137316285	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.784000	0.75084	2.866000	0.98385	0.650000	0.86243	GAT	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		148.323741	1	30	152	0	1.51926e-22	1	1.51926e-22		42	155.446364	3	0.933333
RAB33A	9363	broad.mit.edu	hg19	X	129318341	129318341	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chrX:129318341T>C	ENST00000257017.4	+	2	755	c.341T>C	c.(340-342)gTc>gCc	p.V114A		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	114		protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11					CATGCCGTGGTCTTCGTCTAT	0.502	0	162.0	122.0	135.0	X	129318341	2203	4300	6503	SO:0001583	missense	D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594	"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333			7688322, 9512502	Standard	NM_004794	Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.341T>C	X.37:g.129318341T>C	ENSP00000257017:p.Val114Ala	Q5JUZ6|Q92465	ENST00000257017.4	37	CCDS14621.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.298518	0.81025	.	.	ENSG00000134594	ENST00000257017	D	0.81996	-1.56	4.71	4.71	0.59529	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89753	0.6806	M	0.69523	2.12	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.90910	0.4775	10	0.87932	D	0	-19.3113	13.6381	0.62233	0.0:0.0:0.0:1.0	.	114	Q14088	RB33A_HUMAN	A	114	ENSP00000257017:V114A	ENSP00000257017:V114A	V	+	2	0	RAB33A	129146022	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.997000	0.88414	1.663000	0.50791	0.350000	0.21858	GTC	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1		73.718073	0	-9	48	0	0	1	0	NM_004794	23	74.038824	32	0.418182
ZNF446	55663	broad.mit.edu	hg19	19	58991009	58991009	+	Splice_Site	SNP	G	G	C			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr19:58991009G>C	ENST00000596341.1	+	5	2847		c.e5-1		ZNF446_ENST00000335841.4_Intron|ZNF446_ENST00000594369.1_Splice_Site			Q9NWS9	ZN446_HUMAN	zinc finger protein 446			viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)	CACATCCGCAGGAGGAGTGGG	0.582	1	93.0	78.0	83.0	19	58991009	2203	4300	6503	SO:0001630	splice_region_variant		CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838	"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product						Standard	NM_017908	Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.628-1G>C	19.37:g.58991009G>C			ENST00000594369.1	37	CCDS12982.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131978	0.56828	.	.	ENSG00000083838	ENST00000335841;ENST00000540481;ENST00000391694	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5628	0.56293	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF446	63682821	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	2.745000	0.47459	2.423000	0.82170	0.561000	0.74099	.	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467052.1		24.026209	0	-9	11	0	0	1	0	NM_017908	7	24.042947	6	0.538462
OSGIN1	29948	broad.mit.edu	hg19	16	83999242	83999242	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr16:83999242A>G	ENST00000343939.2	+	7	1696	c.1313A>G	c.(1312-1314)tAt>tGt	p.Y438C	OSGIN1_ENST00000361711.3_Missense_Mutation_p.Y355C|OSGIN1_ENST00000393306.1_Missense_Mutation_p.Y355C			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	438		cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity	autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12					CCCAGCCCCTATGAGGGTTAC	0.617	0	87.0	79.0	82.0	16	83999242	2200	4300	6500	SO:0001583	missense	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961		30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975			11459809, 14570898	Standard	NM_182981	Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000361711.3:c.1064A>G	16.37:g.83999242A>G	ENSP00000355374:p.Tyr355Cys	Q52M33|Q86UQ1|Q96S88|Q9BZ70	ENST00000361711.3	37	CCDS10939.1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.253680	0.59212	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.48201	0.82;0.82;0.82	4.8	3.65	0.41850	.	0.125086	0.56097	D	0.000023	T	0.59252	0.2180	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.64042	0.921	T	0.59182	-0.7502	10	0.42905	T	0.14	-24.9902	10.0644	0.42295	0.85:0.0:0.0:0.1499	.	438	Q9UJX0	OSGI1_HUMAN	C	438;355;355	ENSP00000343376:Y438C;ENSP00000355374:Y355C;ENSP00000376983:Y355C	ENSP00000343376:Y438C	Y	+	2	0	OSGIN1	82556743	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	5.901000	0.69861	1.794000	0.52575	0.383000	0.25322	TAT	OSGIN1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432616.1		60.160568	0	-22	33	0	0	1	0	NM_013370	18	60.221462	15	0.545455
TWF2	11344	broad.mit.edu	hg19	3	52263159	52263159	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr3:52263159G>C	ENST00000305533.5	-	9	1184	c.941C>G	c.(940-942)cCc>cGc	p.P314R	TWF2_ENST00000499914.2_3'UTR|TLR9_ENST00000494383.1_Intron|TLR9_ENST00000597542.1_Intron	NM_007284.3	NP_009215.1			twinfilin actin-binding protein 2						breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	GTGTTGCTTGGGGTGCACCTC	0.642	0	119.0	106.0	110.0	3	52263159	2203	4300	6503	SO:0001583	missense	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596		9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L	10406962, 12807912	Standard	NM_007284	Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.941C>G	3.37:g.52263159G>C	ENSP00000303908:p.Pro314Arg	Q9Y3F5	ENST00000305533.5	37	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442530	0.83993	.	.	ENSG00000247596	ENST00000305533	T	0.31769	1.48	5.04	4.16	0.48862	.	.	.	.	.	T	0.59838	0.2223	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67538	-0.5645	9	0.87932	D	0	.	13.3672	0.60692	0.0764:0.0:0.9236:0.0	.	314	Q6IBS0	TWF2_HUMAN	R	314	ENSP00000303908:P314R	ENSP00000303908:P314R	P	-	2	0	TWF2	52238199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.824000	0.99380	1.120000	0.41904	0.561000	0.74099	CCC	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		94.573558	0	-14	92	0	0	1	0		29	98.796310	2	0.935484
DCAF8L2	347442	broad.mit.edu	hg19	X	27766141	27766141	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chrX:27766141G>A	ENST00000451261.2	+	5	1528	c.1129G>A	c.(1129-1131)Gcc>Acc	p.A377T		NM_001136533.1	NP_001130005.1			DDB1 and CUL4 associated factor 8-like 2						central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24					TGTGAATCCCGCCAATACCTA	0.408	0	107.0	80.0	89.0	X	27766141	692	1591	2283	SO:0001583	missense		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186	"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C		Standard	NM_001136533	Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1129G>A	X.37:g.27766141G>A	ENSP00000462745:p.Ala377Thr	B2RXH9|J3KT06	ENST00000451261.2	37	CCDS59162.1																																																																																			DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4		-0.507307	0	4	62	0	0	1	0	XM_293354	3	7.172112	38	0.073171
C8orf31	286122	broad.mit.edu	hg19	8	144124604	144124604	+	Silent	SNP	G	G	A			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr8:144124604G>A	ENST00000395172.1	+	3	463	c.111G>A	c.(109-111)ggG>ggA	p.G37G	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	37					breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				GGGCCCAGGGGCTGCTGGCTG	0.642	0	36.0	39.0	38.0	8	144124604	2203	4300	6503	SO:0001819	synonymous_variant		CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335		26731	protein-coding gene	gene with protein product						Standard	NM_173687	Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.111G>A	8.37:g.144124604G>A		Q6GMU7	ENST00000395172.1	37	CCDS6395.1																																																																																			C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1		73.929014	0	-1	20	0	0	1	0	NM_173687	23	74.203306	16	0.589744
TMEM2	23670	broad.mit.edu	hg19	9	74324303	74324303	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr9:74324303T>C	ENST00000377044.4	-	17	3396	c.2857A>G	c.(2857-2859)Att>Gtt	p.I953V	TMEM2_ENST00000377066.5_Missense_Mutation_p.I890V	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	953			integral to membrane		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	GAGCCATCAATGTCATGGAAT	0.448	0	219.0	184.0	195.0	9	74324303	2203	4300	6503	SO:0001583	missense		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048		11869	protein-coding gene	gene with protein product		605835				Standard	NM_013390	Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.2857A>G	9.37:g.74324303T>C	ENSP00000366243:p.Ile953Val	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	0.803	-0.754578	0.03041	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000377043	T;T;T	0.42900	0.96;0.96;0.96	5.67	-5.47	0.02600	Pectin lyase fold/virulence factor (1);	0.901261	0.09718	N	0.764883	T	0.08758	0.0217	N	0.00224	-1.81	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44034	-0.9354	10	0.02654	T	1	.	13.5683	0.61832	0.0:0.6285:0.1083:0.2632	.	953;890	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	V	953;890;54	ENSP00000366243:I953V;ENSP00000366266:I890V;ENSP00000366242:I54V	ENSP00000366242:I54V	I	-	1	0	TMEM2	73514123	0.000000	0.05858	0.001000	0.08648	0.904000	0.53231	-1.121000	0.03270	-0.943000	0.03691	-0.479000	0.04858	ATT	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2		82.986282	0	-9	70	0	0	1	0	NM_013390	28	83.113316	34	0.451613
CDH4	1002	broad.mit.edu	hg19	20	60470052	60470065	+	Frame_Shift_Del	DEL	CATCACGGTGACAG	CATCACGGTGACAG	-	rs149375024	by1000genomes	TCGA-VD-AA8P-01A-11D-A39W-08	TCGA-VD-AA8P-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5e4ed9fe-6d1c-495a-8ae6-ade952d0fec2	9c561355-ff26-452d-9ed3-870d5a6fdb1e	g.chr20:60470052_60470065delCATCACGGTGACAG	ENST00000360469.5	+	8	1225_1238	c.1137_1150delCATCACGGTGACAG	c.(1135-1152)atcatcacggtgacagatfs	p.ITVTD380fs	CDH4_ENST00000543233.1_Frame_Shift_Del_p.ITVTD306fs	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	380	Cadherin 2.	adherens junction organization|cell junction assembly		calcium ion binding	NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)		CCACAGCCATCATCACGGTGACAGATGTGAATGA	0.547	0									SO:0001589	frameshift_variant	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242	"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006			10191097, 10516427	Standard	NM_001794	Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1137_1150delCATCACGGTGACAG	20.37:g.60470052_60470065delCATCACGGTGACAG	ENSP00000353656:p.Ile380fs	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	ENST00000360469.5	37	CCDS13488.1																																																																																			CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	.	.		-33	127					NM_001794	28		73	0.28
