Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
HOXB5	3215	broad.mit.edu	hg19	17	46670514	46670514	+	Missense_Mutation	SNP	G	G	T			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:46670514G>T	ENST00000239151.5	-	1	809	c.531C>A	c.(529-531)ttC>ttA	p.F177L	HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000467155.2_RNA	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	177			nucleus	sequence-specific DNA binding	large_intestine(1)|lung(2)	3					TCATCCAGGGGAATATTTGCG	0.597	0	42.0	46.0	45.0	17	46670514	2202	4299	6501	SO:0001583	missense		CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075	"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A	1973146, 1358459	Standard	NM_002147	Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.531C>A	17.37:g.46670514G>T	ENSP00000239151:p.Phe177Leu	B2RC69|P09069|Q17RP4	ENST00000239151.5	37	CCDS11530.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365987	0.61513	.	.	ENSG00000120075	ENST00000239151	D	0.92299	-3.01	5.31	2.24	0.28232	Homeobox protein, antennapedia type, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.90779	0.7105	M	0.72118	2.19	0.80722	D	1	P	0.46220	0.874	P	0.45343	0.477	D	0.88839	0.3311	10	0.87932	D	0	.	8.0276	0.30446	0.3178:0.0:0.6822:0.0	.	177	P09067	HXB5_HUMAN	L	177	ENSP00000239151:F177L	ENSP00000239151:F177L	F	-	3	2	HOXB5	44025513	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.272000	0.43373	0.615000	0.30124	0.455000	0.32223	TTC	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358148.2		13.722984	1	27	80	0	0.000442599	1	0.000442599		7	16.844763	29	0.194444
HOXB8	3218	broad.mit.edu	hg19	17	46691904	46691904	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:46691904G>C	ENST00000239144.4	-	1	397	c.163C>G	c.(163-165)Cag>Gag	p.Q55E	HOXB8_ENST00000576562.1_Missense_Mutation_p.Q55E|HOXB7_ENST00000567101.2_Intron	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	55			nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	large_intestine(1)|lung(8)|urinary_tract(2)	11					TAGAACTCCTGGATTTGCGAC	0.662	0	21.0	23.0	22.0	17	46691904	2200	4297	6497	SO:0001583	missense		CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068	"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D	1973146, 1358459	Standard	XM_005257286	Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.163C>G	17.37:g.46691904G>C	ENSP00000239144:p.Gln55Glu	Q9H1I2	ENST00000239144.4	37	CCDS11533.1	.	.	.	.	.	.	.	.	.	.	g	14.31	2.496902	0.44352	.	.	ENSG00000120068	ENST00000239144	T	0.39592	1.07	2.71	2.71	0.32032	.	0.000000	0.56097	U	0.000030	T	0.52996	0.1769	M	0.81942	2.565	0.54753	D	0.999983	P	0.45715	0.865	P	0.54706	0.759	T	0.60209	-0.7308	10	0.02654	T	1	.	13.8138	0.63278	0.0:0.0:1.0:0.0	.	55	P17481	HXB8_HUMAN	E	55	ENSP00000239144:Q55E	ENSP00000239144:Q55E	Q	-	1	0	HOXB8	44046903	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	8.971000	0.93419	1.543000	0.49345	0.290000	0.19541	CAG	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3		16.845442	0	-1	24	0	0	1	0		6	17.065144	10	0.375000
KRTAP9-3	83900	broad.mit.edu	hg19	17	39389143	39389143	+	Missense_Mutation	SNP	C	C	G			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:39389143C>G	ENST00000411528.2	+	1	429	c.390C>G	c.(388-390)tgC>tgG	p.C130W		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	130	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].		keratin filament	protein binding	breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)		AGCCCTGCTGCCGCCCAGCCT	0.582	0	105.0	129.0	121.0	17	39389143	2101	4297	6398	SO:0001583	missense	AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873	"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product					11279113	Standard	NM_031962	Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.390C>G	17.37:g.39389143C>G	ENSP00000392189:p.Cys130Trp		ENST00000411528.2	37	CCDS11385.1	.	.	.	.	.	.	.	.	.	.	.	15.41	2.826248	0.50739	.	.	ENSG00000204873	ENST00000411528	T	0.02812	4.15	2.67	1.65	0.23941	.	.	.	.	.	T	0.11793	0.0287	M	0.89353	3.025	0.49687	D	0.999811	.	.	.	.	.	.	T	0.00482	-1.1713	7	0.87932	D	0	.	7.0931	0.25295	0.0:0.8388:0.0:0.1612	.	.	.	.	W	130	ENSP00000392189:C130W	ENSP00000392189:C130W	C	+	3	2	KRTAP9-3	36642669	0.271000	0.24162	0.586000	0.28679	0.470000	0.32858	1.211000	0.32382	0.404000	0.25506	0.194000	0.17425	TGC	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		93.983883	0	5	138	0	0	1	0		29	94.967162	15	0.659091
ZNF182	7569	broad.mit.edu	hg19	X	47836907	47836907	+	Silent	SNP	A	A	G			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chrX:47836907A>G	ENST00000396965.1	-	7	929	c.579T>C	c.(577-579)caT>caC	p.H193H	ZNF182_ENST00000305127.6_Silent_p.H193H|ZNF182_ENST00000376943.3_Silent_p.H174H	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	193		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22					CATACTCAGTATGGAAGAACA	0.343	0	64.0	57.0	59.0	X	47836907	2203	4299	6502	SO:0001819	synonymous_variant	AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118	"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21	8088786, 2014798, 8914609	Standard	NM_001178099	Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.579T>C	X.37:g.47836907A>G		A2IDD7|Q3KP67|Q96QH7	ENST00000396965.1	37	CCDS35236.1																																																																																			ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277055.1		32.750269	0	-50	26	0	0	1	0	NM_006962	10	32.761678	9	0.526316
FASTK	10922	broad.mit.edu	hg19	7	150776028	150776028	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr7:150776028A>C	ENST00000297532.6	-	3	663	c.586T>G	c.(586-588)Ttg>Gtg	p.L196V	FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000540185.1_Intron|FASTK_ENST00000353841.2_Missense_Mutation_p.L55V|FASTK_ENST00000482571.1_Missense_Mutation_p.L196V	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	196		apoptosis|induction of apoptosis by extracellular signals|regulation of RNA splicing		ATP binding|Fas-activated serine/threonine kinase activity|protein binding	lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)	AGGGGCTGCAAAGGGGGAGGT	0.622	0	22.0	21.0	21.0	7	150776028	2199	4295	6494	SO:0001583	missense		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896		24676	protein-coding gene	gene with protein product		606965			7544399, 15572676	Standard	NM_006712	Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.586T>G	7.37:g.150776028A>C	ENSP00000297532:p.Leu196Val	A8K867|F8VTW9|Q59EM8|Q8IVA0	ENST00000297532.6	37	CCDS5918.1	.	.	.	.	.	.	.	.	.	.	A	6.926	0.540501	0.13250	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.33865	2.19;1.95;1.39	4.31	1.08	0.20341	.	1.099010	0.07232	N	0.862668	T	0.22205	0.0535	N	0.14661	0.345	0.18873	N	0.999987	B;B;B	0.26547	0.152;0.039;0.039	B;B;B	0.29176	0.099;0.034;0.021	T	0.32214	-0.9915	10	0.51188	T	0.08	-30.2411	5.1637	0.15075	0.1336:0.0:0.6618:0.2046	.	196;55;196	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	V	196;196;55;196;196	ENSP00000324817:L55V;ENSP00000297532:L196V;ENSP00000418516:L196V	ENSP00000297530:L196V	L	-	1	2	FASTK	150406961	0.001000	0.12720	0.131000	0.22000	0.191000	0.23601	0.575000	0.23729	0.480000	0.27534	-0.261000	0.10672	TTG	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2		14.672810	0	4	29	0	0	1	0	NM_006712	5	14.745564	7	0.416667
ACTRT2	140625	broad.mit.edu	hg19	1	2939192	2939192	+	Silent	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr1:2939192G>A	ENST00000378404.2	+	1	1147	c.942G>A	c.(940-942)cgG>cgA	p.R314R		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	314			cytoplasm|cytoskeleton		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)	TGGATGACCGGCTTCTCAAGG	0.607	0	50.0	58.0	55.0	1	2939192	2203	4299	6502	SO:0001819	synonymous_variant	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717		24026	protein-coding gene	gene with protein product		608535			11750065, 12243744	Standard	NM_080431	Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.942G>A	1.37:g.2939192G>A		B1AN52|Q8NHS6|Q8TDG1	ENST00000378404.2	37	CCDS45.1																																																																																			ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1		75.275826	0	-5	78	0	0	1	0	NM_080431	25	75.292249	27	0.480769
GNAQ	2776	broad.mit.edu	hg19	9	80409488	80409488	+	Missense_Mutation	SNP	T	T	G	rs121913492		TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr9:80409488T>G	ENST00000286548.4	-	5	848	c.626A>C	c.(625-627)cAa>cCa	p.Q209P	GNAQ_ENST00000397476.3_Missense_Mutation_p.Q7P	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	209		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					CTCTGACCTTTGGCCCCCTAC	0.348	153	108.0	105.0	106.0	9	80409488	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.626A>C	9.37:g.80409488T>G	ENSP00000286548:p.Gln209Pro	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614273	0.87359	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.91237	-2.81;-2.81	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.98607	1.0661	10	0.87932	D	0	.	15.9502	0.79827	0.0:0.0:0.0:1.0	.	209	P50148	GNAQ_HUMAN	P	209;7	ENSP00000286548:Q209P;ENSP00000443197:Q7P	ENSP00000286548:Q209P	Q	-	2	0	GNAQ	79599308	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.040000	0.89188	2.167000	0.68274	0.460000	0.39030	CAA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		65.022693	0	-28	84	0	0	1	0	NM_002072	22	67.594207	51	0.301370
RASA2	5922	broad.mit.edu	hg19	3	141231112	141231112	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr3:141231112A>C	ENST00000286364.3	+	2	276	c.241A>C	c.(241-243)Aaa>Caa	p.K81Q	RASA2_ENST00000452898.1_Missense_Mutation_p.K81Q			Q15283	RASA2_HUMAN	RAS p21 protein activator 2	81	C2 1.	intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity	NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34					AGTTGTGGAAAAATCTTTAAG	0.284	0	57.0	60.0	59.0	3	141231112	2203	4298	6501	SO:0001583	missense	AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903	"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589			8699317	Standard	NM_006506	Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000286364.3:c.241A>C	3.37:g.141231112A>C	ENSP00000286364:p.Lys81Gln	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	ENST00000286364.3	37	CCDS3117.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468870	0.84533	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	T;T	0.73152	-0.72;-0.72	5.37	5.37	0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.117590	0.56097	D	0.000030	D	0.84897	0.5574	M	0.85945	2.785	0.53688	D	0.999976	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.982;0.969;0.982	D	0.87294	0.2301	10	0.66056	D	0.02	.	14.3518	0.66708	1.0:0.0:0.0:0.0	.	81;81;81	A8K7K1;G3V0F9;Q15283	.;.;RASA2_HUMAN	Q	81	ENSP00000286364:K81Q;ENSP00000391677:K81Q	ENSP00000286364:K81Q	K	+	1	0	RASA2	142713802	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.749000	0.85096	2.033000	0.60031	0.533000	0.62120	AAA	RASA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359711.2		60.047636	0	-11	70	0	0	1	0	NM_006506	18	60.097745	21	0.461538
RARG	5916	broad.mit.edu	hg19	12	53606945	53606945	+	Silent	SNP	G	G	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr12:53606945G>C	ENST00000425354.2	-	9	1588	c.1101C>G	c.(1099-1101)cgC>cgG	p.R367R	RARG_ENST00000327550.3_Silent_p.R295R|RARG_ENST00000543726.1_Silent_p.R345R|RARG_ENST00000338561.5_Silent_p.R356R|RARG_ENST00000394426.1_Silent_p.R367R|RARG_ENST00000543762.1_5'UTR	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	367	Ligand-binding.	canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					TGGGCCGCCGGCGCCGGGCGT	0.602	0	48.0	47.0	48.0	12	53606945	2203	4300	6503	SO:0001819	synonymous_variant	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819	"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190			1849262	Standard	NM_001042728	Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.1101C>G	12.37:g.53606945G>C		B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	ENST00000425354.2	37	CCDS8850.1																																																																																			RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2		69.747831	0	13	70	0	0	1	0	NM_000966	22	69.752679	23	0.488889
ZNF180	7733	broad.mit.edu	hg19	19	44981067	44981067	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr19:44981067G>C	ENST00000221327.4	-	5	1912	c.1631C>G	c.(1630-1632)aCt>aGt	p.T544S	ZNF180_ENST00000391956.4_Missense_Mutation_p.T519S|ZNF180_ENST00000592529.1_Missense_Mutation_p.T517S	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	544		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)			TTTCTCTCCAGTGTGAGTTCT	0.423	0	78.0	78.0	78.0	19	44981067	2203	4300	6503	SO:0001583	missense	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384	"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""			Standard	NM_001288762	Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1631C>G	19.37:g.44981067G>C	ENSP00000221327:p.Thr544Ser	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148613	0.57151	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.24151	1.87;1.87	5.23	4.15	0.48705	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43416	D	0.000561	T	0.21267	0.0512	N	0.26130	0.795	0.80722	D	1	P;P;P	0.36768	0.513;0.569;0.569	B;B;B	0.38683	0.183;0.279;0.279	T	0.06232	-1.0838	10	0.49607	T	0.09	-11.686	14.7864	0.69806	0.0:0.1447:0.8553:0.0	.	519;543;544	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	S	544;519	ENSP00000221327:T544S;ENSP00000375818:T519S	ENSP00000221327:T544S	T	-	2	0	ZNF180	49672907	1.000000	0.71417	0.970000	0.41538	0.976000	0.68499	3.444000	0.52914	2.437000	0.82529	0.467000	0.42956	ACT	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1		102.015711	0	-10	117	0	0	1	0	NM_013256	31	102.318234	41	0.430556
IGF2BP1	10642	broad.mit.edu	hg19	17	47119660	47119660	+	Missense_Mutation	SNP	T	T	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:47119660T>C	ENST00000290341.3	+	9	1332	c.998T>C	c.(997-999)aTc>aCc	p.I333T	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.I194T	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	333	KH 2.|Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).	CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31					AAGGGGGCCATCGAGAATTGT	0.532	0	118.0	116.0	117.0	17	47119660	2203	4300	6503	SO:0001583	missense	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217	"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288			9891060, 11992722	Standard	NM_001160423	Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.998T>C	17.37:g.47119660T>C	ENSP00000290341:p.Ile333Thr	C9JT33	ENST00000290341.3	37	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597867	0.66332	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.28454	1.61;1.61	5.59	5.59	0.84812	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.136010	0.56097	D	0.000040	T	0.42223	0.1193	L	0.31157	0.91	0.80722	D	1	P;B	0.40180	0.705;0.18	P;B	0.58780	0.845;0.178	T	0.16394	-1.0404	10	0.33141	T	0.24	-16.2489	15.7197	0.77697	0.0:0.0:0.0:1.0	.	194;333	C9JT33;Q9NZI8	.;IF2B1_HUMAN	T	333;194	ENSP00000290341:I333T;ENSP00000389135:I194T	ENSP00000290341:I333T	I	+	2	0	IGF2BP1	44474659	0.999000	0.42202	0.988000	0.46212	0.972000	0.66771	5.056000	0.64287	2.231000	0.72958	0.533000	0.62120	ATC	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1		-14.623388	0	-28	118	0	0	1	0	NM_006546	6	6.617203	97	0.058252
GAP43	2596	broad.mit.edu	hg19	3	115395065	115395065	+	Missense_Mutation	SNP	A	A	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr3:115395065A>C	ENST00000393780.3	+	3	812	c.344A>C	c.(343-345)gAg>gCg	p.E115A	GAP43_ENST00000305124.6_Missense_Mutation_p.E79A	NM_001130064.1	NP_001123536.1	P17677	NEUM_HUMAN	growth associated protein 43	79		activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding	endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)	GATGGGGTGGAGAAGAAGGGA	0.537	0	81.0	78.0	79.0	3	115395065	2203	4300	6503	SO:0001583	missense		CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020		4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060			3272162, 8231732	Standard	NM_002045	Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000393780.3:c.344A>C	3.37:g.115395065A>C	ENSP00000377372:p.Glu115Ala	A8K0Y4	ENST00000393780.3	37	CCDS46890.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.604969	0.28623	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	T;T	0.60920	0.15;0.15	4.62	3.42	0.39159	Neuromodulin (GAP-43), C-terminal (1);	0.205951	0.42548	N	0.000698	T	0.46964	0.1420	L	0.45228	1.405	0.42532	D	0.993044	B;B	0.25772	0.134;0.006	B;B	0.20767	0.031;0.011	T	0.43212	-0.9405	10	0.46703	T	0.11	-7.7158	10.5671	0.45179	0.6893:0.3107:0.0:0.0	.	115;79	A8K0Y4;P17677	.;NEUM_HUMAN	A	79;115	ENSP00000305010:E79A;ENSP00000377372:E115A	ENSP00000305010:E79A	E	+	2	0	GAP43	116877755	1.000000	0.71417	0.983000	0.44433	0.898000	0.52572	3.627000	0.54252	0.865000	0.35603	0.533000	0.62120	GAG	GAP43-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258217.2		56.242453	0	-19	45	0	0	1	0	NM_002045	19	56.268787	21	0.475000
SRRM2	23524	broad.mit.edu	hg19	16	2818118	2818118	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr16:2818118G>A	ENST00000301740.8	+	11	8138	c.7589G>A	c.(7588-7590)cGg>cAg	p.R2530Q	SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2530	Ser-rich.		Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105					GCAAAGGAGCGGCGGAGTtcc	0.632	1	53.0	48.0	50.0	16	2818118	2198	4300	6498	SO:0001583	missense	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978		16639	protein-coding gene	gene with protein product		606032			10668804, 11004489	Standard	NM_016333	Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7589G>A	16.37:g.2818118G>A	ENSP00000301740:p.Arg2530Gln	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.767753	0.90020	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.77358	-1.09	5.91	5.91	0.95273	.	0.000000	0.56097	D	0.000029	T	0.80144	0.4569	N	0.19112	0.55	0.33018	D	0.528436	D	0.69078	0.997	D	0.70227	0.968	D	0.84048	0.0368	10	0.56958	D	0.05	-8.9045	15.8054	0.78501	0.0:0.0:1.0:0.0	.	2530	Q9UQ35	SRRM2_HUMAN	Q	2530;2112;1782	ENSP00000301740:R2530Q	ENSP00000301740:R2530Q	R	+	2	0	SRRM2	2758119	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.739000	0.47409	2.808000	0.96608	0.655000	0.94253	CGG	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		49.127402	0	7	43	0	0	1	0		15	49.158547	13	0.535714
DEAF1	10522	broad.mit.edu	hg19	11	679783	679783	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr11:679783G>A	ENST00000382409.3	-	8	1515	c.1031C>T	c.(1030-1032)tCg>tTg	p.S344L	DEAF1_ENST00000338675.6_Missense_Mutation_p.S255L|DEAF1_ENST00000525904.1_5'UTR	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	344		embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding	breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)	CAGTGCCCCCGAGGTCGTGAT	0.652	0	65.0	58.0	60.0	11	679783	2203	4300	6503	SO:0001583	missense	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030	"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""		9773984	Standard	XR_428838	Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1031C>T	11.37:g.679783G>A	ENSP00000371846:p.Ser344Leu	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	ENST00000382409.3	37	CCDS31327.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328934	0.60743	.	.	ENSG00000177030	ENST00000382409;ENST00000338675;ENST00000359958;ENST00000388804	T	0.69561	-0.41	3.37	3.37	0.38596	.	0.000000	0.64402	D	0.000004	T	0.59128	0.2171	L	0.34521	1.04	0.46954	D	0.999261	D	0.63046	0.992	P	0.45610	0.487	T	0.66752	-0.5844	10	0.66056	D	0.02	-14.6476	14.0456	0.64704	0.0:0.0:1.0:0.0	.	344	O75398	DEAF1_HUMAN	L	344;255;330;267	ENSP00000371846:S344L	ENSP00000341902:S255L	S	-	2	0	DEAF1	669783	1.000000	0.71417	0.838000	0.33150	0.153000	0.21895	8.737000	0.91562	1.909000	0.55274	0.460000	0.39030	TCG	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383614.3		20.119548	0	-1	40	0	0	1	0	NM_021008	7	20.516316	13	0.350000
TPSAB1	7177	broad.mit.edu	hg19	16	1291302	1291302	+	Silent	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr16:1291302G>A	ENST00000461509.2	+	2	425	c.231G>A	c.(229-231)ctG>ctA	p.L77L	TPSAB1_ENST00000338844.3_Silent_p.L70L			P20231	TRYB2_HUMAN	tryptase alpha/beta 1	70	Peptidase S1.	proteolysis	extracellular region	protein binding|serine-type endopeptidase activity	NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)			AGTGGGTGCTGACCGCAGCGC	0.706	1	45.0	44.0	44.0	16	1291302	2198	4298	6496	SO:0001819	synonymous_variant	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236		12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2	2203827, 9920877	Standard	NM_003294	Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.210G>A	16.37:g.1291302G>A		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	ENST00000338844.3	37	CCDS10431.1																																																																																			TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1		3.837655	0	-15	67	0	0	1	0	NM_003294	5	11.575831	44	0.102041
EXOC2	55770	broad.mit.edu	hg19	6	610103	610103	+	Missense_Mutation	SNP	A	A	G			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr6:610103A>G	ENST00000230449.4	-	7	872	c.737T>C	c.(736-738)cTg>cCg	p.L246P	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	246		exocytosis|protein transport			breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)	CTTACTGTTCAGAACATTCTC	0.368	0	145.0	136.0	139.0	6	610103	2202	4300	6502	SO:0001583	missense	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685		24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1	12575951, 12459492	Standard	NM_018303	Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.737T>C	6.37:g.610103A>G	ENSP00000230449:p.Leu246Pro	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.186355	0.78789	.	.	ENSG00000112685	ENST00000230449	T	0.55760	0.5	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.69833	-0.5038	10	0.87932	D	0	-12.8069	15.5852	0.76475	1.0:0.0:0.0:0.0	.	246	Q96KP1	EXOC2_HUMAN	P	246	ENSP00000230449:L246P	ENSP00000230449:L246P	L	-	2	0	EXOC2	555103	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.629000	0.90983	2.068000	0.61886	0.533000	0.62120	CTG	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1		48.544942	0	7	67	0	0	1	0	NM_018303	17	48.688334	22	0.435897
TTF1	7270	broad.mit.edu	hg19	9	135251526	135251526	+	Missense_Mutation	SNP	G	G	C			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr9:135251526G>C	ENST00000334270.2	-	11	2533	c.2494C>G	c.(2494-2496)Cta>Gta	p.L832V	TTF1_ENST00000461970.1_5'UTR	NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	832		negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding	endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)	AGCAAAGGTAGAGTCGTCTCA	0.403	0	124.0	118.0	120.0	9	135251526	2203	4300	6503	SO:0001583	missense	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482		12397	protein-coding gene	gene with protein product		600777			7597036	Standard	NM_007344	Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.2494C>G	9.37:g.135251526G>C	ENSP00000333920:p.Leu832Val	A1L160|Q4VXF3|Q58EY2|Q6P5T5	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.352701	0.41700	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.11712	2.75	5.12	5.12	0.69794	.	0.380127	0.21668	N	0.070909	T	0.25382	0.0617	L	0.61218	1.895	0.09310	N	1	D	0.67145	0.996	P	0.57620	0.824	T	0.03068	-1.1076	10	0.66056	D	0.02	.	14.4204	0.67180	0.0:0.0:1.0:0.0	.	832	Q15361	TTF1_HUMAN	V	832	ENSP00000333920:L832V	ENSP00000245588:L832V	L	-	1	2	TTF1	134241347	0.871000	0.30034	0.040000	0.18447	0.258000	0.26162	2.307000	0.43682	2.560000	0.86352	0.558000	0.71614	CTA	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2		58.763229	0	0	65	0	0	1	0	NM_007344	18	59.074531	26	0.409091
DNAH17	8632	broad.mit.edu	hg19	17	76421433	76421433	+	Missense_Mutation	SNP	T	T	G			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:76421433T>G	ENST00000389840.5	-	80	13328	c.13204A>C	c.(13204-13206)Atg>Ctg	p.M4402L	DNAH17_ENST00000585328.1_Missense_Mutation_p.M4374L|DNAH17_ENST00000586052.1_5'UTR					dynein, axonemal, heavy chain 17						NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		TTACCTTCCATGAAGAGTCCG	0.532	0	92.0	91.0	91.0	17	76421433	2203	4300	6503	SO:0001583	missense	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775	"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1	9545504	Standard	NM_173628	Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.13120A>C	17.37:g.76421433T>G	ENSP00000465516:p.Met4374Leu	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	T	14.93	2.683326	0.47991	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.04083	3.71	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000001	T	0.03305	0.0096	N	0.05487	-0.04	0.50467	D	0.999872	B	0.16396	0.017	B	0.25291	0.059	T	0.52533	-0.8563	10	0.15952	T	0.53	.	14.6095	0.68507	0.0:0.0:0.0:1.0	.	4374	E7EUM8	.	L	4374;4402	ENSP00000374490:M4402L	ENSP00000300671:M4374L	M	-	1	0	DNAH17	73933028	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.700000	0.84556	2.027000	0.59764	0.482000	0.46254	ATG	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2		97.838415	0	17	110	0	0	1	0	NM_173628	30	98.416489	44	0.405405
IFIT3	3437	broad.mit.edu	hg19	10	91099758	91099758	+	Missense_Mutation	SNP	C	C	T			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr10:91099758C>T	ENST00000371818.4	+	2	1526	c.1346C>T	c.(1345-1347)gCc>gTc	p.A449V	LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.A449V	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	449		type I interferon-mediated signaling pathway		protein binding	breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15					CTAAGGGATGCCCCTTCAGGC	0.498	0	74.0	75.0	75.0	10	91099758	2203	4300	6503	SO:0001583	missense	U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917	"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4	9828129, 9391139	Standard	NM_001031683	Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.1346C>T	10.37:g.91099758C>T	ENSP00000360883:p.Ala449Val	Q99634|Q9BSK7	ENST00000371818.4	37	CCDS7402.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734826	0.30774	.	.	ENSG00000119917	ENST00000371818;ENST00000371811;ENST00000543062	T;T	0.13196	2.61;2.61	4.65	0.621	0.17643	.	1.124900	0.06953	N	0.814954	T	0.06005	0.0156	N	0.14661	0.345	0.09310	N	1	B	0.26318	0.146	B	0.19148	0.024	T	0.40813	-0.9543	10	0.13853	T	0.58	0.0712	1.3313	0.02136	0.1389:0.3907:0.245:0.2254	.	449	O14879	IFIT3_HUMAN	V	449;449;270	ENSP00000360883:A449V;ENSP00000360876:A449V	ENSP00000360876:A449V	A	+	2	0	IFIT3	91089738	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.216000	0.09266	0.032000	0.15435	-0.140000	0.14226	GCC	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1		-0.908817	0	2	71	0	0	1	0	NM_001549	3	6.772586	38	0.073171
UMODL1	89766	broad.mit.edu	hg19	21	43543127	43543127	+	Missense_Mutation	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr21:43543127G>A	ENST00000400424.2	+	17	3194	c.2798G>A	c.(2797-2799)cGc>cAc	p.R933H	UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400427.1_Missense_Mutation_p.R1061H|UMODL1_ENST00000408989.2_Missense_Mutation_p.R1133H|UMODL1_ENST00000408910.2_Missense_Mutation_p.R1005H	NM_001199528.2	NP_001186457	Q5DID0	UROL1_HUMAN	uromodulin-like 1		EGF-like 3; calcium-binding (Potential).		cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47					ATCCAGAAGCGCTTCCTGCAG	0.637	0	86.0	93.0	90.0	21	43543127	2175	4271	6446	SO:0001583	missense		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398		12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859			16026467	Standard	NM_173568	Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3014G>A	21.37:g.43543127G>A	ENSP00000386147:p.Arg1005His	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618443	0.28801	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	3.13	-0.879	0.10613	Zona pellucida sperm-binding protein (3);	0.802743	0.10438	N	0.674606	T	0.69486	0.3116	L	0.31294	0.92	0.26420	N	0.976111	B;B	0.21688	0.059;0.039	B;B	0.12156	0.005;0.007	T	0.52071	-0.8624	9	.	.	.	-9.003	7.916	0.29818	0.4938:0.0:0.5062:0.0	.	1133;1005	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	H	1061;933;1133;1005	ENSP00000383279:R1061H;ENSP00000383276:R933H;ENSP00000386126:R1133H;ENSP00000386147:R1005H	.	R	+	2	0	UMODL1	42416196	0.013000	0.17824	0.995000	0.50966	0.959000	0.62525	-0.472000	0.06623	-0.199000	0.10317	0.313000	0.20887	CGC	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		32.315988	0	12	64	0	0	1	0		11	33.005746	21	0.343750
CDH24	64403	broad.mit.edu	hg19	14	23522740	23522740	+	Silent	SNP	G	G	A			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr14:23522740G>A	ENST00000397359.3	-	7	1450	c.1191C>T	c.(1189-1191)tcC>tcT	p.S397S	CDH24_ENST00000554034.1_Silent_p.S397S|CDH24_ENST00000487137.2_Silent_p.S397S|CDH24_ENST00000267383.5_Silent_p.S397S	NM_022478.3	NP_071923.2	Q86UP0	CAD24_HUMAN	cadherin 24, type 2	397	Cadherin 4.	adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding	breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)	GGTCAGCCGCGGAGATCTGGC	0.637	0	37.0	34.0	35.0	14	23522740	2203	4300	6503	SO:0001819	synonymous_variant	AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880	"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""		12734196	Standard	NM_022478	Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000554034.1:c.1191C>T	14.37:g.23522740G>A		D3DS44|Q86UP1|Q9NT84	ENST00000554034.1	37	CCDS9586.1																																																																																			CDH24-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413308.1		43.953647	0	4	32	0	0	1	0	NM_022478	14	44.191605	9	0.608696
MMS22L	253714	broad.mit.edu	hg19	6	97599676	97599678	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr6:97599676_97599678delTTC	ENST00000275053.4	-	23	3716_3718	c.3451_3453delGAA	c.(3451-3453)gaadel	p.E1151del	MMS22L_ENST00000369251.2_In_Frame_Del_p.E1111del	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1151		double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding	breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50					GGGAGGAAGGTTCTTCTTCTGAC	0.438	0									SO:0001651	inframe_deletion		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263		21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167	21055983, 21055984	Standard	NM_198468	Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3451_3453delGAA	6.37:g.97599682_97599684delTTC	ENSP00000275053:p.Glu1151del	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	ENST00000275053.4	37	CCDS5039.1																																																																																			MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	.	.		-13	224					NM_198468	81		152	0.35
SLC16A3	9123	broad.mit.edu	hg19	17	80195168	80195168	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:80195168delC	ENST00000581287.1	+	3	2844	c.522delC	c.(520-522)tacfs	p.Y174fs	SLC16A3_ENST00000392339.1_Frame_Shift_Del_p.Y174fs|SLC16A3_ENST00000392341.1_Frame_Shift_Del_p.Y174fs|SLC16A3_ENST00000582743.1_Frame_Shift_Del_p.Y174fs	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	174		blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	actin cytoskeleton|integral to plasma membrane|membrane fraction|nuclear membrane	secondary active monocarboxylate transmembrane transporter activity|symporter activity	endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		AGGACCGCTACGGCTGGCGGG	0.711	0	6.0	6.0	6.0	17	80195168	2121	4174	6295	SO:0001589	frameshift_variant	U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526	"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""		9425115	Standard	NM_004207	Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.522delC	17.37:g.80195168delC	ENSP00000463978:p.Tyr174fs	B3KXG8|Q2M1P8	ENST00000581287.1	37	CCDS11804.1																																																																																			SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443498.1	.	.		0	8					NM_004207	2		4	0.33
EFCAB5	374786	broad.mit.edu	hg19	17	28270612	28270612	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr17:28270612delA	ENST00000394835.3	+	3	327	c.135delA	c.(133-135)gtafs	p.V45fs	EFCAB5_ENST00000536908.2_5'UTR|EFCAB5_ENST00000320856.5_Frame_Shift_Del_p.V45fs|EFCAB5_ENST00000394832.2_Frame_Shift_Del_p.V45fs|EFCAB5_ENST00000541045.1_5'UTR|EFCAB5_ENST00000378738.3_Frame_Shift_Del_p.V45fs|EFCAB5_ENST00000534836.2_3'UTR	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	45				calcium ion binding	breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43					ACGTTCCTGTAAAAGAGGACA	0.368	0	50.0	48.0	48.0	17	28270612	1852	4095	5947	SO:0001589	frameshift_variant	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927	"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product						Standard	NM_198529	Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.135delA	17.37:g.28270612delA	ENSP00000378312:p.Val45fs	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	ENST00000394835.3	37	CCDS11254.2																																																																																			EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	.	.		7	14					NM_198529	2		4	0.33
KY	339855	broad.mit.edu	hg19	3	134343938	134343938	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr3:134343938delA	ENST00000508956.1	-	5	434	c.377delT	c.(376-378)ctgfs	p.L126fs	KY_ENST00000423778.2_Frame_Shift_Del_p.L147fs|KY_ENST00000503669.1_Frame_Shift_Del_p.L147fs|KY_ENST00000508041.1_5'UTR			Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	147			cytoskeleton|Z disc	peptidase activity	central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21					CTGCAGGTCCAGGGACATGGA	0.567	0	67.0	71.0	70.0	3	134343938	2028	4195	6223	SO:0001589	frameshift_variant	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611		26576	protein-coding gene	gene with protein product		605739				Standard	NM_178554	Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.440delT	3.37:g.134343938delA	ENSP00000397598:p.Leu147fs	B7Z1S4|Q6ZT15	ENST00000423778.2	37	CCDS46920.1																																																																																			KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	.	.		6	10					NM_178554	2		4	0.33
NUDT1	4521	broad.mit.edu	hg19	7	2284320	2284320	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr7:2284320delC	ENST00000397049.1	+	3	282	c.180delC	c.(178-180)ggcfs	p.G60fs	NUDT1_ENST00000356714.1_Frame_Shift_Del_p.G37fs|NUDT1_ENST00000397046.1_Frame_Shift_Del_p.G37fs|NUDT1_ENST00000339737.2_Frame_Shift_Del_p.G37fs|NUDT1_ENST00000343985.4_Frame_Shift_Del_p.G60fs|NUDT1_ENST00000397048.1_Frame_Shift_Del_p.G60fs	NM_198948.1|NM_198949.1	NP_945186.1|NP_945187.1	P36639	8ODP_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 1	78	Nudix hydrolase.	DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding	large_intestine(3)|lung(8)|urinary_tract(1)	12		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)	GCTTTGGGGGCAAAGTGCAAG	0.617	0	43.0	43.0	43.0	7	2284320	2203	4300	6503	SO:0001589	frameshift_variant	D16581	CCDS5329.1, CCDS5330.1	7p22	2008-07-18			ENSG00000106268	ENSG00000106268	"""Nudix motif containing"""	8048	protein-coding gene	gene with protein product	"""mutT human homolog 1"", ""nudix motif 1"", ""8-oxo-7,8-dihydrodeoxyguanosine triphosphatase"", ""8-oxo-dGTPase"", ""7,8-dihydro-8-oxoguanine triphosphatase"", ""8-oxo-7,8-dihydroguanosine triphosphatase"", ""nucleoside diphosphate-linked moiety X-type motif 1"""	600312		MTH1	7713494, 8226881	Standard	NM_002452	Approved		uc003slp.1	P36639	OTTHUMG00000023072	ENST00000397046.1:c.111delC	7.37:g.2284320delC	ENSP00000380239:p.Gly37fs	A4D205|Q6LES7|Q6P0Y6|Q7Z7N6|Q8IV95|Q9UBM0|Q9UBM9	ENST00000397046.1	37	CCDS5330.1																																																																																			NUDT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206922.1	.	.		-1	14					NM_002452	2		4	0.33
PROSER2	254427	broad.mit.edu	hg19	10	11911649	11911649	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VD-AA8Q-01A-11D-A39W-08	TCGA-VD-AA8Q-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	991200cc-b343-4fe2-8162-e19a3f557a2a	74a842e8-7339-457c-a2d2-394c3b271e96	g.chr10:11911649delC	ENST00000277570.5	+	4	706	c.552delC	c.(550-552)cacfs	p.H184fs	PROSER2-AS1_ENST00000445498.1_RNA|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2_ENST00000379200.1_5'UTR	NM_153256.3	NP_694988.3			proline and serine-rich protein 2												CGGTGGAGCACCCCAGACTCC	0.701	0	11.0	12.0	12.0	10	11911649	2189	4288	6477	SO:0001589	frameshift_variant	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426		23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47	12477932	Standard	NM_153256	Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.552delC	10.37:g.11911649delC	ENSP00000277570:p.His184fs	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	ENST00000277570.5	37	CCDS7085.1																																																																																			PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	.	.		-4	7					NM_153256	2		4	0.33
