Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
GPR78	27201	broad.mit.edu	hg19	4	8588969	8588969	+	Missense_Mutation	SNP	A	A	G			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr4:8588969A>G	ENST00000382487.4	+	3	1388	c.971A>G	c.(970-972)gAc>gGc	p.D324G	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	324		activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26					TCCACCCATGACAGCTCTCTG	0.647	0	45.0	51.0	49.0	4	8588969	2203	4299	6502	SO:0001583	missense	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269	"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921			11574155	Standard	NM_080819	Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.971A>G	4.37:g.8588969A>G	ENSP00000371927:p.Asp324Gly	Q8NGV3	ENST00000382487.4	37	CCDS3403.1	.	.	.	.	.	.	.	.	.	.	A	2.982	-0.210017	0.06140	.	.	ENSG00000155269	ENST00000382487	T	0.61274	0.12	1.91	1.91	0.25777	.	0.338236	0.24904	N	0.034671	T	0.30665	0.0772	N	0.08118	0	0.22292	N	0.999224	B	0.02656	0.0	B	0.01281	0.0	T	0.14227	-1.0480	10	0.22706	T	0.39	.	7.0915	0.25287	1.0:0.0:0.0:0.0	.	324	Q96P69	GPR78_HUMAN	G	324	ENSP00000371927:D324G	ENSP00000371927:D324G	D	+	2	0	GPR78	8639869	0.998000	0.40836	0.015000	0.15790	0.011000	0.07611	1.532000	0.36029	0.412000	0.25729	0.172000	0.16884	GAC	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		25.896248	0	-3	64	0	0	1	0		11	30.295561	43	0.203704
ANGEL1	23357	broad.mit.edu	hg19	14	77273137	77273137	+	Silent	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr14:77273137G>A	ENST00000251089.2	-	5	1114	c.1002C>T	c.(1000-1002)gtC>gtT	p.V334V		NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	334					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)	GCTTGTAGCAGACAGCACAGC	0.512	0	169.0	180.0	177.0	14	77273137	2203	4300	6503	SO:0001819	synonymous_variant	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523		19961	protein-coding gene	gene with protein product				KIAA0759	11943475	Standard	NM_015305	Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1002C>T	14.37:g.77273137G>A		B4DWL7|O94859|Q8NCS9	ENST00000251089.2	37	CCDS9852.1																																																																																			ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2		-33.350294	0	-5	214	0	0	1	0	NM_015305	4	6.985138	157	0.024845
SPTBN1	0	broad.mit.edu	hg19	2	54845327	54845327	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr2:54845327G>A	ENST00000333896.5	+	6	1106	c.721G>A	c.(721-723)Gaa>Aaa	p.E241K	SPTBN1_ENST00000356805.4_Missense_Mutation_p.E254K	NM_178313.2	NP_842565.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	254	Actin-binding.|CH 2.	actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)		GTTGGACCCCGAAGGTAGGGA	0.428	0	61.0	59.0	60.0	2	54845327	2203	4300	6503	SO:0001583	missense		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306	"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790				Standard	NM_003128	Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.760G>A	2.37:g.54845327G>A	ENSP00000349259:p.Glu254Lys	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	36	5.957391	0.97145	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;D	0.97620	-0.31;-0.31;-4.46	5.56	5.56	0.83823	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98604	0.9533	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.76575	0.988;0.827	D	0.99533	1.0961	10	0.87932	D	0	.	19.5255	0.95203	0.0:0.0:1.0:0.0	.	241;254	Q01082-3;Q01082	.;SPTB2_HUMAN	K	254;254;241	ENSP00000349259:E254K;ENSP00000374630:E254K;ENSP00000334156:E241K	ENSP00000334156:E241K	E	+	1	0	SPTBN1	54698831	1.000000	0.71417	0.983000	0.44433	0.930000	0.56654	9.807000	0.99171	2.624000	0.88883	0.650000	0.86243	GAA	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		1.262545	0	-4	49	0	0	1	0		4	9.469446	43	0.085106
CACNA1B	774	broad.mit.edu	hg19	9	141016204	141016204	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr9:141016204C>T	ENST00000277549.5	+	47	6924	c.4355C>T	c.(4354-4356)cCt>cTt	p.P1452L	CACNA1B_ENST00000371357.1_Missense_Mutation_p.P2257L|CACNA1B_ENST00000371372.1_Missense_Mutation_p.P2258L|CACNA1B_ENST00000371355.4_Missense_Mutation_p.P2259L|CACNA1B_ENST00000277551.2_Missense_Mutation_p.L2196F|CACNA1B_ENST00000371363.1_Missense_Mutation_p.P2256L			Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2258		membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	GGCTCTGACCCTTACCTGGGG	0.667	0	35.0	40.0	38.0	9	141016204	2001	4160	6161	SO:0001583	missense	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408	"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5	8825650, 16382099	Standard	NM_000718	Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6773C>T	9.37:g.141016204C>T	ENSP00000360423:p.Pro2258Leu	B1AQK5	ENST00000371372.1	37	CCDS59522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.507888|4.507888	0.85282|0.85282	.|.	.|.	ENSG00000148408|ENSG00000148408	ENST00000277551|ENST00000371372;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D|D;D;D;D;D	0.96587|0.99005	-4.06|-4.9;-5.32;-4.91;-4.89;-4.88	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.652243	.|0.14374	.|N	.|0.323603	D|D	0.99227|0.99227	0.9731|0.9731	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;P	.|0.71656	.|0.974;0.904	D|D	0.99878|0.99878	1.1107|1.1107	7|10	0.10111|0.87932	T|D	0.7|0	.|.	18.5267|18.5267	0.90975|0.90975	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2257;2256	.|B1AQK7;B1AQK6	.|.;.	F|L	2196|2258;1452;2256;2257;2259	ENSP00000277551:L2196F|ENSP00000360423:P2258L;ENSP00000277549:P1452L;ENSP00000360414:P2256L;ENSP00000360408:P2257L;ENSP00000360406:P2259L	ENSP00000277551:L2196F|ENSP00000277549:P1452L	L|P	+|+	1|2	0|0	CACNA1B|CACNA1B	140136025|140136025	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.813000|0.813000	0.45954|0.45954	7.213000|7.213000	0.77950|0.77950	2.381000|2.381000	0.81170|0.81170	0.555000|0.555000	0.69702|0.69702	CTT|CCT	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1		25.429891	0	9	64	0	0	1	0	NM_000718	10	27.529615	29	0.256410
GNA11	2767	broad.mit.edu	hg19	19	3118942	3118942	+	Missense_Mutation	SNP	A	A	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr19:3118942A>T	ENST00000078429.4	+	5	868	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	209		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GTGGGGGGCCAGCGGTCGGAG	0.612	82	104.0	89.0	94.0	19	3118942	2203	4300	6503	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.626A>T	19.37:g.3118942A>T	ENSP00000078429:p.Gln209Leu	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	15.05	2.718086	0.48622	.	.	ENSG00000088256	ENST00000078429	D	0.91237	-2.81	3.26	3.26	0.37387	.	0.000000	0.64402	U	0.000006	D	0.96950	0.9004	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.68483	0.958	D	0.96823	0.9605	10	0.87932	D	0	.	10.7338	0.46113	1.0:0.0:0.0:0.0	.	209	P29992	GNA11_HUMAN	L	209	ENSP00000078429:Q209L	ENSP00000078429:Q209L	Q	+	2	0	GNA11	3069942	1.000000	0.71417	0.438000	0.26821	0.027000	0.11550	9.104000	0.94239	1.256000	0.44068	0.379000	0.24179	CAG	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		46.184060	0	-28	53	0	0	1	0	NM_002067	16	47.364860	32	0.333333
DENND6A	201627	broad.mit.edu	hg19	3	57627390	57627390	+	Silent	SNP	A	A	G			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr3:57627390A>G	ENST00000311128.5	-	12	1192	c.1122T>C	c.(1120-1122)ctT>ctC	p.L374L	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1			DENN/MADD domain containing 6A												CTGTAGGTTTAAGGTCTCCTA	0.363	0	138.0	129.0	132.0	3	57627390	2203	4300	6503	SO:0001819	synonymous_variant	AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839	"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A	21330364	Standard	NM_152678	Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1122T>C	3.37:g.57627390A>G		Q7Z5T4|Q8N235|Q8TEG8	ENST00000311128.5	37	CCDS33773.1	.	.	.	.	.	.	.	.	.	.	A	8.747	0.920335	0.17982	.	.	ENSG00000174839	ENST00000477344	.	.	.	5.26	2.71	0.32032	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.1716	1.7721	0.03014	0.4697:0.2671:0.1344:0.1288	.	.	.	.	Q	143	.	.	X	-	1	0	FAM116A	57602430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.342000	0.33919	0.335000	0.23614	0.477000	0.44152	TAA	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1		37.351572	0	-30	57	0	0	1	0	NM_152678	13	40.481135	40	0.245283
OSM	5008	broad.mit.edu	hg19	22	30661053	30661053	+	Missense_Mutation	SNP	G	G	T	rs149963275		TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr22:30661053G>T	ENST00000215781.2	-	2	155	c.115C>A	c.(115-117)Ctt>Att	p.L39I	OSM_ENST00000403389.1_Missense_Mutation_p.L18I|OSM_ENST00000403463.1_Intron	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	39		cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding	breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)		AGCTGGCCAAGGAGCACGCGG	0.577	0	146.0	134.0	138.0	22	30661053	2203	4300	6503	SO:0001583	missense	AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985		8506	protein-coding gene	gene with protein product		165095			1717982	Standard	NM_020530	Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000403389.1:c.52C>A	22.37:g.30661053G>T	ENSP00000383893:p.Leu18Ile	Q6FHP8|Q9UCP6	ENST00000403389.1	37		.	.	.	.	.	.	.	.	.	.	G	19.45	3.829116	0.71258	.	.	ENSG00000099985	ENST00000215781;ENST00000403389	T	0.61392	0.11	3.69	3.69	0.42338	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.33364	N	0.004993	T	0.63593	0.2524	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.65372	-0.6184	10	0.62326	D	0.03	-21.8977	11.2324	0.48920	0.0:0.0:1.0:0.0	.	39	P13725	ONCM_HUMAN	I	39;18	ENSP00000215781:L39I	ENSP00000215781:L39I	L	-	1	0	OSM	28991053	0.980000	0.34600	0.642000	0.29436	0.098000	0.18820	1.876000	0.39588	2.372000	0.80975	0.561000	0.74099	CTT	OSM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000320514.1		12.855980	1	0	147	0	4.68919e-08	1	4.90233e-08	NM_020530	11	26.173316	82	0.118280
ARAP3	64411	broad.mit.edu	hg19	5	141059986	141059986	+	Missense_Mutation	SNP	T	T	G			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr5:141059986T>G	ENST00000239440.4	-	2	133	c.68A>C	c.(67-69)gAc>gCc	p.D23A	ARAP3_ENST00000508305.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	23	SAM.	cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding	NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53					TCGGAACGTGTCTGCATACTG	0.672	0	43.0	42.0	42.0	5	141059986	2203	4299	6502	SO:0001583	missense	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318	"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3	11804589, 12015138	Standard	XM_005268497	Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.68A>C	5.37:g.141059986T>G	ENSP00000239440:p.Asp23Ala	B4DIT1|D3DQE3	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.505405	0.64410	.	.	ENSG00000120318	ENST00000239440;ENST00000504448	D;D	0.86956	-2.19;-2.19	4.39	4.39	0.52855	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.64402	D	0.000001	D	0.88869	0.6554	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85687	0.1304	10	0.02654	T	1	.	11.0754	0.48027	0.0:0.0:0.0:1.0	.	23	Q8WWN8	ARAP3_HUMAN	A	23	ENSP00000239440:D23A;ENSP00000421148:D23A	ENSP00000239440:D23A	D	-	2	0	ARAP3	141040170	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.432000	0.59922	1.842000	0.53543	0.379000	0.24179	GAC	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1		3.469072	0	-12	55	0	0	1	0	NM_022481	4	10.117667	37	0.097561
SPAG16	79582	broad.mit.edu	hg19	2	214794781	214794781	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr2:214794781G>A	ENST00000331683.5	+	12	1407	c.1312G>A	c.(1312-1314)Gca>Aca	p.A438T	SPAG16_ENST00000374309.3_Missense_Mutation_p.A344T	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	438		cilium assembly	cilium axoneme|flagellar axoneme		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)	ACACAGCCGCGCAGTGTGGTC	0.443	0	111.0	110.0	110.0	2	214794781	2203	4300	6503	SO:0001583	missense	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451	"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173			12391165, 11867345	Standard	NM_024532	Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1312G>A	2.37:g.214794781G>A	ENSP00000332592:p.Ala438Thr	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495707	0.64186	.	.	ENSG00000144451	ENST00000331683;ENST00000374309	T;T	0.59364	0.27;0.27	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.350989	0.24737	N	0.036001	T	0.65729	0.2719	L	0.38953	1.18	0.53005	D	0.999965	D;D;P;D	0.76494	0.999;0.999;0.869;0.999	D;D;B;D	0.65773	0.938;0.923;0.418;0.938	T	0.58901	-0.7554	10	0.20519	T	0.43	.	17.8902	0.88870	0.0:0.0:1.0:0.0	.	344;289;378;438	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	T	438;344	ENSP00000332592:A438T;ENSP00000363428:A344T	ENSP00000332592:A438T	A	+	1	0	SPAG16	214503026	1.000000	0.71417	0.890000	0.34922	0.148000	0.21650	4.875000	0.63072	2.550000	0.86006	0.655000	0.94253	GCA	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2		7.749510	0	-6	86	0	0	1	0	NM_024532	8	19.263683	67	0.106667
OR9A4	130075	broad.mit.edu	hg19	7	141618729	141618729	+	Silent	SNP	C	C	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr7:141618729C>A	ENST00000548136.1	+	1	113	c.54C>A	c.(52-54)ggC>ggA	p.G18G	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	18		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)				GCTTCCCTGGCTCTGAAGAAC	0.373	0	240.0	245.0	243.0	7	141618729	2131	4271	6402	SO:0001819	synonymous_variant		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083	"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product						Standard	NM_001001656	Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.54C>A	7.37:g.141618729C>A		B9EGV6|Q6IFI4	ENST00000548136.1	37	CCDS43661.1																																																																																			OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3		2.536394	1	16	184	0	1.61879e-10	1	1.77296e-10	NM_001001656	11	24.507603	116	0.086614
OR5B21	219968	broad.mit.edu	hg19	11	58274720	58274720	+	Missense_Mutation	SNP	A	A	G			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr11:58274720A>G	ENST00000360374.2	-	1	858	c.859T>C	c.(859-861)Tac>Cac	p.Y287H		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	287		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)			CTAAGGCTGTATATCAAGGGA	0.418	0	145.0	142.0	143.0	11	58274720	2201	4295	6496	SO:0001583	missense		CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283	"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product						Standard	NM_001005218	Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.859T>C	11.37:g.58274720A>G	ENSP00000353537:p.Tyr287His		ENST00000360374.2	37	CCDS31552.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.036007	0.75617	.	.	ENSG00000198283	ENST00000360374	T	0.61859	0.07	4.84	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33691	U	0.004646	D	0.84110	0.5400	H	0.98218	4.175	0.44388	D	0.997297	D	0.89917	1.0	D	0.97110	1.0	D	0.89643	0.3864	10	0.87932	D	0	-1.8995	13.392	0.60829	1.0:0.0:0.0:0.0	.	287	A6NL26	OR5BL_HUMAN	H	287	ENSP00000353537:Y287H	ENSP00000353537:Y287H	Y	-	1	0	OR5B21	58031296	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	8.918000	0.92759	2.024000	0.59613	0.533000	0.62120	TAC	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394891.1		37.508965	0	-25	171	0	0	1	0	NM_001005218	20	55.648400	124	0.138889
HSD17B7	51478	broad.mit.edu	hg19	1	162769603	162769603	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr1:162769603G>A	ENST00000367917.3	+	5	586	c.518G>A	c.(517-519)aGt>aAt	p.S173N	HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000254521.3_Missense_Mutation_p.S173N			P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	173		cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	3-keto sterol reductase activity|estradiol 17-beta-dehydrogenase activity	endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)				TCATCTCGCAGTGCAAGGAAA	0.458	4	76.0	70.0	72.0	1	162769603	2203	4300	6503	SO:0001583	missense	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756			10544267, 10419022, 19027726	Standard	NM_016371	Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.518G>A	1.37:g.162769603G>A	ENSP00000254521:p.Ser173Asn	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	ENST00000254521.3	37	CCDS1242.1	.	.	.	.	.	.	.	.	.	.	A	0.896	-0.723912	0.03158	.	.	ENSG00000132196	ENST00000367917;ENST00000254521;ENST00000413934	T;T;T	0.76578	2.88;-1.03;2.88	4.44	3.31	0.37934	NAD(P)-binding domain (1);	0.000000	0.85682	N	0.000000	T	0.27205	0.0667	N	0.04705	-0.18	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.06917	-1.0800	9	0.05833	T	0.94	-30.7352	7.9369	0.29935	0.8252:0.0:0.1748:0.0	.	173	P56937	DHB7_HUMAN	N	173;173;26	ENSP00000356894:S173N;ENSP00000254521:S173N;ENSP00000412146:S26N	ENSP00000254521:S173N	S	+	2	0	HSD17B7	161036227	1.000000	0.71417	0.991000	0.47740	0.478000	0.33099	4.183000	0.58317	0.241000	0.21283	-1.007000	0.02485	AGT	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1		-7.666666	0	-24	36	0	0	1	0	NM_016371	4	8.407219	72	0.052632
SGSM3	27352	broad.mit.edu	hg19	22	40801734	40801734	+	Missense_Mutation	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr22:40801734G>A	ENST00000248929.9	+	8	889	c.700G>A	c.(700-702)Gcc>Acc	p.A234T	SGSM3_ENST00000454798.2_Missense_Mutation_p.A167T	NM_015705.4	NP_056520.2	Q96HU1	SGSM3_HUMAN	small G protein signaling modulator 3	234	Rab-GAP TBC.	cell cycle arrest|Rap protein signal transduction	cytoplasm	Rab GTPase activator activity|Rab GTPase binding	cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19					CCTGCTCCCCGCCTCCTACTT	0.647	0	104.0	105.0	104.0	22	40801734	2203	4300	6503	SO:0001583	missense	AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359	"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3	11214971, 17509819	Standard	XM_005261572	Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.700G>A	22.37:g.40801734G>A	ENSP00000248929:p.Ala234Thr		ENST00000248929.9	37	CCDS14002.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716676	0.30413	.	.	ENSG00000100359	ENST00000457767;ENST00000248929;ENST00000545416;ENST00000454798	T;T;T	0.11277	2.79;2.79;2.79	4.78	4.78	0.61160	Rab-GAP/TBC domain (4);	0.114380	0.64402	D	0.000013	T	0.16171	0.0389	L	0.55834	1.745	0.46356	D	0.999005	P;P;P;B;B	0.46952	0.746;0.746;0.887;0.16;0.16	B;B;B;B;B	0.43658	0.426;0.426;0.3;0.106;0.106	T	0.01940	-1.1243	10	0.39692	T	0.17	.	18.1887	0.89800	0.0:0.0:1.0:0.0	.	171;167;234;234;234	B4DVE3;B4DMS2;Q96HU1-2;B9A6J5;Q96HU1	.;.;.;.;SGSM3_HUMAN	T	167;234;177;167	ENSP00000399249:A167T;ENSP00000248929:A234T;ENSP00000390998:A167T	ENSP00000248929:A234T	A	+	1	0	SGSM3	39131680	1.000000	0.71417	0.995000	0.50966	0.419000	0.31324	6.923000	0.75817	2.401000	0.81631	0.313000	0.20887	GCC	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2		-23.810351	0	-24	131	0	0	1	0	NM_015705	4	6.707913	123	0.031496
SPAG5	10615	broad.mit.edu	hg19	17	26906802	26906802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr17:26906802G>A	ENST00000321765.5	-	17	3183	c.2851C>T	c.(2851-2853)Cga>Tga	p.R951*		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	951		cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding	NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)				GATGCTACTCGGGTGAAAGCA	0.502	0	149.0	153.0	152.0	17	26906802	2203	4300	6503	SO:0001587	stop_gained	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382		13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562			11549262	Standard	NM_006461	Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2851C>T	17.37:g.26906802G>A	ENSP00000323300:p.Arg951*	O95213|Q9BWE8|Q9NT17|Q9UFE6	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	g	41	8.587239	0.98875	.	.	ENSG00000076382	ENST00000321765	.	.	.	5.4	3.38	0.38709	.	0.148155	0.30365	N	0.009799	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7226	10.8941	0.47012	0.0:0.0:0.6404:0.3596	.	.	.	.	X	951	.	ENSP00000323300:R951X	R	-	1	2	SPAG5	23930929	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.605000	0.24179	0.813000	0.34350	0.645000	0.84053	CGA	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2		14.622097	0	-41	140	0	0	1	0	NM_006461	12	31.266820	98	0.109091
CADM3	57863	broad.mit.edu	hg19	1	159162404	159162404	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr1:159162404C>T	ENST00000368125.4	+	3	423	c.266C>T	c.(265-267)aCg>aTg	p.T89M	CADM3_ENST00000368124.4_Missense_Mutation_p.T123M	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	89	Ig-like V-type.	adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)				GTTACCTCTACGCCCCACGAG	0.507	1	143.0	119.0	127.0	1	159162404	2203	4300	6503	SO:0001583	missense	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B	11536053	Standard	NM_021189	Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368124.4:c.368C>T	1.37:g.159162404C>T	ENSP00000357106:p.Thr123Met	Q8IZQ9|Q9NVJ5|Q9UJP1	ENST00000368124.4	37	CCDS1182.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402662	0.42613	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	D;D;D	0.84660	-1.88;-1.88;-1.88	5.22	5.22	0.72569	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.068114	0.56097	D	0.000036	D	0.87458	0.6182	L	0.61218	1.895	0.28871	N	0.894971	D;D;D	0.89917	1.0;1.0;1.0	P;D;P	0.71656	0.89;0.974;0.905	T	0.83035	-0.0160	10	0.87932	D	0	.	11.9319	0.52851	0.0:0.8253:0.1747:0.0	.	89;89;123	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	M	123;89;89	ENSP00000357106:T123M;ENSP00000357107:T89M;ENSP00000387802:T89M	ENSP00000357106:T123M	T	+	2	0	CADM3	157429028	0.921000	0.31238	0.077000	0.20336	0.089000	0.18198	5.400000	0.66320	2.708000	0.92522	0.650000	0.86243	ACG	CADM3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090331.1		20.913589	0	12	76	0	0	1	0	NM_021189	10	27.454489	51	0.163934
TTC18	118491	broad.mit.edu	hg19	10	75053041	75053041	+	Missense_Mutation	SNP	C	C	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr10:75053041C>T	ENST00000401621.2	-	17	2080	c.1960G>A	c.(1960-1962)Gca>Aca	p.A654T	TTC18_ENST00000394865.1_Missense_Mutation_p.A654T|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_Missense_Mutation_p.A123T|TTC18_ENST00000310715.3_Missense_Mutation_p.A654T|TTC18_ENST00000340329.3_Intron			Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	654				binding	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)				TATGCTGCTGCCATCTCAAAG	0.348	0	108.0	95.0	99.0	10	75053041	2203	4300	6503	SO:0001583	missense																									ENST00000355577.3:c.367G>A	10.37:g.75053041C>T	ENSP00000347781:p.Ala123Thr	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	ENST00000355577.3	37		.	.	.	.	.	.	.	.	.	.	C	26.8	4.767914	0.90020	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000433268;ENST00000394865	D;D;T;D	0.94232	-3.38;-3.38;-0.66;-3.38	5.63	5.63	0.86233	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.97213	0.9089	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97782	1.0233	10	0.87932	D	0	-20.0741	17.1754	0.86840	0.0:1.0:0.0:0.0	.	654	Q5T0N1	TTC18_HUMAN	T	654;654;654;61;654	ENSP00000310829:A654T;ENSP00000384479:A654T;ENSP00000409527:A61T;ENSP00000378334:A654T	ENSP00000310829:A654T	A	-	1	0	TTC18	74723047	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.093000	0.71422	2.632000	0.89209	0.557000	0.71058	GCA	TTC18-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048627.2		13.230382	0	-35	39	0	0	1	0		6	16.368563	27	0.181818
LIPI	149998	broad.mit.edu	hg19	21	15554114	15554114	+	Missense_Mutation	SNP	G	G	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr21:15554114G>T	ENST00000344577.2	-	4	696	c.671C>A	c.(670-672)gCa>gAa	p.A224E	LIPI_ENST00000536861.1_Missense_Mutation_p.A203E	NM_198996.2	NP_945347.1	Q6XZB0	LIPI_HUMAN	lipase, member I	203		lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	CACAAACTTTGCATCCGTGTA	0.388	0	103.0	96.0	98.0	21	15554114	2203	4300	6503	SO:0001583	missense	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992		18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252			12719377	Standard	XM_005260924	Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000344577.2:c.671C>A	21.37:g.15554114G>T	ENSP00000343331:p.Ala224Glu	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	ENST00000344577.2	37	CCDS13564.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.05|19.05	3.752436|3.752436	0.69533|0.69533	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000344577;ENST00000536861;ENST00000382981|ENST00000400211	D;D|.	0.95001|.	-3.58;-3.58|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.91009|.	0.7172|.	H|H	0.98446|0.98446	4.235|4.235	0.52099|0.52099	D|D	0.999943|0.999943	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|.	0.94103|.	0.7364|.	10|.	0.87932|.	D|.	0|.	.|.	19.3027|19.3027	0.94149|0.94149	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	203;224|.	G1JSG6;Q6XZB0-2|.	.;.|.	E|X	224;203;98|82	ENSP00000343331:A224E;ENSP00000440381:A203E|.	ENSP00000343331:A224E|.	A|C	-|-	2|3	0|2	LIPI|LIPI	14475985|14475985	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.375000|0.375000	0.29983|0.29983	8.714000|8.714000	0.91412|0.91412	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	GCA|TGC	LIPI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157810.2		4.903207	1	0	52	0	5.9392e-07	1	5.9392e-07	NM_198996	6	14.240812	53	0.101695
DDR2	4921	broad.mit.edu	hg19	1	162737092	162737092	+	Silent	SNP	C	C	T			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr1:162737092C>T	ENST00000367922.3	+	12	1674	c.1236C>T	c.(1234-1236)ctC>ctT	p.L412L	DDR2_ENST00000367921.3_Silent_p.L412L	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2			cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		TCTTTATCCTCCTGGCCATCA	0.483	0	166.0	149.0	154.0	1	162737092	2203	4300	6503	SO:0001819	synonymous_variant	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3	9659899	Standard	XM_005245221	Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1236C>T	1.37:g.162737092C>T		Q7Z730	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417808	0.25552	.	.	ENSG00000162733	ENST00000433757	.	.	.	5.79	-2.79	0.05841	.	.	.	.	.	T	0.19685	0.0473	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.23904	-1.0175	3	.	.	.	.	8.0521	0.30583	0.0:0.1749:0.5007:0.3243	.	.	.	.	S	5	.	.	P	+	1	0	DDR2	161003716	0.478000	0.25917	0.987000	0.45799	0.998000	0.95712	-0.415000	0.07106	-0.133000	0.11537	0.655000	0.94253	CCT	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2		53.331744	0	-21	79	0	0	1	0	NM_006182	21	58.639751	66	0.241379
OGFR	11054	broad.mit.edu	hg19	20	61444363	61444363	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr20:61444363delG	ENST00000370461.1	+	5	3517	c.1240delG	c.(1240-1242)gggfs	p.G414fs	OGFR_ENST00000290291.6_Frame_Shift_Del_p.G466fs			Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	466		regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity	endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)				TGAGGGTGCTGGGGACAGTGC	0.697	0	33.0	37.0	36.0	20	61444363	2193	4292	6485	SO:0001589	frameshift_variant	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491		15768	protein-coding gene	gene with protein product		606459			10677613	Standard	NM_007346	Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1396delG	20.37:g.61444363delG	ENSP00000290291:p.Gly466fs	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	ENST00000290291.6	37	CCDS13504.1																																																																																			OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1	.	.		-1	12						2		4	0.33
SRSF2	6427	broad.mit.edu	hg19	17	74732373	74732390	+	In_Frame_Del	DEL	GATCTGGAGACCGACGAG	GATCTGGAGACCGACGAG	-			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr17:74732373_74732390delGATCTGGAGACCGACGAG	ENST00000392485.2	-	2	691_708	c.519_536delCTCGTCGGTCTCCAGATC	c.(517-537)tcctcgtcggtctccagatct>tct	p.173_179SSSVSRS>S	SRSF2_ENST00000508921.3_In_Frame_Del_p.161_167SSSVSRS>S|SRSF2_ENST00000359995.5_In_Frame_Del_p.173_179SSSVSRS>S|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000586622.1_5'UTR	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	173	Arg/Ser-rich (RS domain).	mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity	haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329					CCGCGAACGAGATCTGGAGACCGACGAGGACTTGGACT	0.615	2									SO:0001651	inframe_deletion	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547	"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2	8530103, 20516191	Standard	NM_003016	Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.519_536delCTCGTCGGTCTCCAGATC	17.37:g.74732373_74732390delGATCTGGAGACCGACGAG	ENSP00000376276:p.Ser173_Arg178del	B3KWD5|B4DN89|H0YG49	ENST00000392485.2	37	CCDS11749.1																																																																																			SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	.	.		-19	72					NM_003016	10		56	0.15
BAP1	8314	broad.mit.edu	hg19	3	52441252	52441252	+	Missense_Mutation	SNP	T	T	C			TCGA-WC-A888-01A-11D-A39W-08	TCGA-WC-A888-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fcd43d1-6d9e-483d-bbf1-5729efbc8b18	b43e1b51-25e9-44bb-a804-0159be269c75	g.chr3:52441252T>C	ENST00000460680.1	-	7	989	c.518A>G	c.(517-519)tAt>tGt	p.Y173C	BAP1_ENST00000296288.5_Missense_Mutation_p.Y173C	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.	anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	GATAGGCACATAGCTGACAAA	0.582	1	80.0	78.0	79.0	3	52441252	2203	4300	6503	SO:0001583	missense	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.518A>G	3:g.52441252T>C	ENSP00000417132:p.Tyr173Cys	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1		CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489191	0.84962	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	T;T;T	0.61859	0.07;0.07;0.07	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	T	0.82084	0.4960	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86417	0.1752	10	0.87932	D	0	-9.1034	16.6	0.84812	0.0:0.0:0.0:1.0	.	173	Q92560	BAP1_HUMAN	C	173;173;94	ENSP00000417132:Y173C;ENSP00000296288:Y173C;ENSP00000417776:Y94C	ENSP00000296288:Y173C	Y	-	2	0	BAP1	52416292	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.005000	0.88553	2.323000	0.78572	0.533000	0.62120	TAT	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	1.023000e+01	1.158000e+01		-29	39						4		21	1.820000e-01
