Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	ref_context	gc_content	COSMIC_n_overlapping_mutations	ESP_AvgAAsampleReadDepth	ESP_AvgEAsampleReadDepth	ESP_AvgSampleReadDepth	ESP_Chromosome	ESP_Position	ESP_TotalAAsamplesCovered	ESP_TotalEAsamplesCovered	ESP_TotalSamplesCovered	Ensembl_so_accession	Ensembl_so_term	HGNC_AccessionNumbers	HGNC_CCDSIDs	HGNC_Chromosome	HGNC_DateModified	HGNC_DateNameChanged	HGNC_DateSymbolChanged	HGNC_EnsemblGeneID	HGNC_EnsemblIDsuppliedbyEnsembl	HGNC_Genefamilydescription	HGNC_HGNCID	HGNC_LocusGroup	HGNC_LocusType	HGNC_NameSynonyms	HGNC_OMIMIDsuppliedbyNCBI	HGNC_PreviousNames	HGNC_PreviousSymbols	HGNC_PubmedIDs	HGNC_RecordType	HGNC_RefSeqsuppliedbyNCBI	HGNC_Status	HGNC_Synonyms	HGNC_UCSCIDsuppliedbyUCSC	HGNC_UniProtIDsuppliedbyUniProt	HGNC_VEGAIDs	HGVS_coding_DNA_change	HGVS_genomic_change	HGVS_protein_change	UniProt_alt_uniprot_accessions	annotation_transcript	build	ccds_id	dbNSFP_1000Gp1_AC	dbNSFP_1000Gp1_AF	dbNSFP_1000Gp1_AFR_AC	dbNSFP_1000Gp1_AFR_AF	dbNSFP_1000Gp1_AMR_AC	dbNSFP_1000Gp1_AMR_AF	dbNSFP_1000Gp1_ASN_AC	dbNSFP_1000Gp1_ASN_AF	dbNSFP_1000Gp1_EUR_AC	dbNSFP_1000Gp1_EUR_AF	dbNSFP_Ancestral_allele	dbNSFP_CADD_phred	dbNSFP_CADD_raw	dbNSFP_CADD_raw_rankscore	dbNSFP_ESP6500_AA_AF	dbNSFP_ESP6500_EA_AF	dbNSFP_Ensembl_geneid	dbNSFP_Ensembl_transcriptid	dbNSFP_FATHMM_pred	dbNSFP_FATHMM_rankscore	dbNSFP_FATHMM_score	dbNSFP_GERP_NR	dbNSFP_GERP_RS	dbNSFP_GERP_RS_rankscore	dbNSFP_Interpro_domain	dbNSFP_LRT_Omega	dbNSFP_LRT_converted_rankscore	dbNSFP_LRT_pred	dbNSFP_LRT_score	dbNSFP_LR_pred	dbNSFP_LR_rankscore	dbNSFP_LR_score	dbNSFP_MutationAssessor_pred	dbNSFP_MutationAssessor_rankscore	dbNSFP_MutationAssessor_score	dbNSFP_MutationTaster_converted_rankscore	dbNSFP_MutationTaster_pred	dbNSFP_MutationTaster_score	dbNSFP_Polyphen2_HDIV_pred	dbNSFP_Polyphen2_HDIV_rankscore	dbNSFP_Polyphen2_HDIV_score	dbNSFP_Polyphen2_HVAR_pred	dbNSFP_Polyphen2_HVAR_rankscore	dbNSFP_Polyphen2_HVAR_score	dbNSFP_RadialSVM_pred	dbNSFP_RadialSVM_rankscore	dbNSFP_RadialSVM_score	dbNSFP_Reliability_index	dbNSFP_SIFT_converted_rankscore	dbNSFP_SIFT_pred	dbNSFP_SIFT_score	dbNSFP_SLR_test_statistic	dbNSFP_SiPhy_29way_logOdds	dbNSFP_SiPhy_29way_logOdds_rankscore	dbNSFP_SiPhy_29way_pi	dbNSFP_UniSNP_ids	dbNSFP_Uniprot_aapos	dbNSFP_Uniprot_acc	dbNSFP_Uniprot_id	dbNSFP_aaalt	dbNSFP_aapos	dbNSFP_aapos_FATHMM	dbNSFP_aapos_SIFT	dbNSFP_aaref	dbNSFP_cds_strand	dbNSFP_codonpos	dbNSFP_folddegenerate	dbNSFP_genename	dbNSFP_hg18_pos1coor	dbNSFP_phastCons100way_vertebrate	dbNSFP_phastCons100way_vertebrate_rankscore	dbNSFP_phastCons46way_placental	dbNSFP_phastCons46way_placental_rankscore	dbNSFP_phastCons46way_primate	dbNSFP_phastCons46way_primate_rankscore	dbNSFP_phyloP100way_vertebrate	dbNSFP_phyloP100way_vertebrate_rankscore	dbNSFP_phyloP46way_placental	dbNSFP_phyloP46way_placental_rankscore	dbNSFP_phyloP46way_primate	dbNSFP_phyloP46way_primate_rankscore	dbNSFP_refcodon	gencode_transcript_name	gencode_transcript_status	gencode_transcript_tags	gencode_transcript_type	gene_type	havana_transcript	init_n_lod	init_t_lod	isArtifactMode	n_alt_count	n_ref_count	oxoGCut	pox	pox_cutoff	qox	refseq_mrna_id	t_alt_count	t_lod_fstar	t_ref_count	tumor_f
DAPK1	1612	broad.mit.edu	hg19	9	90321557	90321557	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:90321557G>A	ENST00000469640.2	+	27	4021	c.3646G>A	c.(3646-3648)Ggc>Agc	p.G1216S	DAPK1_ENST00000472284.1_Missense_Mutation_p.G1191S|DAPK1_ENST00000408954.3_Missense_Mutation_p.G1191S|DAPK1_ENST00000358077.5_Missense_Mutation_p.G1191S|DAPK1_ENST00000491893.1_Missense_Mutation_p.G1125S			P53355	DAPK1_HUMAN	death-associated protein kinase 1	1191		apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity	breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72					GGTCAACCACGGCCAGGGCAT	0.642	0	27.0	31.0	29.0	9	90321557	2161	4252	6413	SO:0001583	missense	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730	"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831			8530096	Standard	XM_005251757	Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000491893.1:c.3373G>A	9.37:g.90321557G>A	ENSP00000419026:p.Gly1125Ser	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	ENST00000491893.1	37		.	.	.	.	.	.	.	.	.	.	G	27.6	4.849831	0.91277	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.69040	-0.33;-0.33;-0.34;-0.33;-0.37	5.51	5.51	0.81932	.	0.000000	0.52532	D	0.000061	T	0.81307	0.4795	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72625	0.962;0.978;0.962	T	0.82299	-0.0526	10	0.66056	D	0.02	.	19.4155	0.94694	0.0:0.0:1.0:0.0	.	1125;1191;1191	B7ZLE7;P53355-3;P53355	.;.;DAPK1_HUMAN	S	1191;1191;1216;1191;1125	ENSP00000350785:G1191S;ENSP00000417076:G1191S;ENSP00000418885:G1216S;ENSP00000386135:G1191S;ENSP00000419026:G1125S	ENSP00000350785:G1191S	G	+	1	0	DAPK1	89511377	1.000000	0.71417	0.993000	0.49108	0.885000	0.51271	9.869000	0.99810	2.589000	0.87451	0.561000	0.74099	GGC	DAPK1-011	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000356844.1		42.079985	0	-7	19	0	0	1	0	NM_004938	13	42.476994	7	0.650000
COL4A1	1282	broad.mit.edu	hg19	13	110862385	110862385	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:110862385G>A	ENST00000375820.4	-	10	678	c.557C>T	c.(556-558)cCa>cTa	p.P186L	COL4A1_ENST00000543140.1_Missense_Mutation_p.P186L	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	186	Triple-helical region.	angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		CAGTCCTGGTGGGCCCTAGAA	0.502	0	68.0	72.0	70.0	13	110862385	2203	4300	6503	SO:0001583	missense	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498	"""Collagens"""	2202	protein-coding gene	gene with protein product		120130			3691802	Standard	NM_001845	Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.557C>T	13.37:g.110862385G>A	ENSP00000364979:p.Pro186Leu	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	9.727	1.161313	0.21538	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.97731	-4.51;-4.51	5.0	3.27	0.37495	.	0.762691	0.11760	N	0.532133	D	0.93749	0.8002	L	0.35487	1.065	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.82904	-0.0226	10	0.09084	T	0.74	.	9.6694	0.40004	0.2257:0.0:0.7743:0.0	.	186;186	F5H5K0;P02462	.;CO4A1_HUMAN	L	177;186;186;186	ENSP00000364979:P186L;ENSP00000443348:P186L	ENSP00000364973:P177L	P	-	2	0	COL4A1	109660386	0.000000	0.05858	0.001000	0.08648	0.158000	0.22134	0.770000	0.26618	0.623000	0.30267	0.637000	0.83480	CCA	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		58.854238	0	-10	33	0	0	1	0		18	59.030113	13	0.580645
CDH18	1016	broad.mit.edu	hg19	5	19721471	19721471	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:19721471C>T	ENST00000507958.1	-	7	1618	c.628G>A	c.(628-630)Gtc>Atc	p.V210I	CDH18_ENST00000506372.1_Missense_Mutation_p.V210I|CDH18_ENST00000511273.1_Missense_Mutation_p.V210I|CDH18_ENST00000502796.1_Missense_Mutation_p.V210I|CDH18_ENST00000382275.1_Missense_Mutation_p.V210I|CDH18_ENST00000274170.4_Missense_Mutation_p.V210I			Q13634	CAD18_HUMAN	cadherin 18, type 2	210	Cadherin 2.	adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)				TTAGGGTCGACGGAGAAGTAG	0.448	1	167.0	147.0	154.0	5	19721471	2203	4300	6503	SO:0001583	missense	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526	"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019			9030594, 10191097	Standard	NM_004934	Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000506372.1:c.628G>A	5.37:g.19721471C>T	ENSP00000424931:p.Val210Ile	A8K0I2|B4DHG6|Q8N5Z2	ENST00000506372.1	37		.	.	.	.	.	.	.	.	.	.	C	15.62	2.885980	0.51908	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	N	0.02985	-0.445	0.58432	D	0.999996	B;D	0.89917	0.346;1.0	B;D	0.65443	0.122;0.935	T	0.49688	-0.8913	9	.	.	.	.	17.9639	0.89094	0.0:1.0:0.0:0.0	.	210;210	B4DHG6;Q13634	.;CAD18_HUMAN	I	210;210;210;210;210;210;156;210	ENSP00000371710:V210I;ENSP00000425093:V210I;ENSP00000274170:V210I;ENSP00000424931:V210I;ENSP00000422138:V210I;ENSP00000427383:V156I;ENSP00000425854:V210I	.	V	-	1	0	CDH18	19757228	1.000000	0.71417	0.973000	0.42090	0.311000	0.27955	5.986000	0.70563	2.571000	0.86741	0.650000	0.86243	GTC	CDH18-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366746.1		3.584844	0	-5	117	0	0	1	0	NM_004934	9	19.068723	85	0.095745
ASB11	0	broad.mit.edu	hg19	X	15306030	15306030	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:15306030C>T	ENST00000537676.1	-	6	829	c.757G>A	c.(757-759)Gtg>Atg	p.V253M	ASB11_ENST00000344384.4_Missense_Mutation_p.V253M|ASB11_ENST00000480796.1_Missense_Mutation_p.V274M|ASB11_ENST00000380470.3_Missense_Mutation_p.V257M			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11	274		intracellular signal transduction			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)				GCCTGCTCCACGCTGCTTTTT	0.522	0	99.0	77.0	85.0	X	15306030	2203	4300	6503	SO:0001583	missense	AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192	"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""		24337577	Standard	NM_080873	Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.820G>A	X.37:g.15306030C>T	ENSP00000417914:p.Val274Met	E9PEN1|Q3SYC4|Q7Z667	ENST00000480796.1	37	CCDS14164.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606762	0.66558	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.44	3.68	0.42216	SOCS protein, C-terminal (1);Ankyrin repeat-containing domain (4);	0.195013	0.35970	N	0.002868	T	0.73009	0.3532	L	0.43757	1.38	0.42153	D	0.99156	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.981;0.999;0.999	T	0.70171	-0.4945	10	0.42905	T	0.14	-2.7402	10.2954	0.43620	0.0:0.8372:0.0:0.1628	.	257;274;253	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	M	253;257;253;274	ENSP00000445465:V253M;ENSP00000369837:V257M;ENSP00000343408:V253M;ENSP00000417914:V274M	ENSP00000343408:V253M	V	-	1	0	ASB11	15215951	0.975000	0.34042	0.294000	0.24946	0.937000	0.57800	2.446000	0.44908	0.506000	0.28125	0.523000	0.50628	GTG	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2		10.722547	0	-7	66	0	0	1	0		6	15.651433	35	0.146341
MATN4	8785	broad.mit.edu	hg19	20	43936911	43936911	+	Translation_Start_Site	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:43936911G>A	ENST00000537548.1	-	0	114				MATN4_ENST00000360607.6_De_novo_Start_InFrame|RBPJL_ENST00000343694.3_Intron|MATN4_ENST00000372751.4_De_novo_Start_InFrame|MATN4_ENST00000342716.4_De_novo_Start_InFrame|RBPJL_ENST00000372741.3_Intron|MATN4_ENST00000353917.5_De_novo_Start_InFrame|RBPJL_ENST00000372743.1_Intron			O95460	MATN4_HUMAN	matrilin 4				extracellular region	protein binding	central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)			GCGTGGCAGCGTGCCCTAGGT	0.667	0	28.0	30.0	29.0	20	43936911	2203	4299	6502			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159		6910	protein-coding gene	gene with protein product		603897			9827539, 9027493	Standard	NM_003833	Approved		uc002xnn.2	O95460	OTTHUMG00000033043		20.37:g.43936911G>A		A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	ENST00000360607.6	37	CCDS46607.1																																																																																			MATN4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000472010.1		43.683183	0	0	37	0	0	1	0		13	44.772243	4	0.764706
CCDC8	83987	broad.mit.edu	hg19	19	46915352	46915352	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:46915352G>A	ENST00000307522.3	-	1	1489	c.716C>T	c.(715-717)gCg>gTg	p.A239V		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	239			plasma membrane		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)	GCCCTCTGGCGCCGATGATAC	0.706	0	25.0	30.0	28.0	19	46915352	2195	4292	6487	SO:0001583	missense	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145			11230166	Standard	NM_032040	Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.716C>T	19.37:g.46915352G>A	ENSP00000303158:p.Ala239Val	Q8TB26	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	G	6.410	0.443821	0.12164	.	.	ENSG00000169515	ENST00000307522	T	0.11712	2.75	2.68	-4.27	0.03744	.	4.673350	0.00447	N	0.000097	T	0.02888	0.0086	N	0.00926	-1.1	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.31696	-0.9934	10	0.21014	T	0.42	4.8503	2.6164	0.04905	0.3635:0.0:0.2813:0.3552	.	239	Q9H0W5	CCDC8_HUMAN	V	239	ENSP00000303158:A239V	ENSP00000303158:A239V	A	-	2	0	CCDC8	51607192	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-0.355000	0.07671	-0.839000	0.04212	-0.806000	0.03193	GCG	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1		49.226789	0	7	48	0	0	1	0	NM_032040	18	49.794904	29	0.382979
TRAV40	0	broad.mit.edu	hg19	14	22783266	22783266	+	RNA	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:22783266G>A	ENST00000390467.3	+	0	232																					CTTCGGAGGCGGAAATATTAA	0.458	0	61.0	65.0	63.0	14	22783266	1807	4067	5874			X73521		14q11.2	2012-02-07			ENSG00000211819	ENSG00000211819	"""T cell receptors / TRA locus"""	12141	other	T cell receptor gene					8412327	Standard	NG_001332	Approved	TCRAV31S1, TCRAV40S1			OTTHUMG00000170840		14.37:g.22783266G>A			ENST00000390467.3	37																																																																																				TRAV40-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000410666.1		-1.678593	0	-4	64	0	0	1	0	NG_001332	5	11.300143	64	0.072464
CNTN2	6900	broad.mit.edu	hg19	1	205036303	205036303	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:205036303C>T	ENST00000331830.4	+	16	2334	c.2050C>T	c.(2050-2052)Cgg>Tgg	p.R684W		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	684	Fibronectin type-III 1.	axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		CTATGAGTTCCGGGTCATAGC	0.577	0	89.0	88.0	89.0	1	205036303	2203	4300	6503	SO:0001583	missense	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT	8307567, 8586965	Standard	NM_005076	Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2050C>T	1.37:g.205036303C>T	ENSP00000330633:p.Arg684Trp	P78432|Q5T054	ENST00000331830.4	37	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265336	0.80358	.	.	ENSG00000184144	ENST00000331830	T	0.60920	0.15	5.51	5.51	0.81932	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.45361	D	0.000380	D	0.88284	0.6395	H	0.99806	4.795	0.47621	D	0.999478	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93732	0.7042	10	0.87932	D	0	.	19.014	0.92886	0.0:1.0:0.0:0.0	.	684;575	Q02246;Q68DA2	CNTN2_HUMAN;.	W	684	ENSP00000330633:R684W	ENSP00000330633:R684W	R	+	1	2	CNTN2	203302926	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.472000	0.45136	2.590000	0.87494	0.467000	0.42956	CGG	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3		5.506858	0	8	96	0	0	1	0	NM_005076	6	14.587937	52	0.103448
DUSP11	8446	broad.mit.edu	hg19	2	74002108	74002108	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:74002108G>A	ENST00000443070.1	-	3	387	c.382C>T	c.(382-384)Cga>Tga	p.R128*	DUSP11_ENST00000272444.3_Nonsense_Mutation_p.R128*|DUSP11_ENST00000480948.1_5'UTR|DUSP11_ENST00000377706.4_Nonsense_Mutation_p.R81*			O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	81	Tyrosine-protein phosphatase.	RNA processing	nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|RNA binding	breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12					TTTTGTTCTCGGATTTTGTTA	0.338	1	92.0	95.0	94.0	2	74002108	2203	4300	6503	SO:0001587	stop_gained	AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092			9685386	Standard	NM_003584	Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.382C>T	2.37:g.74002108G>A	ENSP00000272444:p.Arg128*	B2RCT8|Q6AI47|Q9BWE3	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822595	0.32237	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706;ENST00000452812	.	.	.	4.71	0.909	0.19332	.	0.904261	0.09730	N	0.763308	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1216	3.2235	0.06724	0.1599:0.136:0.5637:0.1404	.	.	.	.	X	128;128;81;79	.	ENSP00000272444:R128X	R	-	1	2	DUSP11	73855616	0.998000	0.40836	0.109000	0.21407	0.127000	0.20565	1.602000	0.36783	0.060000	0.16281	-0.137000	0.14449	CGA	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		50.126274	0	-4	53	0	0	1	0		15	50.133778	14	0.517241
CNGA2	1260	broad.mit.edu	hg19	X	150908176	150908176	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:150908176G>A	ENST00000329903.4	+	3	379	c.346G>A	c.(346-348)Gac>Aac	p.D116N		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	116		response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)				TGGCAAAGGCGACAAGGATGG	0.532	0	129.0	97.0	108.0	X	150908176	2203	4300	6503	SO:0001583	missense	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862	"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA	7532814, 16382102	Standard	NM_005140	Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.346G>A	X.37:g.150908176G>A	ENSP00000328478:p.Asp116Asn	A0AVD0	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.482817	0.26598	.	.	ENSG00000183862	ENST00000329903	D	0.97279	-4.32	5.58	-0.754	0.11065	.	0.286206	0.37623	N	0.002004	D	0.89483	0.6728	L	0.29908	0.895	0.25493	N	0.987627	B	0.29766	0.256	B	0.18871	0.023	T	0.80948	-0.1154	10	0.07644	T	0.81	.	5.3436	0.15996	0.309:0.248:0.443:0.0	.	116	Q16280	CNGA2_HUMAN	N	116	ENSP00000328478:D116N	ENSP00000328478:D116N	D	+	1	0	CNGA2	150658832	1.000000	0.71417	0.973000	0.42090	0.445000	0.32107	1.703000	0.37846	-0.301000	0.08882	0.529000	0.55759	GAC	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1		31.175923	0	2	87	0	0	1	0	NM_005140	12	34.080393	37	0.244898
GRIK4	2900	broad.mit.edu	hg19	11	120827588	120827588	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:120827588G>A	ENST00000527524.2	+	16	2087	c.1800G>A	c.(1798-1800)ccG>ccA	p.P600P	GRIK4_ENST00000438375.2_Silent_p.P600P	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	600		glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	TCTGGTTTCCGGTCGGGGGGT	0.642	0	66.0	55.0	59.0	11	120827588	2203	4299	6502	SO:0001819	synonymous_variant	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403	"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK		Standard	NM_001282470	Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1800G>A	11.37:g.120827588G>A		A8K9L1	ENST00000527524.2	37	CCDS8433.1																																																																																			GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4		2.165198	0	-4	51	0	0	1	0	NM_014619	4	9.848179	41	0.088889
ADAD2	161931	broad.mit.edu	hg19	16	84229876	84229876	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:84229876G>A	ENST00000268624.3	+	9	1765	c.1672G>A	c.(1672-1674)Gaa>Aaa	p.E558K	ADAD2_ENST00000315906.5_Missense_Mutation_p.E476K|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_139174.3	NP_631913.3	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	476	A to I editase.	RNA processing	intracellular	adenosine deaminase activity|double-stranded RNA binding	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13					GGCCCCTTCCGAACCCACCCC	0.697	0	38.0	46.0	43.0	16	84229876	2197	4297	6494	SO:0001583	missense	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955		30714	protein-coding gene	gene with protein product						Standard	NM_139174	Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1426G>A	16.37:g.84229876G>A	ENSP00000325153:p.Glu476Lys	B2RCL6|Q8NA94	ENST00000315906.5	37	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	G	8.301	0.819980	0.16678	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.93133	-3.17;-3.17	5.15	-1.94	0.07571	Adenosine deaminase/editase (2);	1.169020	0.06144	N	0.672863	T	0.78207	0.4247	N	0.01464	-0.85	0.09310	N	1	B;B	0.26195	0.142;0.144	B;B	0.14578	0.011;0.009	T	0.68228	-0.5464	10	0.10902	T	0.67	-11.2126	9.1316	0.36848	0.5547:0.0:0.4453:0.0	.	476;558	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	K	476;558	ENSP00000325153:E476K;ENSP00000268624:E558K	ENSP00000268624:E558K	E	+	1	0	ADAD2	82787377	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.435000	0.06931	-0.547000	0.06207	0.655000	0.94253	GAA	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1		13.589305	0	21	99	0	0	1	0	NM_139174	9	20.595369	51	0.150000
IMP4	92856	broad.mit.edu	hg19	2	131103363	131103363	+	Missense_Mutation	SNP	G	G	A	rs11542413		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:131103363G>A	ENST00000259239.3	+	6	1159	c.451G>A	c.(451-453)Gtc>Atc	p.V151I	IMP4_ENST00000409935.1_Missense_Mutation_p.V151I	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)	151	Brix.	rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding	central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)				GGGGCTCATCGTCAGCCACCT	0.647	0	93.0	91.0	92.0	2	131103363	2203	4300	6503	SO:0001583	missense	BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718		30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""		8619474, 9110174, 12655004	Standard	NM_033416	Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.451G>A	2.37:g.131103363G>A	ENSP00000259239:p.Val151Ile	Q3ZTT3	ENST00000259239.3	37	CCDS2160.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	12.80	2.047974	0.36085	.	.	ENSG00000136718	ENST00000259239;ENST00000409935;ENST00000409649;ENST00000428740	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.18	3.39	0.38822	Brix domain (3);Anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.20007	0.0481	N	0.08118	0	0.54753	D	0.99998	B	0.26975	0.165	B	0.28011	0.085	T	0.04708	-1.0932	10	0.09338	T	0.73	-35.085	9.9151	0.41430	0.1672:0.0:0.8328:0.0	rs11542413	151	Q96G21	IMP4_HUMAN	I	151;151;66;96	ENSP00000259239:V151I;ENSP00000386411:V151I;ENSP00000386716:V66I;ENSP00000389701:V96I	ENSP00000259239:V151I	V	+	1	0	IMP4	130819833	0.995000	0.38212	0.998000	0.56505	0.981000	0.71138	2.231000	0.43009	0.701000	0.31803	-0.123000	0.14984	GTC	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254520.2		76.502618	0	-6	66	0	0	1	0	NM_033416	24	76.581633	20	0.545455
RYR2	6262	broad.mit.edu	hg19	1	237870347	237870347	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:237870347C>T	ENST00000366574.2	+	68	9996	c.9679C>T	c.(9679-9681)Cgc>Tgc	p.R3227C	RYR2_ENST00000360064.6_Missense_Mutation_p.R3225C|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.R3211C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3227		cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		GTCCGGCATTCGCTACACTCA	0.473	0	122.0	120.0	121.0	1	237870347	1998	4192	6190	SO:0001583	missense	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626	"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2	2380170, 8406504, 11159936	Standard	NM_001035	Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9679C>T	1.37:g.237870347C>T	ENSP00000355533:p.Arg3227Cys	Q15411|Q546N8|Q5T3P2	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231190	0.79688	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.88586	-0.23;-2.4;-0.23	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000009	D	0.94019	0.8084	M	0.82630	2.6	0.80722	D	1	D	0.76494	0.999	P	0.56960	0.81	D	0.94377	0.7601	10	0.87932	D	0	-11.2401	19.8946	0.96949	0.0:1.0:0.0:0.0	.	3227	Q92736	RYR2_HUMAN	C	3227;3225;3211;182	ENSP00000355533:R3227C;ENSP00000353174:R3225C;ENSP00000443798:R3211C	ENSP00000353174:R3225C	R	+	1	0	RYR2	235936970	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	3.248000	0.51430	2.711000	0.92665	0.655000	0.94253	CGC	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		96.850339	0	18	87	0	0	1	0	NM_001035	30	96.853848	31	0.491803
SGK223	0	broad.mit.edu	hg19	8	8175725	8175725	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:8175725G>A	ENST00000520004.1	-	6	4424	c.4160C>T	c.(4159-4161)gCg>gTg	p.A1387V	SGK223_ENST00000330777.4_Missense_Mutation_p.A1387V			Q86YV5	SG223_HUMAN		1387				ATP binding|non-membrane spanning protein tyrosine kinase activity							CCCGGGCTCCGCAGACGCCAG	0.647	0	37.0	46.0	43.0	8	8175725	2019	4175	6194	SO:0001583	missense																									ENST00000520004.1:c.4160C>T	8.37:g.8175725G>A	ENSP00000428054:p.Ala1387Val	Q8N3N5	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190369	0.78789	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.14516	2.5;2.5	5.48	5.48	0.80851	.	0.054657	0.64402	D	0.000001	T	0.34948	0.0915	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.01613	-1.1312	10	0.87932	D	0	.	18.7301	0.91731	0.0:0.0:1.0:0.0	.	1387	Q86YV5	SG223_HUMAN	V	1387	ENSP00000330930:A1387V;ENSP00000428054:A1387V	ENSP00000330930:A1387V	A	-	2	0	AC068353.1	8213135	1.000000	0.71417	0.163000	0.22734	0.480000	0.33159	9.825000	0.99386	2.748000	0.94277	0.462000	0.41574	GCG	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		54.476626	0	3	54	0	0	1	0		17	54.503808	15	0.531250
KLHL41	10324	broad.mit.edu	hg19	2	170366495	170366495	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:170366495G>A	ENST00000284669.1	+	1	284	c.207G>A	c.(205-207)gcG>gcA	p.A69A	BBS5_ENST00000554017.1_Intron|RP11-724O16.1_ENST00000513963.1_Intron	NM_006063.2	NP_006054.2			kelch-like family member 41												TTGATGAGGCGAAAAAAAAGG	0.393	0	147.0	146.0	146.0	2	170366495	2203	4300	6503	SO:0001819	synonymous_variant	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474	"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10	9655184	Standard	NM_006063	Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.207G>A	2.37:g.170366495G>A		Q53R42	ENST00000284669.1	37	CCDS2234.1																																																																																			KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1		26.755787	0	-8	109	0	0	1	0	NM_006063	15	39.194590	88	0.145631
C2orf54	79919	broad.mit.edu	hg19	2	241829490	241829490	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:241829490C>T	ENST00000307486.8	-	3	477	c.379G>A	c.(379-381)Gac>Aac	p.D127N	C2orf54_ENST00000402775.2_Missense_Mutation_p.D108N|C2orf54_ENST00000388934.4_Missense_Mutation_p.D276N	NM_001282921.1	NP_001269850.1	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	276					haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	TTGACCCGGTCGAGGATGGAG	0.662	0	47.0	56.0	53.0	2	241829490	2096	4219	6315	SO:0001583	missense	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478		26216	protein-coding gene	gene with protein product						Standard	NM_001282921	Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.826G>A	2.37:g.241829490C>T	ENSP00000373586:p.Asp276Asn	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	ENST00000388934.4	37	CCDS42839.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315665	0.60524	.	.	ENSG00000172478	ENST00000402775;ENST00000307486;ENST00000388934	T;T;T	0.07567	3.18;3.18;3.18	3.73	3.73	0.42828	.	0.253393	0.27851	N	0.017592	T	0.26629	0.0651	M	0.72118	2.19	0.33082	D	0.536817	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.97;0.98;0.922	T	0.40683	-0.9550	10	0.87932	D	0	0.7157	14.1323	0.65263	0.0:1.0:0.0:0.0	.	276;127;108	Q08AI8;B3KU29;Q08AI8-3	CB054_HUMAN;.;.	N	108;127;276	ENSP00000385338:D108N;ENSP00000302779:D127N;ENSP00000373586:D276N	ENSP00000302779:D127N	D	-	1	0	C2orf54	241478163	0.954000	0.32549	0.996000	0.52242	0.458000	0.32498	1.500000	0.35682	1.832000	0.53329	0.555000	0.69702	GAC	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324353.1		6.582204	0	11	60	0	0	1	0	NM_024861, NM_001085437	4	9.791090	23	0.148148
SSPO	23145	broad.mit.edu	hg19	7	149515812	149515812	+	RNA	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:149515812C>T	ENST00000378016.2	+	0	11713							A2VEC9	SSPO_HUMAN	SCO-spondin			cell adhesion	extracellular space	peptidase inhibitor activity			Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)		CCCTGCATGGCGCAGCCGCAC	0.687	0	16.0	18.0	17.0	7	149515812	1986	4157	6143			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558		21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""		8743952, 11008217	Standard	NM_198455	Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149515812C>T		Q76B61	ENST00000378016.2	37																																																																																				SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			8.835016	0	11	27	0	0	1	0		5	10.001749	15	0.250000
ELMO2	63916	broad.mit.edu	hg19	20	45000478	45000478	+	Missense_Mutation	SNP	A	A	G			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:45000478A>G	ENST00000372176.1	-	17	1751	c.1283T>C	c.(1282-1284)aTg>aCg	p.M428T	ELMO2_ENST00000439931.2_Missense_Mutation_p.M528T|ELMO2_ENST00000454865.2_Missense_Mutation_p.M248T|ELMO2_ENST00000396391.1_Missense_Mutation_p.M516T|ELMO2_ENST00000352077.2_Missense_Mutation_p.M514T|ELMO2_ENST00000445496.2_Missense_Mutation_p.M333T|ELMO2_ENST00000290246.6_Missense_Mutation_p.M516T			Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	516	ELMO.	apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding	breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)			ATCCTGACTCATCCTCTCAGA	0.547	0	79.0	73.0	75.0	20	45000478	2203	4300	6503	SO:0001583	missense	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598	"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""		11595183	Standard	NM_133171	Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1547T>C	20.37:g.45000478A>G	ENSP00000290246:p.Met516Thr	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	A	5.037	0.192575	0.09599	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000452857;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	4.79	4.79	0.61399	.	0.037568	0.85682	D	0.000000	T	0.25494	0.0620	N	0.20685	0.6	0.80722	D	1	B;B;B;B	0.16802	0.019;0.0;0.008;0.008	B;B;B;B	0.21151	0.016;0.002;0.033;0.024	T	0.07731	-1.0757	10	0.02654	T	1	-26.9287	13.9627	0.64191	1.0:0.0:0.0:0.0	.	528;248;333;516	B4DRL5;B4DZ20;B7Z1S8;Q96JJ3	.;.;.;ELMO2_HUMAN	T	516;428;83;516;528;333;248;514	ENSP00000290246:M516T;ENSP00000361249:M428T;ENSP00000414329:M83T;ENSP00000379673:M516T;ENSP00000396519:M528T;ENSP00000409920:M333T;ENSP00000415641:M248T;ENSP00000326172:M514T	ENSP00000290246:M516T	M	-	2	0	ELMO2	44433885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.087000	0.94110	2.129000	0.65627	0.533000	0.62120	ATG	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1		-2.739875	0	-18	65	0	0	1	0	NM_022086	4	8.392302	54	0.068966
ASCC3	10973	broad.mit.edu	hg19	6	101075824	101075824	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:101075824C>T	ENST00000369162.2	-	28	4759	c.4415G>A	c.(4414-4416)cGa>cAa	p.R1472Q		NM_006828.2	NP_006819.2	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit 3	1472	Helicase ATP-binding 2.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding	breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)	AAAATTTGTTCGAGATACAAT	0.393	0	108.0	105.0	106.0	6	101075824	2203	4300	6503	SO:0001583	missense	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249		18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1	10218103	Standard	NM_006828	Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4415G>A	6.37:g.101075824C>T	ENSP00000358159:p.Arg1472Gln	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	35	5.466401	0.96257	.	.	ENSG00000112249	ENST00000369162	T	0.15372	2.43	6.17	6.17	0.99709	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58148	0.2102	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73282	-0.4032	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1472	Q8N3C0	HELC1_HUMAN	Q	1472	ENSP00000358159:R1472Q	ENSP00000358159:R1472Q	R	-	2	0	ASCC3	101182545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGA	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2		10.520426	0	2	54	0	0	1	0	NM_006828	6	15.917413	37	0.139535
EDN1	1906	broad.mit.edu	hg19	6	12292598	12292598	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:12292598C>T	ENST00000379375.5	+	2	356	c.89C>T	c.(88-90)gCg>gTg	p.A30V		NM_001168319.1|NM_001955.4	NP_001161791.1|NP_001946.3	P05305	EDN1_HUMAN	endothelin 1	30		artery smooth muscle contraction|calcium-mediated signaling|leukocyte activation|negative regulation of blood coagulation|negative regulation of cellular protein metabolic process|negative regulation of nitric-oxide synthase biosynthetic process|negative regulation of transcription from RNA polymerase II promoter|nitric oxide transport|peptide hormone secretion|phosphatidylinositol 3-kinase cascade|positive regulation of cardiac muscle hypertrophy|positive regulation of cell size|positive regulation of endothelial cell migration|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of JUN kinase activity|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of sarcomere organization|positive regulation of smooth muscle cell proliferation|prostaglandin biosynthetic process|protein kinase C deactivation|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	cytoplasm|extracellular space	cytokine activity|endothelin A receptor binding|endothelin B receptor binding|hormone activity	endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	13	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)			GAGCTCAGCGCGGTGGGTGAG	0.612	0	76.0	83.0	81.0	6	12292598	2202	4300	6502	SO:0001583	missense	S56805	CCDS4522.1	6p24.1	2014-03-19			ENSG00000078401	ENSG00000078401	"""Endogenous ligands"""	3176	protein-coding gene	gene with protein product		131240				Standard	NM_001168319	Approved	ET1	uc003nae.4	P05305	OTTHUMG00000014266	ENST00000379375.5:c.89C>T	6.37:g.12292598C>T	ENSP00000368683:p.Ala30Val	Q96DA1	ENST00000379375.5	37	CCDS4522.1	.	.	.	.	.	.	.	.	.	.	c	16.04	3.009757	0.54361	.	.	ENSG00000078401	ENST00000379375	D	0.84589	-1.87	5.99	3.31	0.37934	.	0.739422	0.13381	N	0.392146	T	0.51517	0.1679	N	0.08118	0	0.09310	N	1	B;B	0.18863	0.031;0.031	B;B	0.16289	0.015;0.015	T	0.44787	-0.9305	10	0.35671	T	0.21	-16.9053	9.9686	0.41741	0.0:0.793:0.0:0.207	.	30;30	Q6FH53;P05305	.;EDN1_HUMAN	V	30	ENSP00000368683:A30V	ENSP00000368683:A30V	A	+	2	0	EDN1	12400584	0.026000	0.19158	0.005000	0.12908	0.069000	0.16628	2.895000	0.48648	0.450000	0.26774	-0.119000	0.15052	GCG	EDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039872.1		-14.314068	0	-17	138	0	0	1	0	NM_001955	5	9.684012	104	0.045872
KIAA1919	91749	broad.mit.edu	hg19	6	111583554	111583554	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:111583554G>A	ENST00000368847.4	+	2	475	c.122G>A	c.(121-123)cGt>cAt	p.R41H		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	41		carbohydrate transport|sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)	TTTGTGGGTCGTGCCTTGGGA	0.383	0	371.0	349.0	357.0	6	111583554	2203	4300	6503	SO:0001583	missense	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214		21053	protein-coding gene	gene with protein product						Standard	NM_153369	Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.122G>A	6.37:g.111583554G>A	ENSP00000357840:p.Arg41His	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	ENST00000368847.4	37	CCDS5090.1	.	.	.	.	.	.	.	.	.	.	G	35	5.535304	0.96460	.	.	ENSG00000173214	ENST00000368847	T	0.57436	0.4	6.04	6.04	0.98038	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73414	-0.3990	10	0.66056	D	0.02	-13.4087	20.1743	0.98175	0.0:0.0:1.0:0.0	.	41	Q5TF39	NAGT1_HUMAN	H	41	ENSP00000357840:R41H	ENSP00000357840:R41H	R	+	2	0	KIAA1919	111690247	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.546000	0.90661	2.873000	0.98535	0.561000	0.74099	CGT	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1		159.145812	0	-27	208	0	0	1	0	NM_153369	56	164.720642	123	0.312849
FAT2	2196	broad.mit.edu	hg19	5	150891882	150891882	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:150891882C>T	ENST00000261800.5	-	20	11761	c.11749G>A	c.(11749-11751)Gtg>Atg	p.V3917M	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3917	Laminin G-like.	epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		TCGTTGACCACGACAGCATCC	0.592	0	78.0	75.0	76.0	5	150891882	2203	4300	6503	SO:0001583	missense	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570	"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""		9693030	Standard	NM_001447	Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11749G>A	5.37:g.150891882C>T	ENSP00000261800:p.Val3917Met	O75091|Q9NSR7	ENST00000261800.5	37	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.155|3.155	-0.173462|-0.173462	0.06421|0.06421	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.78707	.|-1.2	5.16|5.16	-5.74|-5.74	0.02391|0.02391	.|Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.|1.420810	.|0.04654	.|N	.|0.407616	T|T	0.62502|0.62502	0.2433|0.2433	N|N	0.25647|0.25647	0.755|0.755	0.09310|0.09310	N|N	1|1	.|B;B	.|0.19445	.|0.036;0.019	.|B;B	.|0.19148	.|0.024;0.002	T|T	0.48658|0.48658	-0.9016|-0.9016	5|10	.|0.33141	.|T	.|0.24	.|.	8.2577|8.2577	0.31766|0.31766	0.1709:0.3172:0.0:0.5119|0.1709:0.3172:0.0:0.5119	.|.	.|3917;1022	.|Q9NYQ8;E9PDJ8	.|FAT2_HUMAN;.	H|M	689|3917	.|ENSP00000261800:V3917M	.|ENSP00000261800:V3917M	R|V	-|-	2|1	0|0	FAT2|FAT2	150872075|150872075	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.311000|0.311000	0.27955|0.27955	-1.725000|-1.725000	0.01863|0.01863	-1.472000|-1.472000	0.01883|0.01883	-2.636000|-2.636000	0.00152|0.00152	CGT|GTG	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1		4.775173	0	-7	58	0	0	1	0	NM_001447	4	9.662167	30	0.117647
XRCC2	7516	broad.mit.edu	hg19	7	152345797	152345797	+	Missense_Mutation	SNP	C	C	T	rs149186933		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:152345797C>T	ENST00000359321.1	-	3	858	c.773G>A	c.(772-774)cGt>cAt	p.R258H	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	258		meiosis	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity	NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)	TTTTAAACAACGTGAAACTAA	0.333	1	85.0	90.0	89.0	7	152345797	2203	4300	6503	SO:0001583	missense	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584		12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375			7607692, 10422536	Standard	NM_005431	Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.773G>A	7.37:g.152345797C>T	ENSP00000352271:p.Arg258His	B2R925	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	C	6.232	0.410989	0.11812	0.0	1.16E-4	ENSG00000196584	ENST00000359321	T	0.66099	-0.19	5.29	1.47	0.22746	.	0.634660	0.16755	N	0.200854	T	0.53334	0.1790	L	0.57536	1.79	0.24281	N	0.995205	B	0.12630	0.006	B	0.06405	0.002	T	0.41770	-0.9490	10	0.28530	T	0.3	-13.3511	9.4934	0.38974	0.0:0.7092:0.0:0.2908	.	258	O43543	XRCC2_HUMAN	H	258	ENSP00000352271:R258H	ENSP00000352271:R258H	R	-	2	0	XRCC2	151976730	0.978000	0.34361	0.943000	0.38184	0.129000	0.20672	0.387000	0.20718	0.248000	0.21435	-0.262000	0.10625	CGT	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1		-1.442304	0	-15	77	0	0	1	0	NM_005431	4	7.826355	47	0.078431
WDR27	253769	broad.mit.edu	hg19	6	170068142	170068142	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:170068142G>A	ENST00000333572.6	-	5	1115	c.596C>T	c.(595-597)gCg>gTg	p.A199V	WDR27_ENST00000423258.1_Intron|WDR27_ENST00000420344.2_Intron|WDR27_ENST00000448612.1_Missense_Mutation_p.A199V			A2RRH5	WDR27_HUMAN	WD repeat domain 27	169					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)	GAACTCCACCGCAGTCACCGG	0.632	0	66.0	78.0	74.0	6	170068142	2072	4197	6269	SO:0001583	missense	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465	"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product						Standard	NM_182552	Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.596C>T	6.37:g.170068142G>A	ENSP00000416289:p.Ala199Val	A5PLM8|C9JGV0|Q5T066	ENST00000448612.1	37	CCDS47520.2	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660163	0.88154	0.0	1.19E-4	ENSG00000184465	ENST00000448612;ENST00000333572	T;T	0.61859	0.07;0.07	5.24	5.24	0.73138	.	0.080255	0.48767	D	0.000172	T	0.67392	0.2888	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69307	0.95;0.963	T	0.70726	-0.4793	10	0.72032	D	0.01	-20.5923	17.5919	0.87999	0.0:0.0:1.0:0.0	.	199;199	F2Z2U5;C9JGV0	.;.	V	199	ENSP00000416289:A199V;ENSP00000330265:A199V	ENSP00000330265:A199V	A	-	2	0	WDR27	169810067	0.988000	0.35896	0.057000	0.19452	0.910000	0.53928	4.845000	0.62853	2.452000	0.82932	0.650000	0.86243	GCG	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1		18.012097	0	2	30	0	0	1	0	NM_182552	7	19.602425	21	0.250000
KPNB1	3837	broad.mit.edu	hg19	17	45742469	45742469	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:45742469C>T	ENST00000290158.4	+	9	1351	c.944C>T	c.(943-945)gCg>gTg	p.A315V	KPNB1_ENST00000537679.1_Intron|KPNB1_ENST00000540627.1_Missense_Mutation_p.A170V|KPNB1_ENST00000535458.2_Missense_Mutation_p.A170V	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	315		DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding	breast(1)|ovary(1)|pancreas(1)|skin(1)	4					AAGTTTTATGCGAAGGGAGCA	0.458	0	99.0	91.0	94.0	17	45742469	2203	4300	6503	SO:0001583	missense	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424	"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738			7615630, 7627554	Standard	NM_002265	Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000540627.1:c.509C>T	17.37:g.45742469C>T	ENSP00000438964:p.Ala170Val	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	ENST00000540627.1	37		.	.	.	.	.	.	.	.	.	.	C	28.1	4.887823	0.91814	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627	T;T;T	0.68331	-0.32;-0.32;-0.32	5.98	5.98	0.97165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	M	0.62154	1.92	0.40003	D	0.975197	D	0.64830	0.994	B	0.39531	0.302	T	0.68938	-0.5277	9	0.36615	T	0.2	-4.2011	20.4561	0.99145	0.0:1.0:0.0:0.0	.	315	Q14974	IMB1_HUMAN	V	170;315;170	ENSP00000438253:A170V;ENSP00000290158:A315V;ENSP00000438964:A170V	ENSP00000290158:A315V	A	+	2	0	KPNB1	43097468	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.847000	0.97988	0.591000	0.81541	GCG	KPNB1-003	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000441351.1		8.685645	0	5	44	0	0	1	0	NM_002265	4	10.993975	19	0.173913
MSR1	0	broad.mit.edu	hg19	8	16012621	16012621	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:16012621G>A	ENST00000350896.3	-	6	1047	c.850C>T	c.(850-852)Cga>Tga	p.R284*	MSR1_ENST00000262101.5_Nonsense_Mutation_p.R284*|MSR1_ENST00000536385.1_Nonsense_Mutation_p.R58*|MSR1_ENST00000355282.2_Nonsense_Mutation_p.R284*|MSR1_ENST00000381998.4_Nonsense_Mutation_p.R284*|MSR1_ENST00000445506.2_Nonsense_Mutation_p.R302*	NM_138715.2|NM_138716.2	NP_619729.1|NP_619730.1	P21757	MSRE_HUMAN	macrophage scavenger receptor 1	284	Collagen-like.	cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity	haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)	GTGGGACCTCGATCTCCTTTT	0.393	0	69.0	69.0	69.0	8	16012621	2203	4300	6503	SO:0001587	stop_gained	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945	"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622			2251254	Standard	NM_138715	Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000445506.2:c.904C>T	8.37:g.16012621G>A	ENSP00000405453:p.Arg302*	D3DSP3|O60505|P21759|Q45F10	ENST00000445506.2	37		.	.	.	.	.	.	.	.	.	.	G	28.1	4.894614	0.91962	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000522672;ENST00000381998;ENST00000536385	.	.	.	4.87	0.814	0.18756	.	0.329552	0.26032	N	0.026754	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5783	0.50877	0.0:0.0:0.5001:0.4999	.	.	.	.	X	284;284;302;284;74;284;58	.	ENSP00000262101:R284X	R	-	1	2	MSR1	16056992	0.409000	0.25368	0.953000	0.39169	0.259000	0.26198	0.384000	0.20668	0.379000	0.24794	-0.284000	0.09977	CGA	MSR1-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000375985.1		-0.842896	0	9	58	0	0	1	0		4	9.218738	50	0.074074
PPL	5493	broad.mit.edu	hg19	16	4933601	4933601	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:4933601G>A	ENST00000345988.2	-	22	5144	c.5055C>T	c.(5053-5055)ttC>ttT	p.F1685F	PPL_ENST00000590782.2_Silent_p.F1683F	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1685		keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62					TGAGTTTCACGAACATGTTCC	0.592	0	73.0	66.0	69.0	16	4933601	2197	4300	6497	SO:0001819	synonymous_variant	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898		9273	protein-coding gene	gene with protein product		602871			9570964, 9521878	Standard	NM_002705	Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.5055C>T	16.37:g.4933601G>A		O60314|O60454|Q14C98	ENST00000345988.2	37	CCDS10526.1																																																																																			PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1		50.000251	0	3	47	0	0	1	0	NM_002705	16	50.007247	15	0.516129
GIP	2695	broad.mit.edu	hg19	17	47041771	47041771	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:47041771G>A	ENST00000357424.2	-	3	258	c.158C>T	c.(157-159)gCg>gTg	p.A53V		NM_004123.2	NP_004114.1	P09681	GIP_HUMAN	gastric inhibitory polypeptide	53		energy reserve metabolic process|signal transduction	extracellular region|soluble fraction	hormone activity	lung(2)|skin(1)|stomach(1)	4					AGTCCCTTCCGCGTACCTGGG	0.552	0	150.0	129.0	136.0	17	47041771	2203	4300	6503	SO:0001583	missense		CCDS11542.1	17q21.3-q22	2013-02-26			ENSG00000159224	ENSG00000159224	"""Endogenous ligands"""	4270	protein-coding gene	gene with protein product	"""glucose-dependent insulinotropic polypeptide"""	137240			2739653	Standard	NM_004123	Approved		uc002iol.1	P09681	OTTHUMG00000161171	ENST00000357424.2:c.158C>T	17.37:g.47041771G>A	ENSP00000350005:p.Ala53Val	Q4VB42|Q6NTD3	ENST00000357424.2	37	CCDS11542.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048167	0.93740	0.0	1.16E-4	ENSG00000159224	ENST00000357424	T	0.55234	0.53	5.32	5.32	0.75619	Glucagon/GIP/secretin/VIP (3);	0.109714	0.41097	D	0.000945	T	0.72479	0.3465	M	0.78344	2.41	0.36540	D	0.871212	D	0.89917	1.0	D	0.91635	0.999	T	0.79205	-0.1899	10	0.72032	D	0.01	-13.4303	14.357	0.66745	0.0:0.0:1.0:0.0	.	53	P09681	GIP_HUMAN	V	53	ENSP00000350005:A53V	ENSP00000350005:A53V	A	-	2	0	GIP	44396770	0.714000	0.27936	0.596000	0.28811	0.500000	0.33767	4.738000	0.62073	2.769000	0.95229	0.563000	0.77884	GCG	GIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364044.1		34.391749	0	-20	87	0	0	1	0	NM_004123	15	38.341159	48	0.238095
IL25	0	broad.mit.edu	hg19	14	23845042	23845042	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:23845042C>T	ENST00000329715.2	+	2	745	c.487C>T	c.(487-489)Cgt>Tgt	p.R163C	IL25_ENST00000397242.2_Missense_Mutation_p.R147C	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	163		inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding	NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)	CAGGCTGTACCGTGTTTCCTT	0.612	0	157.0	142.0	147.0	14	23845042	2203	4300	6503	SO:0001583	missense	AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090	"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E	11058597, 11754819	Standard	NM_172314	Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.487C>T	14.37:g.23845042C>T	ENSP00000328111:p.Arg163Cys	Q2M3F0|Q8IZV3|Q8WXB0	ENST00000329715.2	37	CCDS9597.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062144	0.76187	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.56275	0.47;0.47	4.58	4.58	0.56647	.	0.391738	0.22245	N	0.062631	T	0.61464	0.2349	L	0.54323	1.7	0.47153	D	0.999339	D;D	0.76494	0.999;0.998	P;P	0.57679	0.825;0.742	T	0.63093	-0.6714	10	0.54805	T	0.06	-10.6501	12.7393	0.57241	0.0:1.0:0.0:0.0	.	163;147	Q9H293;Q9H293-2	IL25_HUMAN;.	C	147;163	ENSP00000380417:R147C;ENSP00000328111:R163C	ENSP00000328111:R163C	R	+	1	0	IL25	22914882	0.987000	0.35691	0.980000	0.43619	0.983000	0.72400	3.627000	0.54252	2.405000	0.81733	0.561000	0.74099	CGT	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2		96.153702	0	-9	86	0	0	1	0		30	96.153702	30	0.500000
SMARCA4	6597	broad.mit.edu	hg19	19	11132513	11132513	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:11132513C>T	ENST00000358026.2	+	19	3013	c.2729C>T	c.(2728-2730)aCg>aTg	p.T910M	SMARCA4_ENST00000541122.2_Missense_Mutation_p.T910M|SMARCA4_ENST00000344626.4_Missense_Mutation_p.T910M|SMARCA4_ENST00000413806.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000444061.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000450717.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000590574.1_Missense_Mutation_p.T910M|SMARCA4_ENST00000429416.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000589677.1_Missense_Mutation_p.T910M	NM_001128849.1	NP_001122321.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	910	Helicase ATP-binding.	chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)			CTGCTGCTGACGGGCACACCG	0.592	7	88.0	68.0	75.0	19	11132513	2203	4300	6503	SO:0001583	missense	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616		11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4	8208605	Standard	NM_003072	Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000541122.2:c.2729C>T	19.37:g.11132513C>T	ENSP00000445036:p.Thr910Met	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	ENST00000541122.2	37	CCDS45972.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061387	0.55432	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	4.51	4.51	0.55191	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.98507	4.25	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.998;0.998;0.996;0.994;1.0;0.998;0.998	D	0.98869	1.0765	10	0.87932	D	0	-34.7546	16.1519	0.81629	0.0:1.0:0.0:0.0	.	910;910;910;910;910;130;910;910	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	M	910;910;974;910;910;910;910;910	ENSP00000395654:T910M;ENSP00000350720:T910M;ENSP00000343896:T910M;ENSP00000445036:T910M;ENSP00000392837:T910M;ENSP00000397783:T910M;ENSP00000414727:T910M	ENSP00000343896:T910M	T	+	2	0	SMARCA4	10993513	1.000000	0.71417	0.968000	0.41197	0.009000	0.06853	7.651000	0.83577	2.348000	0.79779	0.655000	0.94253	ACG	SMARCA4-005	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403237.2		47.058297	0	2	40	0	0	1	0	NM_003072	14	48.022083	5	0.736842
ZNF503	84858	broad.mit.edu	hg19	10	77158605	77158605	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:77158605C>T	ENST00000372524.4	-	2	2329	c.1843G>A	c.(1843-1845)Gcc>Acc	p.A615T	ZNF503_ENST00000535216.1_Missense_Mutation_p.A615T|RP11-399K21.11_ENST00000418818.2_lincRNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	615		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)				GGCACGGGGGCGCCAGGCGTG	0.726	0	8.0	10.0	10.0	10	77158605	2175	4252	6427	SO:0001583	missense	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655	"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902			12477932	Standard	NM_032772	Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1843G>A	10.37:g.77158605C>T	ENSP00000361602:p.Ala615Thr	Q8NAC5|Q96E25|Q96IJ0	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862163	0.91511	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.51071	0.72;0.72	4.6	4.6	0.57074	.	0.057511	0.64402	D	0.000002	T	0.41465	0.1160	L	0.44542	1.39	0.80722	D	1	D	0.57899	0.981	B	0.40066	0.318	T	0.43605	-0.9381	10	0.40728	T	0.16	-12.78	17.6259	0.88093	0.0:1.0:0.0:0.0	.	615	Q96F45	ZN503_HUMAN	T	615;615;578	ENSP00000361602:A615T;ENSP00000438988:A615T	ENSP00000361594:A578T	A	-	1	0	ZNF503	76828611	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.779000	0.62375	2.376000	0.81061	0.643000	0.83706	GCC	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1		10.100975	0	2	9	0	0	1	0	NM_032772	4	10.279114	7	0.363636
OBSCN	84033	broad.mit.edu	hg19	1	228505446	228505446	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:228505446C>T	ENST00000570156.2	+	63	16788	c.16714C>T	c.(16714-16716)Cgg>Tgg	p.R5572W	OBSCN_ENST00000422127.1_Missense_Mutation_p.R4615W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1734W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2249W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4615W	NM_001271223.2	NP_001258152.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4615		apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)			CCAGACAGTGCGGCTTGGTGA	0.672	0	47.0	54.0	51.0	1	228505446	1980	4022	6002	SO:0001583	missense	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358	"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616			11448995, 11814696	Standard	NM_001098623	Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000570156.2:c.16714C>T	1.37:g.228505446C>T	ENSP00000455507:p.Arg5572Trp	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	ENST00000570156.2	37	CCDS59204.1	.	.	.	.	.	.	.	.	.	.	c	14.63	2.592383	0.46214	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	4.51	-2.93	0.05598	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.955998	0.08623	N	0.918149	T	0.51075	0.1653	N	0.22421	0.69	0.09310	N	0.99999	D;D	0.65815	0.991;0.995	B;P	0.50049	0.425;0.629	T	0.56050	-0.8043	10	0.66056	D	0.02	.	14.1853	0.65601	0.1629:0.7445:0.0:0.0926	.	4615;4615	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4615;4615;2249;1734	ENSP00000284548:R4615W;ENSP00000409493:R4615W;ENSP00000355668:R2249W;ENSP00000355670:R1734W	ENSP00000284548:R4615W	R	+	1	2	OBSCN	226572069	0.922000	0.31269	0.001000	0.08648	0.163000	0.22366	0.812000	0.27211	-0.757000	0.04697	0.479000	0.44913	CGG	OBSCN-011	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000421354.3		74.495366	0	-25	66	0	0	1	0	NM_052843	24	74.640133	30	0.444444
DEPDC5	9681	broad.mit.edu	hg19	22	32239098	32239098	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:32239098C>T	ENST00000400246.1	+	28	2675	c.2533C>T	c.(2533-2535)Cgc>Tgc	p.R845C	DEPDC5_ENST00000400248.2_Missense_Mutation_p.R836C|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R767C|DEPDC5_ENST00000382111.2_Missense_Mutation_p.R845C|DEPDC5_ENST00000382105.2_Missense_Mutation_p.R767C|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R836C|DEPDC5_ENST00000382112.3_Missense_Mutation_p.R836C|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R845C			O75140	DEPD5_HUMAN	DEP domain containing 5	836		intracellular signal transduction			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63					GTCCCGAAACCGCCCTGAGGA	0.443	0	90.0	83.0	85.0	22	32239098	1963	4156	6119	SO:0001583	missense	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150		18423	protein-coding gene	gene with protein product		614191			23542697, 23542701	Standard	NM_001242896	Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2506C>T	22.37:g.32239098C>T	ENSP00000371546:p.Arg836Cys	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	ENST00000382112.3	37	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.06|19.06	3.754560|3.754560	0.69648|0.69648	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.|T;T;T;T;T;T;T;T	.|0.22945	.|1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.68|5.68	4.64|4.64	0.57946|0.57946	.|.	.|0.060343	.|0.64402	.|D	.|0.000002	T|T	0.42988|0.42988	0.1227|0.1227	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;0.999;0.999	.|D;P;P;P;P;P	.|0.79108	.|0.992;0.891;0.891;0.897;0.719;0.791	T|T	0.28522|0.28522	-1.0041|-1.0041	5|10	.|0.54805	.|T	.|0.06	.|.	10.0209|10.0209	0.42041|0.42041	0.2636:0.6052:0.1312:0.0|0.2636:0.6052:0.1312:0.0	.|.	.|166;845;767;845;836;836	.|B4DSS1;B9EGN9;B4DH93;O75140-4;A8MPX9;O75140	.|.;.;.;.;.;DEPD5_HUMAN	L|C	242|767;845;836;767;845;767;836;845;836	.|ENSP00000440210:R767C;ENSP00000266091:R845C;ENSP00000383108:R836C;ENSP00000383105:R845C;ENSP00000371539:R767C;ENSP00000371546:R836C;ENSP00000371545:R845C;ENSP00000383107:R836C	.|ENSP00000266091:R845C	P|R	+|+	2|1	0|0	DEPDC5|DEPDC5	30569098|30569098	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	2.022000|2.022000	0.41030|0.41030	1.366000|1.366000	0.46076|0.46076	0.655000|0.655000	0.94253|0.94253	CCG|CGC	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1		10.518738	0	7	60	0	0	1	0	NM_014662	6	16.389938	39	0.133333
RGAG4	340526	broad.mit.edu	hg19	X	71349781	71349781	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:71349781C>T	ENST00000545866.1	-	1	1977	c.1610G>A	c.(1609-1611)cGt>cAt	p.R537H	RGAG4_ENST00000609883.1_Missense_Mutation_p.R537H|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	537					cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)				TTGTCCTAAACGACCTGTGCG	0.587	0	46.0	49.0	48.0	X	71349781	1941	4120	6061	SO:0001583	missense	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732		29430	protein-coding gene	gene with protein product					12056414, 15716091, 16093683	Standard	NM_001024455	Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1610G>A	X.37:g.71349781C>T	ENSP00000441366:p.Arg537His	A7E2W7|Q8NCM4|Q9NPX1	ENST00000545866.1	37	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	C	8.948	0.967446	0.18659	0.001208	0.0	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.17213	2.29;2.29	4.11	3.25	0.37280	.	.	.	.	.	T	0.08179	0.0204	N	0.19112	0.55	0.09310	N	0.999999	P	0.47106	0.89	B	0.33568	0.166	T	0.18335	-1.0340	8	.	.	.	-4.5822	6.6381	0.22895	0.0:0.8701:0.0:0.1299	.	537	Q5HYW3	RGAG4_HUMAN	H	537	ENSP00000441366:R537H;ENSP00000418667:R537H	.	R	-	2	0	RGAG4	71266506	0.874000	0.30092	0.303000	0.25071	0.041000	0.13682	0.315000	0.19451	1.085000	0.41206	0.513000	0.50165	CGT	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1		4.978184	0	-9	34	0	0	1	0	NM_001024455	4	9.133811	27	0.129032
NCR3	259197	broad.mit.edu	hg19	6	31557652	31557652	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:31557652G>A	ENST00000376073.4	-	2	558	c.295C>T	c.(295-297)Cga>Tga	p.R99*	NCR3_ENST00000376072.3_Nonsense_Mutation_p.R99*|NCR3_ENST00000376071.4_Nonsense_Mutation_p.R74*|NCR3_ENST00000340027.5_Nonsense_Mutation_p.R99*|NCR3_ENST00000491161.1_5'UTR	NM_001145466.1	NP_001138938.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	99	Ig-like.	cell recognition|immune response|inflammatory response|positive regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane	receptor activity	cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9					TCATGGCCTCGCACGTCCCGG	0.622	0	139.0	128.0	132.0	6	31557652	1511	2709	4220	SO:0001587	stop_gained	AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117	8824804, 11782277	Standard	NM_001145466	Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.295C>T	6.37:g.31557652G>A	ENSP00000342156:p.Arg99*	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	ENST00000340027.5	37	CCDS34397.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628979	0.67015	.	.	ENSG00000204475	ENST00000340027;ENST00000376073;ENST00000376072;ENST00000376071	.	.	.	4.01	0.804	0.18697	.	1.405150	0.04900	N	0.451210	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	8.3211	2.3291	0.04231	0.112:0.1902:0.5027:0.1951	.	.	.	.	X	99;99;99;74	.	ENSP00000342156:R99X	R	-	1	2	NCR3	31665631	0.000000	0.05858	0.000000	0.03702	0.265000	0.26407	-0.031000	0.12287	0.403000	0.25479	0.585000	0.79938	CGA	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2		106.346677	0	-11	99	0	0	1	0		34	106.374175	37	0.478873
UTRN	7402	broad.mit.edu	hg19	6	144814587	144814587	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:144814587G>A	ENST00000367545.3	+	32	4588	c.4588G>A	c.(4588-4590)Gca>Aca	p.A1530T		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1530	Interaction with SYNM.	muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	TGACCTGGGCGCACAGGTGAG	0.468	0	72.0	62.0	65.0	6	144814587	2203	4300	6503	SO:0001583	missense	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818		12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL	1426262	Standard	NM_007124	Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.4588G>A	6.37:g.144814587G>A	ENSP00000356515:p.Ala1530Thr	Q5SYY1|Q5SZ57|Q9UJ40	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617554	0.87359	.	.	ENSG00000152818	ENST00000367545	T	0.35421	1.31	5.32	5.32	0.75619	.	0.000000	0.52532	D	0.000080	T	0.49932	0.1586	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.32955	-0.9887	10	0.29301	T	0.29	.	19.0104	0.92871	0.0:0.0:1.0:0.0	.	1530	P46939	UTRO_HUMAN	T	1530	ENSP00000356515:A1530T	ENSP00000356515:A1530T	A	+	1	0	UTRN	144856280	1.000000	0.71417	0.937000	0.37676	0.740000	0.42216	6.605000	0.74155	2.487000	0.83934	0.655000	0.94253	GCA	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		60.922463	0	-2	43	0	0	1	0		19	61.712194	9	0.678571
MAP3K5	4217	broad.mit.edu	hg19	6	136888863	136888863	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:136888863C>T	ENST00000359015.4	-	26	4027	c.3667G>A	c.(3667-3669)Gtg>Atg	p.V1223M	MAP3K5_ENST00000355845.4_Missense_Mutation_p.V470M	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1223		activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	AGCGTGCTCACGCCTGAGGTA	0.468	0	138.0	105.0	116.0	6	136888863	2203	4300	6503	SO:0001583	missense	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5	9465908	Standard	NM_005923	Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3667G>A	6.37:g.136888863C>T	ENSP00000351908:p.Val1223Met	A6NIA0|B4DGB2|Q5THN3|Q99461	ENST00000359015.4	37	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333670	0.81801	.	.	ENSG00000197442	ENST00000359015;ENST00000355845	T;T	0.73363	-0.58;-0.74	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.82291	0.5005	M	0.68952	2.095	0.58432	D	0.999999	D;D	0.89917	0.996;1.0	P;D	0.80764	0.818;0.994	T	0.79841	-0.1633	10	0.35671	T	0.21	.	19.1483	0.93477	0.0:1.0:0.0:0.0	.	1304;1223	Q59GL6;Q99683	.;M3K5_HUMAN	M	1223;470	ENSP00000351908:V1223M;ENSP00000348104:V470M	ENSP00000348104:V470M	V	-	1	0	MAP3K5	136930556	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.263000	0.78421	2.513000	0.84729	0.561000	0.74099	GTG	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		8.154027	0	-3	40	0	0	1	0		5	11.765302	27	0.156250
IGHV3-16	0	broad.mit.edu	hg19	14	106622014	106622014	+	RNA	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:106622014C>T	ENST00000390604.2	-	0	304																					CCACATAGTGCGTCCTACTGC	0.537	0	190.0	171.0	177.0	14	106622014	1934	4141	6075			M99655		14q32.33	2012-02-08	2008-08-22		ENSG00000211944	ENSG00000211944	"""Immunoglobulins / IGH locus"""	5583	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-16"""			Standard	NG_001019	Approved				OTTHUMG00000152273		14.37:g.106622014C>T			ENST00000390604.2	37																																																																																				IGHV3-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000325661.1		221.001851	0	-147	106	0	0	1	0	NG_001019	63	227.835675	3	0.954545
CSMD1	64478	broad.mit.edu	hg19	8	3263583	3263583	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:3263583G>A	ENST00000602557.1	-	16	2790	c.2235C>T	c.(2233-2235)aaC>aaT	p.N745N	CSMD1_ENST00000400186.3_Silent_p.N745N|CSMD1_ENST00000539096.1_Silent_p.N744N|CSMD1_ENST00000602723.1_Silent_p.N745N|CSMD1_ENST00000542608.1_Silent_p.N744N|CSMD1_ENST00000520002.1_Silent_p.N745N|CSMD1_ENST00000537824.1_Silent_p.N744N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	745	Sushi 4.		integral to membrane		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	TCCAGACCACGTTCCCGTCTT	0.552	0	60.0	61.0	60.0	8	3263583	1982	4173	6155	SO:0001819	synonymous_variant			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397				Standard	NM_033225	Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2235C>T	8.37:g.3263583G>A		Q0H0J5|Q96QU9|Q96RM4	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	9.151	1.016301	0.19355	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.36	-7.22	0.01485	.	.	.	.	.	T	0.62368	0.2422	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66575	-0.5889	4	.	.	.	.	15.6057	0.76668	0.4359:0.0:0.5641:0.0	.	.	.	.	C	225	.	.	R	-	1	0	CSMD1	3250990	0.006000	0.16342	0.763000	0.31416	0.837000	0.47467	-0.625000	0.05534	-1.745000	0.01337	-0.469000	0.05056	CGT	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2		35.992317	0	-6	59	0	0	1	0	NM_033225	12	36.431209	20	0.375000
DOCK10	55619	broad.mit.edu	hg19	2	225688296	225688296	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:225688296G>A	ENST00000409592.3	-	28	3200	c.3087C>T	c.(3085-3087)tcC>tcT	p.S1029S	DOCK10_ENST00000258390.7_Silent_p.S1035S			Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1035				GTP binding	NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	TCACATGGTCGGATAGGACCA	0.418	1	146.0	137.0	140.0	2	225688296	1896	4119	6015	SO:0001819	synonymous_variant	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905	"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518			12432077	Standard	NM_014689	Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3105C>T	2.37:g.225688296G>A		B3FL70|O75178|Q9NW06|Q9NXI8	ENST00000258390.7	37	CCDS46528.1																																																																																			DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		18.679073	0	-20	42	0	0	1	0		8	21.823872	31	0.205128
C11orf57	55216	broad.mit.edu	hg19	11	111953260	111953260	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:111953260G>A	ENST00000532163.1	+	6	1125	c.359G>A	c.(358-360)cGc>cAc	p.R120H	C11orf57_ENST00000393047.3_Missense_Mutation_p.R149H|C11orf57_ENST00000420986.2_Missense_Mutation_p.R148H|C11orf57_ENST00000280352.9_Missense_Mutation_p.R148H			Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	148					autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)	CATGAATCCCGCAAACACAAG	0.358	0	55.0	60.0	58.0	11	111953260	2201	4297	6498	SO:0001583	missense	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776		25569	protein-coding gene	gene with protein product					12477932	Standard	NM_001082970	Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000393047.3:c.446G>A	11.37:g.111953260G>A	ENSP00000376767:p.Arg149His	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	ENST00000393047.3	37	CCDS8356.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.597|8.597	0.886036|0.886036	0.17540|0.17540	.|.	.|.	ENSG00000150776|ENSG00000150776	ENST00000393048|ENST00000420986;ENST00000532163;ENST00000280352;ENST00000393047;ENST00000525785;ENST00000531378	.|.	.|.	.|.	5.06|5.06	-1.16|-1.16	0.09678|0.09678	.|.	.|0.705657	.|0.13890	.|N	.|0.355685	T|T	0.15003|0.15003	0.0362|0.0362	N|N	0.08118|0.08118	0|0	0.23003|0.23003	N|N	0.998448|0.998448	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.30909|0.30909	-0.9962|-0.9962	6|9	0.87932|0.14252	D|T	0|0.57	0.7805|0.7805	8.1671|8.1671	0.31233|0.31233	0.6366:0.1092:0.2543:0.0|0.6366:0.1092:0.2543:0.0	.|.	.|149;148	.|Q6ZUT1-2;Q6ZUT1	.|.;CK057_HUMAN	T|H	4|148;120;148;149;120;103	.|.	ENSP00000376768:A4T|ENSP00000339076:R148H	A|R	+|+	1|2	0|0	C11orf57|C11orf57	111458470|111458470	0.905000|0.905000	0.30787|0.30787	0.928000|0.928000	0.36995|0.36995	0.885000|0.885000	0.51271|0.51271	0.229000|0.229000	0.17833|0.17833	-0.576000|-0.576000	0.05974|0.05974	-1.814000|-1.814000	0.00607|0.00607	GCA|CGC	C11orf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316853.1		-2.914035	0	-7	64	0	0	1	0	NM_018195	3	6.660295	45	0.062500
AKR7L	246181	broad.mit.edu	hg19	1	19596161	19596161	+	RNA	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:19596161C>T	ENST00000420396.2	-	0	507				AKR7L_ENST00000429712.1_RNA					aldo-keto reductase family 7-like						breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6					CGGGTGGTGGCGCTGTACATG	0.552	0	80.0	80.0	80.0	1	19596161	692	1591	2283					1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454		24056	protein-coding gene	gene with protein product		608478			12879023	Standard	NR_040288	Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19596161C>T		Q5U614	ENST00000429712.1	37		.	.	.	.	.	.	.	.	.	.	C	16.18	3.049958	0.55218	.	.	ENSG00000211454	ENST00000429712;ENST00000388886	.	.	.	3.67	2.74	0.32292	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.74596	0.3737	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.73528	-0.3954	8	0.41790	T	0.15	.	10.4637	0.44594	0.0:0.8992:0.0:0.1008	.	174	Q8NHP1	ARK74_HUMAN	T	174;139	.	ENSP00000373538:A139T	A	-	1	0	AKR7L	19468748	1.000000	0.71417	0.979000	0.43373	0.151000	0.21798	4.329000	0.59260	0.870000	0.35726	0.305000	0.20034	GCC	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3		47.265975	0	19	43	0	0	1	0	NM_201252	14	48.565961	4	0.777778
POLD1	5424	broad.mit.edu	hg19	19	50917082	50917082	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:50917082C>T	ENST00000440232.2	+	19	2387	c.2334C>T	c.(2332-2334)gcC>gcT	p.A778A	POLD1_ENST00000595904.1_Silent_p.A804A|POLD1_ENST00000599857.1_Silent_p.A778A	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	778		base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)	GGCGGGAGGCCGCGGACTGGG	0.657	0	60.0	59.0	60.0	19	50917082	2203	4300	6503	SO:0001819	synonymous_variant		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822	"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD	1722322	Standard	NM_001256849	Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2334C>T	19.37:g.50917082C>T		Q8NER3|Q96H98	ENST00000440232.2	37	CCDS12795.1																																																																																			POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1		20.546184	0	-2	62	0	0	1	0		9	23.148021	30	0.230769
ITGAX	3687	broad.mit.edu	hg19	16	31374553	31374553	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:31374553C>T	ENST00000268296.4	+	14	1689	c.1568C>T	c.(1567-1569)gCg>gTg	p.A523V	ITGAX_ENST00000562522.1_Missense_Mutation_p.A523V	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	523		blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77					CGCTTTGGGGCGGCTCTGACA	0.617	0	108.0	117.0	114.0	16	31374553	2197	4300	6497	SO:0001583	missense	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678	"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C	3284962, 2303426	Standard	NM_001286375	Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1568C>T	16.37:g.31374553C>T	ENSP00000268296:p.Ala523Val	Q8IVA6	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345086	0.82022	.	.	ENSG00000140678	ENST00000268296	T	0.24538	1.85	4.03	4.03	0.46877	.	.	.	.	.	T	0.33440	0.0863	M	0.78049	2.395	0.37132	D	0.901292	D	0.71674	0.998	B	0.43331	0.416	T	0.54430	-0.8295	9	0.66056	D	0.02	.	13.447	0.61146	0.0:1.0:0.0:0.0	.	523	P20702	ITAX_HUMAN	V	523	ENSP00000268296:A523V	ENSP00000268296:A523V	A	+	2	0	ITGAX	31282054	0.869000	0.29996	0.996000	0.52242	0.944000	0.59088	1.939000	0.40213	1.952000	0.56665	0.460000	0.39030	GCG	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2		55.818695	0	-43	110	0	0	1	0	NM_000887	22	59.464464	58	0.275000
FUT9	10690	broad.mit.edu	hg19	6	96651363	96651363	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:96651363G>A	ENST00000302103.5	+	3	658	c.332G>A	c.(331-333)cGa>cAa	p.R111Q		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	111		L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)	ATCCATCACCGAGACATCAGT	0.468	0	125.0	109.0	115.0	6	96651363	2203	4300	6503	SO:0001583	missense	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461	"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865			10386598, 10575236	Standard	NM_006581	Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.332G>A	6.37:g.96651363G>A	ENSP00000302599:p.Arg111Gln	Q5T0W4	ENST00000302103.5	37	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525396	0.85600	.	.	ENSG00000172461	ENST00000302103	T	0.25579	1.79	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.46952	-0.9154	10	0.44086	T	0.13	-7.5419	18.3049	0.90177	0.0:0.0:1.0:0.0	.	111	Q9Y231	FUT9_HUMAN	Q	111	ENSP00000302599:R111Q	ENSP00000302599:R111Q	R	+	2	0	FUT9	96758084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.643000	0.89663	0.655000	0.94253	CGA	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2		29.308262	0	-4	59	0	0	1	0	NM_006581	11	30.972955	28	0.282051
ROR2	4920	hgsc.bcm.edu	hg19	9	94495610	94495610	+	Missense_Mutation	SNP	C	C	T	rs55737262		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										CTTGGGTGTCCGGGAGCGCGC	0.647	0	41.0	39.0	39.0	9	94495610	2203	4300	6503	SO:0001583	missense	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071	"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1	1334494, 10700182	Standard	NM_004560	Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.731G>A	9.37:g.94495610C>T	ENSP00000364860:p.Arg244Gln	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	ENST00000375708.3	37	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851177	0.32699	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	T;T	0.75821	0.6;-0.97	4.44	4.44	0.53790	Frizzled domain (2);Kringle (1);	0.000000	0.38164	N	0.001794	T	0.61664	0.2365	L	0.46157	1.445	0.50467	D	0.99987	B;B;B	0.29115	0.112;0.233;0.112	B;B;B	0.18561	0.015;0.02;0.022	T	0.56786	-0.7921	10	0.13108	T	0.6	.	10.8451	0.46739	0.0:0.9142:0.0:0.0858	rs55737262	244;244;104	A1L4F5;Q01974;B1APY4	.;ROR2_HUMAN;.	Q	104;244	ENSP00000364867:R104Q;ENSP00000364860:R244Q	ENSP00000364860:R244Q	R	-	2	0	ROR2	93535431	0.129000	0.22400	1.000000	0.80357	0.900000	0.52787	3.497000	0.53295	2.306000	0.77630	0.561000	0.74099	CGG	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1				-9	19						4		14	
GREB1	9687	broad.mit.edu	hg19	2	11774455	11774455	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:11774455C>T	ENST00000381486.2	+	29	5490	c.5190C>T	c.(5188-5190)aaC>aaT	p.N1730N	GREB1_ENST00000234142.5_Silent_p.N1730N|GREB1_ENST00000396123.1_Silent_p.N728N	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1730			integral to membrane		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	TGACCCAGAACGTGCAGTACA	0.657	0	35.0	37.0	36.0	2	11774455	2100	4232	6332	SO:0001819	synonymous_variant		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208		24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736			11103799	Standard	NM_014668	Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5190C>T	2.37:g.11774455C>T		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	ENST00000381486.2	37	CCDS42655.1																																																																																			GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1		12.598478	0	-4	30	0	0	1	0	NM_014668	4	12.685791	6	0.400000
ATF6B	1388	broad.mit.edu	hg19	6	32084485	32084485	+	Missense_Mutation	SNP	C	C	T	rs148987710		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:32084485C>T	ENST00000375201.4	-	16	1829	c.1784G>A	c.(1783-1785)cGa>cAa	p.R595Q	ATF6B_ENST00000375203.3_Missense_Mutation_p.R598Q			Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	598		response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22					ACTCACCCTTCGGAAAGAGAC	0.552	0	81.0	77.0	79.0	6	32084485	2203	4300	6503	SO:0001583	missense		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676	"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1	11256944, 14973138	Standard	NM_004381	Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.1793G>A	6.37:g.32084485C>T	ENSP00000364349:p.Arg598Gln	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	ENST00000375203.3	37	CCDS4737.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289386	0.95517	4.54E-4	2.33E-4	ENSG00000213676	ENST00000375192;ENST00000375203;ENST00000375201	T;T	0.60548	0.18;0.93	5.17	5.17	0.71159	.	0.000000	0.56097	U	0.000023	T	0.65780	0.2724	L	0.49126	1.545	0.51012	D	0.999906	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.992	T	0.69698	-0.5075	10	0.87932	D	0	-4.5871	16.1583	0.81680	0.0:1.0:0.0:0.0	.	595;598;598	Q99941-2;Q99941;Q6AZW6	.;ATF6B_HUMAN;.	Q	201;598;595	ENSP00000364349:R598Q;ENSP00000364347:R595Q	ENSP00000364338:R201Q	R	-	2	0	ATF6B	32192463	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	6.988000	0.76212	2.403000	0.81681	0.563000	0.77884	CGA	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2		47.224221	0	-6	39	0	0	1	0		15	47.224221	15	0.500000
CASP14	23581	broad.mit.edu	hg19	19	15166256	15166256	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:15166256G>A	ENST00000427043.3	+	6	844	c.536G>A	c.(535-537)cGa>cAa	p.R179Q	CASP14_ENST00000221740.1_Missense_Mutation_p.R179Q	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	179		apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity	NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26					ATCGCCTACCGACATGATCAG	0.532	0	110.0	95.0	100.0	19	15166256	2203	4300	6503	SO:0001583	missense		CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141		1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""		10203698, 9792675	Standard	NM_012114	Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.536G>A	19.37:g.15166256G>A	ENSP00000393417:p.Arg179Gln	O95823|Q3SYC9	ENST00000427043.3	37	CCDS12323.1	6	0.0027472527472527475	3	0.006097560975609756	0	0.0	3	0.005244755244755245	0	0.0	g	15.58	2.875696	0.51695	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.25250	1.81;1.81	4.5	4.5	0.54988	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (2);	0.224065	0.30940	N	0.008578	T	0.52901	0.1763	H	0.96398	3.815	0.42975	D	0.994442	D	0.89917	1.0	D	0.66196	0.942	T	0.72424	-0.4298	10	0.72032	D	0.01	.	13.0259	0.58814	0.0:0.0:1.0:0.0	.	179	P31944	CASPE_HUMAN	Q	179	ENSP00000393417:R179Q;ENSP00000221740:R179Q	ENSP00000221740:R179Q	R	+	2	0	CASP14	15027256	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	4.534000	0.60622	2.197000	0.70478	0.462000	0.41574	CGA	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1		10.516956	0	-16	103	0	0	1	0	NM_012114	9	22.378062	71	0.112500
ANK1	286	broad.mit.edu	hg19	8	41550657	41550657	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:41550657C>T	ENST00000396942.1	-	30	3678	c.3595G>A	c.(3595-3597)Gag>Aag	p.E1199K	ANK1_ENST00000265709.8_Missense_Mutation_p.E1240K|ANK1_ENST00000352337.4_Missense_Mutation_p.E1199K|ANK1_ENST00000396945.1_Missense_Mutation_p.E1199K|ANK1_ENST00000379758.2_Missense_Mutation_p.E1199K|ANK1_ENST00000289734.7_Missense_Mutation_p.E1199K|ANK1_ENST00000347528.4_Missense_Mutation_p.E1199K			P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1199		axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		TTGGCGCACTCGTTGGCATAT	0.572	0	365.0	284.0	312.0	8	41550657	2203	4300	6503	SO:0001583	missense	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534	"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK	1689849	Standard	NM_001142445	Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000289734.7:c.3595G>A	8.37:g.41550657C>T	ENSP00000289734:p.Glu1199Lys	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	ENST00000289734.7	37	CCDS6121.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.728921|4.728921	0.89390|0.89390	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820|ENST00000520299	T;T;T;T;T;T;T|.	0.73789|.	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.250398|.	0.38492|.	N|.	0.001673|.	T|T	0.60932|0.60932	0.2307|0.2307	L|L	0.38838|0.38838	1.175|1.175	0.54753|0.54753	D|D	0.999983|0.999983	P;P;D;D;P;D|.	0.59357|.	0.886;0.912;0.979;0.972;0.886;0.985|.	B;B;B;B;B;B|.	0.42462|.	0.388;0.239;0.296;0.388;0.388;0.326|.	T|T	0.56679|0.56679	-0.7939|-0.7939	10|5	0.87932|.	D|.	0|.	.|.	18.5488|18.5488	0.91056|0.91056	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1240;1199;1199;1199;1199;515|.	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39|.	.;.;ANK1_HUMAN;.;.;.|.	K|Q	1199;1199;1199;1199;1199;1199;1240;1199|520	ENSP00000339620:E1199K;ENSP00000289734:E1199K;ENSP00000369082:E1199K;ENSP00000380149:E1199K;ENSP00000380147:E1199K;ENSP00000309131:E1199K;ENSP00000265709:E1240K|.	ENSP00000265709:E1240K|.	E|R	-|-	1|2	0|0	ANK1|ANK1	41669814|41669814	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.838000|0.838000	0.47535|0.47535	4.859000|4.859000	0.62954|0.62954	2.453000|2.453000	0.82957|0.82957	0.467000|0.467000	0.42956|0.42956	GAG|CGA	ANK1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317298.1		-3.717351	0	15	87	0	0	1	0	NM_020475	3	6.405836	47	0.060000
SUN5	140732	broad.mit.edu	hg19	20	31571673	31571673	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:31571673C>T	ENST00000356173.3	-	13	1159	c.1067G>A	c.(1066-1068)cGc>cAc	p.R356H	SUN5_ENST00000375523.3_Missense_Mutation_p.R331H	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	356	SUN.	spermatogenesis			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25					CACTCGCACGCGGTACAGGCA	0.557	0	84.0	92.0	90.0	20	31571673	2203	4300	6503	SO:0001583	missense	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098		16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L	9691178, 10373309	Standard	NM_080675	Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.1067G>A	20.37:g.31571673C>T	ENSP00000348496:p.Arg356His	A6NJ82|Q5T9R0	ENST00000356173.3	37	CCDS13209.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352931	0.82132	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.80480	-1.38;-1.38	4.86	4.86	0.63082	Sad1/UNC-like, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90003	0.6879	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91434	0.5168	10	0.87932	D	0	-21.1096	13.8647	0.63581	0.0:1.0:0.0:0.0	.	356	Q8TC36	SUN5_HUMAN	H	356;331	ENSP00000348496:R356H;ENSP00000364673:R331H	ENSP00000348496:R356H	R	-	2	0	SUN5	31035334	1.000000	0.71417	0.949000	0.38748	0.695000	0.40330	5.510000	0.67018	2.408000	0.81797	0.655000	0.94253	CGC	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1		18.075101	0	22	150	0	0	1	0	NM_080675	11	27.073959	64	0.146667
ABCA7	10347	broad.mit.edu	hg19	19	1054604	1054604	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:1054604C>T	ENST00000263094.6	+	28	3993	c.3762C>T	c.(3760-3762)ctC>ctT	p.L1254L	ABCA7_ENST00000435683.2_Silent_p.L1116L|ABCA7_ENST00000433129.1_Silent_p.L1254L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1254		phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity	NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	GCCTGGCCCTCGTGTTCAGCC	0.632	0	89.0	67.0	74.0	19	1054604	2203	4300	6503	SO:0001819	synonymous_variant	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687	"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414				Standard	NM_019112	Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000435683.2:c.3348C>T	19.37:g.1054604C>T		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	ENST00000435683.2	37																																																																																				ABCA7-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395001.2		4.310128	0	5	42	0	0	1	0	NM_019112	3	7.364893	20	0.130435
ATP5J2-PTCD1	26024	broad.mit.edu	hg19	7	99022532	99022532	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:99022532C>T	ENST00000292478.4	-	6	1873	c.1623G>A	c.(1621-1623)gcG>gcA	p.A541A	PTCD1_ENST00000555673.1_Silent_p.A590A|ATP5J2-PTCD1_ENST00000413834.1_Silent_p.A590A	NM_015545.3	NP_056360.2			pentatricopeptide repeat domain 1						endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		CCGGCAACAGCGCCTTGGCCC	0.612	0	73.0	69.0	70.0	7	99022532	2203	4300	6503	SO:0001819	synonymous_variant		CCDS56496.1	7q22.1	2011-02-21			ENSG00000248919	ENSG00000248919		38844	other	readthrough						Standard	NM_001198879	Approved		uc011kiw.2		OTTHUMG00000160779	ENST00000413834.1:c.1770G>A	7.37:g.99022532C>T			ENST00000413834.1	37	CCDS56496.1																																																																																			ATP5J2-PTCD1-001	KNOWN	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362258.1		17.914275	0	-18	37	0	0	1	0	NM_001198879.1	7	19.163303	19	0.269231
FGFR4	2264	broad.mit.edu	hg19	5	176520431	176520431	+	Missense_Mutation	SNP	G	G	A	rs55879131	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:176520431G>A	ENST00000292408.4	+	10	1521	c.1276G>A	c.(1276-1278)Ggc>Agc	p.G426S	FGFR4_ENST00000393637.1_Missense_Mutation_p.G386S|FGFR4_ENST00000502906.1_Missense_Mutation_p.G426S|FGFR4_ENST00000292410.3_Missense_Mutation_p.G386S|FGFR4_ENST00000393648.2_Silent_p.P374P	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	426		insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity	breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		AGGCTCTTCCGGCAAGTCAAG	0.617	0	79.0	81.0	80.0	5	176520431	2203	4300	6503	SO:0001583	missense	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935				Standard	XM_005265837	Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1276G>A	5.37:g.176520431G>A	ENSP00000292408:p.Gly426Ser	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	ENST00000292408.4	37	CCDS4410.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	10.99|10.99	1.506986|1.506986	0.27036|0.27036	0.0|0.0	1.16E-4|1.16E-4	ENSG00000160867|ENSG00000160867	ENST00000292408;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207|ENST00000511076	D;D;D;D|.	0.82984|.	-1.67;-1.67;-1.67;-1.67|.	4.76|4.76	3.89|3.89	0.44902|0.44902	.|.	0.213165|.	0.48286|.	N|.	0.000189|.	T|T	0.63640|0.63640	0.2528|0.2528	L|L	0.60455|0.60455	1.87|1.87	0.40652|0.40652	D|D	0.982048|0.982048	P;B|.	0.39964|.	0.697;0.083|.	B;B|.	0.29524|.	0.103;0.015|.	T|T	0.63791|0.63791	-0.6557|-0.6557	10|5	0.07813|.	T|.	0.8|.	.|.	13.0003|13.0003	0.58672|0.58672	0.0792:0.0:0.9208:0.0|0.0792:0.0:0.9208:0.0	rs55879131|rs55879131	386;426|.	P22455-2;P22455|.	.;FGFR4_HUMAN|.	S|Q	426;426;386;386;654|57	ENSP00000292408:G426S;ENSP00000424960:G426S;ENSP00000292410:G386S;ENSP00000377254:G386S|.	ENSP00000292408:G426S|.	G|R	+|+	1|2	0|0	FGFR4|FGFR4	176453037|176453037	1.000000|1.000000	0.71417|0.71417	0.864000|0.864000	0.33941|0.33941	0.633000|0.633000	0.38033|0.38033	3.836000|3.836000	0.55813|0.55813	1.256000|1.256000	0.44068|0.44068	-0.226000|-0.226000	0.12346|0.12346	GGC|CGG	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		38.795248	0	-18	94	0	0	1	0		15	42.560067	47	0.241935
DLX2	1746	broad.mit.edu	hg19	2	172965648	172965648	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:172965648G>A	ENST00000234198.4	-	3	971	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	DLX2_ENST00000466293.2_3'UTR	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	204			nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)		AACTTGGACCGGCGGTTCTGG	0.542	0	37.0	38.0	38.0	2	172965648	2141	4151	6292	SO:0001583	missense	U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844	"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""		1354641	Standard	NM_004405	Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.610C>T	2.37:g.172965648G>A	ENSP00000234198:p.Arg204Trp	B4DMK4|B7ZA14	ENST00000234198.4	37	CCDS2248.1	.	.	.	.	.	.	.	.	.	.	g	25.5	4.648960	0.87958	.	.	ENSG00000115844	ENST00000234198	D	0.99167	-5.51	4.8	4.8	0.61643	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99486	0.9817	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98221	1.0478	10	0.87932	D	0	-15.7063	13.3491	0.60591	0.0:0.0:0.8413:0.1587	.	204	Q07687	DLX2_HUMAN	W	204	ENSP00000234198:R204W	ENSP00000234198:R204W	R	-	1	2	DLX2	172673894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.497000	0.60367	2.196000	0.70406	0.457000	0.33378	CGG	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255368.3		6.044595	0	-7	47	0	0	1	0		5	12.030141	37	0.119048
MIR519A2	0	broad.mit.edu	hg19	19	54264407	54264407	+	RNA	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:54264407G>A	ENST00000384888.1	+	0	21					NR_030221.1																TGACCTTCTCGAGGAAAGAAG	0.413	0	110.0	100.0	103.0	19	54264407	1568	3582	5150					19q13.42	2011-09-12		2008-12-18	ENSG00000207723		"""ncRNAs / Micro RNAs"""	32132	non-coding RNA	RNA, micro				MIRN519A-2, MIRN519A2		Standard	NR_030222	Approved	hsa-mir-519a-2	uc021vaz.1				19.37:g.54264407G>A			ENST00000384990.1	37																																																																																				MIR519A2-201	KNOWN	basic	miRNA	lincRNA			99.488258	0	-46	131	0	0	1	0	NR_030222	32	99.966874	45	0.415584
FAM57B	83723	broad.mit.edu	hg19	16	30036680	30036680	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:30036680G>A	ENST00000380495.4	-	5	1380	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	FAM57B_ENST00000279389.4_Missense_Mutation_p.R167C|FAM57B_ENST00000564806.1_3'UTR	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	217	TLC.		endoplasmic reticulum|integral to membrane		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14					CCGGCATGGCGCCCGTAGGCC	0.672	0	36.0	39.0	38.0	16	30036680	2195	4296	6491	SO:0001583	missense	AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926		25295	protein-coding gene	gene with protein product		615175			11230166, 23275342	Standard	NM_031478	Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.649C>T	16.37:g.30036680G>A	ENSP00000369863:p.Arg217Cys	Q9H0J1	ENST00000380495.4	37	CCDS10667.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.01	3.280625	0.59758	.	.	ENSG00000149926	ENST00000380495	D	0.85773	-2.03	4.78	3.8	0.43715	TRAM/LAG1/CLN8 homology domain (3);	0.124480	0.49916	D	0.000124	D	0.85137	0.5628	M	0.75777	2.31	0.80722	D	1	P	0.39116	0.66	B	0.41332	0.354	T	0.83349	-0.0004	10	0.37606	T	0.19	-5.6786	13.0654	0.59030	0.0:0.0:0.8373:0.1627	.	217	Q71RH2	FA57B_HUMAN	C	217	ENSP00000369863:R217C	ENSP00000369863:R217C	R	-	1	0	FAM57B	29944181	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.638000	0.46562	0.950000	0.37743	0.561000	0.74099	CGC	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255142.2		11.498167	0	0	21	0	0	1	0	NM_031478	4	11.585551	6	0.400000
REXO1	57455	broad.mit.edu	hg19	19	1828397	1828397	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:1828397C>T	ENST00000170168.4	-	2	485	c.391G>A	c.(391-393)Ggc>Agc	p.G131S	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	131			nucleus	exonuclease activity|nucleic acid binding	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	GCGTTggggccgcggggcgcc	0.731	0									SO:0001583	missense	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313		24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1	10574461	Standard	NM_020695	Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.391G>A	19.37:g.1828397C>T	ENSP00000170168:p.Gly131Ser	Q9ULT2	ENST00000170168.4	37	CCDS32866.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.356	-0.942275	0.02322	.	.	ENSG00000079313	ENST00000170168;ENST00000413153	T	0.10860	2.83	3.42	-0.681	0.11342	.	1.624920	0.03428	N	0.207374	T	0.05456	0.0144	N	0.17474	0.49	0.09310	N	1	B;B	0.31817	0.341;0.001	B;B	0.19148	0.024;0.001	T	0.29212	-1.0019	10	0.08179	T	0.78	-10.4205	6.959	0.24587	0.0:0.2925:0.0:0.7075	.	85;131	F5H016;Q8N1G1	.;REXO1_HUMAN	S	131;85	ENSP00000170168:G131S	ENSP00000170168:G131S	G	-	1	0	REXO1	1779397	0.001000	0.12720	0.006000	0.13384	0.001000	0.01503	0.079000	0.14782	0.066000	0.16515	-0.448000	0.05591	GGC	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1		6.815597	0	-5	20	0	0	1	0	NM_020695	3	8.278564	13	0.187500
IFT27	11020	broad.mit.edu	hg19	22	37163883	37163883	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:37163883C>T	ENST00000340630.5	-	2	500	c.55G>A	c.(55-57)Gcc>Acc	p.A19T	IFT27_ENST00000453009.2_5'UTR|IFT27_ENST00000433985.2_Missense_Mutation_p.A20T	NM_006860.4	NP_006851.1	Q9BW83	IFT27_HUMAN	intraflagellar transport 27 homolog (Chlamydomonas)	20		small GTPase mediated signal transduction	intraflagellar transport particle B|microtubule-based flagellum	GTP binding	endometrium(3)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	7					TGTGCCAGGGCGGTCTTGCCC	0.512	0	210.0	198.0	202.0	22	37163883	2203	4300	6503	SO:0001583	missense	Z80897	CCDS13932.1, CCDS54523.1	22q13.1	2014-07-03	2014-07-03	2010-04-22	ENSG00000100360	ENSG00000100360	"""Intraflagellar transport homologs"", ""RAB, member RAS oncogene"""	18626	protein-coding gene	gene with protein product		615870	"""RAB, member of RAS oncogene family-like 4"", ""intraflagellar transport 27 homolog (Chlamydomonas)"""	RABL4	12529303, 17276912	Standard	NM_001177701	Approved	RAYL, BBS19	uc003apv.3	Q9BW83	OTTHUMG00000150544	ENST00000340630.5:c.55G>A	22.37:g.37163883C>T	ENSP00000343593:p.Ala19Thr	O60897	ENST00000340630.5	37	CCDS13932.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231071	0.39399	.	.	ENSG00000100360	ENST00000340630;ENST00000433985;ENST00000417951;ENST00000430701	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	4.5	3.46	0.39613	Small GTP-binding protein domain (1);	0.209151	0.41294	D	0.000903	T	0.76111	0.3942	L	0.49126	1.545	0.80722	D	1	D;P;P;P	0.69078	0.997;0.899;0.954;0.835	P;B;B;B	0.57960	0.83;0.236;0.313;0.416	T	0.75897	-0.3155	10	0.49607	T	0.09	.	8.4676	0.32966	0.0:0.8151:0.0:0.1849	.	59;19;20;19	F5GZ09;B1AH58;Q9BW83;Q9BW83-2	.;.;IFT27_HUMAN;.	T	19;20;59;19	ENSP00000343593:A19T;ENSP00000393541:A20T;ENSP00000392016:A59T;ENSP00000390016:A19T	ENSP00000343593:A19T	A	-	1	0	IFT27	35493829	0.763000	0.28462	0.921000	0.36526	0.487000	0.33371	1.307000	0.33516	2.060000	0.61445	0.561000	0.74099	GCC	IFT27-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318834.1		-27.860253	0	-4	236	0	0	1	0	NM_006860	5	10.057954	153	0.031646
KCNA5	3741	broad.mit.edu	hg19	12	5154303	5154303	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:5154303G>A	ENST00000252321.3	+	1	1219	c.990G>A	c.(988-990)acG>acA	p.T330T		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	330			Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity	NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					TGGAGACCACGTGCGTCATCT	0.652	1	86.0	78.0	81.0	12	5154303	2203	4300	6503	SO:0001819	synonymous_variant	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267			16382104	Standard	NM_002234	Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.990G>A	12.37:g.5154303G>A		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	ENST00000252321.3	37	CCDS8536.1																																																																																			KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2		7.281245	0	-3	95	0	0	1	0	NM_002234	7	16.699361	56	0.111111
SCN8A	6334	broad.mit.edu	hg19	12	52200942	52200942	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:52200942G>A	ENST00000354534.6	+	27	5850	c.5672G>A	c.(5671-5673)cGt>cAt	p.R1891H	SCN8A_ENST00000545061.1_Missense_Mutation_p.R1850H	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit			axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity	breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	ACCACACTGCGTCGCAAGCAG	0.547	0	135.0	141.0	139.0	12	52200942	2079	4221	6300	SO:0001583	missense	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876	"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED	7670495, 9828131, 16382098	Standard	NM_014191	Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5672G>A	12.37:g.52200942G>A	ENSP00000346534:p.Arg1891His	B9VWG8|O95788|Q9NYX2|Q9UPB2	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809232	0.70797	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.96200	-3.94;-3.88	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.97390	0.9146	M	0.78223	2.4	0.80722	D	1	D	0.76494	0.999	D	0.63033	0.91	D	0.97617	1.0133	10	0.66056	D	0.02	.	18.9611	0.92678	0.0:0.0:1.0:0.0	.	1891	Q9UQD0	SCN8A_HUMAN	H	1891;1850	ENSP00000346534:R1891H;ENSP00000440360:R1850H	ENSP00000346534:R1891H	R	+	2	0	SCN8A	50487209	0.937000	0.31787	1.000000	0.80357	0.831000	0.47069	4.762000	0.62250	2.793000	0.96121	0.655000	0.94253	CGT	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3		-29.670062	0	0	207	0	0	1	0	NM_014191	4	6.836714	144	0.027027
ATP10D	57205	broad.mit.edu	hg19	4	47538910	47538910	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:47538910C>T	ENST00000273859.3	+	9	1620	c.1351C>T	c.(1351-1353)Cga>Tga	p.R451*	ATP10D_ENST00000504445.1_Nonsense_Mutation_p.R436*	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	451		ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66					GATGGTTTTTCGAAGATGTAG	0.443	0	66.0	64.0	64.0	4	47538910	2203	4300	6503	SO:0001587	stop_gained	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246	"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""		12532265	Standard	NM_020453	Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1351C>T	4.37:g.47538910C>T	ENSP00000273859:p.Arg451*	A2RRC8|D6REN2|Q8NC70|Q96SR3	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	C	34	5.355705	0.95854	0.0	1.16E-4	ENSG00000145246	ENST00000273859;ENST00000504445	.	.	.	5.38	3.6	0.41247	.	0.073080	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3079	13.588	0.61942	0.2829:0.7171:0.0:0.0	.	.	.	.	X	451;436	.	ENSP00000273859:R451X	R	+	1	2	ATP10D	47233667	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	3.222000	0.51223	0.605000	0.29947	0.650000	0.86243	CGA	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1		0.294672	0	-19	38	0	0	1	0	NM_020453	3	6.911429	34	0.081081
P2RY2	5029	broad.mit.edu	hg19	11	72945667	72945667	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:72945667G>A	ENST00000311131.2	+	3	930	c.463G>A	c.(463-465)Ggg>Agg	p.G155R	P2RY2_ENST00000393596.2_Missense_Mutation_p.G155R|P2RY2_ENST00000393597.2_Missense_Mutation_p.G155R	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	155		activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					CCGGGTGGCCGGGGCCGTGTG	0.721	0	27.0	30.0	29.0	11	72945667	2197	4287	6484	SO:0001583	missense	U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591	"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041			8159738, 9286708	Standard	NM_002564	Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.463G>A	11.37:g.72945667G>A	ENSP00000310305:p.Gly155Arg	B2R9W3|Q96EM8	ENST00000311131.2	37	CCDS8219.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749562	0.30955	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.38722	1.12;1.12;1.12	5.24	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.199336	0.41938	D	0.000798	T	0.47985	0.1475	M	0.64404	1.975	0.09310	N	1	B	0.32543	0.375	B	0.40565	0.333	T	0.49643	-0.8918	10	0.66056	D	0.02	.	14.1042	0.65078	0.0:0.0:0.8483:0.1517	.	155	P41231	P2RY2_HUMAN	R	155	ENSP00000377222:G155R;ENSP00000310305:G155R;ENSP00000377221:G155R	ENSP00000310305:G155R	G	+	1	0	P2RY2	72623315	0.175000	0.23083	0.002000	0.10522	0.217000	0.24651	2.889000	0.48601	1.179000	0.42884	0.561000	0.74099	GGG	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1		5.542406	0	-25	45	0	0	1	0	NM_176072	5	12.270545	40	0.111111
ZNF521	25925	broad.mit.edu	hg19	18	22807526	22807526	+	Missense_Mutation	SNP	G	G	A	rs149969134		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:22807526G>A	ENST00000361524.3	-	4	504	c.356C>T	c.(355-357)cCg>cTg	p.P119L	ZNF521_ENST00000584787.1_5'UTR|ZNF521_ENST00000538137.2_Missense_Mutation_p.P119L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	119		cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)				GAATTGACACGGGTATGGAAG	0.517	0	105.0	98.0	100.0	18	22807526	2203	4300	6503	SO:0001583	missense	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795	"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974			11984006, 14630787	Standard	NM_015461	Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.356C>T	18.37:g.22807526G>A	ENSP00000354794:p.Pro119Leu	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.549679	0.27652	0.0	1.16E-4	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.52057	0.68;0.68	6.07	6.07	0.98685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.053757	0.85682	D	0.000000	T	0.49201	0.1543	N	0.19112	0.55	0.54753	D	0.999984	D	0.63880	0.993	P	0.56700	0.804	T	0.40850	-0.9541	10	0.38643	T	0.18	-17.3632	16.8961	0.86101	0.0:0.0:0.8714:0.1286	.	119	Q96K83	ZN521_HUMAN	L	119;153;119	ENSP00000354794:P119L;ENSP00000382352:P119L	ENSP00000354794:P119L	P	-	2	0	ZNF521	21061524	1.000000	0.71417	0.437000	0.26809	0.754000	0.42855	7.617000	0.83032	2.885000	0.99019	0.655000	0.94253	CCG	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2		31.598146	0	-37	101	0	0	1	0	NM_015461	15	40.179553	71	0.174419
SLC25A18	83733	broad.mit.edu	hg19	22	18072420	18072420	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:18072420C>T	ENST00000327451.6	+	10	1333	c.795C>T	c.(793-795)acC>acT	p.T265T	SLC25A18_ENST00000399813.1_Silent_p.T265T	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18				integral to membrane|mitochondrial inner membrane	binding|symporter activity	breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)	GTGGGATCACCGACTGTGCCA	0.488	1	80.0	76.0	77.0	22	18072420	2203	4300	6503	SO:0001819	synonymous_variant	AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902	"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""		11381032, 11897791	Standard	NM_031481	Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.795C>T	22.37:g.18072420C>T			ENST00000327451.6	37	CCDS13744.1																																																																																			SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3		20.318302	0	-6	53	0	0	1	0	NM_031481	7	20.834764	14	0.333333
ITGA2	3673	broad.mit.edu	hg19	5	52358678	52358678	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:52358678C>T	ENST00000296585.5	+	13	1664	c.1521C>T	c.(1519-1521)gaC>gaT	p.D507D		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	507		axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)			CCATTACAGACGTGCTCTTGG	0.368	0	186.0	172.0	177.0	5	52358678	2203	4300	6503	SO:0001819	synonymous_variant		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171	"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B		Standard	NM_002203	Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1521C>T	5.37:g.52358678C>T		Q14595	ENST00000296585.5	37	CCDS3957.1																																																																																			ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2		95.478484	0	-1	119	0	0	1	0	NM_002203	29	95.514119	26	0.527273
PPFIA1	8500	broad.mit.edu	hg19	11	70208475	70208475	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:70208475G>A	ENST00000253925.7	+	21	2961	c.2746G>A	c.(2746-2748)Gac>Aac	p.D916N	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.D916N	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	916	SAM 1.	cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		GGCCCTGTCCGACACAGAGAT	0.617	0	88.0	80.0	82.0	11	70208475	2200	4294	6494	SO:0001583	missense	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626	"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054			7796809, 9624153	Standard	NM_003626	Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.2746G>A	11.37:g.70208475G>A	ENSP00000253925:p.Asp916Asn	A6NLE3|Q13135|Q14567|Q8N4I2	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	35	5.514892	0.96402	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950	T;T	0.50001	0.76;0.76	5.32	5.32	0.75619	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.69771	0.3148	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.999	D;D;D	0.83275	0.996;0.959;0.932	T	0.73020	-0.4114	10	0.87932	D	0	.	18.9937	0.92804	0.0:0.0:1.0:0.0	.	413;916;916	F5H1G2;Q13136;Q13136-2	.;LIPA1_HUMAN;.	N	916;916;413	ENSP00000253925:D916N;ENSP00000374198:D916N	ENSP00000253925:D916N	D	+	1	0	PPFIA1	69886123	1.000000	0.71417	0.946000	0.38457	0.857000	0.48899	9.542000	0.98086	2.488000	0.83962	0.561000	0.74099	GAC	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1		5.644673	0	-5	66	0	0	1	0	NM_003626	5	11.876127	38	0.116279
HDLBP	3069	broad.mit.edu	hg19	2	242179190	242179190	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:242179190G>A	ENST00000391975.1	-	19	2664	c.2437C>T	c.(2437-2439)Cgc>Tgc	p.R813C	HDLBP_ENST00000310931.4_Missense_Mutation_p.R813C|HDLBP_ENST00000427183.2_Missense_Mutation_p.R780C|HDLBP_ENST00000391976.2_Missense_Mutation_p.R813C	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	813	KH 10.	cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding	breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)	ACGAAGTGGCGGTGGTGCTTG	0.577	0	62.0	58.0	59.0	2	242179190	2203	4300	6503	SO:0001583	missense		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677		4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL	1318310, 8390966	Standard	NM_005336	Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2437C>T	2.37:g.242179190G>A	ENSP00000375836:p.Arg813Cys	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.734081|4.734081	0.89482|0.89482	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183	.|T;T;T;T	.|0.32753	.|1.44;1.44;1.44;1.44	5.41|5.41	4.53|4.53	0.55603|0.55603	.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.|0.047041	.|0.85682	.|D	.|0.000000	T|T	0.60327|0.60327	0.2260|0.2260	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.79784	.|0.993;0.982	T|T	0.69045|0.69045	-0.5249|-0.5249	5|10	.|0.87932	.|D	.|0	-23.1174|-23.1174	14.4193|14.4193	0.67173|0.67173	0.0712:0.0:0.9288:0.0|0.0712:0.0:0.9288:0.0	.|.	.|780;813	.|E7EM71;Q00341	.|.;VIGLN_HUMAN	L|C	621|813;813;813;780	.|ENSP00000375836:R813C;ENSP00000375837:R813C;ENSP00000312042:R813C;ENSP00000399139:R780C	.|ENSP00000312042:R813C	P|R	-|-	2|1	0|0	HDLBP|HDLBP	241827863|241827863	1.000000|1.000000	0.71417|0.71417	0.922000|0.922000	0.36590|0.36590	0.929000|0.929000	0.56500|0.56500	9.699000|9.699000	0.98703|0.98703	1.427000|1.427000	0.47276|0.47276	0.561000|0.561000	0.74099|0.74099	CCG|CGC	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5		10.048807	0	-7	43	0	0	1	0	NM_203346	5	11.568309	17	0.227273
WISP1	8840	broad.mit.edu	hg19	8	134225300	134225300	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:134225300C>T	ENST00000250160.6	+	2	369	c.263C>T	c.(262-264)aCg>aTg	p.T88M	WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.T88M|WISP1_ENST00000517423.1_Missense_Mutation_p.T88M	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	88	IGFBP N-terminal.	cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding	central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)		GACAACTGCACGGAGGCTGCC	0.637	0	60.0	60.0	60.0	8	134225300	2203	4300	6503	SO:0001583	missense	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415		12769	protein-coding gene	gene with protein product		603398			9843955	Standard	NM_003882	Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000517423.1:c.263C>T	8.37:g.134225300C>T	ENSP00000427744:p.Thr88Met	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	ENST00000517423.1	37	CCDS56555.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807599	0.70797	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.63744	-0.06;-0.06;-0.06	5.13	4.19	0.49359	Insulin-like growth factor-binding protein, IGFBP (3);	0.211578	0.47852	D	0.000217	T	0.75012	0.3792	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.938;0.963	T	0.77651	-0.2508	10	0.72032	D	0.01	-21.5098	13.4726	0.61290	0.157:0.843:0.0:0.0	.	88;88;88	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	M	88	ENSP00000250160:T88M;ENSP00000427744:T88M;ENSP00000220856:T88M	ENSP00000220856:T88M	T	+	2	0	WISP1	134294482	0.992000	0.36948	1.000000	0.80357	0.927000	0.56198	3.001000	0.49488	2.394000	0.81467	0.549000	0.68633	ACG	WISP1-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000378797.1		7.447712	0	3	75	0	0	1	0	NM_003882	5	12.942108	35	0.125000
CDK3	1018	broad.mit.edu	hg19	17	73999371	73999371	+	Silent	SNP	C	C	T	rs141477491		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:73999371C>T	ENST00000425876.2	+	6	772	c.684C>T	c.(682-684)ccC>ccT	p.P228P	CDK3_ENST00000448471.1_Silent_p.P228P|TEN1-CDK3_ENST00000567351.1_RNA			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	228	Protein kinase.	cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity	central_nervous_system(1)	1					ACACATGGCCCGGGGTCACCC	0.562	0	111.0	122.0	118.0	17	73999371	2203	4300	6503	SO:0001819	synonymous_variant	X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506	"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828			1639063	Standard	NM_001258	Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.684C>T	17.37:g.73999371C>T			ENST00000425876.2	37	CCDS11736.1																																																																																			CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337389.2		12.088511	0	-32	109	0	0	1	0	NM_001258	10	25.292214	79	0.112360
RGAG4	340526	broad.mit.edu	hg19	X	71350832	71350832	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:71350832G>A	ENST00000545866.1	-	1	926	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	RGAG4_ENST00000609883.1_Missense_Mutation_p.R187W|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	187					cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)				AAGGCCACCCGCTCGGCGCCC	0.582	0	29.0	31.0	30.0	X	71350832	1875	4088	5963	SO:0001583	missense	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732		29430	protein-coding gene	gene with protein product					12056414, 15716091, 16093683	Standard	NM_001024455	Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.559C>T	X.37:g.71350832G>A	ENSP00000441366:p.Arg187Trp	A7E2W7|Q8NCM4|Q9NPX1	ENST00000545866.1	37	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848301	0.51164	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.16597	2.33;2.33	4.37	3.48	0.39840	.	.	.	.	.	T	0.13415	0.0325	N	0.08118	0	0.09310	N	0.999995	D	0.76494	0.999	P	0.53146	0.719	T	0.13683	-1.0500	8	.	.	.	-2.2816	8.4173	0.32678	0.0:0.0:0.7679:0.2321	.	187	Q5HYW3	RGAG4_HUMAN	W	187	ENSP00000441366:R187W;ENSP00000418667:R187W	.	R	-	1	2	RGAG4	71267557	0.992000	0.36948	0.364000	0.25888	0.990000	0.78478	1.515000	0.35845	1.137000	0.42214	0.600000	0.82982	CGG	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1		5.011071	0	13	65	0	0	1	0	NM_001024455	6	12.839135	47	0.113208
EIF2AK2	5610	broad.mit.edu	hg19	2	37349797	37349797	+	Missense_Mutation	SNP	G	G	A	rs3953394		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:37349797G>A	ENST00000233057.4	-	12	1241	c.919C>T	c.(919-921)Cgt>Tgt	p.R307C	EIF2AK2_ENST00000405334.1_Missense_Mutation_p.R266C|EIF2AK2_ENST00000395127.2_Missense_Mutation_p.R307C	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	307	Protein kinase.	evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity	breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)			TTTACTTCACGCTCCGCCTTC	0.408	1	138.0	127.0	131.0	2	37349797	2203	4300	6503	SO:0001583	missense	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332		9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR	1351683	Standard	NM_001135651	Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.919C>T	2.37:g.37349797G>A	ENSP00000233057:p.Arg307Cys	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	ENST00000233057.4	37	CCDS1786.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939260	0.73557	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334	T;T;T	0.55930	0.49;0.49;0.49	4.82	4.82	0.62117	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120830	0.37715	N	0.001974	T	0.75910	0.3914	M	0.90922	3.16	0.54753	D	0.999984	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.80665	-0.1281	10	0.87932	D	0	-13.7913	10.7482	0.46194	0.0899:0.0:0.9101:0.0	.	307;307;266	Q8IW76;P19525;E9PC80	.;E2AK2_HUMAN;.	C	307;307;266	ENSP00000233057:R307C;ENSP00000378559:R307C;ENSP00000385014:R266C	ENSP00000233057:R307C	R	-	1	0	EIF2AK2	37203301	0.956000	0.32656	0.917000	0.36280	0.262000	0.26303	4.446000	0.60014	2.388000	0.81334	0.585000	0.79938	CGT	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2		55.344545	0	-12	69	0	0	1	0	NM_002759	18	55.477332	23	0.439024
MFSD5	84975	broad.mit.edu	hg19	12	53647517	53647517	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:53647517C>T	ENST00000534842.1	+	2	1366	c.1219C>T	c.(1219-1221)Cgt>Tgt	p.R407C	MFSD5_ENST00000329548.4_Missense_Mutation_p.R300C	NM_001170790.1	NP_001164261.1	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	300		transport	integral to membrane		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16					TTCCCTGTACCGTATCGCCAC	0.567	0	99.0	83.0	88.0	12	53647517	2203	4300	6503	SO:0001583	missense	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544		28156	protein-coding gene	gene with protein product						Standard	NM_032889	Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.898C>T	12.37:g.53647517C>T	ENSP00000332624:p.Arg300Cys	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	ENST00000329548.4	37	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	C	9.754	1.168143	0.21621	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	T;T	0.80566	-1.39;-1.39	5.04	4.15	0.48705	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.75228	0.3821	L	0.59436	1.845	0.80722	D	1	B;B	0.30361	0.083;0.277	B;B	0.20767	0.031;0.026	T	0.75010	-0.3468	10	0.72032	D	0.01	-1.6626	12.4044	0.55430	0.0:0.9165:0.0:0.0835	.	300;407	Q6N075;G3V1N7	MFSD5_HUMAN;.	C	407;407;407;300	ENSP00000442688:R407C;ENSP00000332624:R300C	ENSP00000331231:R407C	R	+	1	0	MFSD5	51933784	1.000000	0.71417	0.998000	0.56505	0.225000	0.24961	7.564000	0.82326	1.129000	0.42072	-0.258000	0.10820	CGT	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1		1.969788	0	-4	53	0	0	1	0	NM_032889	4	8.365446	36	0.100000
DCAF12	25853	broad.mit.edu	hg19	9	34093293	34093293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:34093293G>A	ENST00000361264.4	-	7	1356	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*	RP11-537H15.3_ENST00000448245.1_RNA	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	339			centrosome|CUL4 RING ubiquitin ligase complex		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11					CCACTGCCTCGCTCCCTGGAA	0.502	0	148.0	125.0	133.0	9	34093293	2203	4300	6503	SO:0001587	stop_gained	AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876	"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A	11572484, 9110174	Standard	NM_015397	Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.1015C>T	9.37:g.34093293G>A	ENSP00000355114:p.Arg339*	A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	ENST00000361264.4	37	CCDS6549.1	.	.	.	.	.	.	.	.	.	.	G	40	8.439080	0.98813	.	.	ENSG00000198876	ENST00000361264	.	.	.	5.75	2.8	0.32819	.	0.124867	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-23.3755	14.8729	0.70471	0.0:0.0:0.6244:0.3756	.	.	.	.	X	339	.	ENSP00000355114:R339X	R	-	1	2	DCAF12	34083293	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.577000	0.36515	0.305000	0.22832	0.655000	0.94253	CGA	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052133.2		65.368894	0	6	68	0	0	1	0	NM_015397	21	65.586567	28	0.428571
CLEC18B	497190	broad.mit.edu	hg19	16	74452059	74452059	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:74452059C>T	ENST00000339953.5	-	3	475	c.354G>A	c.(352-354)gcG>gcA	p.A118A		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	118	SCP.		extracellular region	sugar binding	endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27					CAACAAAGGACGCCAAGCCCG	0.667	0	57.0	62.0	60.0	16	74452059	2108	4213	6321	SO:0001819	synonymous_variant	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839	"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product						Standard	NM_001011880	Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.354G>A	16.37:g.74452059C>T		B4DF90	ENST00000339953.5	37	CCDS32484.1																																																																																			CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1		28.840616	0	15	34	0	0	1	0	NM_001011880	10	29.457562	19	0.344828
TBL2	26608	broad.mit.edu	hg19	7	72988286	72988286	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:72988286C>T	ENST00000305632.5	-	3	669	c.428G>A	c.(427-429)cGc>cAc	p.R143H	TBL2_ENST00000452475.1_Missense_Mutation_p.R143H|TBL2_ENST00000432538.1_Missense_Mutation_p.R107H|TBL2_ENST00000459913.1_5'UTR	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	143					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)			AGGGCTGAAGCGCACCAGGGT	0.607	0	103.0	81.0	88.0	7	72988286	2203	4300	6503	SO:0001583	missense	AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638	"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842			9860302, 10575226	Standard	XM_006715923	Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.428G>A	7.37:g.72988286C>T	ENSP00000307260:p.Arg143His	Q9UQE2	ENST00000305632.5	37	CCDS5551.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011512	0.93346	4.54E-4	0.0	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538;ENST00000452475	T;T;T	0.30182	1.54;1.54;1.54	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53965	0.1829	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67382	0.951;0.951	T	0.54009	-0.8357	10	0.49607	T	0.09	-22.0223	16.4333	0.83861	0.0:1.0:0.0:0.0	.	107;143	E9PF19;Q9Y4P3	.;TBL2_HUMAN	H	143;143;107;143	ENSP00000307260:R143H;ENSP00000413979:R107H;ENSP00000407371:R143H	ENSP00000307260:R143H	R	-	2	0	TBL2	72626222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.716000	0.84723	2.491000	0.84063	0.561000	0.74099	CGC	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3		91.442470	0	9	96	0	0	1	0	NM_012453	30	91.601573	37	0.447761
GPR124	25960	broad.mit.edu	hg19	8	37698635	37698635	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:37698635G>A	ENST00000315215.7	+	16	2491	c.2128G>A	c.(2128-2130)Gcc>Acc	p.A710T	GPR124_ENST00000412232.2_Missense_Mutation_p.A927T			Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	927	GPS.	central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		AAGCCTTGGCGCCTTCTACAT	0.627	0	107.0	116.0	113.0	8	37698635	2203	4300	6503	SO:0001583	missense	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181	"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823			11559528, 12565841	Standard	NM_032777	Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2779G>A	8.37:g.37698635G>A	ENSP00000406367:p.Ala927Thr	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568480	0.86439	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.44482	0.92;0.92	4.67	4.67	0.58626	GPCR, family 2-like (1);	0.062185	0.64402	D	0.000004	T	0.69015	0.3064	M	0.86573	2.825	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.69142	0.962;0.919	T	0.77038	-0.2736	10	0.87932	D	0	-27.2058	17.575	0.87946	0.0:0.0:1.0:0.0	.	710;927	Q96PE1-2;Q96PE1	.;GP124_HUMAN	T	920;710;927	ENSP00000323508:A710T;ENSP00000406367:A927T	ENSP00000323508:A710T	A	+	1	0	GPR124	37817793	1.000000	0.71417	0.986000	0.45419	0.910000	0.53928	5.357000	0.66058	2.138000	0.66242	0.655000	0.94253	GCC	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		0.357890	0	-17	127	0	0	1	0		7	15.707095	79	0.081395
SLC22A14	9389	broad.mit.edu	hg19	3	38355294	38355294	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:38355294G>A	ENST00000273173.4	+	7	1331	c.1240G>A	c.(1240-1242)Gtg>Atg	p.V414M	SLC22A14_ENST00000448498.1_Missense_Mutation_p.V414M	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	414			integral to plasma membrane	organic cation transmembrane transporter activity	central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)	CTTCAGACACGTGGTCCCCAG	0.567	0	136.0	129.0	131.0	3	38355294	2203	4300	6503	SO:0001583	missense	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671	"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4	10072596	Standard	NM_004803	Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.1240G>A	3.37:g.38355294G>A	ENSP00000273173:p.Val414Met	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	ENST00000273173.4	37	CCDS2677.1	.	.	.	.	.	.	.	.	.	.	g	7.256	0.604299	0.14002	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.75821	-0.97;-0.97	4.27	-8.54	0.00912	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.724340	0.03222	N	0.177768	T	0.57125	0.2032	L	0.43152	1.355	0.09310	N	1	P	0.38677	0.642	B	0.36378	0.223	T	0.55667	-0.8105	10	0.36615	T	0.2	.	1.2618	0.02003	0.4288:0.2274:0.1624:0.1814	.	414	Q9Y267	S22AE_HUMAN	M	414	ENSP00000396283:V414M;ENSP00000273173:V414M	ENSP00000273173:V414M	V	+	1	0	SLC22A14	38330298	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.731000	0.01853	-2.154000	0.00792	-1.501000	0.00957	GTG	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3		140.144586	0	2	113	0	0	1	0	NM_004803	38	141.805230	1	0.974359
SCAMP5	192683	broad.mit.edu	hg19	15	75310786	75310786	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:75310786C>T	ENST00000361900.6	+	7	630	c.423C>T	c.(421-423)ttC>ttT	p.F141F	SCAMP5_ENST00000562212.1_Silent_p.F149F|SCAMP5_ENST00000425597.3_Silent_p.F141F|SCAMP5_ENST00000568081.1_Silent_p.F74F|SCAMP5_ENST00000545456.1_Silent_p.F70F	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	141		exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding	large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5					TCTCCTTCTTCGGAACGAACA	0.587	0	148.0	138.0	141.0	15	75310786	2013	4177	6190	SO:0001819	synonymous_variant	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794	"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766			12477932	Standard	NM_001178111	Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.423C>T	15.37:g.75310786C>T		B3KPJ7|B7Z762|D3DW71|Q8N3M4	ENST00000361900.6	37	CCDS45306.1																																																																																			SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2		55.965165	0	-38	167	0	0	1	0	NM_138967	26	69.139667	115	0.184397
DIDO1	11083	broad.mit.edu	hg19	20	61511261	61511261	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:61511261G>A	ENST00000266070.4	-	16	6372	c.6047C>T	c.(6046-6048)cCg>cTg	p.P2016L	DIDO1_ENST00000395343.1_Missense_Mutation_p.P2016L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	2016	Pro-rich.	apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)				CATCACCTGCGGGGCCTGGCC	0.687	0	36.0	47.0	44.0	20	61511261	2177	4264	6441	SO:0001583	missense	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191	"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1	10393935	Standard	NM_033081	Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.6047C>T	20.37:g.61511261G>A	ENSP00000266070:p.Pro2016Leu	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	8.112	0.778986	0.16120	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09255	3.0;3.0	4.94	3.92	0.45320	.	1.080270	0.07312	N	0.876107	T	0.09512	0.0234	L	0.36672	1.1	0.19300	N	0.99998	P	0.50819	0.939	B	0.34242	0.178	T	0.28299	-1.0048	10	0.62326	D	0.03	-1.6771	12.2577	0.54633	0.0:0.0:0.7274:0.2726	.	2016	Q9BTC0	DIDO1_HUMAN	L	2016	ENSP00000266070:P2016L;ENSP00000378752:P2016L	ENSP00000266070:P2016L	P	-	2	0	DIDO1	60981706	0.822000	0.29219	0.029000	0.17559	0.088000	0.18126	2.359000	0.44142	2.277000	0.76020	0.561000	0.74099	CCG	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2		96.015998	0	-8	120	0	0	1	0	NM_080796	31	96.376796	42	0.424658
DNAH7	56171	broad.mit.edu	hg19	2	196788444	196788444	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:196788444C>T	ENST00000312428.6	-	23	3800	c.3700G>A	c.(3700-3702)Gta>Ata	p.V1234I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1234	Stem (By similarity).	ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205					CCCAGAGTTACGCGATTCTGC	0.398	1	122.0	113.0	116.0	2	196788444	1972	4163	6135	SO:0001583	missense	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997	"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""		9373155, 11877439	Standard	NM_018897	Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3700G>A	2.37:g.196788444C>T	ENSP00000311273:p.Val1234Ile	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	1.908	-0.451426	0.04572	.	.	ENSG00000118997	ENST00000312428	T	0.54675	0.56	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.31040	0.0784	N	0.05330	-0.07	0.80722	D	1	B	0.20780	0.048	B	0.14578	0.011	T	0.26815	-1.0092	10	0.02654	T	1	.	18.7284	0.91724	0.0:1.0:0.0:0.0	.	1234	Q8WXX0	DYH7_HUMAN	I	1234	ENSP00000311273:V1234I	ENSP00000311273:V1234I	V	-	1	0	DNAH7	196496689	1.000000	0.71417	0.995000	0.50966	0.235000	0.25334	5.690000	0.68241	2.494000	0.84150	0.655000	0.94253	GTA	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		27.965860	0	-32	56	0	0	1	0	NM_018897	12	33.192080	49	0.196721
MUC16	94025	broad.mit.edu	hg19	19	9091523	9091523	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:9091523C>T	ENST00000397910.4	-	1	495	c.292G>A	c.(292-294)Gag>Aag	p.E98K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	98	Thr-rich.	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590					GTTCTTTGCTCGGAGTGTGTC	0.542	0	137.0	134.0	135.0	19	9091523	1982	4166	6148	SO:0001583	missense	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143	"""Mucins"""	15582	protein-coding gene	gene with protein product		606154			11369781	Standard	XM_006722941	Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.292G>A	19.37:g.9091523C>T	ENSP00000381008:p.Glu98Lys	Q6ZQW5|Q96RK2	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.368	0.253081	0.10185	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	1.01	-0.119	0.13543	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.27679	0.185	B	0.14023	0.01	T	0.44112	-0.9349	8	0.87932	D	0	.	3.4185	0.07385	0.0:0.7053:0.0:0.2947	.	98	B5ME49	.	K	98	ENSP00000381008:E98K	ENSP00000381008:E98K	E	-	1	0	MUC16	8952523	0.000000	0.05858	0.000000	0.03702	0.179000	0.23085	-1.277000	0.02812	0.010000	0.14839	0.313000	0.20887	GAG	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		-5.653190	0	7	97	0	0	1	0	NM_024690	4	8.480014	65	0.057971
MBTPS2	51360	broad.mit.edu	hg19	X	21886609	21886609	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:21886609C>T	ENST00000365779.2	+	6	776	c.695C>T	c.(694-696)gCa>gTa	p.A232V	MBTPS2_ENST00000379484.5_Missense_Mutation_p.A232V			O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	232		cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity	breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24					TTTGTCCTTGCACTCTTGGGT	0.433	0	348.0	321.0	330.0	X	21886609	2203	4300	6503	SO:0001583	missense	AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174		15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD	9847074, 9659902, 20672378	Standard	NM_015884	Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.695C>T	X.37:g.21886609C>T	ENSP00000368798:p.Ala232Val	Q9UM70|Q9UMD3	ENST00000379484.5	37	CCDS14201.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.677965	0.47886	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.94576	-3.46;-3.46	5.78	4.91	0.64330	Peptidase M50 (1);	0.101073	0.64402	D	0.000002	D	0.91513	0.7320	L	0.49640	1.575	0.40838	D	0.983649	B;B	0.27932	0.062;0.194	B;B	0.26202	0.023;0.067	D	0.89855	0.4012	10	0.45353	T	0.12	-18.5893	12.1482	0.54036	0.0:0.5354:0.4646:0.0	.	232;232	O43462;B9ZVQ3	MBTP2_HUMAN;.	V	232	ENSP00000368798:A232V;ENSP00000368796:A232V	ENSP00000368796:A232V	A	+	2	0	MBTPS2	21796530	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.020000	0.64066	2.433000	0.82419	0.544000	0.68410	GCA	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056026.1		-25.587769	0	-65	256	0	0	1	0		6	11.181034	153	0.037736
E2F7	144455	broad.mit.edu	hg19	12	77417851	77417851	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:77417851G>A	ENST00000322886.7	-	13	2915	c.2680C>T	c.(2680-2682)Cga>Tga	p.R894*	E2F7_ENST00000416496.2_3'UTR	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	894		cell cycle	transcription factor complex	DNA binding|identical protein binding	central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42					CTGGTGTTTCGTGACTGGTTC	0.587	0	132.0	131.0	131.0	12	77417851	2203	4300	6503	SO:0001587	stop_gained	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891		23820	protein-coding gene	gene with protein product		612046			12893818	Standard	NM_203394	Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.2680C>T	12.37:g.77417851G>A	ENSP00000323246:p.Arg894*	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	G	41	8.653156	0.98901	.	.	ENSG00000165891	ENST00000322886;ENST00000339887	.	.	.	6.17	4.19	0.49359	.	0.208419	0.37761	N	0.001945	.	.	.	.	.	.	0.31184	N	0.701703	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6583	11.7552	0.51872	0.0:0.0:0.5586:0.4414	.	.	.	.	X	894;365	.	ENSP00000323246:R894X	R	-	1	2	E2F7	75941982	0.993000	0.37304	0.444000	0.26895	0.725000	0.41563	2.762000	0.47597	1.600000	0.50102	0.655000	0.94253	CGA	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1		58.359501	0	-14	134	0	0	1	0	XM_084871	22	62.470426	61	0.265060
PRRC2A	7916	broad.mit.edu	hg19	6	31593371	31593371	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:31593371G>A	ENST00000376033.2	+	7	976	c.742G>A	c.(742-744)Gga>Aga	p.G248R	PRRC2A_ENST00000469577.1_3'UTR|PRRC2A_ENST00000376007.4_Missense_Mutation_p.G248R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	248	4 X 57 AA type A repeats.		cytoplasm|nucleus	protein binding	breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70					TCCCTACCGCGGAATGATGCC	0.557	1	91.0	88.0	89.0	6	31593371	2203	4300	6503	SO:0001583	missense	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469		13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2	2156268, 8499947	Standard	NM_080686	Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.742G>A	6.37:g.31593371G>A	ENSP00000365201:p.Gly248Arg	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587932	0.46110	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.01871	4.59;4.59	5.06	5.06	0.68205	.	0.000000	0.50627	D	0.000108	T	0.06050	0.0157	L	0.50333	1.59	0.58432	D	0.999997	D	0.89917	1.0	D	0.77004	0.989	T	0.29731	-1.0002	10	0.87932	D	0	-9.9248	17.3477	0.87314	0.0:0.0:1.0:0.0	.	248	P48634	PRC2A_HUMAN	R	248	ENSP00000365175:G248R;ENSP00000365201:G248R	ENSP00000365175:G248R	G	+	1	0	PRRC2A	31701350	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.223000	0.89779	2.628000	0.89032	0.655000	0.94253	GGA	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1		52.403261	0	-3	53	0	0	1	0	NM_080686	16	52.470917	13	0.551724
ESPNP	0	broad.mit.edu	hg19	1	17023064	17023064	+	RNA	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:17023064C>T	ENST00000492551.1	-	0	1799					NR_026567.1																GCACCCCCGGCGCAGGAGTAG	0.677	0											AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869		23285	pseudogene	pseudogene					15286153	Standard	NR_026567	Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17023064C>T			ENST00000492551.1	37																																																																																				ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1		5.113285	0	-1	24	0	0	1	0		3	6.793015	14	0.176471
PDE6B	5158	broad.mit.edu	hg19	4	647752	647752	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:647752G>A	ENST00000255622.6	+	4	866	c.823G>A	c.(823-825)Gtg>Atg	p.V275M	PDE6B_ENST00000429163.2_5'UTR|RP11-1191J2.2_ENST00000489312.1_RNA|PDE6B_ENST00000496514.1_Missense_Mutation_p.V275M|RP11-1191J2.2_ENST00000468356.1_RNA	NM_000283.3|NM_001145291.1	NP_000274.2|NP_001138763	P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	275	GAF 2.	cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					GCGGTACTCCGTGGGCCTCCT	0.647	0	93.0	79.0	84.0	4	647752	2203	4300	6503	SO:0001583	missense	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB	1313787	Standard	NM_001145292	Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.823G>A	4.37:g.647752G>A	ENSP00000420295:p.Val275Met	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.674935	0.67928	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.72167	-0.63;-0.63	5.26	5.26	0.73747	GAF (2);	0.000000	0.85682	D	0.000000	D	0.85986	0.5825	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	D	0.88489	0.3074	10	0.87932	D	0	.	16.3608	0.83267	0.0:0.0:1.0:0.0	.	275;275	P35913;P35913-2	PDE6B_HUMAN;.	M	275	ENSP00000255622:V275M;ENSP00000420295:V275M	ENSP00000255622:V275M	V	+	1	0	PDE6B	637752	1.000000	0.71417	0.945000	0.38365	0.059000	0.15707	9.447000	0.97595	2.449000	0.82847	0.561000	0.74099	GTG	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1		15.137316	0	-23	58	0	0	1	0	NM_000283	6	16.863703	20	0.230769
NLRP4	147945	broad.mit.edu	hg19	19	56369494	56369494	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:56369494G>A	ENST00000301295.6	+	3	1157	c.735G>A	c.(733-735)tcG>tcA	p.S245S	NLRP4_ENST00000587891.1_Silent_p.S170S|NLRP4_ENST00000346986.5_Silent_p.S245S	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	245	NACHT.			ATP binding	breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)	AACCCGATTCGGATCTGTGTG	0.562	0	80.0	84.0	82.0	19	56369494	2203	4300	6503	SO:0001819	synonymous_variant	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08			"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4	12563287, 12019269	Standard	NM_134444	Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.735G>A	19.37:g.56369494G>A		Q86W87|Q96AY6	ENST00000301295.6	37	CCDS12936.1																																																																																			NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2		82.952827	0	-4	101	0	0	1	0	NM_134444	26	83.014015	30	0.464286
CCAR1	55749	broad.mit.edu	hg19	10	70516034	70516034	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:70516034C>T	ENST00000265872.6	+	14	1749	c.1630C>T	c.(1630-1632)Cgt>Tgt	p.R544C	CCAR1_ENST00000543719.1_Missense_Mutation_p.R529C|CCAR1_ENST00000535016.1_Missense_Mutation_p.R529C|CCAR1_ENST00000483264.1_3'UTR	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	544		apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding	NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56					CAACAGGTACCGTTTTGCAGA	0.423	0	106.0	103.0	104.0	10	70516034	2203	4300	6503	SO:0001583	missense	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339		24236	protein-coding gene	gene with protein product		612569			12816952	Standard	NM_018237	Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1630C>T	10.37:g.70516034C>T	ENSP00000265872:p.Arg544Cys	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	ENST00000265872.6	37	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533655	0.45073	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.992	T	0.78316	-0.2251	10	0.87932	D	0	-4.7661	19.1212	0.93364	0.0:1.0:0.0:0.0	.	529;544;518	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	C	544;529;529;529;518;349	ENSP00000265872:R544C;ENSP00000441820:R529C;ENSP00000445254:R529C;ENSP00000439252:R529C;ENSP00000438610:R518C;ENSP00000439642:R349C	ENSP00000265872:R544C	R	+	1	0	CCAR1	70186040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.725000	0.84808	2.533000	0.85409	0.585000	0.79938	CGT	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2		3.303783	0	21	57	0	0	1	0	NM_018237	3	7.591851	25	0.107143
SPG7	6687	broad.mit.edu	hg19	16	89614493	89614493	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:89614493C>T	ENST00000268704.2	+	12	1650	c.1635C>T	c.(1633-1635)ttC>ttT	p.F545F		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	545		cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)	CTCTCAACTTCGAGTACGCCG	0.627	0	97.0	87.0	90.0	16	89614493	2198	4300	6498	SO:0001819	synonymous_variant	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912	"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR	9635427, 9634528	Standard	XM_006721264	Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1635C>T	16.37:g.89614493C>T		O75756|Q2TB70|Q58F00|Q96IB0	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	C	9.278	1.047297	0.19827	.	.	ENSG00000197912	ENST00000312613	.	.	.	5.47	-5.4	0.02656	.	.	.	.	.	T	0.66036	0.2749	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71922	-0.4446	5	0.87932	D	0	-0.0792	10.9495	0.47321	0.0:0.1874:0.0991:0.7135	.	.	.	.	L	20	.	ENSP00000310320:S20L	S	+	2	0	SPG7	88141994	0.084000	0.21492	0.873000	0.34254	0.599000	0.36880	-0.747000	0.04823	-0.750000	0.04740	0.561000	0.74099	TCG	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2		33.314643	0	-20	81	0	0	1	0	NM_003119	14	38.766676	54	0.205882
ZCCHC2	54877	broad.mit.edu	hg19	18	60242302	60242302	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:60242302C>T	ENST00000269499.5	+	13	3406	c.2988C>T	c.(2986-2988)aaC>aaT	p.N996N	ZCCHC2_ENST00000586834.1_Silent_p.N675N	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	996		cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding	breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25					GGAACACGAACGCTAATGGGA	0.597	0	80.0	88.0	86.0	18	60242302	2149	4251	6400	SO:0001819	synonymous_variant	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664	"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49	11214970	Standard	NM_017742	Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2988C>T	18.37:g.60242302C>T		B2RPG6|Q8N3S1|Q9NXF6	ENST00000269499.5	37	CCDS45880.1																																																																																			ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1		9.589140	0	-16	26	0	0	1	0	NM_017742	4	11.062169	15	0.210526
SLC6A9	6536	broad.mit.edu	hg19	1	44463572	44463572	+	Silent	SNP	G	G	A	rs145370858		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:44463572G>A	ENST00000372310.3	-	13	1827	c.1662C>T	c.(1660-1662)taC>taT	p.Y554Y	SLC6A9_ENST00000360584.2_Silent_p.Y627Y|SLC6A9_ENST00000475075.2_Silent_p.Y443Y|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000357730.2_Silent_p.Y573Y	NM_001024845.2	NP_001020016.1	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	627			integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			GGAACATGGCGTAGAGGGGGA	0.637	0	112.0	111.0	111.0	1	44463572	2203	4300	6503	SO:0001819	synonymous_variant	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517	"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019			8183239, 7587377	Standard	NM_006934	Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000372310.3:c.1662C>T	1.37:g.44463572G>A		A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	ENST00000372310.3	37	CCDS30695.1																																																																																			SLC6A9-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022827.1		8.388036	0	-2	44	0	0	1	0	NM_201649	4	10.062871	16	0.200000
LPA	4018	broad.mit.edu	hg19	6	161027540	161027540	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:161027540C>T	ENST00000447678.1	-	18	2874	c.2754G>A	c.(2752-2754)ccG>ccA	p.P918P	LPA_ENST00000316300.5_Silent_p.P918P	NM_005577.2	NP_005568.2	P08519	APOA_HUMAN	lipoprotein, Lp(a)	3426	Kringle 8.	blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	GGCTTGGAATCGGGGTAATAG	0.527	0	95.0	97.0	96.0	6	161027540	1979	4213	6192	SO:0001819	synonymous_variant	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670		6667	protein-coding gene	gene with protein product		152200		LP	3670400	Standard	NM_005577	Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2754G>A	6.37:g.161027540C>T		Q5VTD7|Q9UD88	ENST00000316300.5	37	CCDS43523.1																																																																																			LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1		-12.178249	0	10	138	0	0	1	0	NM_005577	4	7.808217	86	0.044444
ZNF546	339327	broad.mit.edu	hg19	19	40521032	40521032	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:40521032C>T	ENST00000347077.4	+	7	2071	c.1855C>T	c.(1855-1857)Cga>Tga	p.R619*	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Nonsense_Mutation_p.R593*	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	619		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)				GAAAGCCTTTCGATTTCAAAC	0.358	0	45.0	48.0	47.0	19	40521032	2203	4300	6503	SO:0001587	stop_gained	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187	"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49	12477932	Standard	XM_005258853	Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1855C>T	19.37:g.40521032C>T	ENSP00000339823:p.Arg619*	A8K913	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	c	37	6.084811	0.97267	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	.	.	.	2.91	-0.341	0.12639	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	6.3833	0.21546	0.326:0.5006:0.1734:0.0	.	.	.	.	X	619;228	.	ENSP00000339823:R619X	R	+	1	2	ZNF546	45212872	0.000000	0.05858	0.100000	0.21137	0.971000	0.66376	-2.524000	0.00948	0.004000	0.14682	0.591000	0.81541	CGA	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2		23.793081	0	-9	40	0	0	1	0	NM_178544	8	24.263182	15	0.347826
TRAF3	7187	broad.mit.edu	hg19	14	103371684	103371684	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:103371684G>A	ENST00000560371.1	+	11	1487	c.1270G>A	c.(1270-1272)Gac>Aac	p.D424N	TRAF3_ENST00000392745.2_Missense_Mutation_p.D424N|TRAF3_ENST00000351691.5_Missense_Mutation_p.D399N|TRAF3_ENST00000347662.4_Missense_Mutation_p.D399N|TRAF3_ENST00000539721.1_Missense_Mutation_p.D341N	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	424	MATH.	apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)	GAAGATTCGCGACTACAAGCG	0.567	0	108.0	99.0	102.0	14	103371684	2203	4300	6503	SO:0001583	missense	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323		12033	protein-coding gene	gene with protein product		601896			7530216, 7859281	Standard	NM_145725	Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1270G>A	14.37:g.103371684G>A	ENSP00000454207:p.Asp424Asn	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	ENST00000560371.1	37	CCDS9975.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242048	0.79912	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	T;T;T	0.36157	1.27;1.27;1.27	5.45	5.45	0.79879	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.43389	0.1245	N	0.21282	0.65	0.80722	D	1	D;D;D	0.71674	0.998;0.976;0.997	P;P;P	0.60286	0.871;0.5;0.872	T	0.15578	-1.0432	10	0.23891	T	0.37	-32.0079	19.3058	0.94163	0.0:0.0:1.0:0.0	.	341;399;424	Q13114-2;A6NHG8;Q13114	.;.;TRAF3_HUMAN	N	424;399;424;341	ENSP00000376500:D424N;ENSP00000328003:D399N;ENSP00000445998:D341N	ENSP00000328003:D399N	D	+	1	0	TRAF3	102441437	1.000000	0.71417	0.259000	0.24435	0.579000	0.36224	9.869000	0.99810	2.558000	0.86282	0.655000	0.94253	GAC	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1		5.111844	0	4	57	0	0	1	0	NM_145725	3	7.460747	17	0.150000
STK11IP	114790	broad.mit.edu	hg19	2	220473354	220473354	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:220473354C>T	ENST00000456909.1	+	15	1743	c.1653C>T	c.(1651-1653)ggC>ggT	p.G551G	STK11IP_ENST00000295641.10_Silent_p.G562G			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	562	Glu-rich.	protein localization	cytoplasm	protein kinase binding	breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	GGCCTGAGGGCGTACGGGGCA	0.602	0	51.0	56.0	54.0	2	220473354	1991	4145	6136	SO:0001819	synonymous_variant	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589		19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172			11741830	Standard	NM_052902	Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1653C>T	2.37:g.220473354C>T		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	ENST00000456909.1	37																																																																																				STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1		19.884480	0	-10	53	0	0	1	0	NM_052902	8	21.041074	20	0.285714
SHROOM1	134549	broad.mit.edu	hg19	5	132158676	132158676	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:132158676C>T	ENST00000378679.3	-	10	3175	c.2371G>A	c.(2371-2373)Gcc>Acc	p.A791T	SHROOM1_ENST00000378676.1_Missense_Mutation_p.A722T|SHROOM1_ENST00000319854.3_Missense_Mutation_p.A786T	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	791	ASD2.	actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding	endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		GCCAGCAGGGCGCAATAGACG	0.701	0	35.0	32.0	33.0	5	132158676	2199	4298	6497	SO:0001583	missense	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403		24084	protein-coding gene	gene with protein product		611179			11853319, 16615870	Standard	NM_133456	Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.2371G>A	5.37:g.132158676C>T	ENSP00000367950:p.Ala791Thr	B7WP40|B7ZL01|Q8TDP0|Q8TF41	ENST00000378679.3	37	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	C	8.557	0.876877	0.17395	.	.	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676	T;T;T	0.29397	1.57;1.57;1.57	4.92	-0.199	0.13220	Apx/shroom, ASD2 (2);	0.979382	0.08366	N	0.956918	T	0.13970	0.0338	N	0.16478	0.41	0.09310	N	1	B;B	0.29115	0.196;0.233	B;B	0.20384	0.017;0.029	T	0.25745	-1.0123	10	0.22706	T	0.39	-3.01	2.6354	0.04956	0.3393:0.4027:0.1163:0.1417	.	786;791	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	T	791;786;722	ENSP00000367950:A791T;ENSP00000324245:A786T;ENSP00000367947:A722T	ENSP00000324245:A786T	A	-	1	0	SHROOM1	132186575	0.000000	0.05858	0.031000	0.17742	0.506000	0.33950	0.061000	0.14366	-0.168000	0.10853	0.655000	0.94253	GCC	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1		23.395652	0	-1	30	0	0	1	0	NM_133456	8	23.570642	12	0.400000
ZNF860	344787	broad.mit.edu	hg19	3	32030999	32030999	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:32030999G>A	ENST00000360311.4	+	2	977	c.428G>A	c.(427-429)cGa>cAa	p.R143Q		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	143		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(3)|lung(4)|ovary(1)	8					AGATATGATCGAAGGCATCCT	0.403	1	59.0	45.0	49.0	3	32030999	692	1591	2283	SO:0001583	missense	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385	"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product						Standard	NM_001137674	Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.428G>A	3.37:g.32030999G>A	ENSP00000373274:p.Arg143Gln	B4DFA4	ENST00000360311.4	37	CCDS46784.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.623274	0.00820	.	.	ENSG00000197385	ENST00000360311	T	0.04862	3.54	0.336	0.336	0.15958	.	.	.	.	.	T	0.05593	0.0147	L	0.43757	1.38	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40794	-0.9544	8	.	.	.	.	6.424	0.21760	2.0E-4:0.0:0.9998:0.0	.	143	A6NHJ4	ZN860_HUMAN	Q	143	ENSP00000373274:R143Q	.	R	+	2	0	ZNF860	32006003	0.010000	0.17322	0.016000	0.15963	0.015000	0.08874	1.299000	0.33424	0.385000	0.24970	0.385000	0.25706	CGA	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1		4.308537	0	-5	78	0	0	1	0		3	7.605368	21	0.125000
SEPT6	23157	broad.mit.edu	hg19	X	118774741	118774741	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:118774741G>A	ENST00000394610.1	-	6	965	c.701C>T	c.(700-702)cCg>cTg	p.P234L	SEPT6_ENST00000354228.4_Missense_Mutation_p.P234L|SEPT6_ENST00000360156.7_Missense_Mutation_p.P234L|SEPT6_ENST00000394617.2_Missense_Mutation_p.P264L|SEPT6_ENST00000489216.1_Missense_Mutation_p.P234L|SEPT6_ENST00000354416.3_Missense_Mutation_p.P234L|SEPT6_ENST00000343984.5_Missense_Mutation_p.P234L|SEPT6_ENST00000394616.4_Missense_Mutation_p.P176L	NM_145799.3	NP_665798.1	Q14141	SEPT6_HUMAN	septin 6	234		cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding	central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17					GACAGCAAACGGCAGGTGGGC	0.547	0	142.0	98.0	113.0	X	118774741	2203	4300	6503	SO:0001583	missense	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354	"""Septins"""	15848	protein-coding gene	gene with protein product		300683			8590280, 10744683	Standard	NM_015129	Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000394610.1:c.701C>T	X.37:g.118774741G>A	ENSP00000378108:p.Pro234Leu	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	ENST00000394610.1	37	CCDS14585.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847985	0.91277	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617;ENST00000520510	T;T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.92779	0.7704	H	0.99555	4.625	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.95982	0.8978	10	0.87932	D	0	.	17.5271	0.87803	0.0:0.0:1.0:0.0	.	264;176;234;234	F5H1J5;B4E049;Q14141;Q548C9	.;.;SEPT6_HUMAN;.	L	234;234;234;234;234;234;176;264;234	ENSP00000353278:P234L;ENSP00000346169:P234L;ENSP00000418715:P234L;ENSP00000346397:P234L;ENSP00000378108:P234L;ENSP00000341524:P234L;ENSP00000378114:P176L;ENSP00000378115:P264L	ENSP00000341524:P234L	P	-	2	0	SEPT6	118658769	1.000000	0.71417	0.940000	0.37924	0.874000	0.50279	9.476000	0.97823	2.354000	0.79902	0.594000	0.82650	CCG	SEPT6-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058061.1		55.136603	0	-3	73	0	0	1	0	NM_145802	18	56.108414	33	0.352941
INPP5F	22876	broad.mit.edu	hg19	10	121551527	121551527	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:121551527C>T	ENST00000361976.2	+	5	757	c.591C>T	c.(589-591)gaC>gaT	p.D197D	INPP5F_ENST00000369081.1_Silent_p.D101D|INPP5F_ENST00000369083.3_Silent_p.D197D	NM_014937.3	NP_055752.1	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	197	SAC.			phosphoric ester hydrolase activity	breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)	GGGAGAGGGACGGTCGGCCCC	0.502	0	159.0	162.0	161.0	10	121551527	2203	4300	6503	SO:0001819	synonymous_variant	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825		17054	protein-coding gene	gene with protein product		609389			10231032, 11274189	Standard	NM_014937	Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.591C>T	10.37:g.121551527C>T		A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	ENST00000361976.2	37	CCDS7616.1																																																																																			INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1		85.355508	0	-14	103	0	0	1	0	NM_014937	29	86.481571	49	0.371795
ULK1	8408	broad.mit.edu	hg19	12	132396495	132396495	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:132396495C>T	ENST00000321867.4	+	13	1308	c.957C>T	c.(955-957)ggC>ggT	p.G319G		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	319	Interaction with GABARAP and GABARAPL2.	autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity	breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)	AGTCCCTGGGCGAGATGCAGC	0.647	0	49.0	47.0	48.0	12	132396495	2203	4299	6502	SO:0001819	synonymous_variant	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169		12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""		9693035	Standard	NM_003565	Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.957C>T	12.37:g.132396495C>T		Q9UQ28	ENST00000321867.4	37	CCDS9274.1																																																																																			ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		48.497029	0	-5	57	0	0	1	0		16	48.620791	12	0.571429
LAMA3	3909	broad.mit.edu	hg19	18	21484018	21484018	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:21484018G>A	ENST00000313654.9	+	50	6681	c.6440G>A	c.(6439-6441)cGg>cAg	p.R2147Q	LAMA3_ENST00000587184.1_Missense_Mutation_p.R482Q|LAMA3_ENST00000399516.3_Missense_Mutation_p.R2091Q|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.R538Q	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2147	Domain II and I.	cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				AAGCACGCGCGGTCCTTACAA	0.512	0	81.0	83.0	82.0	18	21484018	2203	4300	6503	SO:0001583	missense	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747	"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA	8077230	Standard	NM_000227	Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6440G>A	18.37:g.21484018G>A	ENSP00000324532:p.Arg2147Gln	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	0.212	-1.035403	0.02029	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.77358	2.31;-1.09;2.0	6.11	4.95	0.65309	.	.	.	.	.	T	0.36220	0.0959	N	0.00182	-1.905	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.42783	-0.9431	9	0.02654	T	1	.	6.3132	0.21176	0.7524:0.0:0.1292:0.1184	.	482;538;2091;2147	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	Q	2147;2091;538	ENSP00000324532:R2147Q;ENSP00000382432:R2091Q;ENSP00000269217:R538Q	ENSP00000269217:R538Q	R	+	2	0	LAMA3	19738016	0.993000	0.37304	0.064000	0.19789	0.049000	0.14656	3.166000	0.50785	0.549000	0.28973	-0.254000	0.11334	CGG	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3		1.460779	0	-7	112	0	0	1	0	NM_000227, NM_198129	7	16.280938	77	0.083333
EFEMP2	30008	broad.mit.edu	hg19	11	65638031	65638031	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:65638031G>A	ENST00000307998.6	-	5	696	c.466C>T	c.(466-468)Cgc>Tgc	p.R156C	EFEMP2_ENST00000528176.1_Missense_Mutation_p.R156C	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	156	EGF-like 2; calcium-binding (Potential).	blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity	cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)	CCGATCTTGCGGTAACCATCA	0.622	0	87.0	74.0	78.0	11	65638031	2201	4296	6497	SO:0001583	missense	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638	"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""		10601734, 10982184	Standard	NR_037718	Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000528176.1:c.466C>T	11.37:g.65638031G>A	ENSP00000434151:p.Arg156Cys	A8K7R4|B3KM31|B3KQT1|O75967	ENST00000528176.1	37		.	.	.	.	.	.	.	.	.	.	G	22.9	4.346497	0.82022	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;D;D;D	0.87571	-2.27;-2.27;-2.24;-2.27	5.3	4.35	0.52113	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.42053	D	0.000778	D	0.92678	0.7673	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.993	D	0.92183	0.5753	10	0.52906	T	0.07	.	11.3294	0.49467	0.0:0.0:0.7056:0.2944	.	156;156	E9PRU1;O95967	.;FBLN4_HUMAN	C	156	ENSP00000434151:R156C;ENSP00000309953:R156C;ENSP00000435419:R156C;ENSP00000435963:R156C	ENSP00000309953:R156C	R	-	1	0	EFEMP2	65394607	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.374000	0.59543	2.761000	0.94854	0.561000	0.74099	CGC	EFEMP2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000391858.1		34.255824	0	5	29	0	0	1	0	NM_016938	10	34.832819	4	0.714286
NUP210	23225	broad.mit.edu	hg19	3	13370329	13370329	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:13370329C>T	ENST00000254508.5	-	31	4310	c.4228G>A	c.(4228-4230)Gac>Aac	p.D1410N		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1410		carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)				CCAGAGTTGTCGTGGAAGTGG	0.547	0	137.0	122.0	127.0	3	13370329	2203	4300	6503	SO:0001583	missense	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182		30052	protein-coding gene	gene with protein product		607703			2184032, 7504063	Standard	NM_024923	Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4228G>A	3.37:g.13370329C>T	ENSP00000254508:p.Asp1410Asn	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114160	0.56398	.	.	ENSG00000132182	ENST00000254508	T	0.17054	2.3	5.41	5.41	0.78517	.	0.117155	0.64402	D	0.000020	T	0.36248	0.0960	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	P	0.59115	0.852	T	0.01215	-1.1416	10	0.29301	T	0.29	-36.046	19.5739	0.95434	0.0:1.0:0.0:0.0	.	1410	Q8TEM1	PO210_HUMAN	N	1410	ENSP00000254508:D1410N	ENSP00000254508:D1410N	D	-	1	0	NUP210	13345329	1.000000	0.71417	0.925000	0.36789	0.023000	0.10783	7.755000	0.85180	2.691000	0.91804	0.563000	0.77884	GAC	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1		77.742315	0	17	77	0	0	1	0	NM_024923	22	80.913576	2	0.916667
KMT2D	8085	broad.mit.edu	hg19	12	49433784	49433784	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:49433784G>A	ENST00000301067.7	-	31	7768	c.7769C>T	c.(7768-7770)tCg>tTg	p.S2590L		NM_003482.3	NP_003473.3			lysine (K)-specific methyltransferase 2D												GGGGCTGCCCGATGGGTGGAA	0.657	0	33.0	38.0	37.0	12	49433784	1912	4117	6029	SO:0001583	missense	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2	9247308	Standard	NM_003482	Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7769C>T	12.37:g.49433784G>A	ENSP00000301067:p.Ser2590Leu	O14687	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	9.695	1.152869	0.21371	.	.	ENSG00000167548	ENST00000301067	T	0.79141	-1.24	5.24	4.3	0.51218	.	0.000000	0.32147	N	0.006511	T	0.60818	0.2298	N	0.14661	0.345	0.27095	N	0.962752	B	0.06786	0.001	B	0.06405	0.002	T	0.57106	-0.7868	10	0.87932	D	0	.	9.7506	0.40473	0.0817:0.1445:0.7738:0.0	.	2590	O14686	MLL2_HUMAN	L	2590	ENSP00000301067:S2590L	ENSP00000301067:S2590L	S	-	2	0	MLL2	47720051	0.869000	0.29996	1.000000	0.80357	0.992000	0.81027	1.698000	0.37794	2.609000	0.88269	0.591000	0.81541	TCG	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		6.818385	0	-3	18	0	0	1	0		3	7.681915	10	0.230769
ISG15	9636	broad.mit.edu	hg19	1	949767	949767	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:949767C>T	ENST00000379389.4	+	2	558	c.407C>T	c.(406-408)cCg>cTg	p.P136L		NM_005101.3	NP_005092.1	P05161	ISG15_HUMAN	ISG15 ubiquitin-like modifier	136	Ubiquitin-like 2.	cell-cell signaling|interspecies interaction between organisms|ISG15-protein conjugation|negative regulation of type I interferon production|response to virus|type I interferon-mediated signaling pathway	cytosol|extracellular space	protein binding	endometrium(1)|lung(1)|upper_aerodigestive_tract(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.05e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.54e-23)|Colorectal(212;5.37e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00238)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	GACCAGCTCCCGCTGGGGGAG	0.677	0	45.0	49.0	47.0	1	949767	2203	4299	6502	SO:0001583	missense	BC009507	CCDS6.1	1p36.33	2008-02-05	2006-04-28	2006-04-28	ENSG00000187608	ENSG00000187608		4053	protein-coding gene	gene with protein product		147571	"""interferon, alpha-inducible protein (clone IFI-15K)"""	G1P2	3087979	Standard	NM_005101	Approved	IFI15, UCRP	uc001acj.4	P05161	OTTHUMG00000040777	ENST00000379389.4:c.407C>T	1.37:g.949767C>T	ENSP00000368699:p.Pro136Leu	Q5SVA4|Q7Z2G2|Q96GF0	ENST00000379389.4	37	CCDS6.1	.	.	.	.	.	.	.	.	.	.	C	6.876	0.531106	0.13127	.	.	ENSG00000187608	ENST00000379389	T	0.73897	-0.79	4.21	-8.43	0.00953	Ubiquitin supergroup (1);Ubiquitin (2);	8.594950	0.00166	N	0.000000	T	0.49423	0.1556	N	0.16233	0.39	0.09310	N	1	B	0.28512	0.214	B	0.14023	0.01	T	0.40979	-0.9534	10	0.87932	D	0	-7.5699	0.9151	0.01303	0.2529:0.3409:0.2148:0.1914	.	136	P05161	ISG15_HUMAN	L	136	ENSP00000368699:P136L	ENSP00000368699:P136L	P	+	2	0	ISG15	939630	0.000000	0.05858	0.000000	0.03702	0.295000	0.27426	-3.609000	0.00415	-1.993000	0.00974	0.561000	0.74099	CCG	ISG15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097989.1		6.847923	0	-4	52	0	0	1	0	NM_005101	5	12.585325	36	0.121951
SALL3	27164	broad.mit.edu	hg19	18	76754682	76754682	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:76754682C>T	ENST00000536229.3	+	1	3001	c.2292C>T	c.(2290-2292)tcC>tcT	p.S764S	SALL3_ENST00000537592.2_Silent_p.S897S|SALL3_ENST00000575389.2_Silent_p.S897S			Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	897		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	CCGCCCTGTCCGAGTCCTCGT	0.731	0	11.0	14.0	13.0	18	76754682	2034	4017	6051	SO:0001819	synonymous_variant	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463	"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""		10610715	Standard	NM_171999	Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2691C>T	18.37:g.76754682C>T		Q9UGH1	ENST00000537592.2	37	CCDS12013.1																																																																																			SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1		50.533232	0	-1	29	0	0	1	0	NM_171999	15	51.180417	7	0.681818
LRFN1	57622	broad.mit.edu	hg19	19	39805081	39805081	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:39805081G>A	ENST00000248668.4	-	1	895	c.896C>T	c.(895-897)cCg>cTg	p.P299L		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	299	Ig-like.		cell junction|integral to membrane|postsynaptic density|postsynaptic membrane		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		TGTGATCAGCGGGGGCTCACA	0.706	0	15.0	20.0	18.0	19	39805081	2116	4238	6354	SO:0001583	missense	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807			10819331, 16828986	Standard	NM_020862	Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.896C>T	19.37:g.39805081G>A	ENSP00000248668:p.Pro299Leu	Q8TBS9	ENST00000248668.4	37	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393017	0.83011	.	.	ENSG00000128011	ENST00000248668	D	0.93189	-3.18	4.53	4.53	0.55603	Immunoglobulin-like (1);	0.000000	0.44483	D	0.000453	D	0.97682	0.9240	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97812	1.0251	10	0.38643	T	0.18	.	14.7902	0.69837	0.0:0.0:1.0:0.0	.	299	Q9P244	LRFN1_HUMAN	L	299	ENSP00000248668:P299L	ENSP00000248668:P299L	P	-	2	0	LRFN1	44496921	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.603000	0.98315	2.352000	0.79861	0.655000	0.94253	CCG	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1		23.327833	0	14	25	0	0	1	0	NM_020862	7	23.507782	4	0.636364
FMO2	2327	broad.mit.edu	hg19	1	171174750	171174750	+	Missense_Mutation	SNP	G	G	A	rs72549336		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:171174750G>A	ENST00000441535.1	+	7	1277	c.1160G>A	c.(1159-1161)cGt>cAt	p.R387H	RP1-127D3.4_ENST00000445909.1_RNA|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA|FMO2_ENST00000209929.7_Missense_Mutation_p.R387H	NM_001460.2	NP_001451.1	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2 (non-functional)	387		drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				CTTCAAGCTCGTTGGGTGACA	0.468	0	43.0	42.0	42.0	1	171174750	2203	4299	6502	SO:0001583	missense	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963		3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""		1417778, 9804831	Standard	XR_426768	Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1160G>A	1.37:g.171174750G>A	ENSP00000209929:p.Arg387His	Q53XR0	ENST00000209929.7	37	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	G	35	5.460870	0.96240	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.63580	-0.05;-0.05	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81009	0.4734	H	0.94385	3.53	0.80722	D	1	D	0.61697	0.99	P	0.58577	0.841	D	0.85749	0.1342	10	0.72032	D	0.01	-17.9497	18.6468	0.91413	0.0:0.0:1.0:0.0	.	387	Q99518	FMO2_HUMAN	H	387	ENSP00000209929:R387H;ENSP00000405905:R387H	ENSP00000209929:R387H	R	+	2	0	FMO2	169441374	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.732000	0.74790	2.768000	0.95171	0.655000	0.94253	CGT	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2		44.303176	0	-10	36	0	0	1	0	NM_001460	15	44.364388	18	0.454545
DCTN1	1639	broad.mit.edu	hg19	2	74596484	74596484	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:74596484C>T	ENST00000361874.3	-	14	1844	c.1527G>A	c.(1525-1527)acG>acA	p.T509T	DCTN1_ENST00000409567.3_Silent_p.T489T|DCTN1_ENST00000409868.1_Silent_p.T492T|DCTN1_ENST00000409438.1_Silent_p.T375T|DCTN1_ENST00000409240.1_Silent_p.T472T|DCTN1_ENST00000394003.3_Silent_p.T502T|DCTN1_ENST00000407639.2_Silent_p.T375T	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	509		cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45					AGTCTGCAACCGTCTCCTGGG	0.617	0	160.0	152.0	155.0	2	74596484	2203	4300	6503	SO:0001819	synonymous_variant		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843		2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""		1828535	Standard	NM_001190836	Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1527G>A	2.37:g.74596484C>T		A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	ENST00000361874.3	37	CCDS1939.1																																																																																			DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3		11.461393	0	-1	49	0	0	1	0	NM_004082	5	13.553491	20	0.200000
CLPSL2	389383	broad.mit.edu	hg19	6	35745315	35745315	+	Missense_Mutation	SNP	T	T	G			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:35745315T>G	ENST00000360454.2	+	2	168	c.164T>G	c.(163-165)tTc>tGc	p.F55C	CLPSL2_ENST00000403376.3_Missense_Mutation_p.F55C|CLPSL2_ENST00000481904.1_3'UTR			Q6UWE3	CF126_HUMAN	colipase-like 2	55		digestion|lipid catabolic process	extracellular region	enzyme activator activity							GGTGGAGCCTTCTGTGCCCCC	0.567	0	61.0	57.0	58.0	6	35745315	2203	4300	6503	SO:0001583	missense		CCDS4810.2, CCDS69095.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000196748	ENSG00000196748		21250	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 126"""	C6orf126		Standard	NM_001286550	Approved	dJ510O8.5, UNQ3045	uc010jvz.1	Q6UWE3	OTTHUMG00000014581	ENST00000403376.3:c.164T>G	6.37:g.35745315T>G	ENSP00000385898:p.Phe55Cys	B0QZ45|Q5T9G3	ENST00000403376.3	37	CCDS4810.2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114540	0.77210	.	.	ENSG00000196748	ENST00000360454;ENST00000403376	.	.	.	3.41	3.41	0.39046	.	0.202751	0.24960	N	0.034231	T	0.54078	0.1836	L	0.57536	1.79	0.32740	N	0.507765	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.57665	-0.7772	9	0.87932	D	0	-35.2339	8.5441	0.33410	0.0:0.0:0.0:1.0	.	55;55	Q6UWE3;Q6UWE3-2	CF126_HUMAN;.	C	55	.	ENSP00000353639:F55C	F	+	2	0	C6orf126	35853293	0.991000	0.36638	0.966000	0.40874	0.784000	0.44337	0.961000	0.29267	1.782000	0.52362	0.459000	0.35465	TTC	CLPSL2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280618.2		15.936085	0	0	49	0	0	1	0	NM_207409	6	17.852035	21	0.222222
SLC25A28	81894	broad.mit.edu	hg19	10	101370891	101370891	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:101370891G>A	ENST00000370495.4	-	4	838	c.810C>T	c.(808-810)tgC>tgT	p.C270C	SLC25A28_ENST00000496035.1_5'UTR	NM_031212.3	NP_112489.3	Q96A46	MFRN2_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 28	270		ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane		endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|stomach(1)	11		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)	CAGCTCCTGCGCAAGCTCCAG	0.537	0	75.0	77.0	76.0	10	101370891	1965	4152	6117	SO:0001819	synonymous_variant	AF327402	CCDS41559.1	10q24.2	2013-05-22	2012-03-29		ENSG00000155287	ENSG00000155287	"""Solute carriers"""	23472	protein-coding gene	gene with protein product	"""mitoferrin 2"""	609767	"""solute carrier family 25, member 28"""		11297739	Standard	NM_031212	Approved	MRS3/4, MRS4L	uc001kpx.2	Q96A46	OTTHUMG00000018886	ENST00000370495.4:c.810C>T	10.37:g.101370891G>A		Q4VBZ0|Q5T777|Q86VX5|Q969G8|Q9H2J3	ENST00000370495.4	37	CCDS41559.1																																																																																			SLC25A28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049801.1		24.600335	0	1	56	0	0	1	0	NM_031212	11	28.402699	40	0.215686
CCDC180	100499483	broad.mit.edu	hg19	9	100071854	100071854	+	Silent	SNP	C	C	T	rs147529206		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:100071854C>T	ENST00000375202.2	+	17	1712	c.360C>T	c.(358-360)aaC>aaT	p.N120N	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000357054.1_Silent_p.N259N|CCDC180_ENST00000411667.2_Silent_p.N120N|CCDC180_ENST00000395220.1_Silent_p.N259N|CCDC180_ENST00000529487.1_Silent_p.N120N|CCDC180_ENST00000460482.2_3'UTR					coiled-coil domain containing 180												GCCTCCCCAACGACTGGATCA	0.537	0	95.0	73.0	81.0	9	100071854	2203	4300	6503	SO:0001819	synonymous_variant	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816		29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174	10819331	Standard	NM_020893	Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000529487.1:c.360C>T	9.37:g.100071854C>T		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	ENST00000529487.1	37	CCDS35077.2																																																																																			CCDC180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383515.2		23.262803	0	-14	37	0	0	1	0	NM_020893	9	24.638228	23	0.281250
ABCA3	21	broad.mit.edu	hg19	16	2347526	2347526	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:2347526G>A	ENST00000301732.5	-	17	2767	c.2067C>T	c.(2065-2067)gaC>gaT	p.D689D	ABCA3_ENST00000382381.3_Silent_p.D631D	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	689	ABC transporter 1.	response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			AGGTGGGCTCGTCCAGTATCA	0.637	0	97.0	77.0	84.0	16	2347526	2198	4300	6498	SO:0001819	synonymous_variant	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972	"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3	8706931	Standard	NM_001089	Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000382381.3:c.1893C>T	16.37:g.2347526G>A		B2RU09|Q54A95|Q6P5P9|Q92473	ENST00000382381.3	37																																																																																				ABCA3-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000435440.1		19.626932	0	-34	41	0	0	1	0	NM_001089	8	22.149790	28	0.222222
LRFN3	79414	broad.mit.edu	hg19	19	36430628	36430628	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:36430628G>A	ENST00000588831.1	+	3	1355	c.301G>A	c.(301-303)Ggc>Agc	p.G101S	LRFN3_ENST00000246529.3_Missense_Mutation_p.G101S			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	101		cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane		cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)		CGTGGCTGCCGGCGCCTTCGC	0.697	0	13.0	14.0	14.0	19	36430628	2110	4112	6222	SO:0001583	missense	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809			12975309, 16495444, 16828986	Standard	NM_024509	Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.301G>A	19.37:g.36430628G>A	ENSP00000466989:p.Gly101Ser	Q6UY10	ENST00000588831.1	37	CCDS12483.1	.	.	.	.	.	.	.	.	.	.	G	3.104	-0.184233	0.06340	.	.	ENSG00000126243	ENST00000246529	T	0.58940	0.3	4.5	4.5	0.54988	.	0.000000	0.35495	N	0.003172	T	0.45135	0.1327	L	0.49571	1.57	0.18873	N	0.999982	B	0.34264	0.446	B	0.24848	0.056	T	0.34650	-0.9820	10	0.23302	T	0.38	.	11.0601	0.47942	0.0:0.1885:0.8115:0.0	.	101	Q9BTN0	LRFN3_HUMAN	S	101	ENSP00000246529:G101S	ENSP00000246529:G101S	G	+	1	0	LRFN3	41122468	0.004000	0.15560	0.668000	0.29813	0.079000	0.17450	0.515000	0.22801	2.231000	0.72958	0.557000	0.71058	GGC	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2		52.207092	0	21	52	0	0	1	0	NM_024509	16	52.797645	8	0.666667
ADCY9	115	broad.mit.edu	hg19	16	4164055	4164055	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:4164055G>A	ENST00000294016.3	-	2	1927	c.1389C>T	c.(1387-1389)atC>atT	p.I463I		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	463	Guanylate cyclase 1.	activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					GGCCCATCTCGATGCAGCAGT	0.597	0	87.0	93.0	91.0	16	4164055	2197	4300	6497	SO:0001819	synonymous_variant	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302			9628827	Standard	NM_001116	Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1389C>T	16.37:g.4164055G>A		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	ENST00000294016.3	37	CCDS32382.1																																																																																			ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		5.309029	0	1	82	0	0	1	0		6	14.388341	52	0.103448
TCEB3CL	728929	broad.mit.edu	hg19	18	44549182	44549182	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:44549182C>T	ENST00000451265.1	-	1	1352	c.1117G>A	c.(1117-1119)Gat>Aat	p.D373N	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_001100817.1	NP_001094287.1			transcription elongation factor B polypeptide 3C-like						central_nervous_system(1)|lung(1)|prostate(1)	3					TACGGCTGATCGGGCGTCCAC	0.582	0	260.0	221.0	234.0	18	44549182	1740	3470	5210	SO:0001583	missense			18q21.1	2007-07-10				ENSG00000275553		31007	protein-coding gene	gene with protein product						Standard	NM_001100817	Approved	HsT828		Q3SY89		ENST00000451265.1:c.1117G>A	18.37:g.44549182C>T	ENSP00000409932:p.Asp373Asn	Q3MI93	ENST00000451265.1	37	CCDS42433.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502292	0.26949	.	.	ENSG00000234298	ENST00000451265	T	0.33654	1.4	1.5	-2.22	0.06952	.	1.096110	0.07174	N	0.852816	T	0.24431	0.0592	L	0.37697	1.125	0.09310	N	1	P	0.38078	0.617	B	0.29663	0.105	T	0.15983	-1.0418	10	0.48119	T	0.1	-5.2221	10.3053	0.43676	0.0:0.4154:0.5846:0.0	.	373	Q3SY89	EA3L1_HUMAN	N	373	ENSP00000409932:D373N	ENSP00000409932:D373N	D	-	1	0	TCEB3CL	42803180	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.782000	0.38654	-0.691000	0.05135	-1.169000	0.01745	GAT	TCEB3CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451071.1		6.861004	0	10	406	0	0	1	0	XM_001132059	19	42.915044	193	0.089623
LRP2BP	55805	broad.mit.edu	hg19	4	186295495	186295495	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:186295495G>A	ENST00000362004.3	-	4	1268	c.457C>T	c.(457-459)Cga>Tga	p.R153*	RP11-714G18.1_ENST00000514884.1_RNA|LRP2BP_ENST00000505916.1_Nonsense_Mutation_p.R151*|LRP2BP_ENST00000510776.1_Nonsense_Mutation_p.R125*|LRP2BP_ENST00000328559.7_Nonsense_Mutation_p.R151*			Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	151			cytoplasm	protein binding	breast(1)|endometrium(2)|large_intestine(6)|lung(3)|prostate(1)|skin(2)	15		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)	TCATTTGATCGTTTAACACCT	0.388	0	180.0	170.0	173.0	4	186295495	2203	4300	6503	SO:0001587	stop_gained	AB037746	CCDS3840.1	4q35.1	2011-05-03			ENSG00000109771	ENSG00000109771		25434	protein-coding gene	gene with protein product					10718198, 12508107	Standard	NM_018409	Approved	DKFZp761O0113	uc003ixj.2	Q9P2M1	OTTHUMG00000160460	ENST00000328559.7:c.451C>T	4.37:g.186295495G>A	ENSP00000332681:p.Arg151*	A6NJR7|A7E219|B3KX83|Q9NSN6	ENST00000328559.7	37	CCDS3840.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	50	16.899404	0.99874	4.54E-4	0.0	ENSG00000109771	ENST00000362004;ENST00000328559;ENST00000510776;ENST00000505916;ENST00000511404	.	.	.	5.56	4.66	0.58398	.	0.348304	0.28109	N	0.016572	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-5.8142	13.9676	0.64218	0.0:0.0:0.6787:0.3213	.	.	.	.	X	153;151;125;151;151	.	ENSP00000332681:R151X	R	-	1	2	LRP2BP	186532489	0.081000	0.21417	0.205000	0.23548	0.678000	0.39670	2.278000	0.43426	1.304000	0.44892	0.563000	0.77884	CGA	LRP2BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360679.2		77.565604	0	-25	80	0	0	1	0	NM_018409	25	77.998302	36	0.409836
C3orf56	285311	broad.mit.edu	hg19	3	126915881	126915881	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:126915881C>T	ENST00000398112.1	+	2	593	c.353C>T	c.(352-354)cCg>cTg	p.P118L		NM_001007534.2	NP_001007535.1			chromosome 3 open reading frame 56						breast(1)|endometrium(2)|kidney(1)|lung(5)	9				GBM - Glioblastoma multiforme(114;0.142)	ATAGGAAGTCCGTATCTGGCT	0.597	0	127.0	135.0	133.0	3	126915881	1897	4122	6019	SO:0001583	missense	AK097460	CCDS63757.1	3q21.3	2012-08-08			ENSG00000214324	ENSG00000214324		32481	protein-coding gene	gene with protein product					14702039	Standard	NM_001007534	Approved	FLJ40141	uc003eji.1	Q8N813	OTTHUMG00000159593	ENST00000398112.1:c.353C>T	3.37:g.126915881C>T	ENSP00000381182:p.Pro118Leu	B2RNW5	ENST00000398112.1	37		.	.	.	.	.	.	.	.	.	.	C	1.279	-0.610791	0.03690	0.0	1.21E-4	ENSG00000214324	ENST00000398112	.	.	.	2.04	-0.411	0.12370	.	.	.	.	.	T	0.11367	0.0277	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31110	-0.9955	7	0.02654	T	1	.	2.7604	0.05305	0.4743:0.2745:0.0:0.2512	.	118	Q8N813	CC056_HUMAN	L	118	.	ENSP00000381182:P118L	P	+	2	0	C3orf56	128398571	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.072000	0.11486	-0.108000	0.12066	-1.522000	0.00932	CCG	C3orf56-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000356354.1		207.511649	0	-48	243	0	0	1	0		61	211.935273	21	0.743902
PPEF1	5475	broad.mit.edu	hg19	X	18775810	18775810	+	Silent	SNP	G	G	A	rs143899775		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:18775810G>A	ENST00000361511.4	+	8	956	c.462G>A	c.(460-462)ccG>ccA	p.P154P	PPEF1_ENST00000359763.6_Silent_p.P101P|PPEF1_ENST00000543630.1_Silent_p.P154P|PPEF1_ENST00000349874.5_Silent_p.P154P|PPEF1_ENST00000544635.1_Silent_p.P89P	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	154	Catalytic.	detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)				AGCAAATGCCGAATTTCACTC	0.413	0	214.0	200.0	205.0	X	18775810	2203	4300	6503	SO:0001819	synonymous_variant	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF	9215685, 9326663	Standard	NM_152224	Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.462G>A	X.37:g.18775810G>A		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	ENST00000361511.4	37	CCDS14188.1																																																																																			PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3		279.553652	0	1	224	0	0	1	0	NM_006240	89	280.223204	114	0.438424
ERAP2	64167	broad.mit.edu	hg19	5	96219534	96219534	+	Missense_Mutation	SNP	G	G	A	rs73150323	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:96219534G>A	ENST00000437043.3	+	3	1325	c.614G>A	c.(613-615)cGc>cAc	p.R205H	ERAP2_ENST00000510309.1_Missense_Mutation_p.R205H|ERAP2_ENST00000379904.4_Missense_Mutation_p.R205H|CTD-2260A17.2_ENST00000501338.1_Intron	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	205		antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)	ACCCAGGCACGCATGGCTTTC	0.438	0	89.0	83.0	86.0	5	96219534	2203	4300	6503	SO:0001583	missense	AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308		29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497			12799365, 15908954	Standard	NM_022350	Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.614G>A	5.37:g.96219534G>A	ENSP00000400376:p.Arg205His	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	ENST00000437043.3	37	CCDS4086.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	24.3	4.521248	0.85600	9.08E-4	0.0	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000513084;ENST00000379904;ENST00000510309	T;T;T;T;T	0.11063	2.87;2.87;2.87;2.81;2.87	5.13	3.26	0.37387	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.178796	0.36854	N	0.002371	T	0.49813	0.1579	H	0.99368	4.535	0.39718	D	0.971428	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65030	-0.6267	10	0.87932	D	0	.	9.8843	0.41253	0.1812:0.0:0.8188:0.0	.	205;205	Q6P179-3;Q6P179	.;ERAP2_HUMAN	H	205	ENSP00000400376:R205H;ENSP00000421175:R205H;ENSP00000421849:R205H;ENSP00000369235:R205H;ENSP00000425758:R205H	ENSP00000369235:R205H	R	+	2	0	ERAP2	96245290	0.888000	0.30383	0.011000	0.14972	0.962000	0.63368	4.905000	0.63286	0.593000	0.29745	0.557000	0.71058	CGC	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2		47.157135	0	-7	61	0	0	1	0	NM_022350	17	48.412201	34	0.333333
SBSPON	157869	broad.mit.edu	hg19	8	73993379	73993379	+	Missense_Mutation	SNP	C	C	T	rs34728970		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:73993379C>T	ENST00000297354.6	-	2	488	c.284G>A	c.(283-285)cGt>cAt	p.R95H	SBSPON_ENST00000519697.1_5'UTR	NM_153225.3	NP_694957.3	Q8IVN8	RPESP_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	95	TSP type-1.	immune response	extracellular region	polysaccharide binding|scavenger receptor activity							CCTCCGCACACGGGTTGTAGG	0.652	0	65.0	72.0	70.0	8	73993379	2021	4174	6195	SO:0001583	missense		CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764		30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84	12107410	Standard	NM_153225	Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.284G>A	8.37:g.73993379C>T	ENSP00000297354:p.Arg95His	A8KAA5|Q96J64	ENST00000297354.6	37	CCDS43747.2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888198	0.91814	.	.	ENSG00000164764	ENST00000297354	T	0.21191	2.02	5.29	4.4	0.53042	.	0.118037	0.56097	D	0.000031	T	0.44117	0.1278	M	0.80982	2.52	0.80722	D	1	D	0.67145	0.996	P	0.58077	0.832	T	0.52026	-0.8630	10	0.66056	D	0.02	-5.0986	15.3079	0.74008	0.1412:0.8588:0.0:0.0	.	95	Q8IVN8	RPESP_HUMAN	H	95	ENSP00000297354:R95H	ENSP00000297354:R95H	R	-	2	0	C8orf84	74155933	1.000000	0.71417	0.971000	0.41717	0.926000	0.56050	5.388000	0.66249	1.204000	0.43247	0.591000	0.81541	CGT	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347584.2		43.478442	0	-2	112	0	0	1	0	NM_153225	16	45.632269	39	0.290909
PLEK2	26499	broad.mit.edu	hg19	14	67862208	67862208	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:67862208G>A	ENST00000216446.4	-	3	440	c.300C>T	c.(298-300)acC>acT	p.T100T		NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	100	PH 1.	actin cytoskeleton organization|intracellular signal transduction	cytoplasm|cytoskeleton|lamellipodium membrane		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	GAATAGCCCCGGTGATCTCAA	0.597	1	90.0	89.0	89.0	14	67862208	2203	4300	6503	SO:0001819	synonymous_variant	AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558	"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007			11911883, 17658464	Standard	NM_016445	Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.300C>T	14.37:g.67862208G>A		Q96JT0	ENST00000216446.4	37	CCDS9782.1																																																																																			PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412547.2		-3.564476	0	-26	87	0	0	1	0		5	11.283531	71	0.065789
KIRREL	55243	broad.mit.edu	hg19	1	158047863	158047863	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:158047863C>T	ENST00000368173.3	+	3	689	c.285C>T	c.(283-285)gaC>gaT	p.D95D	KIRREL_ENST00000392272.2_Silent_p.D95D|KIRREL_ENST00000359209.6_Silent_p.D95D|KIRREL_ENST00000360089.4_Silent_p.D34D|KIRREL_ENST00000416935.2_Intron	NM_018240.5	NP_060710.3	Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	95	Ig-like C2-type 1.		integral to membrane		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)				TCTCTGACGACGCCTCTTACG	0.612	0	126.0	114.0	118.0	1	158047863	2203	4300	6503	SO:0001819	synonymous_variant	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428			12424224	Standard	NM_001286349	Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000360089.4:c.102C>T	1.37:g.158047863C>T		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	ENST00000360089.4	37																																																																																				KIRREL-002	PUTATIVE	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000058343.2		144.649573	0	-1	110	0	0	1	0	NM_018240	46	144.651868	47	0.494624
EMC1	23065	broad.mit.edu	hg19	1	19557911	19557911	+	Silent	SNP	C	C	T	rs150315726		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:19557911C>T	ENST00000477853.1	-	16	1830	c.1788G>A	c.(1786-1788)tcG>tcA	p.S596S	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Silent_p.S574S|EMC1_ENST00000375199.3_Silent_p.S595S	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1			ER membrane protein complex subunit 1												AACTCATTCCCGACTCCTAAA	0.502	0	40.0	41.0	40.0	1	19557911	2203	4300	6503	SO:0001819	synonymous_variant		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463		28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090	22119785	Standard	NM_015047	Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1788G>A	1.37:g.19557911C>T		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	ENST00000477853.1	37	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	8.021	0.759725	0.15846	4.54E-4	0.0	ENSG00000127463	ENST00000375197	.	.	.	4.87	-3.78	0.04333	.	.	.	.	.	T	0.40145	0.1105	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38757	-0.9646	4	.	.	.	.	3.5369	0.07796	0.1244:0.1479:0.1236:0.6041	.	.	.	.	R	330	.	.	G	-	1	0	KIAA0090	19430498	0.007000	0.16637	0.994000	0.49952	0.801000	0.45260	-1.550000	0.02180	-0.239000	0.09710	0.462000	0.41574	GGG	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2		24.901521	0	-9	35	0	0	1	0	NM_015047	8	25.052987	5	0.615385
ATF7IP	55729	broad.mit.edu	hg19	12	14650705	14650705	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:14650705G>A	ENST00000544627.1	+	15	3855	c.3535G>A	c.(3535-3537)Gtt>Att	p.V1179I	ATF7IP_ENST00000261168.4_Missense_Mutation_p.V1171I|ATF7IP_ENST00000540793.1_Missense_Mutation_p.V1171I|ATF7IP_ENST00000536444.1_Missense_Mutation_p.V1170I			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	1171	Fibronectin type-III.|Interaction with MBD1.	DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54					GTTAGCACGCGTTCAGAGTCA	0.532	0	183.0	150.0	161.0	12	14650705	2203	4300	6503	SO:0001583	missense	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681		20092	protein-coding gene	gene with protein product		613644			10976766, 10777215	Standard	XM_005253424	Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.3511G>A	12.37:g.14650705G>A	ENSP00000444589:p.Val1171Ile	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600276	0.87055	.	.	ENSG00000171681	ENST00000261168;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	6.08	6.08	0.98989	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000027	T	0.50820	0.1638	L	0.41573	1.285	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	T	0.44267	-0.9339	10	0.87932	D	0	-19.1858	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1170;1171	G3V1U0;Q6VMQ6	.;MCAF1_HUMAN	I	1171;1170;1179;1171	ENSP00000261168:V1171I;ENSP00000445955:V1170I;ENSP00000440440:V1179I;ENSP00000444589:V1171I	ENSP00000261168:V1171I	V	+	1	0	ATF7IP	14541972	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.857000	0.86963	2.894000	0.99253	0.655000	0.94253	GTT	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1		62.297505	0	-13	39	0	0	1	0	NM_018179	20	62.342892	23	0.465116
DLGAP3	58512	broad.mit.edu	hg19	1	35365688	35365688	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:35365688C>T	ENST00000373347.1	-	4	1562	c.1294G>A	c.(1294-1296)Gtg>Atg	p.V432M	DLGAP3_ENST00000235180.4_Missense_Mutation_p.V432M			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	432		cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)			GCCTGGTCCACGCTGGAGGAG	0.647	0	59.0	56.0	57.0	1	35365688	2203	4300	6503	SO:0001583	missense	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544		30368	protein-coding gene	gene with protein product		611413			8619474, 9110174	Standard	NM_001080418	Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1294G>A	1.37:g.35365688C>T	ENSP00000362444:p.Val432Met	Q5TDD5|Q9H3X7	ENST00000373347.1	37	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821795	0.32237	0.0	1.16E-4	ENSG00000116544	ENST00000373347;ENST00000235180;ENST00000542913	D;D	0.89270	-2.49;-2.49	4.57	4.57	0.56435	.	1.186950	0.06037	N	0.654190	D	0.83603	0.5290	N	0.24115	0.695	0.37404	D	0.912954	B	0.30851	0.297	B	0.19391	0.025	T	0.68704	-0.5338	10	0.29301	T	0.29	-10.5228	17.5202	0.87784	0.0:1.0:0.0:0.0	.	432	O95886	DLGP3_HUMAN	M	432;432;115	ENSP00000362444:V432M;ENSP00000235180:V432M	ENSP00000235180:V432M	V	-	1	0	DLGAP3	35138275	0.998000	0.40836	0.987000	0.45799	0.986000	0.74619	2.699000	0.47077	2.361000	0.80049	0.462000	0.41574	GTG	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1		26.066116	0	1	54	0	0	1	0	NM_021234	9	26.730275	18	0.333333
TLN2	83660	broad.mit.edu	hg19	15	63029131	63029131	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:63029131G>A	ENST00000561311.1	+	28	3643	c.3413G>A	c.(3412-3414)cGt>cAt	p.R1138H	TLN2_ENST00000559908.1_3'UTR|TLN2_ENST00000306829.6_Missense_Mutation_p.R1138H			Q9Y4G6	TLN2_HUMAN	talin 2	1138	Ala-rich.	cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99					CAGGCCGCCCGTGGAGTGGCT	0.582	0	32.0	36.0	34.0	15	63029131	2203	4300	6503	SO:0001583	missense	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914		15447	protein-coding gene	gene with protein product		607349			9205841, 11527381	Standard	NM_015059	Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3413G>A	15.37:g.63029131G>A	ENSP00000453508:p.Arg1138His	A6NLB8	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148716	0.78001	.	.	ENSG00000171914	ENST00000306829	T	0.15139	2.45	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.39886	0.1095	M	0.66378	2.025	0.58432	D	0.999999	D	0.71674	0.998	P	0.62885	0.908	T	0.05321	-1.0892	10	0.40728	T	0.16	-14.792	19.2437	0.93893	0.0:0.0:1.0:0.0	.	1138	Q9Y4G6	TLN2_HUMAN	H	1138	ENSP00000303476:R1138H	ENSP00000303476:R1138H	R	+	2	0	TLN2	60816423	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	8.029000	0.88807	2.545000	0.85829	0.591000	0.81541	CGT	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		66.205498	0	-3	54	0	0	1	0		21	66.433595	15	0.583333
TTN	7273	broad.mit.edu	hg19	2	179423251	179423251	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:179423251C>T	ENST00000589042.1	-	327	87159	c.86935G>A	c.(86935-86937)Gtt>Att	p.V28979I	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V20106I|TTN_ENST00000359218.5_Missense_Mutation_p.V20039I|TTN_ENST00000591111.1_Missense_Mutation_p.V27338I|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V26411I|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V19914I|TTN-AS1_ENST00000592600.1_RNA	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	27338	Fibronectin type-III 111.			ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		AGTGCTTCAACGACATAGTGT	0.428	0	128.0	123.0	124.0	2	179423251	1896	4134	6030	SO:0001583	missense	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.86935G>A	2.37:g.179423251C>T	ENSP00000467141:p.Val28979Ile	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476783	0.26511	5.27E-4	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60672	0.17;0.17;0.17;0.17	5.76	2.97	0.34412	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35422	0.0931	N	0.11560	0.145	0.28859	N	0.895597	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.09377	0.004;0.004;0.004;0.004	T	0.28332	-1.0047	9	0.87932	D	0	.	5.8362	0.18609	0.0:0.5185:0.1253:0.3562	.	19914;20039;20106;27338	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	26411;19914;20106;20039;19911	ENSP00000343764:V26411I;ENSP00000434586:V19914I;ENSP00000340554:V20106I;ENSP00000352154:V20039I	ENSP00000340554:V20106I	V	-	1	0	TTN	179131497	0.146000	0.22672	0.395000	0.26283	0.920000	0.55202	0.712000	0.25779	0.432000	0.26286	0.655000	0.94253	GTT	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		4.309415	0	-15	32	0	0	1	0	NM_133378	3	7.127171	19	0.136364
DCTN1	1639	broad.mit.edu	hg19	2	74593736	74593736	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:74593736C>T	ENST00000361874.3	-	22	2795	c.2478G>A	c.(2476-2478)acG>acA	p.T826T	DCTN1_ENST00000495643.1_Intron|DCTN1_ENST00000409567.3_Silent_p.T806T|DCTN1_ENST00000409868.1_Silent_p.T809T|DCTN1_ENST00000409438.1_Silent_p.T692T|DCTN1_ENST00000409240.1_Silent_p.T789T|DCTN1_ENST00000394003.3_Silent_p.T819T|DCTN1_ENST00000407639.2_Silent_p.T692T	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	826		cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45					AGTCTAGGAGCGTGTCAGATA	0.572	0	131.0	130.0	130.0	2	74593736	2203	4300	6503	SO:0001819	synonymous_variant		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843		2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""		1828535	Standard	NM_001190836	Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2478G>A	2.37:g.74593736C>T		A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	ENST00000361874.3	37	CCDS1939.1																																																																																			DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3		156.372665	0	-28	187	0	0	1	0	NM_004082	52	157.282989	75	0.409449
OR10H1	26539	broad.mit.edu	hg19	19	15918449	15918449	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:15918449G>A	ENST00000334920.2	-	1	487	c.399C>T	c.(397-399)aaC>aaT	p.N133N		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	133		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29					TCATGAGCACGTTGTAGCGCA	0.637	1	73.0	59.0	64.0	19	15918449	2203	4300	6503	SO:0001819	synonymous_variant	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723	"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product						Standard	NM_013940	Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.399C>T	19.37:g.15918449G>A		Q6IFQ2|Q96R59	ENST00000334920.2	37	CCDS12335.1																																																																																			OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		10.558399	0	-19	53	0	0	1	0		5	13.280850	23	0.178571
COX16	51241	broad.mit.edu	hg19	14	70809398	70809398	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:70809398G>A	ENST00000389912.6	-	2	261	c.118C>T	c.(118-120)Cga>Tga	p.R40*	COX16_ENST00000557612.1_Intron|SYNJ2BP-COX16_ENST00000555276.1_RNA	NM_016468.6	NP_057552.1			COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)						large_intestine(1)|lung(2)	3					GCATCATATCGGATTTGAGAA	0.328	0	88.0	93.0	92.0	14	70809398	2203	4300	6503	SO:0001587	stop_gained	AF151037	CCDS9802.1	14q24.2	2013-05-10	2008-08-14	2008-06-23	ENSG00000133983	ENSG00000133983		20213	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 112"""	C14orf112	11042152, 15596615	Standard	NM_016468	Approved	HSPC203		Q9P0S2	OTTHUMG00000171238	ENST00000389912.6:c.118C>T	14.37:g.70809398G>A	ENSP00000374562:p.Arg40*	A6NDT5|A8K3X8	ENST00000389912.6	37	CCDS9802.1	.	.	.	.	.	.	.	.	.	.	G	36	5.966321	0.97156	.	.	ENSG00000133983	ENST00000389912	.	.	.	5.03	5.03	0.67393	.	0.000000	0.48286	U	0.000183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	4.7716	14.5908	0.68362	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	ENSP00000374562:R40X	R	-	1	2	COX16	69879151	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.583000	0.60964	2.726000	0.93360	0.655000	0.94253	CGA	COX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412470.2		44.947511	0	-1	65	0	0	1	0	NM_016468	14	45.010582	17	0.451613
SPTBN4	57731	broad.mit.edu	hg19	19	41008365	41008365	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:41008365G>A	ENST00000352632.3	+	10	1240	c.1154G>A	c.(1153-1155)cGt>cAt	p.R385H	SPTBN4_ENST00000344104.3_Missense_Mutation_p.R385H|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R385H|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R385H|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R385H			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	385		actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		GCCTGCAACCGTCGCCTCTTT	0.602	0	73.0	76.0	75.0	19	41008365	2203	4300	6503	SO:0001583	missense	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460	"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214			11086001	Standard	NM_020971	Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1154G>A	19.37:g.41008365G>A	ENSP00000263373:p.Arg385His	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834173	0.71373	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.50277	0.75;0.75;0.75	3.54	3.54	0.40534	.	0.106112	0.37809	U	0.001926	T	0.63260	0.2496	L	0.60904	1.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.962;0.979	T	0.66881	-0.5811	10	0.56958	D	0.05	.	15.0565	0.71917	0.0:0.0:1.0:0.0	.	385;385	Q9H254;Q71S06	SPTN4_HUMAN;.	H	385	ENSP00000263373:R385H;ENSP00000340345:R385H;ENSP00000340741:R385H	ENSP00000340345:R385H	R	+	2	0	SPTBN4	45700205	0.564000	0.26602	0.996000	0.52242	0.859000	0.49053	1.119000	0.31258	2.283000	0.76528	0.563000	0.77884	CGT	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		13.163805	0	-17	94	0	0	1	0		8	20.279461	49	0.140351
PCDH19	57526	broad.mit.edu	hg19	X	99662742	99662742	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:99662742G>A	ENST00000373034.4	-	1	2529	c.854C>T	c.(853-855)aCg>aTg	p.T285M	PCDH19_ENST00000420881.2_Missense_Mutation_p.T285M|PCDH19_ENST00000255531.7_Missense_Mutation_p.T285M	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	285	Cadherin 3.	homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68					GAGCTCGCGCGTGCGGTCGTT	0.612	0	106.0	112.0	110.0	X	99662742	2170	4247	6417	SO:0001583	missense	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194	"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR	11549318, 18469813, 19752159	Standard	NM_020766	Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.854C>T	X.37:g.99662742G>A	ENSP00000362125:p.Thr285Met	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307851	0.60305	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.54071	0.59;0.64;0.59	5.95	5.95	0.96441	Cadherin (4);Cadherin-like (1);	0.095982	0.64402	D	0.000001	T	0.70219	0.3199	M	0.63208	1.945	0.58432	D	0.999994	D;D;D	0.69078	0.997;0.965;0.972	D;P;P	0.63793	0.918;0.637;0.752	T	0.71556	-0.4557	10	0.66056	D	0.02	.	19.254	0.93938	0.0:0.0:1.0:0.0	.	285;285;285	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	M	285	ENSP00000400327:T285M;ENSP00000362125:T285M;ENSP00000255531:T285M	ENSP00000255531:T285M	T	-	2	0	PCDH19	99549398	1.000000	0.71417	0.538000	0.28064	0.811000	0.45836	6.733000	0.74796	2.498000	0.84270	0.513000	0.50165	ACG	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2		48.659946	0	-41	91	0	0	1	0	NM_020766	20	53.382889	61	0.246914
PHKA2	5256	broad.mit.edu	hg19	X	18944633	18944633	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:18944633G>A	ENST00000379942.4	-	14	2062	c.1397C>T	c.(1396-1398)gCg>gTg	p.A466V		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	466		glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)				ATGAATGTCCGCGATACTCTG	0.458	0	175.0	138.0	150.0	X	18944633	2203	4300	6503	SO:0001583	missense		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446		8926	protein-coding gene	gene with protein product		300798		PHK, PYK	2387090	Standard	NM_000292	Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1397C>T	X.37:g.18944633G>A	ENSP00000369274:p.Ala466Val	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	ENST00000379942.4	37	CCDS14190.1	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.32	3.091165	0.55968	.	.	ENSG00000044446	ENST00000379942	D	0.91180	-2.8	5.38	5.38	0.77491	Glycoside hydrolase 15-related (1);	0.207947	0.51477	D	0.000087	D	0.89298	0.6675	M	0.80982	2.52	0.54753	D	0.999983	P	0.37233	0.588	B	0.30572	0.117	D	0.89015	0.3431	10	0.41790	T	0.15	-14.0755	13.7211	0.62728	0.0:0.1504:0.8496:0.0	.	466	P46019	KPB2_HUMAN	V	466	ENSP00000369274:A466V	ENSP00000369274:A466V	A	-	2	0	PHKA2	18854554	1.000000	0.71417	0.887000	0.34795	0.469000	0.32828	7.271000	0.78506	2.383000	0.81215	0.600000	0.82982	GCG	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1		12.117081	0	-20	154	0	0	1	0	NM_000292	12	29.268562	100	0.107143
KIAA1324L	222223	broad.mit.edu	hg19	7	86526871	86526871	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:86526871G>A	ENST00000450689.2	-	19	2821	c.2636C>T	c.(2635-2637)aCg>aTg	p.T879M	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.T712M|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.T808M|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.T639M	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	879			integral to membrane		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)				GTCATGCTCCGTACACAGAGG	0.463	1	100.0	90.0	93.0	7	86526871	2203	4300	6503	SO:0001583	missense	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659		21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048				Standard	NM_001142749	Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000416314.1:c.2135C>T	7.37:g.86526871G>A	ENSP00000402390:p.Thr712Met	A4D1C9|B4DJV3|Q17RI6|Q96DP2	ENST00000416314.1	37	CCDS34677.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182074	0.78677	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.19394	2.42;2.16;2.15;2.16	5.37	5.37	0.77165	.	0.104529	0.64402	D	0.000004	T	0.37210	0.0995	L	0.36672	1.1	0.58432	D	0.999996	D;D;D	0.76494	0.999;0.999;0.999	D;P;P	0.66497	0.944;0.855;0.855	T	0.08932	-1.0698	10	0.66056	D	0.02	.	18.1012	0.89505	0.0:0.0:1.0:0.0	.	879;639;712	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	M	879;639;808;712	ENSP00000413445:T879M;ENSP00000297222:T639M;ENSP00000397377:T808M;ENSP00000402390:T712M	ENSP00000297222:T639M	T	-	2	0	KIAA1324L	86364807	1.000000	0.71417	0.972000	0.41901	0.987000	0.75469	5.667000	0.68067	2.524000	0.85096	0.650000	0.86243	ACG	KIAA1324L-005	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333840.1		27.301989	0	13	53	0	0	1	0	NM_152748	11	30.160310	35	0.239130
BEND3	57673	broad.mit.edu	hg19	6	107390354	107390354	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:107390354G>A	ENST00000429433.2	-	5	2690	c.2041C>T	c.(2041-2043)Cgg>Tgg	p.R681W	BEND3_ENST00000369042.1_Missense_Mutation_p.R681W	NM_001080450.2	NP_001073919.1	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	681					central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30					AACTCCTCCCGGAACCTCTCG	0.637	0	27.0	32.0	30.0	6	107390354	2197	4286	6483	SO:0001583	missense	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409	"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553		Standard	NM_001080450	Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.2041C>T	6.37:g.107390354G>A	ENSP00000358038:p.Arg681Trp	A2RRH2|Q9HCL9	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597851	0.46318	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	4.62	3.72	0.42706	.	0.065887	0.64402	D	0.000020	T	0.36110	0.0955	N	0.19112	0.55	0.41525	D	0.988425	D	0.69078	0.997	P	0.53490	0.727	T	0.42849	-0.9427	9	0.87932	D	0	-3.1108	11.9824	0.53127	0.0:0.0:0.5577:0.4423	.	681	Q5T5X7	BEND3_HUMAN	W	681	.	ENSP00000358038:R681W	R	-	1	2	BEND3	107497047	1.000000	0.71417	0.995000	0.50966	0.938000	0.57974	2.954000	0.49113	1.238000	0.43771	0.455000	0.32223	CGG	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1		12.227919	0	-22	42	0	0	1	0	NM_020913	6	16.019763	30	0.166667
RUNX1	861	broad.mit.edu	hg19	21	36171666	36171666	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr21:36171666G>A	ENST00000344691.4	-	5	2395	c.818C>T	c.(817-819)aCg>aTg	p.T273M	RUNX1_ENST00000437180.1_Missense_Mutation_p.T300M|RUNX1_ENST00000399240.1_Missense_Mutation_p.T209M|RUNX1_ENST00000325074.5_Missense_Mutation_p.T288M|RUNX1_ENST00000300305.3_Missense_Mutation_p.T300M	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	273	Pro/Ser/Thr-rich.	myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|calcium ion binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452					TGAAATGGGCGTTGCTGGGTG	0.522	1	186.0	158.0	168.0	21	36171666	2203	4300	6503	SO:0001583	missense	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216		10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2	1427868, 7835892	Standard	NM_001001890	Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000300305.3:c.899C>T	21.37:g.36171666G>A	ENSP00000300305:p.Thr300Met	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	ENST00000300305.3	37	CCDS13639.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022717	0.54683	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000431176;ENST00000399245	D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38	5.78	5.78	0.91487	.	0.201478	0.52532	D	0.000068	D	0.92724	0.7687	M	0.64567	1.98	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.994;1.0	P;P;P;P;P	0.57846	0.828;0.809;0.795;0.799;0.818	D	0.92793	0.6250	10	0.66056	D	0.02	-14.8679	19.6065	0.95583	0.0:0.0:1.0:0.0	.	276;168;300;288;273	C9JK12;Q01196-11;Q01196-8;Q01196-10;Q01196	.;.;.;.;RUNX1_HUMAN	M	273;300;300;288;209;34;276	ENSP00000340690:T273M;ENSP00000300305:T300M;ENSP00000409227:T300M;ENSP00000319459:T288M;ENSP00000382184:T209M	ENSP00000300305:T300M	T	-	2	0	RUNX1	35093536	1.000000	0.71417	0.905000	0.35620	0.981000	0.71138	5.201000	0.65163	2.731000	0.93534	0.650000	0.86243	ACG	RUNX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194231.1		32.779473	0	11	101	0	0	1	0		15	39.469573	62	0.194805
VAV1	7409	broad.mit.edu	hg19	19	6836478	6836478	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:6836478G>A	ENST00000304076.2	+	20	1907	c.1813G>A	c.(1813-1815)Ggg>Agg	p.G605R	VAV1_ENST00000596764.1_Missense_Mutation_p.G573R|VAV1_ENST00000599806.1_Missense_Mutation_p.G550R|VAV1_ENST00000602142.1_Missense_Mutation_p.G605R|VAV1_ENST00000539284.1_Missense_Mutation_p.G508R	NM_001258206.1	NP_001245135.1	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	605		apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity	biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62					GGAATACTACGGGCTTCCTCC	0.557	0	72.0	60.0	64.0	19	6836478	2203	4300	6503	SO:0001583	missense		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968	"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV	9438848	Standard	NM_005428	Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1813G>A	19.37:g.6836478G>A	ENSP00000472929:p.Gly605Arg	B4DVK9|M0QXX6|Q15860	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376527	0.61735	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.75589	1.44;-0.95	4.29	4.29	0.51040	Src homology-3 domain (2);	0.183893	0.46442	D	0.000299	D	0.82472	0.5044	M	0.67700	2.07	0.49687	D	0.999813	D;D;D;D	0.76494	0.997;0.983;0.999;0.997	P;P;P;P	0.61397	0.826;0.552;0.888;0.888	D	0.85005	0.0902	10	0.72032	D	0.01	.	14.2896	0.66268	0.0:0.0:1.0:0.0	.	508;605;550;605	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	R	605;508	ENSP00000302269:G605R;ENSP00000443242:G508R	ENSP00000302269:G605R	G	+	1	0	VAV1	6787478	1.000000	0.71417	0.160000	0.22671	0.790000	0.44656	6.684000	0.74538	1.963000	0.57068	0.478000	0.44815	GGG	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		5.512118	0	10	47	0	0	1	0		3	7.860565	17	0.150000
KCNE3	10008	broad.mit.edu	hg19	11	74168452	74168452	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:74168452G>A	ENST00000310128.4	-	3	576	c.157C>T	c.(157-159)Cgt>Tgt	p.R53C	KCNE3_ENST00000525550.1_Missense_Mutation_p.R53C|RP11-702H23.4_ENST00000533008.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	53			integral to membrane	voltage-gated potassium channel activity	cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)				TTGTCATCACGGCCAGGTAGG	0.557	0	72.0	63.0	66.0	11	74168452	2200	4293	6493	SO:0001583	missense	AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538	"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433			10219239	Standard	NM_005472	Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.157C>T	11.37:g.74168452G>A	ENSP00000310557:p.Arg53Cys		ENST00000310128.4	37	CCDS8232.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475627	0.63737	0.0	1.16E-4	ENSG00000175538	ENST00000310128;ENST00000525550;ENST00000532569	D;D;D	0.92249	-3.0;-3.0;-3.0	5.33	4.42	0.53409	.	0.080554	0.51477	D	0.000093	D	0.88097	0.6345	L	0.54323	1.7	0.45690	D	0.9986	B	0.21753	0.06	B	0.15484	0.013	D	0.85115	0.0965	10	0.87932	D	0	-15.8816	6.9987	0.24797	0.0859:0.0:0.7444:0.1696	.	53	Q9Y6H6	KCNE3_HUMAN	C	53	ENSP00000310557:R53C;ENSP00000433633:R53C;ENSP00000431739:R53C	ENSP00000310557:R53C	R	-	1	0	KCNE3	73846100	1.000000	0.71417	0.928000	0.36995	0.691000	0.40173	2.888000	0.48594	1.485000	0.48380	0.561000	0.74099	CGT	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1		41.257627	0	5	47	0	0	1	0	NM_005472	13	41.257627	13	0.500000
TMTC3	160418	broad.mit.edu	hg19	12	88566445	88566445	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:88566445C>T	ENST00000266712.6	+	8	1342	c.1122C>T	c.(1120-1122)gcC>gcT	p.A374A		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	374			integral to membrane	binding	NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31					TTGTTGTTGCCGAGCGAGTAT	0.353	0	123.0	120.0	121.0	12	88566445	2203	4299	6502	SO:0001819	synonymous_variant		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324	"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product						Standard	NM_181783	Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1122C>T	12.37:g.88566445C>T		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	ENST00000266712.6	37	CCDS9032.1																																																																																			TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1		48.214545	0	-12	127	0	0	1	0	NM_181783	18	52.660036	56	0.243243
MUM1	84939	broad.mit.edu	hg19	19	1360196	1360196	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:1360196C>T	ENST00000311401.5	+	5	458	c.72C>T	c.(70-72)cgC>cgT	p.R24R	MUM1_ENST00000415183.3_Silent_p.R93R|MUM1_ENST00000591806.1_Silent_p.R93R|MUM1_ENST00000344663.3_Silent_p.R93R			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	92		chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	GGTCGCTTCGCGTGGCTCTGG	0.587	0	75.0	73.0	74.0	19	1360196	2203	4300	6503	SO:0001819	synonymous_variant	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953		29641	protein-coding gene	gene with protein product					11042152, 7644523	Standard	NM_032853	Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.279C>T	19.37:g.1360196C>T		A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	ENST00000415183.3	37																																																																																				MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1		12.897864	0	7	64	0	0	1	0	NM_032853	7	17.323760	35	0.166667
ASB10	136371	broad.mit.edu	hg19	7	150878399	150878399	+	Missense_Mutation	SNP	C	C	T	rs104886476		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:150878399C>T	ENST00000422024.1	-	3	991	c.866G>A	c.(865-867)cGc>cAc	p.R289H	ASB10_ENST00000377867.3_Missense_Mutation_p.R229H|ASB10_ENST00000275838.1_Missense_Mutation_p.R244H|ASB10_ENST00000420175.2_Missense_Mutation_p.R244H|ASB10_ENST00000434669.1_Missense_Mutation_p.R289H	NM_001142459.1	NP_001135931.2	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	244		intracellular signal transduction			NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	TTCGGCATTGCGGGCATCAGG	0.657	0	35.0	35.0	35.0	7	150878399	2203	4300	6503	SO:0001583	missense	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926	"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F	22156576	Standard	NM_080871	Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.731G>A	7.37:g.150878399C>T	ENSP00000391137:p.Arg244His	A0AVH0|Q6ZUL6	ENST00000420175.2	37	CCDS47750.2	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	15.25	2.779284	0.49891	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.24	3.4	0.38934	Ankyrin repeat-containing domain (3);	0.191712	0.46145	D	0.000311	T	0.72179	0.3428	L	0.58583	1.82	0.28234	N	0.925985	D;D;D	0.71674	0.989;0.995;0.998	P;P;P	0.61201	0.817;0.885;0.862	T	0.64162	-0.6472	10	0.46703	T	0.11	-7.3683	8.1899	0.31361	0.0:0.696:0.0:0.304	.	229;244;289	Q8WXI3-3;Q8WXI3;D5MNW9	.;ASB10_HUMAN;.	H	244;229;289;289;244	ENSP00000275838:R244H;ENSP00000367098:R229H;ENSP00000401369:R289H;ENSP00000398247:R289H;ENSP00000391137:R244H	ENSP00000275838:R244H	R	-	2	0	ASB10	150509332	0.001000	0.12720	0.489000	0.27452	0.464000	0.32679	0.288000	0.18939	1.339000	0.45563	0.655000	0.94253	CGC	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3		7.083566	0	3	32	0	0	1	0	NM_080871	4	10.291033	23	0.148148
SPAG5	10615	broad.mit.edu	hg19	17	26912882	26912882	+	Splice_Site	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:26912882C>T	ENST00000321765.5	-	7	2072	c.1740G>A	c.(1738-1740)gcG>gcA	p.A580A		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	580		cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding	NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)				GTCACCTTACCGCATCCTTGC	0.498	0	218.0	191.0	200.0	17	26912882	2203	4300	6503	SO:0001630	splice_region_variant	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382		13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562			11549262	Standard	NM_006461	Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1740+1G>A	17.37:g.26912882C>T		O95213|Q9BWE8|Q9NT17|Q9UFE6	ENST00000321765.5	37	CCDS32594.1																																																																																			SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2		51.090374	0	-11	150	0	0	1	0	NM_006461	22	60.501473	89	0.198198
ITGA5	3678	broad.mit.edu	hg19	12	54799459	54799459	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:54799459G>A	ENST00000293379.4	-	11	1266	c.1005C>T	c.(1003-1005)gtC>gtT	p.V335V	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	335		angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding	NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34					CATCCCCATTGACGTCTGTGG	0.547	0	87.0	74.0	78.0	12	54799459	2203	4300	6503	SO:0001819	synonymous_variant		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638	"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA	2454952	Standard	NM_002205	Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1005C>T	12.37:g.54799459G>A		Q96HA5	ENST00000293379.4	37	CCDS8880.1																																																																																			ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		119.953345	0	4	80	0	0	1	0		38	121.183376	20	0.655172
TNXB	7148	broad.mit.edu	hg19	6	32017060	32017060	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:32017060G>A	ENST00000375244.3	-	28	9945	c.9744C>T	c.(9742-9744)acC>acT	p.T3248T	TNXB_ENST00000375247.2_Silent_p.T3246T			P22105	TENX_HUMAN	tenascin XB	3293	Fibronectin type-III 24.	actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8					TGATGCCCACGGTGGACACTG	0.637	0	29.0	31.0	30.0	6	32017060	1295	2542	3837	SO:0001819	synonymous_variant	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477	"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2	8530023	Standard	NM_019105	Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9744C>T	6.37:g.32017060G>A		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	ENST00000375244.3	37																																																																																				TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2		9.791913	0	-15	25	0	0	1	0	NM_019105	4	11.068474	14	0.222222
CDH7	1005	broad.mit.edu	hg19	18	63511118	63511118	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:63511118G>A	ENST00000536984.2	+	7	1746	c.1052G>A	c.(1051-1053)cGc>cAc	p.R351H	CDH7_ENST00000323011.3_Missense_Mutation_p.R351H|CDH7_ENST00000397968.2_Missense_Mutation_p.R351H			Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	351	Cadherin 3.	adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)			GCCGACCCTCGCTTTCTGAGC	0.443	0	139.0	123.0	128.0	18	63511118	2203	4300	6503	SO:0001583	missense	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138	"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806			9615235	Standard	NM_033646	Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1052G>A	18.37:g.63511118G>A	ENSP00000381058:p.Arg351His	Q9H157	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	9.989	1.230364	0.22542	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.38401	1.14;1.14;1.14	5.04	4.17	0.49024	Cadherin (4);Cadherin-like (1);	0.299368	0.37623	N	0.002018	T	0.55337	0.1914	M	0.78223	2.4	0.30939	N	0.726055	P;D	0.71674	0.495;0.998	B;P	0.59056	0.119;0.851	T	0.64058	-0.6496	10	0.52906	T	0.07	.	13.7615	0.62968	0.0742:0.0:0.9258:0.0	.	351;351	F5H5X9;Q9ULB5	.;CADH7_HUMAN	H	351	ENSP00000319166:R351H;ENSP00000443030:R351H;ENSP00000381058:R351H	ENSP00000319166:R351H	R	+	2	0	CDH7	61662098	0.998000	0.40836	0.126000	0.21872	0.089000	0.18198	3.288000	0.51739	1.483000	0.48342	0.655000	0.94253	CGC	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2		59.521757	0	4	79	0	0	1	0	NM_033646	22	62.692457	55	0.285714
PGAM4	441531	broad.mit.edu	hg19	X	77224669	77224669	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:77224669G>A	ENST00000458128.1	-	1	466	c.467C>T	c.(466-468)cCg>cTg	p.P156L	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000341514.6_Intron|ATP7A_ENST00000343533.5_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	156		glycolysis		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity	endometrium(2)|lung(4)	6					AGTATCCTTCGGACTCTCATA	0.517	0	80.0	76.0	78.0	X	77224669	2203	4295	6498	SO:0001583	missense	AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784		21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""		11961099, 9370262	Standard	NM_001029891	Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.467C>T	X.37:g.77224669G>A	ENSP00000412189:p.Pro156Leu	Q5JPN2|Q8NI24|Q8NI25|Q8NI26	ENST00000458128.1	37	CCDS35338.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.298298	0.00243	.	.	ENSG00000226784	ENST00000458128	T	0.77098	-1.07	0.119	-0.238	0.13055	Histidine phosphatase superfamily, clade-1 (2);	0.086607	0.47852	N	0.000206	T	0.24736	0.0600	N	0.00017	-2.83	0.23232	N	0.998077	B	0.02656	0.0	B	0.01281	0.0	T	0.47032	-0.9148	9	.	.	.	-23.5549	4.3246	0.11034	0.7113:0.0:0.2887:0.0	.	156	Q8N0Y7	PGAM4_HUMAN	L	156	ENSP00000412189:P156L	.	P	-	2	0	PGAM4	77111325	1.000000	0.71417	0.114000	0.21550	0.114000	0.19823	4.188000	0.58351	-1.907000	0.01087	-1.858000	0.00562	CCG	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128371.2		59.877943	0	-14	165	0	0	1	0	NM_001029891	23	65.820323	73	0.239583
DNM1P46	0	broad.mit.edu	hg19	15	100332288	100332288	+	RNA	SNP	C	C	T	rs113961788		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:100332288C>T	ENST00000341853.1	-	0	1903					NR_003260.1																GGAGACCCACCGGGCCATGCA	0.652	0	74.0	75.0	75.0	15	100332288	876	1991	2867			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397		35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51		Standard	NR_003260	Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100332288C>T		Q3ZCN3	ENST00000341853.1	37																																																																																				DNM1P46-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000313543.1		53.201817	0	-5	46	0	0	1	0	NR_003260	16	53.208874	15	0.516129
ZSCAN1	284312	broad.mit.edu	hg19	19	58549469	58549469	+	Missense_Mutation	SNP	G	G	A	rs148253808		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:58549469G>A	ENST00000282326.1	+	3	512	c.265G>A	c.(265-267)Gcg>Acg	p.A89T	ZSCAN1_ENST00000391700.1_Missense_Mutation_p.A89T|ZSCAN1_ENST00000601162.1_Missense_Mutation_p.A89T	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	89	SCAN box.	viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	GTTCCTGGGCGCGCTGCCCAG	0.692	1	17.0	17.0	17.0	19	58549469	2197	4294	6491	SO:0001583	missense	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467	"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""		12477932	Standard	NM_182572	Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.265G>A	19.37:g.58549469G>A	ENSP00000282326:p.Ala89Thr	Q3B798|Q6WLH8|Q86WS8	ENST00000282326.1	37	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378188	0.61735	2.28E-4	0.0	ENSG00000152467	ENST00000391700;ENST00000282326	T;T	0.04360	3.64;3.64	2.08	-1.9	0.07665	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.05502	0.0145	L	0.38733	1.17	0.09310	N	1	P;P	0.52170	0.95;0.951	P;B	0.51999	0.687;0.404	T	0.32375	-0.9909	9	0.27082	T	0.32	.	1.9367	0.03338	0.3721:0.0:0.362:0.2659	.	89;89	Q8NBB4;Q8NBB4-2	ZSCA1_HUMAN;.	T	89	ENSP00000375581:A89T;ENSP00000282326:A89T	ENSP00000282326:A89T	A	+	1	0	ZSCAN1	63241281	0.000000	0.05858	0.034000	0.17996	0.964000	0.63967	0.070000	0.14573	-0.194000	0.10399	0.393000	0.25936	GCG	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1		24.897877	0	-6	23	0	0	1	0	NM_182572	8	24.946256	10	0.444444
CYB561	1534	broad.mit.edu	hg19	17	61514900	61514900	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:61514900G>A	ENST00000584031.1	-	2	308	c.9C>T	c.(7-9)ggC>ggT	p.G3G	CYB561_ENST00000582034.1_Intron|CYB561_ENST00000360793.3_Silent_p.G3G|CYB561_ENST00000448884.2_Silent_p.G3G|CYB561_ENST00000582997.1_Silent_p.G10G|CYB561_ENST00000542042.1_Silent_p.G70G|CYB561_ENST00000392976.1_Silent_p.G3G|CYB561_ENST00000582297.1_Silent_p.G3G|CYB561_ENST00000581573.1_Silent_p.G3G|CYB561_ENST00000392975.2_Silent_p.G3G			P49447	CY561_HUMAN	cytochrome b561	3		electron transport chain|transport	integral to plasma membrane	cytochrome-b5 reductase activity|ferric-chelate reductase activity|metal ion binding	lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)	CCGCGGCCCCGCCCTCCATGC	0.687	0	28.0	29.0	29.0	17	61514900	2202	4298	6500	SO:0001819	synonymous_variant		CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283	"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019			7959749, 23249217	Standard	XM_005257091	Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.9C>T	17.37:g.61514900G>A		B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	ENST00000392976.1	37	CCDS11636.1																																																																																			CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444843.1		26.718150	0	4	18	0	0	1	0	NM_001915	9	26.753753	11	0.450000
IYD	389434	broad.mit.edu	hg19	6	150719260	150719260	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:150719260C>T	ENST00000344419.3	+	5	897	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	IYD_ENST00000229447.5_Missense_Mutation_p.P290L	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	253		cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)	GCTCCTGGGCCGCCCCGCACA	0.557	0	76.0	74.0	75.0	6	150719260	2203	4300	6503	SO:0001583	missense	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765		21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71	16316988, 15289438	Standard	NM_001164694	Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.757C>T	6.37:g.150719260C>T	ENSP00000343763:p.Arg253Cys	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	ENST00000344419.3	37	CCDS5227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.164931|4.164931	0.78339|0.78339	.|.	.|.	ENSG00000009765|ENSG00000009765	ENST00000229447|ENST00000344419	D|T	0.89343|0.76186	-2.5|-1.0	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Nitroreductase-like (3);	0.055170|.	0.64402|.	D|.	0.000001|.	D|D	0.88991|0.88991	0.6588|0.6588	M|M	0.91196|0.91196	3.185|3.185	0.80722|0.80722	D|D	1|1	P|D	0.36483|0.89917	0.555|1.0	B|D	0.24394|0.91635	0.053|0.999	D|D	0.89371|0.89371	0.3675|0.3675	10|9	0.87932|0.62326	D|D	0|0.03	-30.6384|-30.6384	20.6244|20.6244	0.99512|0.99512	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	290|253	C9JFW2|Q6PHW0	.|IYD1_HUMAN	L|C	290|253	ENSP00000229447:P290L|ENSP00000343763:R253C	ENSP00000229447:P290L|ENSP00000343763:R253C	P|R	+|+	2|1	0|0	IYD|IYD	150760953|150760953	1.000000|1.000000	0.71417|0.71417	0.778000|0.778000	0.31720|0.31720	0.515000|0.515000	0.34225|0.34225	4.631000|4.631000	0.61304|0.61304	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	CCG|CGC	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3		2.297431	0	10	115	0	0	1	0	NM_203395	6	14.473740	64	0.085714
CHIT1	1118	broad.mit.edu	hg19	1	203194835	203194835	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:203194835G>A	ENST00000367229.1	-	3	253	c.219C>T	c.(217-219)gaC>gaT	p.D73D	CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000255427.3_Silent_p.D73D|CHIT1_ENST00000535569.1_Silent_p.D83D	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	73		chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity	central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27					AGAGAGTCTCGTCATTCCACT	0.577	0	136.0	127.0	130.0	1	203194835	2203	4300	6503	SO:0001819	synonymous_variant	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063		1936	protein-coding gene	gene with protein product		600031			9748235, 9492324	Standard	NM_003465	Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.219C>T	1.37:g.203194835G>A		B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	ENST00000367229.1	37	CCDS1436.1																																																																																			CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2		15.602403	0	3	70	0	0	1	0	NM_003465	7	19.157159	31	0.184211
NGRN	51335	broad.mit.edu	hg19	15	90814997	90814997	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:90814997G>A	ENST00000379095.3	+	3	861	c.853G>A	c.(853-855)Ggg>Agg	p.G285R	RP11-697E2.6_ENST00000561573.1_3'UTR|NGRN_ENST00000331497.3_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	285		neuron differentiation	extracellular region|nucleus		kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)		TGACAGCAACGGGAACTTCCT	0.498	0	48.0	47.0	47.0	15	90814997	2199	4298	6497	SO:0001583	missense	AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768		18077	protein-coding gene	gene with protein product					11118320	Standard	NR_028052	Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.853G>A	15.37:g.90814997G>A	ENSP00000368389:p.Gly285Arg	B2R6M8|Q4V9L7|Q9HBL4	ENST00000379095.3	37	CCDS32329.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858793	0.51376	.	.	ENSG00000182768	ENST00000379095	T	0.61980	0.06	5.13	5.13	0.70059	.	0.000000	0.64402	U	0.000007	T	0.60470	0.2271	L	0.58428	1.81	0.80722	D	1	P	0.43024	0.798	B	0.39068	0.289	T	0.68108	-0.5496	10	0.87932	D	0	.	16.4285	0.83832	0.0:0.0:1.0:0.0	.	285	Q9NPE2	NGRN_HUMAN	R	285	ENSP00000368389:G285R	ENSP00000368389:G285R	G	+	1	0	NGRN	88616001	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	6.893000	0.75649	2.540000	0.85666	0.460000	0.39030	GGG	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313418.1		0.962719	0	3	80	0	0	1	0		4	9.693841	45	0.081633
IGSF9B	22997	broad.mit.edu	hg19	11	133807352	133807352	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:133807352G>A	ENST00000321016.8	-	5	828	c.598C>T	c.(598-600)Cgg>Tgg	p.R200W	IGSF9B_ENST00000533871.2_Missense_Mutation_p.R200W			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	200	Ig-like 2.		integral to membrane|plasma membrane		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	CTGTCCTCCCGACTGACCGAT	0.607	0	68.0	77.0	74.0	11	133807352	2159	4240	6399	SO:0001583	missense	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20			"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773				Standard	NM_001277285	Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000533871.2:c.598C>T	11.37:g.133807352G>A	ENSP00000436552:p.Arg200Trp	G5EA26	ENST00000533871.2	37		.	.	.	.	.	.	.	.	.	.	G	24.6	4.543952	0.86022	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648;ENST00000533160	T;T;T;D	0.96300	-0.73;-1.17;-0.73;-3.97	5.54	4.61	0.57282	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.97692	0.9243	M	0.72624	2.21	0.47374	D	0.9994	D	0.89917	1.0	D	0.81914	0.995	D	0.98333	1.0534	9	0.87932	D	0	.	15.4874	0.75578	0.0:0.0:0.8532:0.1468	.	200	Q9UPX0	TUTLB_HUMAN	W	200;42;200;190	ENSP00000317980:R200W;ENSP00000436552:R42W;ENSP00000436576:R200W;ENSP00000434026:R190W	ENSP00000317980:R200W	R	-	1	2	IGSF9B	133312562	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.899000	0.69846	1.290000	0.44636	0.561000	0.74099	CGG	IGSF9B-002	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471431.1		62.662515	0	7	74	0	0	1	0	XM_290502	21	62.752623	17	0.552632
L3MBTL2	83746	broad.mit.edu	hg19	22	41621887	41621887	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:41621887C>T	ENST00000216237.5	+	12	1604	c.1446C>T	c.(1444-1446)caC>caT	p.H482H		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	482		chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					CCTCTTCCCACGCCATCTTCC	0.572	0	115.0	81.0	93.0	22	41621887	2203	4300	6503	SO:0001819	synonymous_variant	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395		18594	protein-coding gene	gene with protein product		611865			11682070	Standard	NM_031488	Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1446C>T	22.37:g.41621887C>T		Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	ENST00000216237.5	37	CCDS14011.1																																																																																			L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1		36.654436	0	5	54	0	0	1	0	NM_031488	13	37.269803	23	0.361111
TMTC1	83857	broad.mit.edu	hg19	12	29671410	29671410	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:29671410G>A	ENST00000256062.5	-	13	2168	c.1695C>T	c.(1693-1695)taC>taT	p.Y565Y	TMTC1_ENST00000552618.1_Silent_p.Y697Y|TMTC1_ENST00000539277.1_Silent_p.Y673Y|TMTC1_ENST00000551659.1_Silent_p.Y735Y|TMTC1_ENST00000319685.8_5'UTR	NM_175861.3	NP_787057.2	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	673			integral to membrane	binding	breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)				TTTACCGCTTGTACCATTCTT	0.463	0	184.0	166.0	172.0	12	29671410	2203	4300	6503	SO:0001819	synonymous_variant		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687	"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855			24764305	Standard	NM_001193451	Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000551659.1:c.2205C>T	12.37:g.29671410G>A		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	ENST00000551659.1	37																																																																																				TMTC1-010	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000403505.1		157.318746	0	-34	121	0	0	1	0	NM_031920	51	157.320905	52	0.495146
PRKDC	5591	ucsc.edu	hg19	8	48849060	48849060	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										CATCTTTTGCGTTTATAACCT	0.403	0	114.0	114.0	114.0	8	48849060	1994	4166	6160	SO:0001819	synonymous_variant		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1	7638222	Standard	NM_001081640	Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.1131C>T	8.37:g.48849060G>A		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	ENST00000314191.2	37																																																																																				PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					4	53					NM_001081640	14		24	
CNTN1	1272	broad.mit.edu	hg19	12	41421732	41421732	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:41421732C>T	ENST00000551295.2	+	22	2901	c.2784C>T	c.(2782-2784)gtC>gtT	p.V928V	CNTN1_ENST00000347616.1_Silent_p.V928V|CNTN1_ENST00000348761.2_Silent_p.V917V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	928	Fibronectin type-III 4.	axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)			GGGATCATGTCGTTGCACTAT	0.388	0	153.0	133.0	140.0	12	41421732	2203	4300	6503	SO:0001819	synonymous_variant	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016			7959734, 8586965	Standard	NM_001843	Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2784C>T	12.37:g.41421732C>T		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	ENST00000551295.2	37	CCDS8737.1																																																																																			CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2		16.003220	0	7	66	0	0	1	0	NM_001843	7	19.346772	30	0.189189
PDGFRA	5156	broad.mit.edu	hg19	4	55146591	55146591	+	Silent	SNP	C	C	T	rs149659832		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:55146591C>T	ENST00000257290.5	+	16	2596	c.2265C>T	c.(2263-2265)tcC>tcT	p.S755S	FIP1L1_ENST00000507166.1_Silent_p.S515S	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	755	Protein kinase.	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		CTAAATATTCCGACATCCAGA	0.398	0	85.0	82.0	83.0	4	55146591	2203	4300	6503	SO:0001819	synonymous_variant	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490				Standard	NM_006206	Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2265C>T	4.37:g.55146591C>T		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	ENST00000257290.5	37	CCDS3495.1																																																																																			PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2		72.018350	0	-2	63	0	0	1	0	NM_006206	23	72.219599	30	0.433962
RP11-565P22.6	9722	broad.mit.edu	hg19	1	162336952	162336952	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:162336952G>A	ENST00000493151.1	+	2	2698	c.331G>A	c.(331-333)Gcg>Acg	p.A111T	NOS1AP_ENST00000530878.1_Missense_Mutation_p.A401T|NOS1AP_ENST00000454693.1_3'UTR|RP11-565P22.6_ENST00000431696.1_Missense_Mutation_p.A92T|NOS1AP_ENST00000361897.5_Missense_Mutation_p.A406T	NM_001126060.1	NP_001119532.2	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	406	PID.	regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding	NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)		GCCGCTGGGCGCGGGCTTGGC	0.662	0	64.0	74.0	70.0	1	162336952	2203	4300	6503	SO:0001583	missense																									ENST00000431696.1:c.274G>A	1.37:g.162336952G>A	ENSP00000405676:p.Ala92Thr		ENST00000431696.1	37		.	.	.	.	.	.	.	.	.	.	G	13.71	2.319171	0.41096	.	.	ENSG00000198929;ENSG00000198929;ENSG00000198929;ENSG00000198929;ENSG00000254706	ENST00000530878;ENST00000361897;ENST00000464284;ENST00000493151;ENST00000431696	T;T	0.77098	-1.07;-1.07	4.96	1.56	0.23342	.	0.285831	0.38959	N	0.001520	T	0.31263	0.0791	N	0.14661	0.345	.	.	.	B;B;B	0.23249	0.007;0.082;0.05	B;B;B	0.14023	0.002;0.01;0.01	T	0.02852	-1.1102	9	0.19590	T	0.45	.	2.9688	0.05916	0.1037:0.2697:0.4768:0.1498	.	111;401;406	Q3T551;B7ZLF5;O75052	.;.;CAPON_HUMAN	T	401;406;62;111;92	ENSP00000431586:A401T;ENSP00000355133:A406T	ENSP00000355133:A406T	A	+	1	0	NOS1AP;RP11-565P22.6	160603576	0.425000	0.25498	0.999000	0.59377	0.997000	0.91878	1.432000	0.34936	0.553000	0.29044	0.655000	0.94253	GCG	RP11-565P22.6-001	PUTATIVE	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000382765.1		86.714231	0	-10	102	0	0	1	0		30	87.374892	45	0.400000
YAP1	10413	broad.mit.edu	hg19	11	102094425	102094425	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:102094425G>A	ENST00000282441.5	+	7	1493	c.1105G>A	c.(1105-1107)Ggg>Agg	p.G369R	YAP1_ENST00000524575.1_Missense_Mutation_p.G191R|YAP1_ENST00000537274.1_Missense_Mutation_p.G357R|YAP1_ENST00000345877.2_Missense_Mutation_p.G319R|YAP1_ENST00000526343.1_Missense_Mutation_p.G315R|YAP1_ENST00000531439.1_Missense_Mutation_p.G353R	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	369	Transactivation domain.	cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding	central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)	GTCTTCTCCCGGGATGTCTCA	0.438	0	110.0	99.0	103.0	11	102094425	2203	4299	6502	SO:0001583	missense		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693		16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""		7782338	Standard	NM_001130145	Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000524575.1:c.571G>A	11.37:g.102094425G>A	ENSP00000435602:p.Gly191Arg	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	ENST00000524575.1	37	CCDS53700.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577182	0.86645	.	.	ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575	T;T;T	0.43688	0.94;0.98;0.94	5.49	5.49	0.81192	.	0.134476	0.48767	D	0.000162	T	0.56124	0.1964	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;1.0;0.999;0.956;0.999;1.0	T	0.58691	-0.7592	10	0.87932	D	0	.	19.7375	0.96212	0.0:0.0:1.0:0.0	.	191;286;315;353;369;319	B4DTY1;F5GWC5;E9PRV2;P46937-2;P46937;P46937-3	.;.;.;.;YAP1_HUMAN;.	R	315;369;357;319;286;353;191	ENSP00000434134:G315R;ENSP00000331023:G319R;ENSP00000435602:G191R	ENSP00000282441:G369R	G	+	1	0	YAP1	101599635	1.000000	0.71417	0.969000	0.41365	0.977000	0.68977	7.506000	0.81665	2.753000	0.94483	0.555000	0.69702	GGG	YAP1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000394153.1		107.776643	0	-3	77	0	0	1	0	NM_006106	33	107.780013	32	0.507692
MERTK	10461	broad.mit.edu	hg19	2	112705055	112705055	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:112705055C>T	ENST00000295408.4	+	4	925	c.668C>T	c.(667-669)cCg>cTg	p.P223L	MERTK_ENST00000421804.2_Missense_Mutation_p.P223L|MERTK_ENST00000409780.1_Missense_Mutation_p.P47L			Q12866	MERTK_HUMAN	c-mer proto-oncogene tyrosine kinase	223	Ig-like C2-type 2.	cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46					GCTGTGGGCCCGCCTGAGCCC	0.517	0	73.0	74.0	74.0	2	112705055	2203	4300	6503	SO:0001583	missense	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""		8086340, 10343112	Standard	XM_005263565	Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.668C>T	2.37:g.112705055C>T	ENSP00000295408:p.Pro223Leu	Q9HBB4	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590406	0.86851	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000409780	T;T;T	0.12361	2.69;2.69;2.69	5.24	5.24	0.73138	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.33290	U	0.005068	T	0.35158	0.0922	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.03344	-1.1046	10	0.87932	D	0	-21.076	18.7692	0.91883	0.0:1.0:0.0:0.0	.	223	Q12866	MERTK_HUMAN	L	223;223;47	ENSP00000295408:P223L;ENSP00000389152:P223L;ENSP00000387277:P47L	ENSP00000295408:P223L	P	+	2	0	MERTK	112421526	0.999000	0.42202	0.956000	0.39512	0.909000	0.53808	5.740000	0.68629	2.608000	0.88229	0.655000	0.94253	CCG	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		77.766914	0	-13	56	0	0	1	0		25	77.866011	30	0.454545
UNC5C	8633	broad.mit.edu	hg19	4	96163728	96163728	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:96163728C>T	ENST00000453304.1	-	7	1308	c.960G>A	c.(958-960)acG>acA	p.T320T	UNC5C_ENST00000506749.1_Silent_p.T320T	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	320	TSP type-1 2.	apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	TGCTCCATGGCGTCCACCTGC	0.567	0	26.0	21.0	23.0	4	96163728	2203	4300	6503	SO:0001819	synonymous_variant	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168	"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""		9126742, 9782087	Standard	NM_003728	Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000506749.1:c.960G>A	4.37:g.96163728C>T		Q8IUT0	ENST00000506749.1	37																																																																																				UNC5C-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363048.2		21.421512	0	7	26	0	0	1	0	NM_003728	7	21.616008	11	0.388889
XIST	0	broad.mit.edu	hg19	X	73071059	73071059	+	RNA	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:73071059G>A	ENST00000429829.1	-	0	1529					NR_001564.2																TTAACAATGCGGCAAGCCCGC	0.517	0	117.0	112.0	114.0	X	73071059	876	1991	2867			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807	"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E	1985261, 2034279	Standard	NR_001564	Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071059G>A			ENST00000429829.1	37																																																																																				XIST-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000057239.1		86.953968	0	-18	122	0	0	1	0	NR_001564	32	87.439529	45	0.415584
FRAS1	80144	broad.mit.edu	hg19	4	79334177	79334177	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:79334177G>A	ENST00000264895.6	+	32	4803	c.4363G>A	c.(4363-4365)Gcg>Acg	p.A1455T	FRAS1_ENST00000325942.6_Missense_Mutation_p.A1455T	NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1454		cell communication	integral to membrane|plasma membrane	metal ion binding	breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103					GTTCAACATCGCGATCTTACC	0.512	0	124.0	126.0	125.0	4	79334177	1980	4163	6143	SO:0001583	missense	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759		19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""		12766769, 3118036	Standard	NM_025074	Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4363G>A	4.37:g.79334177G>A	ENSP00000326330:p.Ala1455Thr	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034512	0.54896	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.51325	0.71;0.71	6.17	6.17	0.99709	.	0.114253	0.64402	D	0.000014	T	0.57784	0.2077	N	0.25485	0.75	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.66716	0.743;0.946	T	0.50013	-0.8877	10	0.33141	T	0.24	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1455;1455	E9PHH6;A2RRR8	.;.	T	1455	ENSP00000326330:A1455T;ENSP00000264895:A1455T	ENSP00000264895:A1455T	A	+	1	0	FRAS1	79553201	1.000000	0.71417	0.972000	0.41901	0.092000	0.18411	6.566000	0.73978	2.941000	0.99782	0.655000	0.94253	GCG	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		16.535603	0	2	16	0	0	1	0		6	16.669666	9	0.400000
KCNC1	3746	broad.mit.edu	hg19	11	17793391	17793391	+	Silent	SNP	C	C	T	rs147271572	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:17793391C>T	ENST00000379472.3	+	2	780	c.750C>T	c.(748-750)ggC>ggT	p.G250G	KCNC1_ENST00000265969.6_Silent_p.G250G	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	250			voltage-gated potassium channel complex	voltage-gated potassium channel activity	breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					ACATCGAGGGCGTCTGTGTGG	0.537	0	324.0	267.0	286.0	11	17793391	2200	4293	6493	SO:0001819	synonymous_variant	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258			8449507, 16382104	Standard	NM_004976	Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000265969.6:c.750C>T	11.37:g.17793391C>T		K4DI87	ENST00000265969.6	37	CCDS44547.1																																																																																			KCNC1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389388.1		83.717002	0	9	144	0	0	1	0	NM_004976	32	85.463620	59	0.351648
THSD4	79875	broad.mit.edu	hg19	15	71952898	71952898	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:71952898C>T	ENST00000355327.3	+	8	1316	c.1182C>T	c.(1180-1182)tcC>tcT	p.S394S	THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Silent_p.S394S|THSD4_ENST00000357769.4_Silent_p.S34S			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	394			proteinaceous extracellular matrix	metalloendopeptidase activity	breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42					ACTTAGGCTCCGACAAAGTCG	0.507	0	178.0	179.0	179.0	15	71952898	1975	4171	6146	SO:0001819	synonymous_variant	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720		25835	protein-coding gene	gene with protein product		614476			19734141	Standard	NM_001286429	Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1182C>T	15.37:g.71952898C>T		B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	ENST00000355327.3	37	CCDS10238.2																																																																																			THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2		41.956780	0	-27	201	0	0	1	0	NM_024817	22	59.253657	125	0.149660
DHRS3	9249	broad.mit.edu	hg19	1	12677172	12677172	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:12677172C>T	ENST00000376223.2	-	1	565	c.182G>A	c.(181-183)cGc>cAc	p.R61H		NM_004753.4	NP_004744.2	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3	61		retinol metabolic process|visual perception	integral to membrane	electron carrier activity|NADP-retinol dehydrogenase activity|nucleotide binding	cervix(1)|large_intestine(4)|lung(2)|prostate(1)|skin(1)	9	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	TCTGGCGCCGCGCTCCGCGAA	0.746	1	19.0	23.0	22.0	1	12677172	2195	4277	6472	SO:0001583	missense	AF061741	CCDS146.1	1p36.1	2011-09-20			ENSG00000162496	ENSG00000162496	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	17693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 1"""	612830			9705317, 12226107, 19027726	Standard	XM_005263533	Approved	retSDR1, Rsdr1, SDR1, RDH17, SDR16C1	uc001auc.3	O75911	OTTHUMG00000001885	ENST00000376223.2:c.182G>A	1.37:g.12677172C>T	ENSP00000365397:p.Arg61His	B2R7F3|Q5VUY3|Q6UY38|Q9BUC8	ENST00000376223.2	37	CCDS146.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208849	0.39003	.	.	ENSG00000162496	ENST00000376223	D	0.88509	-2.39	5.04	5.04	0.67666	NAD(P)-binding domain (1);	0.057178	0.64402	D	0.000001	T	0.81389	0.4812	L	0.35593	1.075	0.49299	D	0.999772	B;B;B	0.28667	0.002;0.219;0.004	B;B;B	0.26310	0.001;0.068;0.002	T	0.76677	-0.2871	10	0.21014	T	0.42	.	10.937	0.47251	0.0:0.9142:0.0:0.0858	.	61;61;61	B2R7F3;O75911-2;O75911	.;.;DHRS3_HUMAN	H	61	ENSP00000365397:R61H	ENSP00000365397:R61H	R	-	2	0	DHRS3	12599759	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.571000	0.53841	2.318000	0.78349	0.462000	0.41574	CGC	DHRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005318.1		15.840722	0	-1	31	0	0	1	0	NM_004753	6	16.706419	15	0.285714
SCN4A	6329	broad.mit.edu	hg19	17	62018497	62018497	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:62018497G>A	ENST00000435607.1	-	24	5221	c.5145C>T	c.(5143-5145)taC>taT	p.Y1715Y	SCN4A_ENST00000578147.1_Silent_p.Y1715Y	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1715		muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					TGATGGGCTCGTAGGACACCT	0.607	0	138.0	137.0	137.0	17	62018497	2094	4218	6312	SO:0001819	synonymous_variant	U24693		17q23.3	2012-02-26	2007-01-23				"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP	1654742, 1659948, 16382098	Standard	XM_005257566	Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000578147.1:c.5145C>T	17.37:g.62018497G>A		Q15478|Q16447|Q7Z6B1	ENST00000578147.1	37																																																																																				SCN4A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000444562.1		72.895300	0	17	101	0	0	1	0	NM_000334	24	72.962129	28	0.461538
PLCB4	5332	broad.mit.edu	hg19	20	9389753	9389753	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:9389753G>A	ENST00000378501.2	+	20	1903	c.1888G>A	c.(1888-1890)Gat>Aat	p.D630N	PLCB4_ENST00000378493.1_Missense_Mutation_p.D630N|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Missense_Mutation_p.D630N|PLCB4_ENST00000378473.3_Missense_Mutation_p.D642N|PLCB4_ENST00000334005.3_Missense_Mutation_p.D630N|PLCB4_ENST00000414679.2_Missense_Mutation_p.D642N	NM_000933.3	NP_000924.3	Q15147	PLCB4_HUMAN	phospholipase C, beta 4	630	PI-PLC Y-box.	intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87					AGGCCGAGTCGATTCCAGTAA	0.448	0	67.0	57.0	60.0	20	9389753	2203	4300	6503	SO:0001583	missense		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333		9059	protein-coding gene	gene with protein product		600810			8530101	Standard	NM_000933	Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378501.2:c.1888G>A	20.37:g.9389753G>A	ENSP00000367762:p.Asp630Asn	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	ENST00000378501.2	37	CCDS13104.1	.	.	.	.	.	.	.	.	.	.	G	36	5.638738	0.96693	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43	6.04	6.04	0.98038	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	M	0.63428	1.95	0.80722	D	1	P;B;D;P	0.76494	0.869;0.224;0.999;0.909	P;B;D;B	0.76071	0.514;0.084;0.987;0.379	T	0.71391	-0.4607	10	0.62326	D	0.03	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	642;477;630;630	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	N	630;642;630;630;630;478	ENSP00000334105:D630N;ENSP00000367734:D642N;ENSP00000278655:D630N;ENSP00000367754:D630N;ENSP00000367762:D630N;ENSP00000390616:D478N	ENSP00000278655:D630N	D	+	1	0	PLCB4	9337753	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	GAT	PLCB4-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077958.2		25.414297	0	-41	61	0	0	1	0		12	31.649886	54	0.181818
GTF2E2	2961	broad.mit.edu	hg19	8	30511073	30511073	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:30511073G>A	ENST00000355904.4	-	2	325	c.43C>T	c.(43-45)Cga>Tga	p.R15*		NM_002095.4	NP_002086.1	P29084	T2EB_HUMAN	general transcription factor IIE, polypeptide 2, beta 34kDa	15		regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription factor TFIIE complex	DNA binding|protein binding	endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.113)|Kidney(114;0.135)	GAAAGAGCTCGTTTTTTGAAC	0.378	0	94.0	91.0	92.0	8	30511073	2203	4300	6503	SO:0001587	stop_gained	BC030572	CCDS6078.1	8p12	2010-03-23	2002-08-29		ENSG00000197265	ENSG00000197265	"""General transcription factors"""	4651	protein-coding gene	gene with protein product		189964	"""general transcription factor IIE, polypeptide 2 (beta subunit, 34kD)"""		1956404	Standard	NM_002095	Approved	TFIIE-B, FE, TF2E2	uc003xig.3	P29084	OTTHUMG00000163934	ENST00000355904.4:c.43C>T	8.37:g.30511073G>A	ENSP00000348168:p.Arg15*	D3DSV2|Q9H2B9	ENST00000355904.4	37	CCDS6078.1	.	.	.	.	.	.	.	.	.	.	G	37	5.991135	0.97179	.	.	ENSG00000197265	ENST00000355904;ENST00000518599;ENST00000518445	.	.	.	5.7	3.85	0.44370	.	0.064443	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9014	10.7869	0.46411	0.0:0.1424:0.7097:0.1479	.	.	.	.	X	15	.	ENSP00000348168:R15X	R	-	1	2	GTF2E2	30630615	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.603000	0.54074	0.708000	0.31955	0.644000	0.83932	CGA	GTF2E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376459.2		48.593988	0	-4	60	0	0	1	0	NM_002095	16	48.800574	22	0.421053
CDC27	996	broad.mit.edu	hg19	17	45258967	45258967	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:45258967G>A	ENST00000066544.3	-	2	157	c.64C>T	c.(64-66)Cga>Tga	p.R22*	CDC27_ENST00000527547.1_Nonsense_Mutation_p.R22*|CDC27_ENST00000531206.1_Nonsense_Mutation_p.R22*|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Missense_Mutation_p.P10L	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	22		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding	NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90					ACCGCATCTCGGTAAGCATAG	0.363	0	35.0	35.0	35.0	17	45258967	2203	4300	6503	SO:0001587	stop_gained	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897	"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E	8234252	Standard	XM_005257892	Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000531206.1:c.64C>T	17.37:g.45258967G>A	ENSP00000434614:p.Arg22*	G3V1C4|Q16349|Q96F35	ENST00000531206.1	37	CCDS45720.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.468514|6.468514	0.97590|0.97590	.|.	.|.	ENSG00000004897|ENSG00000004897	ENST00000446365|ENST00000066544;ENST00000531206;ENST00000533415;ENST00000527547;ENST00000526866	T|.	0.75704|.	-0.96|.	4.93|4.93	3.95|3.95	0.45737|0.45737	.|.	.|0.075603	.|0.52532	.|D	.|0.000061	T|.	0.25382|.	0.0617|.	.|.	.|.	.|.	0.35175|0.35175	D|D	0.771941|0.771941	B|.	0.31519|.	0.327|.	B|.	0.19946|.	0.027|.	T|.	0.27157|.	-1.0082|.	8|.	0.87932|0.02654	D|T	0|1	-12.8139|-12.8139	10.1835|10.1835	0.42984|0.42984	0.0:0.0:0.6088:0.3912|0.0:0.0:0.6088:0.3912	.|.	10|.	B4DL80|.	.|.	L|X	10|22	ENSP00000392802:P10L|.	ENSP00000392802:P10L|ENSP00000066544:R22X	P|R	-|-	2|1	0|2	CDC27|CDC27	42613966|42613966	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.795000|4.795000	0.62489|0.62489	1.275000|1.275000	0.44379|0.44379	0.462000|0.462000	0.41574|0.41574	CCG|CGA	CDC27-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389745.1		11.959733	0	-14	23	0	0	1	0		5	14.258374	21	0.192308
KIAA1958	158405	broad.mit.edu	hg19	9	115421680	115421680	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:115421680C>T	ENST00000337530.6	+	4	1778	c.1482C>T	c.(1480-1482)gtC>gtT	p.V494V	KIAA1958_ENST00000536272.1_Silent_p.V522V	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	494					endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25					ATGCAGGTGTCGGCTTTTCCA	0.582	0	49.0	46.0	47.0	9	115421680	2203	4300	6503	SO:0001819	synonymous_variant	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185		23427	protein-coding gene	gene with protein product						Standard	NM_001287038	Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1482C>T	9.37:g.115421680C>T		B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	ENST00000337530.6	37	CCDS35108.1																																																																																			KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1		28.638649	0	4	48	0	0	1	0	NM_133465	10	29.927158	24	0.294118
PLA2G7	7941	broad.mit.edu	hg19	6	46678287	46678287	+	Missense_Mutation	SNP	G	G	C			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:46678287G>C	ENST00000274793.7	-	8	968	c.772C>G	c.(772-774)Ctg>Gtg	p.L258V	PLA2G7_ENST00000538237.1_Missense_Mutation_p.L213V|PLA2G7_ENST00000537365.1_Missense_Mutation_p.L258V|PLA2G7_ENST00000541026.1_Missense_Mutation_p.L131V	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	258		inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding	endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)		CTTACCTTCAGTTGTTCCATA	0.313	0	94.0	93.0	93.0	6	46678287	2203	4300	6503	SO:0001583	missense	U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070		9040	protein-coding gene	gene with protein product		601690			7700381, 8624782	Standard	NM_005084	Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.772C>G	6.37:g.46678287G>C	ENSP00000274793:p.Leu258Val	A5HTT5|Q15692|Q5VTT1|Q8IVA2	ENST00000274793.7	37	CCDS4917.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402737	0.42613	.	.	ENSG00000146070	ENST00000274793;ENST00000537365;ENST00000538237;ENST00000541026	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.87	4.06	0.47325	.	0.142315	0.48286	D	0.000182	T	0.62380	0.2423	M	0.88105	2.93	0.28191	N	0.927767	D;P;D;D	0.64830	0.988;0.858;0.994;0.994	D;P;P;D	0.65140	0.932;0.678;0.899;0.925	T	0.59632	-0.7418	10	0.39692	T	0.17	.	6.009	0.19565	0.1347:0.0:0.5854:0.2799	.	131;213;258;258	B4DLM5;F5GYY6;A8K2W6;Q13093	.;.;.;PAFA_HUMAN	V	258;258;213;131	ENSP00000274793:L258V;ENSP00000445666:L258V;ENSP00000441416:L213V;ENSP00000444164:L131V	ENSP00000274793:L258V	L	-	1	2	PLA2G7	46786246	0.439000	0.25610	0.979000	0.43373	0.636000	0.38137	0.671000	0.25172	0.786000	0.33708	0.655000	0.94253	CTG	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040802.1		3.169029	0	-7	55	0	0	1	0		4	9.310131	35	0.102564
THBS2	7058	broad.mit.edu	hg19	6	169648976	169648976	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:169648976C>T	ENST00000366787.3	-	4	394	c.145G>A	c.(145-147)Gac>Aac	p.D49N		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	49	Heparin-binding (Potential).|TSP N-terminal.	cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	ACGCCGGGGTCGGGCCCGCGG	0.577	0	97.0	79.0	85.0	6	169648976	2203	4300	6503	SO:0001583	missense		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340		11786	protein-coding gene	gene with protein product		188061			18455130	Standard	NM_003247	Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.145G>A	6.37:g.169648976C>T	ENSP00000355751:p.Asp49Asn	A6H8N1|A7E232|Q5RI52	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981105	0.34942	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T;T	0.02280	4.36;4.36	4.42	4.42	0.53409	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.42821	U	0.000644	T	0.01558	0.0050	M	0.66939	2.045	0.27434	N	0.95393	B	0.10296	0.003	B	0.06405	0.002	T	0.27331	-1.0077	10	0.87932	D	0	-43.6698	11.9595	0.53001	0.0:0.9152:0.0:0.0848	.	49	P35442	TSP2_HUMAN	N	49	ENSP00000355751:D49N;ENSP00000398928:D49N	ENSP00000355751:D49N	D	-	1	0	THBS2	169390901	0.549000	0.26481	0.332000	0.25469	0.472000	0.32918	1.063000	0.30567	2.180000	0.69256	0.462000	0.41574	GAC	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1		12.437873	0	10	43	0	0	1	0	NM_003247	6	14.546889	22	0.214286
CTD-2192J16.22	0	broad.mit.edu	hg19	19	12758281	12758281	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:12758281G>A	ENST00000597692.1	-	2	354	c.355C>T	c.(355-357)Cgc>Tgc	p.R119C	MAN2B1_ENST00000221363.4_Silent_p.S931S|MAN2B1_ENST00000456935.2_Silent_p.S932S																	TAACGGGGGCGCTCAGGTTAC	0.592	0	113.0	109.0	110.0	19	12758281	2203	4300	6503	SO:0001583	missense																									ENST00000597692.1:c.355C>T	19.37:g.12758281G>A	ENSP00000470240:p.Arg119Cys		ENST00000597692.1	37																																																																																				CTD-2192J16.22-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000462694.1		24.431556	0	5	127	0	0	1	0		13	32.645417	65	0.166667
TRPM2	7226	broad.mit.edu	hg19	21	45784126	45784126	+	Silent	SNP	C	C	T	rs143653746		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr21:45784126C>T	ENST00000397928.1	+	3	829	c.384C>T	c.(382-384)ggC>ggT	p.G128G	TRPM2_ENST00000300482.5_Silent_p.G128G|TRPM2_ENST00000300481.9_Silent_p.G128G|TRPM2_ENST00000397932.2_Silent_p.G128G	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	128			integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76					ATGCCTTTGGCGACATCGTCT	0.562	0	181.0	139.0	153.0	21	45784126	2203	4300	6503	SO:0001819	synonymous_variant	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185	"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7	9806837, 11385575, 16382100	Standard	NR_038257	Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397932.2:c.384C>T	21.37:g.45784126C>T		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	ENST00000397932.2	37																																																																																				TRPM2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000339787.1		32.916276	0	-16	69	0	0	1	0	NM_003307	11	33.605903	21	0.343750
CSF3	1440	broad.mit.edu	hg19	17	38173107	38173107	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:38173107C>T	ENST00000331769.2	+	4	714	c.498C>T	c.(496-498)ttC>ttT	p.F166F	CSF3_ENST00000225474.2_Silent_p.F173F|CSF3_ENST00000394149.3_Silent_p.F170F|CSF3_ENST00000577675.1_Silent_p.F130F|CSF3_ENST00000394148.3_Silent_p.F137F			P09919	CSF3_HUMAN	colony stimulating factor 3 (granulocyte)	173		cytokine-mediated signaling pathway|granulocyte differentiation|immune response|positive regulation of cell proliferation	extracellular space	cytokine activity|enzyme binding|granulocyte colony-stimulating factor receptor binding|growth factor activity	endometrium(1)|ovary(1)|prostate(1)	3	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			TGCCGGCCTTCGCCTCTGCTT	0.647	0	52.0	50.0	50.0	17	38173107	2203	4300	6503	SO:0001819	synonymous_variant		CCDS11357.1, CCDS11358.1, CCDS42314.1, CCDS11358.2	17q11.2-q12	2014-01-30			ENSG00000108342	ENSG00000108342	"""Endogenous ligands"""	2438	protein-coding gene	gene with protein product	"""granulocyte colony stimulating factor"", ""pluripoietin"", ""filgrastim"", ""lenograstim"""	138970	"""chromosome 17 open reading frame 33"""	GCSF, G-CSF, C17orf33	3499671, 3501046	Standard	NM_000759	Approved	MGC45931	uc002htp.3	P09919	OTTHUMG00000133247	ENST00000225474.2:c.519C>T	17.37:g.38173107C>T		A8MXR7	ENST00000225474.2	37	CCDS11357.1																																																																																			CSF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256988.2		4.542340	0	-7	48	0	0	1	0	NM_172220	5	11.520914	41	0.108696
CHST15	51363	broad.mit.edu	hg19	10	125805354	125805354	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:125805354G>A	ENST00000346248.5	-	2	1017	c.375C>T	c.(373-375)agC>agT	p.S125S	CHST15_ENST00000421115.1_Silent_p.S125S|CHST15_ENST00000435907.1_Silent_p.S125S	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	125		hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity	endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26					TTGGGTTTTCGCTGTCCATCA	0.438	0	147.0	160.0	156.0	10	125805354	2203	4300	6503	SO:0001819	synonymous_variant	AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277			9628581, 9754571, 11572857	Standard	NM_014863	Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.375C>T	10.37:g.125805354G>A		O60338|O60474|Q86VM4	ENST00000346248.5	37	CCDS7638.1																																																																																			CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1		-6.931403	0	-19	176	0	0	1	0	NM_015892	6	12.767514	92	0.061224
TCF19	6941	broad.mit.edu	hg19	6	31130268	31130268	+	Missense_Mutation	SNP	G	G	A	rs142309377	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:31130268G>A	ENST00000376257.3	+	4	1566	c.812G>A	c.(811-813)cGt>cAt	p.R271H	TCF19_ENST00000496421.1_3'UTR|TCF19_ENST00000376255.4_Missense_Mutation_p.R271H	NM_007109.2	NP_009040.2	Q9Y242	TCF19_HUMAN	transcription factor 19	271	Pro-rich.	cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding	kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9					CGACGTGGCCGTCCTCGGAAG	0.607	0	84.0	92.0	89.0	6	31130268	1287	2550	3837	SO:0001583	missense	U25826	CCDS43446.1	6p21.3	2013-01-28	2009-02-05		ENSG00000137310	ENSG00000137310	"""Zinc fingers, PHD-type"""	11629	protein-coding gene	gene with protein product		600912			1868030, 8595903	Standard	NM_001077511	Approved	SC1	uc003nss.3	Q9Y242	OTTHUMG00000031274	ENST00000376257.3:c.812G>A	6.37:g.31130268G>A	ENSP00000365433:p.Arg271His	A6NCT8|B0UY11|Q0EFA8|Q13176|Q15967|Q5SQ89|Q5STD6|Q5STF5|Q9BUM2|Q9UBH7	ENST00000376257.3	37	CCDS43446.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	G	11.65	1.700994	0.30142	.	.	ENSG00000137310	ENST00000376257;ENST00000376255	T;T	0.34667	1.35;1.35	3.21	2.22	0.28083	Zinc finger, FYVE/PHD-type (1);	0.116892	0.64402	N	0.000017	T	0.12092	0.0294	L	0.31926	0.97	0.80722	D	1	B	0.16802	0.019	B	0.10450	0.005	T	0.06552	-1.0820	10	0.72032	D	0.01	-30.1324	7.3256	0.26553	0.156:0.0:0.844:0.0	.	271	Q9Y242	TCF19_HUMAN	H	271	ENSP00000365433:R271H;ENSP00000365431:R271H	ENSP00000365431:R271H	R	+	2	0	TCF19	31238247	0.721000	0.28007	0.894000	0.35097	0.580000	0.36256	1.730000	0.38125	0.564000	0.29238	0.549000	0.68633	CGT	TCF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076595.2		5.744766	0	-12	70	0	0	1	0	NM_007109	5	12.222553	39	0.113636
AKAP13	11214	broad.mit.edu	hg19	15	86124462	86124462	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:86124462G>A	ENST00000394518.2	+	7	3258	c.3163G>A	c.(3163-3165)Gat>Aat	p.D1055N	AKAP13_ENST00000361243.2_Missense_Mutation_p.D1055N	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1055		apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98					TGATGGGTCCGATGCTCTTAA	0.542	0	76.0	72.0	73.0	15	86124462	2202	4299	6501	SO:0001583	missense	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776	"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC	9627117, 1860836	Standard	NM_007200	Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000361243.2:c.3163G>A	15.37:g.86124462G>A	ENSP00000354718:p.Asp1055Asn	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	ENST00000361243.2	37	CCDS32320.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066043	0.36470	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.12774	2.65;2.65	4.57	0.077	0.14406	.	.	.	.	.	T	0.06826	0.0174	N	0.08118	0	0.09310	N	0.999996	B;B	0.15141	0.012;0.006	B;B	0.04013	0.0;0.001	T	0.34527	-0.9825	9	0.66056	D	0.02	.	7.8278	0.29326	0.0952:0.4783:0.4265:0.0	.	1055;1055	Q12802;Q12802-2	AKP13_HUMAN;.	N	1055;1055;1054;1054	ENSP00000354718:D1055N;ENSP00000378026:D1055N	ENSP00000354718:D1055N	D	+	1	0	AKAP13	83925466	0.004000	0.15560	0.019000	0.16419	0.097000	0.18754	1.251000	0.32862	0.146000	0.19002	0.655000	0.94253	GAT	AKAP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417319.1		47.254501	0	-18	63	0	0	1	0	NM_007200	17	49.182392	39	0.303571
OTUD4	54726	broad.mit.edu	hg19	4	146058662	146058662	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:146058662G>A	ENST00000454497.2	-	21	3207	c.3070C>T	c.(3070-3072)Cga>Tga	p.R1024*	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000447906.2_Nonsense_Mutation_p.R1089*	NM_001102653.1	NP_001096123.1	Q01804	OTUD4_HUMAN	OTU domain containing 4	1088				protein binding	breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)				CTGACATTTCGATGGTACTGA	0.502	0	119.0	117.0	118.0	4	146058662	2202	4286	6488	SO:0001587	stop_gained		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164	"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""		1475186, 12727813, 19996094	Standard	NM_001102653	Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.3265C>T	4.37:g.146058662G>A	ENSP00000395487:p.Arg1089*	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	ENST00000447906.2	37		.	.	.	.	.	.	.	.	.	.	G	37	6.072272	0.97256	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4152	17.0623	0.86550	0.0:0.0:0.8725:0.1275	.	.	.	.	X	1024;1089	.	ENSP00000395487:R1089X	R	-	1	2	OTUD4	146278112	1.000000	0.71417	0.946000	0.38457	0.338000	0.28826	4.963000	0.63694	2.941000	0.99782	0.655000	0.94253	CGA	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2		45.306948	0	-33	96	0	0	1	0	NM_017493	21	55.761060	92	0.185841
TOX3	27324	broad.mit.edu	hg19	16	52498045	52498045	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:52498045G>A	ENST00000219746.9	-	3	493	c.209C>T	c.(208-210)aCg>aTg	p.T70M	TOX3_ENST00000407228.3_Missense_Mutation_p.T65M	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	70		apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity	NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24					TGGAGGAGGCGTGATTGGTGG	0.488	0	135.0	150.0	145.0	16	52498045	2082	4207	6289	SO:0001583	missense	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460	"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9	9225980	Standard	NM_001080430	Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.209C>T	16.37:g.52498045G>A	ENSP00000219746:p.Thr70Met	B4DRD0|B5MCW4	ENST00000219746.9	37	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496926	0.64186	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.44482	0.92;0.92	5.9	5.9	0.94986	.	0.051178	0.85682	D	0.000000	T	0.68439	0.3001	M	0.78049	2.395	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	T	0.70015	-0.4988	10	0.87932	D	0	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	65;70	B4DRD0;O15405	.;TOX3_HUMAN	M	70;65	ENSP00000219746:T70M;ENSP00000385705:T65M	ENSP00000219746:T70M	T	-	2	0	TOX3	51055546	1.000000	0.71417	0.989000	0.46669	0.728000	0.41692	7.863000	0.87023	2.806000	0.96561	0.655000	0.94253	ACG	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1		51.098002	0	-8	77	0	0	1	0	XM_049037	19	53.915398	48	0.283582
CCER1	196477	broad.mit.edu	hg19	12	91348368	91348368	+	Missense_Mutation	SNP	G	G	A	rs146867450		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:91348368G>A	ENST00000358859.2	-	1	585	c.152C>T	c.(151-153)cCg>cTg	p.P51L	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1			coiled-coil glutamate-rich protein 1												ATATCGGTGCGGTCTATTGTA	0.652	0	35.0	35.0	35.0	12	91348368	2203	4300	6503	SO:0001583	missense	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651		28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12	17967063	Standard	NM_152638	Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.152C>T	12.37:g.91348368G>A	ENSP00000351727:p.Pro51Leu	Q8TC47	ENST00000358859.2	37	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	G	4.690	0.128353	0.08981	2.27E-4	0.0	ENSG00000197651	ENST00000358859	T	0.37411	1.2	4.87	3.98	0.46160	.	0.283059	0.19197	N	0.120278	T	0.17874	0.0429	N	0.08118	0	0.09310	N	1	B	0.29571	0.249	B	0.19148	0.024	T	0.11842	-1.0571	10	0.38643	T	0.18	-5.9456	11.1284	0.48333	0.0:0.8097:0.1903:0.0	.	51	Q8TC90	CL012_HUMAN	L	51	ENSP00000351727:P51L	ENSP00000351727:P51L	P	-	2	0	C12orf12	89872499	0.018000	0.18449	0.005000	0.12908	0.002000	0.02628	1.951000	0.40333	1.281000	0.44480	-0.539000	0.04255	CCG	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2		2.301166	0	2	27	0	0	1	0	NM_152638	3	7.352277	28	0.096774
CELSR1	9620	broad.mit.edu	hg19	22	46859996	46859996	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:46859996G>A	ENST00000262738.3	-	2	3790	c.3791C>T	c.(3790-3792)gCg>gTg	p.A1264V	CELSR1_ENST00000395964.1_Missense_Mutation_p.A1264V	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1264		central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	AGGCAGCAGCGCCGAGAAGGT	0.632	0	75.0	76.0	76.0	22	46859996	2203	4300	6503	SO:0001583	missense	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275	"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""		9339365	Standard	XM_006724383	Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3791C>T	22.37:g.46859996G>A	ENSP00000262738:p.Ala1264Val	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	ENST00000262738.3	37	CCDS14076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.92|17.92	3.506505|3.506505	0.64410|0.64410	.|.	.|.	ENSG00000075275|ENSG00000075275	ENST00000262738;ENST00000395964|ENST00000454637	T;T|.	0.68765|.	-0.35;-0.09|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.64402|.	U|.	0.000002|.	T|T	0.57080|0.57080	0.2029|0.2029	L|L	0.31207|0.31207	0.915|0.915	0.46336|0.46336	D|D	0.998996|0.998996	P|.	0.50156|.	0.932|.	P|.	0.45377|.	0.478|.	T|T	0.53704|0.53704	-0.8401|-0.8401	10|5	0.12766|.	T|.	0.61|.	.|.	17.5878|17.5878	0.87987|0.87987	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1264|.	Q9NYQ6|.	CELR1_HUMAN|.	V|C	1264|639	ENSP00000262738:A1264V;ENSP00000379293:A1264V|.	ENSP00000262738:A1264V|.	A|R	-|-	2|1	0|0	CELSR1|CELSR1	45238660|45238660	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.989000|0.989000	0.77384|0.77384	5.062000|5.062000	0.64326|0.64326	2.239000|2.239000	0.73571|0.73571	0.655000|0.655000	0.94253|0.94253	GCG|CGC	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1		0.629630	0	10	89	0	0	1	0	NM_014246	5	10.432978	52	0.087719
CHRM1	1128	broad.mit.edu	hg19	11	62678236	62678236	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:62678236C>T	ENST00000306960.3	-	2	878	c.337G>A	c.(337-339)Gtc>Atc	p.V113I	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	113		activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell proliferation|nervous system development|positive regulation of cell proliferation|protein modification process	cell junction|integral to plasma membrane|membrane fraction|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity|protein binding	large_intestine(5)|lung(3)|stomach(1)	9					AGATTCATGACGGAGGCATTG	0.612	0	63.0	58.0	59.0	11	62678236	2201	4298	6499	SO:0001583	missense	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539	"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510				Standard	NM_000738	Approved		uc001nwi.3	P11229		ENST00000306960.3:c.337G>A	11.37:g.62678236C>T	ENSP00000306490:p.Val113Ile	Q96RH1	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016115	0.75161	.	.	ENSG00000168539	ENST00000306960;ENST00000543973;ENST00000536524	T;T;T	0.19806	2.12;2.12;2.12	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000068	T	0.21427	0.0516	N	0.05383	-0.06	0.47778	D	0.999516	D	0.55800	0.973	P	0.58721	0.844	T	0.11348	-1.0591	10	0.30078	T	0.28	-34.1641	14.8803	0.70528	0.0:1.0:0.0:0.0	.	113	P11229	ACM1_HUMAN	I	113	ENSP00000306490:V113I;ENSP00000441188:V113I;ENSP00000444482:V113I	ENSP00000306490:V113I	V	-	1	0	CHRM1	62434812	1.000000	0.71417	0.980000	0.43619	0.944000	0.59088	7.632000	0.83247	2.376000	0.81061	0.563000	0.77884	GTC	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1		5.213620	0	-13	26	0	0	1	0	NM_000738	3	7.110580	15	0.166667
SERPINA3	12	broad.mit.edu	hg19	14	95080899	95080899	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:95080899C>T	ENST00000467132.1	+	2	1269	c.121C>T	c.(121-123)Cga>Tga	p.R41*	RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Nonsense_Mutation_p.R41*|SERPINA3_ENST00000393080.4_Nonsense_Mutation_p.R41*			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	41		acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)	GAACCAAGACCGAGGGACACA	0.582	0	117.0	116.0	116.0	14	95080899	2203	4300	6503	SO:0001587	stop_gained	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136	"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT	3260956, 24172014	Standard	NM_001085	Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.121C>T	14.37:g.95080899C>T	ENSP00000450540:p.Arg41*	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	ENST00000467132.1	37	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680838	0.47886	2.27E-4	0.0	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132;ENST00000380354	.	.	.	4.42	-3.03	0.05429	.	3.988340	0.01188	N	0.007251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.2621	0.02004	0.3193:0.2834:0.2676:0.1297	.	.	.	.	X	66;41;41;41;41;41	.	ENSP00000369712:R41X	R	+	1	2	SERPINA3	94150652	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.024000	0.12435	-0.120000	0.11809	-0.397000	0.06425	CGA	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3		55.842433	0	6	87	0	0	1	0	NM_001085	18	56.235551	27	0.400000
MAP7D2	256714	broad.mit.edu	hg19	X	20081643	20081643	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:20081643G>A	ENST00000379651.3	-	3	279	c.261C>T	c.(259-261)taC>taT	p.Y87Y	MAP7D2_ENST00000452324.3_Silent_p.Y43Y|MAP7D2_ENST00000379643.5_Silent_p.Y87Y|MAP7D2_ENST00000443379.3_Silent_p.Y87Y	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	87					NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37					TTTGCTTTTCGTACTGCAGCC	0.527	0	141.0	113.0	123.0	X	20081643	2203	4300	6503	SO:0001819	synonymous_variant	BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368		25899	protein-coding gene	gene with protein product					12477932	Standard	NM_152780	Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379643.5:c.261C>T	X.37:g.20081643G>A		B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	ENST00000379643.5	37	CCDS55386.1	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.18	1.278199	0.23307	0.0	2.97E-4	ENSG00000184368	ENST00000544957	.	.	.	5.87	-0.59	0.11679	.	.	.	.	.	T	0.58148	0.2102	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53019	-0.8497	4	.	.	.	-13.6087	11.2743	0.49157	0.5151:0.0:0.4849:0.0	.	.	.	.	M	36	.	.	T	-	2	0	MAP7D2	19991564	0.638000	0.27225	0.996000	0.52242	0.989000	0.77384	-0.198000	0.09505	-0.262000	0.09392	0.594000	0.82650	ACG	MAP7D2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056003.2		143.569263	0	-16	129	0	0	1	0	NM_152780	45	143.650684	51	0.468750
ZNF423	23090	broad.mit.edu	hg19	16	49672258	49672258	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:49672258C>T	ENST00000561648.1	-	4	858	c.805G>A	c.(805-807)Gag>Aag	p.E269K	ZNF423_ENST00000562871.1_Missense_Mutation_p.E209K|ZNF423_ENST00000562520.1_Missense_Mutation_p.E209K|ZNF423_ENST00000535559.1_Missense_Mutation_p.E152K|ZNF423_ENST00000567169.1_Missense_Mutation_p.E152K|ZNF423_ENST00000563137.2_Missense_Mutation_p.E209K|ZNF423_ENST00000262383.2_Missense_Mutation_p.E269K	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	269		cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)			AAGGTGTCCTCGCAGTAGTCG	0.597	0	54.0	44.0	47.0	16	49672258	2198	4300	6498	SO:0001583	missense	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935	"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557			9872452, 10660046	Standard	NM_001271620	Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.805G>A	16.37:g.49672258C>T	ENSP00000455426:p.Glu269Lys	O94860|Q76N04|Q9NZ13	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.087678	0.76642	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.76578	-1.03;-1.03	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	D	0.85191	0.5640	L	0.50333	1.59	0.54753	D	0.999984	D	0.89917	1.0	D	0.91635	0.999	D	0.84312	0.0511	9	.	.	.	.	18.3069	0.90185	0.0:1.0:0.0:0.0	.	269	Q2M1K9	ZN423_HUMAN	K	269;152	ENSP00000262383:E269K;ENSP00000442321:E152K	.	E	-	1	0	ZNF423	48229759	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.331000	0.79229	0.561000	0.74099	GAG	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1		16.142004	0	-24	24	0	0	1	0	NM_015069	6	16.856909	14	0.300000
TRIO	7204	broad.mit.edu	hg19	5	14508349	14508349	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:14508349C>T	ENST00000344204.4	+	57	9136	c.9112C>T	c.(9112-9114)Cgt>Tgt	p.R3038C	TRIO_ENST00000537187.1_Missense_Mutation_p.R2862C|TRIO_ENST00000344135.5_Missense_Mutation_p.R537C	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	3038	Protein kinase.	apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)				CCCCGCCAAGCGTCCCTCGGC	0.602	0	50.0	55.0	53.0	5	14508349	2203	4300	6503	SO:0001583	missense	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382	"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""		8643598	Standard	NM_007118	Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.9112C>T	5.37:g.14508349C>T	ENSP00000339299:p.Arg3038Cys	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634843	0.67130	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000344135	T;T;T	0.80738	-1.41;-1.41;-1.41	5.72	4.84	0.62591	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94486	0.8225	H	0.99545	4.62	0.43782	D	0.99631	D	0.89917	1.0	D	0.97110	1.0	D	0.96936	0.9684	10	0.87932	D	0	.	15.8619	0.79032	0.1368:0.8632:0.0:0.0	.	3038	O75962	TRIO_HUMAN	C	3038;2862;537	ENSP00000339299:R3038C;ENSP00000446348:R2862C;ENSP00000339291:R537C	ENSP00000339291:R537C	R	+	1	0	TRIO	14561349	1.000000	0.71417	0.631000	0.29282	0.996000	0.88848	3.163000	0.50763	1.366000	0.46076	0.650000	0.86243	CGT	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2		7.349508	0	-19	62	0	0	1	0	NM_007118	5	12.361605	33	0.131579
AES	166	hgsc.bcm.edu	hg19	19	3061247	3061247	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										GGGGTAGGTGCGAGGAGCCCT	0.667	0	125.0	123.0	123.0	19	3061247	2203	4300	6503	SO:0001819	synonymous_variant	AK094591	CCDS12101.1, CCDS12102.1	19p13.3	2008-02-05						307	protein-coding gene	gene with protein product		600188			8365415	Standard	NM_001130	Approved	GRG5, TLE5	uc002lwx.1	Q08117		ENST00000327141.4:c.36G>A	19.37:g.3061247C>T		B2RBL0|Q12808|Q14CJ1|Q96TG9|Q9UDY9	ENST00000327141.4	37	CCDS12102.1																																																																																			AES-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452154.1				20	133					NM_198969	12		69	
TRIM63	84676	broad.mit.edu	hg19	1	26386770	26386770	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:26386770C>T	ENST00000374272.3	-	4	722	c.584G>A	c.(583-585)cGt>cAt	p.R195H		NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	195	Interaction with TTN.		cytoplasm|microtubule|nucleus	ligase activity|signal transducer activity|titin binding|zinc ion binding	kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	GGTCACTCGACGGGAATCCTC	0.572	0	113.0	106.0	108.0	1	26386770	2203	4300	6503	SO:0001583	missense	AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022	"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28	11243782, 11283016	Standard	NM_032588	Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.584G>A	1.37:g.26386770C>T	ENSP00000363390:p.Arg195His	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	ENST00000374272.3	37	CCDS273.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228760	0.79576	.	.	ENSG00000158022	ENST00000374272	T	0.42900	0.96	5.21	5.21	0.72293	.	0.128263	0.85682	D	0.000000	T	0.29620	0.0739	N	0.08118	0	0.35647	D	0.811443	P	0.50156	0.932	B	0.42522	0.39	T	0.48375	-0.9041	10	0.72032	D	0.01	.	18.7199	0.91689	0.0:1.0:0.0:0.0	.	195	Q969Q1	TRI63_HUMAN	H	195	ENSP00000363390:R195H	ENSP00000363390:R195H	R	-	2	0	TRIM63	26259357	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.717000	0.84732	2.574000	0.86865	0.462000	0.41574	CGT	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1		67.942848	0	15	79	0	0	1	0	NM_032588	22	68.152172	29	0.431373
FRMPD1	22844	broad.mit.edu	hg19	9	37746714	37746714	+	Missense_Mutation	SNP	C	C	T	rs138292555	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:37746714C>T	ENST00000539465.1	+	16	5278	c.4685C>T	c.(4684-4686)aCg>aTg	p.T1562M	FRMPD1_ENST00000377765.3_Missense_Mutation_p.T1562M|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1562			cytoskeleton|cytosol|plasma membrane		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)	ACGGCCCTCACGGCCGCCGTG	0.592	0	93.0	98.0	97.0	9	37746714	2203	4298	6501	SO:0001583	missense	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601		29159	protein-coding gene	gene with protein product					10231032	Standard	NM_014907	Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4685C>T	9.37:g.37746714C>T	ENSP00000444411:p.Thr1562Met	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719469	0.89205	0.0	8.14E-4	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.12039	2.72;2.72	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.35941	0.0949	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01894	-1.1252	10	0.87932	D	0	-5.1585	17.3577	0.87341	0.0:1.0:0.0:0.0	.	1562	Q5SYB0	FRPD1_HUMAN	M	1562	ENSP00000366995:T1562M;ENSP00000444411:T1562M	ENSP00000366995:T1562M	T	+	2	0	FRMPD1	37736714	0.995000	0.38212	0.965000	0.40720	0.905000	0.53344	3.297000	0.51810	2.704000	0.92352	0.655000	0.94253	ACG	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1		-5.859878	0	-1	142	0	0	1	0	NM_014907	7	15.118404	100	0.065421
TMEM132A	54972	broad.mit.edu	hg19	11	60702219	60702219	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:60702219G>A	ENST00000005286.4	+	9	1975	c.1822G>A	c.(1822-1824)Ggt>Agt	p.G608S	TMEM132A_ENST00000453848.2_Missense_Mutation_p.G607S	NM_017870.3|NM_178031.2	NP_060340.2|NP_821174.1	Q24JP5	T132A_HUMAN	transmembrane protein 132A	607			endoplasmic reticulum membrane|Golgi membrane|integral to membrane		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32					CCGGGAGCCCGGTGTCACCTC	0.657	0	19.0	22.0	21.0	11	60702219	2182	4264	6446	SO:0001583	missense	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118		31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1	12514190, 10997877	Standard	NM_017870	Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000005286.4:c.1822G>A	11.37:g.60702219G>A	ENSP00000005286:p.Gly608Ser	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	ENST00000005286.4	37	CCDS7997.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.683263	0.68157	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.35973	1.28;1.28	4.01	4.01	0.46588	.	0.450845	0.21249	N	0.077675	T	0.61173	0.2326	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66885	-0.5810	10	0.87932	D	0	.	17.0352	0.86473	0.0:0.0:1.0:0.0	.	607;608	Q24JP5;Q24JP5-2	T132A_HUMAN;.	S	358;607;608	ENSP00000405823:G607S;ENSP00000005286:G608S	ENSP00000005286:G608S	G	+	1	0	TMEM132A	60458795	1.000000	0.71417	0.833000	0.33012	0.118000	0.20060	7.474000	0.81024	2.535000	0.85469	0.305000	0.20034	GGT	TMEM132A-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396353.1		6.012762	0	-10	20	0	0	1	0	NM_017870	3	8.132980	16	0.157895
NOP10	55505	broad.mit.edu	hg19	15	34634230	34634230	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:34634230C>T	ENST00000328848.4	-	2	237	c.134G>A	c.(133-135)cGa>cAa	p.R45Q	NOP10_ENST00000557912.1_Missense_Mutation_p.E26K	NM_018648.3	NP_061118.1	Q9NPE3	NOP10_HUMAN	NOP10 ribonucleoprotein	45		pseudouridine synthesis|rRNA processing	Cajal body|nucleolus|small nucleolar ribonucleoprotein complex	protein binding	lung(1)|ovary(1)	2					GATGGTGATTCGGTGTCGAGA	0.527	0	175.0	133.0	147.0	15	34634230	2201	4298	6499	SO:0001583	missense	AB043103	CCDS10037.1	15q14-q15	2014-09-17	2012-12-10	2008-10-13	ENSG00000182117	ENSG00000182117		14378	protein-coding gene	gene with protein product	"""homolog of yeast Nop10p"""	606471	"""nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)"", ""NOP10 ribonucleoprotein homolog (yeast)"""	NOLA3	11074001, 9843512	Standard	NM_018648	Approved	NOP10P, MGC70651	uc001zie.1	Q9NPE3	OTTHUMG00000129440	ENST00000557912.1:c.76G>A	15.37:g.34634230C>T	ENSP00000453475:p.Glu26Lys		ENST00000557912.1	37		.	.	.	.	.	.	.	.	.	.	C	18.38	3.611071	0.66558	.	.	ENSG00000182117	ENST00000328848	D	0.97378	-4.36	5.66	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	.	.	.	0.23210	N	0.998114	D	0.55385	0.971	P	0.48795	0.59	D	0.92409	0.5936	9	0.87932	D	0	.	15.4066	0.74884	0.0:0.86:0.14:0.0	.	45	Q9NPE3	NOP10_HUMAN	Q	45	ENSP00000332198:R45Q	ENSP00000332198:R45Q	R	-	2	0	NOP10	32421522	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	6.606000	0.74159	1.351000	0.45789	0.655000	0.94253	CGA	NOP10-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000418023.1		38.799488	0	-6	42	0	0	1	0	NM_018648	12	38.808141	13	0.480000
XPO7	23039	broad.mit.edu	hg19	8	21839354	21839354	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:21839354G>A	ENST00000434536.1	+	10	1199	c.1097G>A	c.(1096-1098)cGa>cAa	p.R366Q	XPO7_ENST00000252512.9_Missense_Mutation_p.R357Q|XPO7_ENST00000433566.4_Missense_Mutation_p.R358Q			Q9UIA9	XPO7_HUMAN	exportin 7	357		mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity	autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)	GAGGTCATCCGATTGATAGCC	0.423	0	168.0	157.0	160.0	8	21839354	1871	4096	5967	SO:0001583	missense	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227	"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16	11024021, 9872452	Standard	NM_015024	Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1070G>A	8.37:g.21839354G>A	ENSP00000252512:p.Arg357Gln	O94846|Q6PJK9|Q8NEK7	ENST00000252512.9	37	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258638	0.39896	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.39787	1.06;1.06;1.06	5.69	5.69	0.88448	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.19327	0.0464	N	0.02357	-0.585	0.80722	D	1	B;B;B	0.19935	0.04;0.02;0.02	B;B;B	0.09377	0.004;0.003;0.003	T	0.23297	-1.0192	10	0.02654	T	1	-6.8499	19.3926	0.94590	0.0:0.0:1.0:0.0	.	358;366;357	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	Q	366;357;358	ENSP00000404853:R366Q;ENSP00000252512:R357Q;ENSP00000410249:R358Q	ENSP00000252512:R357Q	R	+	2	0	XPO7	21895300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.671000	0.90904	0.655000	0.94253	CGA	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1		155.285897	0	3	139	0	0	1	0	NM_015024	48	155.288263	49	0.494845
MYO7A	4647	broad.mit.edu	hg19	11	76912671	76912671	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:76912671G>A	ENST00000409709.3	+	36	5303	c.5031G>A	c.(5029-5031)ccG>ccA	p.P1677P	MYO7A_ENST00000409619.2_Silent_p.P1628P|MYO7A_ENST00000458637.2_Silent_p.P1639P	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1677		actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity	NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64					CCATGCCACCGCGGGAGATTG	0.587	0	52.0	56.0	54.0	11	76912671	2098	4209	6307	SO:0001819	synonymous_variant	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474	"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11	8884266	Standard	NM_000260	Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000458637.2:c.4917G>A	11.37:g.76912671G>A		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	ENST00000458637.2	37	CCDS53684.1																																																																																			MYO7A-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328134.2		1.198693	0	-15	35	0	0	1	0	NM_000260	3	7.026409	31	0.088235
BUB1	699	broad.mit.edu	hg19	2	111413371	111413371	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:111413371C>T	ENST00000535254.1	-	15	1828	c.1761G>A	c.(1759-1761)gcG>gcA	p.A587A	BUB1_ENST00000409311.1_Silent_p.A607A|BUB1_ENST00000302759.6_Silent_p.A607A	NM_001278616.1	NP_001265545.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	607		apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)	ATGGTGTAGACGCAAGTTGTG	0.458	0	235.0	214.0	222.0	2	111413371	2203	4300	6503	SO:0001819	synonymous_variant	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679		1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L		Standard	NM_004336	Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.1821G>A	2.37:g.111413371C>T		E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	ENST00000302759.6	37	CCDS33273.1																																																																																			BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1		4.763951	0	27	145	0	0	1	0	NM_004336	10	23.066506	99	0.091743
CAMTA1	23261	broad.mit.edu	hg19	1	7731000	7731000	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:7731000G>A	ENST00000303635.7	+	10	2889	c.2682G>A	c.(2680-2682)ccG>ccA	p.P894P	CAMTA1_ENST00000439411.2_Silent_p.P894P	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	894	IPT/TIG.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	TCACAGGCCCGTGGCAAGAAG	0.597	0	136.0	118.0	124.0	1	7731000	2203	4300	6503	SO:0001819	synonymous_variant	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735		18806	protein-coding gene	gene with protein product		611501			11925432	Standard	NM_001195563	Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2682G>A	1.37:g.7731000G>A		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	ENST00000303635.7	37	CCDS30576.1																																																																																			CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3		121.351265	0	-37	94	0	0	1	0	NM_015215	38	121.399501	34	0.527778
SKOR1	390598	broad.mit.edu	hg19	15	68118635	68118635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:68118635C>T	ENST00000380035.2	+	2	527	c.469C>T	c.(469-471)Cga>Tga	p.R157*	SKOR1_ENST00000341418.5_Nonsense_Mutation_p.R343*|SKOR1_ENST00000554240.1_Nonsense_Mutation_p.R118*|SKOR1_ENST00000389002.1_Nonsense_Mutation_p.R148*|SKOR1_ENST00000554054.1_Nonsense_Mutation_p.R129*			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	157		negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity	endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23					GATCACTAAGCGAGAGGCCGA	0.657	0	64.0	61.0	62.0	15	68118635	2200	4298	6498	SO:0001587	stop_gained		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779	"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1	15528197	Standard	NM_001258024	Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000341418.5:c.1027C>T	15.37:g.68118635C>T	ENSP00000343200:p.Arg343*	A6NIP4|A6NJY0|Q2VWA5	ENST00000341418.5	37	CCDS58374.1	.	.	.	.	.	.	.	.	.	.	C	36	5.885578	0.97068	.	.	ENSG00000188779	ENST00000341418;ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	.	.	.	4.94	4.94	0.65067	.	0.067585	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4141	16.753	0.85492	0.0:1.0:0.0:0.0	.	.	.	.	X	343;118;129;157;148	.	ENSP00000343200:R343X	R	+	1	2	SKOR1	65905689	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	3.856000	0.55964	2.292000	0.77174	0.561000	0.74099	CGA	SKOR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410829.1		-2.311038	0	3	64	0	0	1	0	NM_001031807	3	6.447592	42	0.066667
ELMOD2	255520	broad.mit.edu	hg19	4	141461345	141461345	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:141461345G>A	ENST00000323570.3	+	6	555	c.423G>A	c.(421-423)acG>acA	p.T141T		NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	141	ELMO.	phagocytosis|regulation of defense response to virus|response to virus	cytoskeleton	GTPase activator activity	endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)				TAATGCCCACGAAGAAGTTAA	0.368	0	92.0	89.0	90.0	4	141461345	2203	4300	6503	SO:0001819	synonymous_variant	BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387		28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""		16773575	Standard	NM_153702	Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.423G>A	4.37:g.141461345G>A		B2R712|D3DNZ0	ENST00000323570.3	37	CCDS3752.1																																																																																			ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257277.2		2.972564	0	3	54	0	0	1	0	NM_153702	4	9.364230	36	0.100000
OR1F1	4992	broad.mit.edu	hg19	16	3254391	3254391	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:3254391G>A	ENST00000304646.2	+	1	145	c.145G>A	c.(145-147)Gta>Ata	p.V49I	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	49		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11					CATCCTGTCCGTAAGCATAGA	0.557	0	189.0	158.0	169.0	16	3254391	2197	4300	6497	SO:0001583	missense	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124	"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P	9288094, 9500546	Standard	NM_012360	Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.145G>A	16.37:g.3254391G>A	ENSP00000305424:p.Val49Ile	O15246|Q6IFL5	ENST00000304646.2	37	CCDS10496.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.901211	0.00517	0.0	1.16E-4	ENSG00000168124	ENST00000304646	T	0.01422	4.91	4.97	2.58	0.30949	GPCR, rhodopsin-like superfamily (1);	0.225949	0.30911	N	0.008635	T	0.00468	0.0015	N	0.00471	-1.455	0.24237	N	0.995376	B	0.06786	0.001	B	0.06405	0.002	T	0.47560	-0.9108	10	0.02654	T	1	.	7.3561	0.26719	0.7883:0.0:0.2117:0.0	.	49	O43749	OR1F1_HUMAN	I	49	ENSP00000305424:V49I	ENSP00000305424:V49I	V	+	1	0	OR1F1	3194392	0.003000	0.15002	0.639000	0.29394	0.007000	0.05969	0.205000	0.17356	0.252000	0.21531	0.393000	0.25936	GTA	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206985.1		-5.374947	0	1	76	0	0	1	0		3	6.356911	53	0.053571
RADIL	55698	broad.mit.edu	hg19	7	4917629	4917629	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:4917629C>T	ENST00000399583.3	-	2	329	c.142G>A	c.(142-144)Gcc>Acc	p.A48T	RADIL_ENST00000536091.1_Missense_Mutation_p.A48T	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	48		cell adhesion|multicellular organismal development|signal transduction		protein binding	NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	TCATCGCTGGCGCCCAGGCTG	0.627	0	18.0	23.0	21.0	7	4917629	2018	4178	6196	SO:0001583	missense	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927		22226	protein-coding gene	gene with protein product		611491			16051602, 17704304	Standard	NM_018059	Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.142G>A	7.37:g.4917629C>T	ENSP00000382492:p.Ala48Thr	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273693	0.23221	4.96E-4	0.0	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	T;T	0.23552	3.31;1.9	5.73	-0.827	0.10802	.	0.354452	0.29321	N	0.012497	T	0.16171	0.0389	L	0.51422	1.61	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.12993	-1.0526	10	0.36615	T	0.2	-11.0028	1.6686	0.02807	0.2315:0.45:0.1151:0.2033	.	48	Q96JH8	RADIL_HUMAN	T	48;22;48;48	ENSP00000382492:A48T;ENSP00000442533:A48T	ENSP00000320946:A22T	A	-	1	0	RADIL	4884155	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.214000	0.09292	-0.180000	0.10637	-0.291000	0.09656	GCC	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2		15.474621	0	4	13	0	0	1	0	NM_018059	5	15.474621	5	0.500000
KRT72	140807	broad.mit.edu	hg19	12	52984649	52984649	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:52984649G>A	ENST00000293745.2	-	6	1145	c.1060C>T	c.(1060-1062)Cgc>Tgc	p.R354C	KRT72_ENST00000398066.3_Missense_Mutation_p.R166C|KRT72_ENST00000354310.4_Intron|KRT72_ENST00000537672.2_Missense_Mutation_p.R354C	NM_080747.2	NP_542785.1	Q14CN4	K2C72_HUMAN	keratin 72	354	Coil 2.|Rod.		keratin filament	structural molecule activity	endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)	ATCTCTGAGCGGATCCTCTGG	0.488	0	98.0	93.0	95.0	12	52984649	2203	4300	6503	SO:0001583	missense	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486	"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246			12648212, 11703281, 16831889	Standard	NM_080747	Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1060C>T	12.37:g.52984649G>A	ENSP00000441160:p.Arg354Cys	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	ENST00000537672.2	37	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670594	0.47781	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000398066	T;T;T	0.78003	-1.14;-1.14;-1.14	5.14	4.24	0.50183	Filament (1);	0.435804	0.19457	N	0.113790	D	0.83013	0.5162	H	0.95402	3.665	0.37568	D	0.919335	B	0.33345	0.409	B	0.33196	0.159	D	0.86466	0.1782	10	0.72032	D	0.01	.	10.0993	0.42495	0.0:0.1314:0.6027:0.266	.	354	Q14CN4	K2C72_HUMAN	C	354;354;166	ENSP00000441160:R354C;ENSP00000293745:R354C;ENSP00000446151:R166C	ENSP00000293745:R354C	R	-	1	0	KRT72	51270916	0.012000	0.17670	1.000000	0.80357	0.870000	0.49936	1.773000	0.38563	1.480000	0.48289	-0.176000	0.13171	CGC	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1		4.810880	0	-12	69	0	0	1	0	NM_080747	6	14.142933	53	0.101695
DMBX1	127343	broad.mit.edu	hg19	1	46976849	46976849	+	Silent	SNP	G	G	A	rs147071342		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:46976849G>A	ENST00000371956.4	+	3	606	c.591G>A	c.(589-591)ccG>ccA	p.P197P	DMBX1_ENST00000360032.3_Silent_p.P192P	NM_147192.2	NP_671725.1	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1	197		brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)				AGGATCAGCCGGACCGTGAGG	0.677	0	21.0	26.0	24.0	1	46976849	2202	4295	6497	SO:0001819	synonymous_variant	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587	"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3		Standard	NM_147192	Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.576G>A	1.37:g.46976849G>A			ENST00000360032.3	37	CCDS536.1																																																																																			DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1		11.796896	0	-6	22	0	0	1	0		4	12.091656	8	0.333333
CBX2	84733	broad.mit.edu	hg19	17	77757864	77757864	+	Missense_Mutation	SNP	G	G	A	rs61738483		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:77757864G>A	ENST00000310942.4	+	5	726	c.622G>A	c.(622-624)Gtt>Att	p.V208I		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	208		cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		CAGCGCCCCCGTTGCAGGCCT	0.692	0	16.0	22.0	20.0	17	77757864	2174	4276	6450	SO:0001583	missense	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894		1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6	7782071, 2477932	Standard	NM_005189	Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.622G>A	17.37:g.77757864G>A	ENSP00000308750:p.Val208Ile	Q0VDA5|Q9BTB1	ENST00000310942.4	37	CCDS32757.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.353	0.831312	0.16820	.	.	ENSG00000173894	ENST00000310942	.	.	.	5.47	5.47	0.80525	.	1.394450	0.04612	N	0.400508	T	0.28830	0.0715	N	0.12182	0.205	0.80722	D	1	D	0.54772	0.968	B	0.31869	0.137	T	0.25984	-1.0116	9	0.22706	T	0.39	0.8498	13.2719	0.60165	0.0771:0.0:0.9229:0.0	.	208	Q14781	CBX2_HUMAN	I	208	.	ENSP00000308750:V208I	V	+	1	0	CBX2	75372459	0.999000	0.42202	0.978000	0.43139	0.268000	0.26511	3.532000	0.53553	2.577000	0.86979	0.655000	0.94253	GTT	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1		16.397945	0	2	35	0	0	1	0	NM_032647	7	17.828745	20	0.259259
RET	5979	broad.mit.edu	hg19	10	43597982	43597982	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:43597982G>A	ENST00000355710.3	+	3	762	c.530G>A	c.(529-531)cGg>cAg	p.R177Q	RET_ENST00000340058.5_Missense_Mutation_p.R177Q	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	177	Cadherin.	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			TTCCGCATTCGGGAGAACCGA	0.617	0	91.0	74.0	80.0	10	43597982	2203	4300	6503	SO:0001583	missense	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731	"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B	2687772, 1611909	Standard	NM_020975	Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.530G>A	10.37:g.43597982G>A	ENSP00000347942:p.Arg177Gln	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633549	0.67015	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.52295	0.67;0.67	5.09	2.09	0.27110	Cadherin (3);Cadherin-like (1);	0.255981	0.37669	N	0.001990	T	0.46889	0.1416	L	0.47716	1.5	0.21473	N	0.999677	D;D	0.63880	0.993;0.991	P;P	0.59288	0.855;0.774	T	0.24261	-1.0165	10	0.27082	T	0.32	.	3.1191	0.06385	0.2841:0.0:0.5116:0.2043	.	177;177	P07949;P07949-2	RET_HUMAN;.	Q	177	ENSP00000347942:R177Q;ENSP00000344798:R177Q	ENSP00000344798:R177Q	R	+	2	0	RET	42917988	0.971000	0.33674	0.200000	0.23457	0.955000	0.61496	2.823000	0.48081	1.076000	0.40961	0.655000	0.94253	CGG	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2		6.077642	0	4	41	0	0	1	0	NM_020975	4	10.473592	28	0.125000
SYT11	23208	broad.mit.edu	hg19	1	155838012	155838012	+	Silent	SNP	C	C	T	rs73002934	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:155838012C>T	ENST00000368324.4	+	2	544	c.291C>T	c.(289-291)gaC>gaT	p.D97D	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	97			cell junction|synaptic vesicle membrane	protein binding|transporter activity	breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)		TGTTGGTGGACGCAGCAGAGG	0.517	0	114.0	107.0	109.0	1	155838012	2203	4300	6503	SO:0001819	synonymous_variant	D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718	"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741			11543631	Standard	NM_152280	Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.291C>T	1.37:g.155838012C>T		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	ENST00000368324.4	37	CCDS1122.1																																																																																			SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1		83.619337	0	-14	75	0	0	1	0	NM_152280	27	83.749749	33	0.450000
SLC16A2	6567	broad.mit.edu	hg19	X	73751218	73751218	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:73751218G>A	ENST00000276033.5	+	6	1838	c.1672G>A	c.(1672-1674)Ggt>Agt	p.G558S	SLC16A2_ENST00000587091.1_Missense_Mutation_p.G484S			P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	484			integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity	breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					CTACTTTGCCGGTGTGCCCCC	0.502	0	117.0	94.0	101.0	X	73751218	2203	4300	6503	SO:0001583	missense		CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100	"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22	7981683, 12871948, 15889350	Standard	NM_006517	Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.1450G>A	X.37:g.73751218G>A	ENSP00000465734:p.Gly484Ser	Q7Z797	ENST00000587091.1	37	CCDS14426.2	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826924	0.90955	.	.	ENSG00000147100	ENST00000276033	T	0.54279	0.58	5.3	5.3	0.74995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.74512	0.3726	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.79017	-0.1975	10	0.87932	D	0	.	18.0979	0.89497	0.0:0.0:1.0:0.0	.	484	P36021	MOT8_HUMAN	S	558	ENSP00000276033:G558S	ENSP00000276033:G558S	G	+	1	0	SLC16A2	73667943	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	9.476000	0.97823	2.210000	0.71456	0.529000	0.55759	GGT	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057266.3		88.026401	0	-16	60	0	0	1	0		27	88.030522	26	0.509434
TCIRG1	10312	broad.mit.edu	hg19	11	67812527	67812527	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:67812527G>A	ENST00000265686.3	+	10	1231	c.1123G>A	c.(1123-1125)Gtg>Atg	p.V375M	TCIRG1_ENST00000532635.1_Missense_Mutation_p.V159M	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	375		ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity	breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16					CCAGGGCATCGTGGATGCCTA	0.682	0	90.0	78.0	82.0	11	67812527	2200	4294	6494	SO:0001583	missense	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719	"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""		8579597, 9806637	Standard	NM_006019	Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1123G>A	11.37:g.67812527G>A	ENSP00000265686:p.Val375Met	O75877|Q8WVC5	ENST00000265686.3	37	CCDS8177.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	28.5	4.922226	0.92319	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.88509	-2.39;-2.39	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	D	0.95149	0.8428	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96149	0.9106	10	0.87932	D	0	-36.4798	15.0171	0.71594	0.0:0.0:1.0:0.0	.	375	Q13488	VPP3_HUMAN	M	375;159	ENSP00000265686:V375M;ENSP00000434407:V159M	ENSP00000265686:V375M	V	+	1	0	TCIRG1	67569103	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	9.420000	0.97426	2.119000	0.64992	0.462000	0.41574	GTG	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1		16.272156	0	-3	64	0	0	1	0	NM_006019	8	20.888515	38	0.173913
MAP2	4133	broad.mit.edu	hg19	2	210559486	210559486	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:210559486C>T	ENST00000360351.4	+	7	3098	c.2592C>T	c.(2590-2592)ctC>ctT	p.L864L	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Silent_p.L860L|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MAP2_HUMAN	microtubule-associated protein 2	864		central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	ACAGTCAGCTCGAAGACCTGG	0.473	0	83.0	74.0	77.0	2	210559486	2203	4300	6503	SO:0001819	synonymous_variant		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018	"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130			3103857, 7479905	Standard	XM_005246554	Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2592C>T	2.37:g.210559486C>T		Q17S04|Q8IUX2|Q99975|Q99976	ENST00000360351.4	37	CCDS2384.1																																																																																			MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2		-1.141521	0	14	53	0	0	1	0	NM_001039538	4	8.131172	47	0.078431
SYPL2	284612	broad.mit.edu	hg19	1	110022032	110022032	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:110022032C>T	ENST00000369872.3	+	6	897	c.681C>T	c.(679-681)gcC>gcT	p.A227A	SYPL2_ENST00000401021.3_Silent_p.A163A	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	227	MARVEL.		integral to membrane|synaptic vesicle	transporter activity	breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)	TCCTGTGGGCCGGGAACTGTT	0.582	1	141.0	145.0	144.0	1	110022032	1911	4147	6058	SO:0001819	synonymous_variant	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028		27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""				12975309	Standard	NM_001040709	Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.681C>T	1.37:g.110022032C>T		A8K0E8|A8KAL7|I0IT67|Q6ZMX1	ENST00000369872.3	37	CCDS41365.1																																																																																			SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1		-11.474393	0	-9	117	0	0	1	0	NM_001006603	4	8.227092	85	0.044944
TLE3	7090	broad.mit.edu	hg19	15	70347577	70347577	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:70347577G>A	ENST00000558939.1	-	15	2775	c.1398C>T	c.(1396-1398)gaC>gaT	p.D466D	TLE3_ENST00000558201.1_Silent_p.D472D|TLE3_ENST00000559929.1_Silent_p.D476D|TLE3_ENST00000559048.1_Silent_p.D466D|TLE3_ENST00000539550.1_Silent_p.D393D|TLE3_ENST00000451782.2_Silent_p.D463D|TLE3_ENST00000559191.1_Silent_p.D47D|TLE3_ENST00000560589.1_Silent_p.D410D|TLE3_ENST00000557997.1_Silent_p.D458D|TLE3_ENST00000317509.8_Silent_p.D454D|TLE3_ENST00000560939.1_Silent_p.D468D|TLE3_ENST00000442299.2_Silent_p.D458D|TLE3_ENST00000440567.3_Silent_p.D456D|TLE3_ENST00000558379.1_Silent_p.D461D|TLE3_ENST00000557907.1_Silent_p.D458D	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)	466		organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding	breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31					CTGCCAGGGCGTCGTGGGGGA	0.647	1	54.0	62.0	59.0	15	70347577	2199	4298	6497	SO:0001819	synonymous_variant	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332	"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""		8365415	Standard	XM_005254623	Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1398C>T	15.37:g.70347577G>A		B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	ENST00000558939.1	37	CCDS45293.1																																																																																			TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1		68.097949	0	-7	78	0	0	1	0	NM_005078	23	68.139413	26	0.469388
UBE2J2	118424	broad.mit.edu	hg19	1	1190771	1190771	+	Missense_Mutation	SNP	C	C	T	rs146586696		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:1190771C>T	ENST00000347370.2	-	7	909	c.436G>A	c.(436-438)Gtc>Atc	p.V146I	UBE2J2_ENST00000339385.6_Missense_Mutation_p.V163I|UBE2J2_ENST00000400929.2_Missense_Mutation_p.V146I|UBE2J2_ENST00000349431.6_Missense_Mutation_p.V198I|UBE2J2_ENST00000348298.7_Missense_Mutation_p.V146I|UBE2J2_ENST00000360466.2_Missense_Mutation_p.V198I|UBE2J2_ENST00000400930.4_Missense_Mutation_p.V214I	NM_194458.1	NP_919440.1	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	198		response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity	cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)	CCGTTCTGGACGAGGTGCGTC	0.607	0	106.0	116.0	112.0	1	1190771	2203	4300	6503	SO:0001583	missense	AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087	"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""		11278356	Standard	NM_058167	Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000400930.4:c.640G>A	1.37:g.1190771C>T	ENSP00000383719:p.Val214Ile	A8MYC7|Q504T9|Q96N26|Q96T84	ENST00000400930.4	37	CCDS15.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560431	0.27827	2.27E-4	0.0	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930	T;T;T;T;T;T;T	0.71934	0.98;-0.02;0.98;0.98;0.98;-0.02;-0.61	5.96	5.05	0.67936	.	0.141042	0.64402	D	0.000005	T	0.45518	0.1346	N	0.08118	0	0.26837	N	0.968469	B;B;B;P	0.40282	0.059;0.009;0.036;0.711	B;B;B;B	0.26094	0.009;0.002;0.003;0.066	T	0.40136	-0.9579	10	0.35671	T	0.21	-4.811	14.2428	0.65969	0.0:0.9288:0.0:0.0712	.	146;214;198;231	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	I	146;198;163;146;146;198;214	ENSP00000344857:V146I;ENSP00000305826:V198I;ENSP00000340197:V163I;ENSP00000342541:V146I;ENSP00000383718:V146I;ENSP00000353653:V198I;ENSP00000383719:V214I	ENSP00000340197:V163I	V	-	1	0	UBE2J2	1180634	1.000000	0.71417	0.795000	0.32087	0.002000	0.02628	5.720000	0.68470	1.539000	0.49286	-0.136000	0.14681	GTC	UBE2J2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365644.1		22.352952	0	-30	89	0	0	1	0	NM_058167	12	30.161603	61	0.164384
MRVI1	10335	broad.mit.edu	hg19	11	10648057	10648057	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:10648057C>T	ENST00000547195.1	-	8	1051	c.551G>A	c.(550-552)cGt>cAt	p.R184H	MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000541483.1_Intron|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000421747.1_Missense_Mutation_p.R266H|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000423302.2_Missense_Mutation_p.R275H|MRVI1_ENST00000527509.2_Missense_Mutation_p.R184H|MRVI1_ENST00000552103.1_Missense_Mutation_p.R184H|MRVI1_ENST00000531107.1_Missense_Mutation_p.R267H|MRVI1_ENST00000436272.1_Missense_Mutation_p.R248H	NM_001100163.2|NM_001206881.1	NP_001093633.1|NP_001193810.1	Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	248		platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)	TGGAGGAGGACGAGGAGCCAG	0.522	0	67.0	73.0	71.0	11	10648057	1963	4154	6117	SO:0001583	missense	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952		7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673			10321731	Standard	NM_001098579	Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000423302.2:c.824G>A	11.37:g.10648057C>T	ENSP00000412130:p.Arg275His	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	ENST00000423302.2	37	CCDS55746.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786825	0.31593	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000423302;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T	0.19105	2.73;2.82;2.17;2.17;2.55;2.73;2.17	5.56	4.66	0.58398	.	0.126644	0.53938	N	0.000041	T	0.22513	0.0543	M	0.65498	2.005	0.80722	D	1	B;B;B	0.22003	0.009;0.037;0.063	B;B;B	0.17433	0.008;0.008;0.018	T	0.03706	-1.1011	10	0.21014	T	0.42	-5.4137	11.7525	0.51857	0.0:0.8584:0.0:0.1416	.	248;267;266	Q9Y6F6;E9PQY6;Q9Y6F6-4	MRVI1_HUMAN;.;.	H	266;249;248;184;184;275;267;184	ENSP00000414598:R266H;ENSP00000412229:R248H;ENSP00000448278:R184H;ENSP00000446764:R184H;ENSP00000412130:R275H;ENSP00000432436:R267H;ENSP00000432067:R184H	ENSP00000307885:R249H	R	-	2	0	MRVI1	10604633	0.976000	0.34144	0.851000	0.33527	0.281000	0.26958	2.018000	0.40991	1.375000	0.46248	-0.222000	0.12452	CGT	MRVI1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386137.2		25.501693	0	0	19	0	0	1	0	NM_001098579	8	25.563984	6	0.571429
CHST12	55501	broad.mit.edu	hg19	7	2472887	2472887	+	Missense_Mutation	SNP	G	G	A	rs138563894		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:2472887G>A	ENST00000258711.6	+	2	748	c.613G>A	c.(613-615)Gag>Aag	p.E205K		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	205		dermatan sulfate biosynthetic process	integral to Golgi membrane	3'-phosphoadenosine 5'-phosphosulfate binding|chondroitin 4-sulfotransferase activity|protein binding	NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)	CATCCCGCGCGAGCACGTGCA	0.647	0	46.0	38.0	40.0	7	2472887	2203	4296	6499	SO:0001583	missense	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129			10781601	Standard	NM_018641	Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.613G>A	7.37:g.2472887G>A	ENSP00000258711:p.Glu205Lys	A4D1Z9|Q502W3|Q9NXY7	ENST00000258711.6	37	CCDS5333.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.492927	0.44352	0.0	1.16E-4	ENSG00000136213	ENST00000258711;ENST00000432336	T;T	0.73152	1.87;-0.72	5.23	5.23	0.72850	.	0.260251	0.38436	N	0.001697	T	0.62208	0.2409	L	0.39245	1.2	0.53005	D	0.999964	D	0.55605	0.972	B	0.40410	0.328	T	0.61103	-0.7130	10	0.17832	T	0.49	3.0E-4	18.7861	0.91955	0.0:0.0:1.0:0.0	.	205	Q9NRB3	CHSTC_HUMAN	K	205	ENSP00000258711:E205K;ENSP00000411207:E205K	ENSP00000258711:E205K	E	+	1	0	CHST12	2439413	1.000000	0.71417	0.560000	0.28344	0.576000	0.36127	6.371000	0.73119	2.451000	0.82905	0.561000	0.74099	GAG	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3		41.677496	0	-4	29	0	0	1	0	NM_018641	13	41.762685	10	0.565217
CNTROB	116840	broad.mit.edu	hg19	17	7852791	7852791	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:7852791C>T	ENST00000380262.3	+	19	3666	c.2741C>T	c.(2740-2742)cCg>cTg	p.P914L	CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000565740.1_Missense_Mutation_p.P893L|CNTROB_ENST00000563694.1_Missense_Mutation_p.P892L	NM_001037144.5	NP_001032221.1	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	892		centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)			CACCCTGCCCCGAGTAGCATG	0.547	0	41.0	48.0	46.0	17	7852791	2202	4300	6502	SO:0001583	missense	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037		29616	protein-coding gene	gene with protein product	"""centrobin"""	611425			11984006, 16275750	Standard	NM_001037144	Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2675C>T	17.37:g.7852791C>T	ENSP00000456335:p.Pro892Leu	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627324	0.28978	.	.	ENSG00000170037	ENST00000380262	T	0.55760	0.5	5.91	4.94	0.65067	.	0.119584	0.38548	N	0.001659	T	0.41003	0.1140	L	0.29908	0.895	0.39839	D	0.97308	B;B;B	0.17667	0.006;0.023;0.023	B;B;B	0.12156	0.007;0.007;0.007	T	0.38373	-0.9664	10	0.87932	D	0	-7.9452	10.9623	0.47393	0.0:0.9143:0.0:0.0857	.	893;892;914	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	L	914	ENSP00000369614:P914L	ENSP00000369614:P914L	P	+	2	0	CNTROB	7793516	0.034000	0.19679	0.059000	0.19551	0.037000	0.13140	2.110000	0.41873	1.501000	0.48654	0.655000	0.94253	CCG	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1		-3.247132	0	-12	70	0	0	1	0	NM_053051	3	6.537677	46	0.061224
RNF43	54894	broad.mit.edu	hg19	17	56435311	56435311	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:56435311C>T	ENST00000584437.1	-	8	3781	c.1826G>A	c.(1825-1827)cGg>cAg	p.R609Q	RNF43_ENST00000577716.1_Missense_Mutation_p.R609Q|RNF43_ENST00000407977.2_Missense_Mutation_p.R609Q|RNF43_ENST00000500597.2_Missense_Mutation_p.R568Q|RNF43_ENST00000583753.1_Missense_Mutation_p.R568Q|RNF43_ENST00000581868.1_Missense_Mutation_p.R482Q|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577625.1_Missense_Mutation_p.R482Q			Q68DV7	RNF43_HUMAN	ring finger protein 43	609	Pro-rich.		endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding	NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)				GTTAGAGAGCCGCCCCGAAGG	0.637	0	53.0	64.0	60.0	17	56435311	2198	4296	6494	SO:0001583	missense		CCDS11607.1	17q23.2	2013-01-09					"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482				Standard	NM_017763	Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1826G>A	17.37:g.56435311C>T	ENSP00000463069:p.Arg609Gln	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.023999	0.00414	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.17528	2.27;2.27	5.08	0.0187	0.14117	.	1.727610	0.02729	N	0.114877	T	0.06690	0.0171	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.28776	-1.0033	10	0.13853	T	0.58	-13.9153	5.1916	0.15212	0.0:0.1852:0.1545:0.6603	.	568;609;609	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	Q	609;568	ENSP00000385328:R609Q;ENSP00000441969:R568Q	ENSP00000385328:R609Q	R	-	2	0	RNF43	53790310	0.412000	0.25392	0.005000	0.12908	0.136000	0.21042	0.976000	0.29462	0.001000	0.14605	-1.026000	0.02426	CGG	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1		57.617699	0	-44	79	0	0	1	0	NM_017763	19	57.921122	27	0.413043
CENPF	1063	broad.mit.edu	hg19	1	214816120	214816120	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:214816120G>A	ENST00000366955.3	+	12	4607	c.4439G>A	c.(4438-4440)tGt>tAt	p.C1480Y		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1576	2 X 96 AA approximate tandem repeats.	cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	TCATCCTCTTGTGTGCCTGAC	0.463	0	68.0	66.0	67.0	1	214816120	2203	4300	6503	SO:0001583	missense	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724		1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""		7904902, 7851898	Standard	NM_016343	Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4439G>A	1.37:g.214816120G>A	ENSP00000355922:p.Cys1480Tyr	Q13171|Q13246|Q5VVM7	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	4.592	0.109987	0.08780	.	.	ENSG00000117724	ENST00000366955	T	0.36340	1.26	4.53	3.53	0.40419	.	0.236921	0.22155	N	0.063863	T	0.27866	0.0686	L	0.27053	0.805	0.09310	N	1	D	0.56521	0.976	P	0.47528	0.549	T	0.06734	-1.0810	10	0.38643	T	0.18	.	7.9878	0.30222	0.0898:0.2759:0.6343:0.0	.	1480	P49454	CENPF_HUMAN	Y	1480	ENSP00000355922:C1480Y	ENSP00000355922:C1480Y	C	+	2	0	CENPF	212882743	0.466000	0.25823	0.006000	0.13384	0.110000	0.19582	2.389000	0.44407	2.223000	0.72356	0.655000	0.94253	TGT	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1		49.263712	0	18	64	0	0	1	0	NM_016343	17	49.263712	17	0.500000
C1orf116	79098	broad.mit.edu	hg19	1	207200928	207200928	+	Missense_Mutation	SNP	G	G	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:207200928G>T	ENST00000359470.5	-	2	265	c.16C>A	c.(16-18)Ctg>Atg	p.L6M	C1orf116_ENST00000461135.2_Intron	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	6			cytoplasm|plasma membrane	receptor activity	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)				GCTGGCCACAGCTCCCTCTCG	0.612	0	65.0	60.0	62.0	1	207200928	2203	4300	6503	SO:0001583	missense		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795		28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680			15525603, 9389513	Standard	NM_023938	Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.16C>A	1.37:g.207200928G>T	ENSP00000352447:p.Leu6Met	C9JV41|Q658X3	ENST00000359470.5	37	CCDS1475.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025097	0.75390	.	.	ENSG00000182795	ENST00000359470	T	0.11604	2.76	5.48	4.56	0.56223	.	0.272697	0.35151	N	0.003414	T	0.29684	0.0741	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.02167	-1.1202	10	0.87932	D	0	-5.7755	13.6392	0.62239	0.0755:0.0:0.9245:0.0	.	6	Q9BW04	SARG_HUMAN	M	6	ENSP00000352447:L6M	ENSP00000352447:L6M	L	-	1	2	C1orf116	205267551	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.797000	0.38804	1.272000	0.44329	0.655000	0.94253	CTG	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1		-2.111334	1	-5	46	0	1	1	1	NM_024115	3	6.378109	41	0.068182
CDH3	1001	broad.mit.edu	hg19	16	68732183	68732183	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:68732183G>A	ENST00000264012.4	+	16	2914	c.2370G>A	c.(2368-2370)gcG>gcA	p.A790A	CDH3_ENST00000581171.1_Silent_p.A735A|CDH3_ENST00000429102.2_3'UTR	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	790	Ser-rich.	adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)	CCGACGCCGCGTCCCTGAGCT	0.612	2	102.0	101.0	102.0	16	68732183	2198	4300	6498	SO:0001819	synonymous_variant	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038	"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""		1427864	Standard	NM_001793	Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.2370G>A	16.37:g.68732183G>A		B2R6F4|Q05DI6	ENST00000264012.4	37	CCDS10868.1																																																																																			CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2		-3.046212	0	-19	132	0	0	1	0	NM_001793	7	13.638389	84	0.076923
PSD4	23550	broad.mit.edu	hg19	2	113940791	113940791	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:113940791C>T	ENST00000441564.3	+	2	927	c.758C>T	c.(757-759)gCg>gTg	p.A253V	PSD4_ENST00000245796.6_Missense_Mutation_p.A253V			Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4			regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity	cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					CTCTTCCTGGCGAGTCCTTGC	0.602	0	95.0	94.0	95.0	2	113940791	2203	4300	6503	SO:0001583	missense	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637	"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442			12082148	Standard	XM_005263634	Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000441564.3:c.758C>T	2.37:g.113940791C>T	ENSP00000413997:p.Ala253Val	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	ENST00000441564.3	37		.	.	.	.	.	.	.	.	.	.	C	14.81	2.647658	0.47258	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.10288	2.91;2.89	5.83	3.32	0.38043	.	0.513843	0.20444	N	0.092229	T	0.04634	0.0126	N	0.08118	0	0.80722	D	1	B;B	0.12630	0.006;0.003	B;B	0.04013	0.001;0.0	T	0.40813	-0.9543	9	.	.	.	.	6.2159	0.20656	0.7554:0.1613:0.0832:0.0	.	253;253	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	V	253	ENSP00000245796:A253V;ENSP00000413997:A253V	.	A	+	2	0	PSD4	113657262	0.994000	0.37717	0.950000	0.38849	0.725000	0.41563	1.595000	0.36708	0.462000	0.27095	-1.139000	0.01908	GCG	PSD4-003	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000330791.3		56.247712	0	9	69	0	0	1	0	NM_012455	18	56.270585	20	0.473684
CHMP7	91782	broad.mit.edu	hg19	8	23106868	23106868	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:23106868G>A	ENST00000397677.1	+	3	1093	c.445G>A	c.(445-447)Gtc>Atc	p.V149I	CHMP7_ENST00000313219.7_Missense_Mutation_p.V149I	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	149		cellular membrane organization|late endosome to vacuole transport	cytosol|ESCRT III complex	protein transporter activity	breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)	AGCTGAGGAGGTCCTTGTCGC	0.557	0	66.0	58.0	61.0	8	23106868	2203	4300	6503	SO:0001583	missense	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457	"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""		16856878	Standard	NM_152272	Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.445G>A	8.37:g.23106868G>A	ENSP00000380794:p.Val149Ile	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	ENST00000397677.1	37	CCDS6040.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920655	0.33908	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	T;T	0.57107	0.42;0.42	5.33	5.33	0.75918	.	0.335174	0.32416	N	0.006140	T	0.35885	0.0947	N	0.22421	0.69	0.31742	N	0.635666	P	0.39216	0.664	B	0.35353	0.201	T	0.47799	-0.9089	10	0.35671	T	0.21	-13.4	11.1296	0.48339	0.0845:0.0:0.9155:0.0	.	149	Q8WUX9	CHMP7_HUMAN	I	149	ENSP00000380794:V149I;ENSP00000324491:V149I	ENSP00000324491:V149I	V	+	1	0	CHMP7	23162813	1.000000	0.71417	0.993000	0.49108	0.861000	0.49209	5.057000	0.64294	2.495000	0.84180	0.591000	0.81541	GTC	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254717.1		48.174410	0	27	47	0	0	1	0	NM_152272	16	48.599199	9	0.640000
MEST	4232	broad.mit.edu	hg19	7	130138026	130138026	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:130138026C>T	ENST00000223215.4	+	5	607	c.386C>T	c.(385-387)gCg>gTg	p.A129V	MEST_ENST00000462132.1_3'UTR|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000393187.1_Missense_Mutation_p.A120V|MEST_ENST00000437945.1_Missense_Mutation_p.A129V|MEST_ENST00000378576.4_Missense_Mutation_p.A120V|MEST_ENST00000416162.2_Missense_Mutation_p.A120V|MEST_ENST00000341441.5_Missense_Mutation_p.A120V	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	129		mesoderm development	endoplasmic reticulum membrane|integral to membrane	hydrolase activity|protein binding	breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)				ATCGTGGAAGCGCTTTTGCGG	0.502	0	83.0	82.0	82.0	7	130138026	2203	4300	6503	SO:0001583	missense		CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484		7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""		8884280	Standard	NM_002402	Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.386C>T	7.37:g.130138026C>T	ENSP00000223215:p.Ala129Val	B2R6S1|O14973|O15007|Q6AI49|Q92571	ENST00000223215.4	37	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870403	0.33069	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000433159;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945;ENST00000437637;ENST00000458161	T;T;T;T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.33	3.41	0.39046	.	0.421745	0.26407	N	0.024542	T	0.63402	0.2508	L	0.55017	1.72	0.39887	D	0.973712	B;B;B;B	0.25351	0.124;0.113;0.016;0.008	B;B;B;B	0.24269	0.052;0.019;0.008;0.004	T	0.65076	-0.6256	10	0.52906	T	0.07	-5.5175	9.7535	0.40490	0.0:0.7105:0.2066:0.0829	.	115;129;129;120	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	V	120;120;120;120;120;120;120;129;129;120;120	ENSP00000342749:A120V;ENSP00000409505:A120V;ENSP00000408933:A120V;ENSP00000367839:A120V;ENSP00000409768:A120V;ENSP00000376884:A120V;ENSP00000407222:A120V;ENSP00000223215:A129V;ENSP00000401657:A129V;ENSP00000393709:A120V	ENSP00000223215:A129V	A	+	2	0	MEST	129925262	0.959000	0.32827	0.295000	0.24960	0.286000	0.27126	2.122000	0.41987	1.390000	0.46547	0.561000	0.74099	GCG	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2		19.013391	0	18	94	0	0	1	0	NM_002402	10	25.113488	49	0.169492
LRRC30	339291	broad.mit.edu	hg19	18	7231425	7231425	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:7231425G>A	ENST00000383467.2	+	1	303	c.289G>A	c.(289-291)Gtg>Atg	p.V97M		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	97					central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31					GACCCGGATCGTGGTCCTGAA	0.582	0	46.0	50.0	49.0	18	7231425	1943	4136	6079	SO:0001583	missense		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422		30219	protein-coding gene	gene with protein product						Standard	NM_001105581	Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.289G>A	18.37:g.7231425G>A	ENSP00000372959:p.Val97Met		ENST00000383467.2	37	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316624	0.60524	.	.	ENSG00000206422	ENST00000383467	T	0.09817	2.94	5.65	4.78	0.61160	.	0.107337	0.64402	N	0.000006	T	0.10294	0.0252	L	0.39467	1.215	0.41749	D	0.989658	P	0.48162	0.906	B	0.38954	0.286	T	0.14755	-1.0461	10	0.33141	T	0.24	.	14.9243	0.70866	0.0688:0.0:0.9312:0.0	.	97	A6NM36	LRC30_HUMAN	M	97	ENSP00000372959:V97M	ENSP00000372959:V97M	V	+	1	0	LRRC30	7221425	1.000000	0.71417	0.923000	0.36655	0.997000	0.91878	7.263000	0.78421	1.530000	0.49136	0.650000	0.86243	GTG	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1		17.910025	0	-2	45	0	0	1	0	XM_292678	7	19.862383	23	0.233333
MYOF	26509	broad.mit.edu	hg19	10	95119637	95119637	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:95119637G>A	ENST00000371501.4	-	29	3195	c.3073C>T	c.(3073-3075)Cga>Tga	p.R1025*	MYOF_ENST00000358334.5_Nonsense_Mutation_p.R1012*|MYOF_ENST00000359263.4_Nonsense_Mutation_p.R1025*|MYOF_ENST00000371502.4_Nonsense_Mutation_p.R1025*			Q9NZM1	MYOF_HUMAN	myoferlin	1025		blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67					TTGCGTTTTCGGACCAGCCTT	0.512	0	203.0	192.0	196.0	10	95119637	1951	4138	6089	SO:0001587	stop_gained	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119		3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3	10607832, 10995573, 17702744	Standard	NM_013451	Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.3073C>T	10.37:g.95119637G>A	ENSP00000352208:p.Arg1025*	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	43	10.062300	0.99327	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	.	.	.	5.36	4.45	0.53987	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5338	15.6043	0.76649	0.0:0.0:0.8615:0.1385	.	.	.	.	X	1012;1025;1025;1025	.	ENSP00000351094:R1012X	R	-	1	2	MYOF	95109627	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.607000	0.36836	1.478000	0.48253	0.561000	0.74099	CGA	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2		44.008663	0	-24	116	0	0	1	0	NM_013451	18	50.730648	68	0.209302
SUGP2	10147	broad.mit.edu	hg19	19	19115139	19115139	+	Missense_Mutation	SNP	C	C	T	rs144507791		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:19115139C>T	ENST00000601879.1	-	7	3064	c.2767G>A	c.(2767-2769)Ggc>Agc	p.G923S	SUGP2_ENST00000600377.1_Missense_Mutation_p.G937S|SUGP2_ENST00000337018.6_Missense_Mutation_p.G923S|SUGP2_ENST00000456085.2_Missense_Mutation_p.G692S|SUGP2_ENST00000452918.2_Missense_Mutation_p.G923S			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	923		mRNA processing|RNA splicing	nucleus	RNA binding	NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43					CCGGGAAGGCCGTCGGCAGGG	0.677	0	33.0	33.0	33.0	19	19115139	2203	4300	6503	SO:0001583	missense	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607	"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14	12594045	Standard	NM_014884	Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2767G>A	19.37:g.19115139C>T	ENSP00000472286:p.Gly923Ser	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576429	0.28092	2.27E-4	0.0	ENSG00000064607	ENST00000337018;ENST00000452918;ENST00000456085	T;T;T	0.11063	3.0;3.0;2.81	5.12	2.9	0.33743	.	0.643972	0.14370	N	0.323824	T	0.04861	0.0131	N	0.17082	0.46	0.09310	N	1	B;B;B	0.28470	0.213;0.213;0.052	B;B;B	0.16289	0.015;0.015;0.005	T	0.42015	-0.9476	10	0.07644	T	0.81	-10.7151	6.6204	0.22800	0.1775:0.7294:0.0:0.093	.	692;923;923	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	S	923;923;692	ENSP00000337926:G923S;ENSP00000389380:G923S;ENSP00000409603:G692S	ENSP00000337926:G923S	G	-	1	0	SUGP2	18976139	0.900000	0.30661	0.689000	0.30133	0.018000	0.09664	0.484000	0.22308	0.483000	0.27608	0.462000	0.41574	GGC	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1		10.295619	0	-6	28	0	0	1	0	NM_001017392	4	10.723956	9	0.307692
EGF	1950	broad.mit.edu	hg19	4	110882146	110882146	+	Splice_Site	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:110882146G>A	ENST00000265171.5	+	7	1634		c.e7+1		EGF_ENST00000503392.1_Splice_Site|EGF_ENST00000509793.1_Splice_Site	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor			angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity	breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	CGATGTCATCGTAAGTTATAG	0.403	0	192.0	169.0	177.0	4	110882146	2203	4300	6503	SO:0001630	splice_region_variant	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798		3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""			Standard	NM_001963	Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000509793.1:c.1063+1G>A	4.37:g.110882146G>A		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	ENST00000509793.1	37	CCDS54795.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284818	0.40394	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9396	0.89023	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EGF	111101595	1.000000	0.71417	0.945000	0.38365	0.293000	0.27360	8.711000	0.91396	2.225000	0.72522	0.561000	0.74099	.	EGF-002	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000363798.2		5.637207	0	6	93	0	0	1	0		8	18.683629	73	0.098765
SPSB1	80176	broad.mit.edu	hg19	1	9416004	9416004	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:9416004G>A	ENST00000328089.6	+	2	395	c.54G>A	c.(52-54)acG>acA	p.T18T	SPSB1_ENST00000377399.2_Silent_p.T18T|SPSB1_ENST00000357898.3_Silent_p.T18T	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	18		intracellular signal transduction	cytoplasm		breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	GGGACCCCACGTACAGGCCCC	0.582	0	91.0	93.0	93.0	1	9416004	2203	4300	6503	SO:0001819	synonymous_variant		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621		30628	protein-coding gene	gene with protein product		611657			15713673, 12076535	Standard	NM_025106	Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.54G>A	1.37:g.9416004G>A		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	ENST00000328089.6	37	CCDS102.1																																																																																			SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2		-3.918084	0	-7	59	0	0	1	0	NM_025106	3	6.752620	49	0.057692
MIR518F	0	broad.mit.edu	hg19	19	54206018	54206018	+	RNA	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:54206018G>A	ENST00000385127.1	+	0	28					NR_030196.1																AGAGGGAAGCGCTTTCTGTTG	0.433	0	75.0	70.0	71.0	19	54206018	1568	3582	5150					19q13.42	2011-09-12		2008-12-18	ENSG00000207706	ENSG00000207706	"""ncRNAs / Micro RNAs"""	32104	non-coding RNA	RNA, micro				MIRN518F		Standard	NR_030194	Approved	hsa-mir-518f	uc021uzx.1				19.37:g.54206018G>A			ENST00000384973.1	37																																																																																				MIR518F-201	KNOWN	basic	miRNA	miRNA			0.861729	0	3	81	0	0	1	0	NR_030194	4	9.331493	44	0.083333
MEN1	0	broad.mit.edu	hg19	11	64575121	64575121	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:64575121C>T	ENST00000337652.1	-	4	1204	c.701G>A	c.(700-702)cGc>cAc	p.R234H	MEN1_ENST00000377326.3_Missense_Mutation_p.R229H|MEN1_ENST00000394374.2_Missense_Mutation_p.R234H|MEN1_ENST00000312049.6_Missense_Mutation_p.R229H|MEN1_ENST00000377316.2_Missense_Mutation_p.R229H|MEN1_ENST00000443283.1_Missense_Mutation_p.R234H|MEN1_ENST00000394376.1_Missense_Mutation_p.R234H|MEN1_ENST00000377321.1_Missense_Mutation_p.R194H|MEN1_ENST00000315422.4_Missense_Mutation_p.R229H|MEN1_ENST00000377313.1_Missense_Mutation_p.R234H	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	234	Interaction with FANCD2.	DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337					GCGGTCACAGCGCATGTATGA	0.562	0	125.0	109.0	114.0	11	64575121	2201	4297	6498	SO:0001583	missense	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895		7010	protein-coding gene	gene with protein product	"""menin"""	613733				Standard	NM_130799	Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000377316.2:c.686G>A	11.37:g.64575121C>T	ENSP00000366533:p.Arg229His	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	ENST00000377316.2	37		.	.	.	.	.	.	.	.	.	.	C	15.48	2.847087	0.51164	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626	D;D;D;D;D;D;D;D;D;D;D;D;D	0.99394	-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82;-5.82	4.8	4.8	0.61643	.	0.064279	0.64402	D	0.000019	D	0.97433	0.9160	N	0.14661	0.345	0.41211	D	0.986448	B;D;P	0.64830	0.388;0.994;0.633	B;P;B	0.48488	0.041;0.579;0.095	D	0.97644	1.0150	10	0.39692	T	0.17	-24.3381	15.7433	0.77920	0.0:1.0:0.0:0.0	.	229;194;234	O00255-2;O00255-3;O00255	.;.;MEN1_HUMAN	H	229;194;229;229;229;234;234;234;234;234;229;229;229	ENSP00000366533:R229H;ENSP00000366538:R194H;ENSP00000366543:R229H;ENSP00000308975:R229H;ENSP00000323747:R229H;ENSP00000337088:R234H;ENSP00000377901:R234H;ENSP00000377899:R234H;ENSP00000396940:R234H;ENSP00000366530:R234H;ENSP00000413944:R229H;ENSP00000394933:R229H;ENSP00000411218:R229H	ENSP00000308975:R229H	R	-	2	0	MEN1	64331697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.678000	0.61641	2.386000	0.81285	0.462000	0.41574	CGC	MEN1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000143886.6		39.335551	0	10	89	0	0	1	0		14	40.496006	29	0.325581
LTBP4	8425	broad.mit.edu	hg19	19	41129854	41129854	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:41129854C>T	ENST00000308370.7	+	30	3897	c.3897C>T	c.(3895-3897)tgC>tgT	p.C1299C	LTBP4_ENST00000396819.3_Silent_p.C1232C|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Silent_p.C667C|LTBP4_ENST00000204005.9_Silent_p.C1262C|LTBP4_ENST00000243562.9_3'UTR	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1300	EGF-like 14; calcium-binding (Potential).	growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)		ATGACGAGTGCGCCGATGAGG	0.582	0	34.0	41.0	39.0	19	41129854	2036	4183	6219	SO:0001819	synonymous_variant	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006	"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710			9660815, 9271198	Standard	NM_003573	Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3897C>T	19.37:g.41129854C>T		O00508|O75412|O75413	ENST00000308370.7	37																																																																																				LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			15.139766	0	1	47	0	0	1	0	NM_003573	6	16.164437	16	0.272727
CYP17A1	1586	broad.mit.edu	hg19	10	104592367	104592367	+	Missense_Mutation	SNP	C	C	T	rs61754278		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:104592367C>T	ENST00000369887.3	-	6	1211	c.1040G>A	c.(1039-1041)cGt>cAt	p.R347H		NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	347		androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity	endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	GAGACGGTTACGGTCACTGAT	0.572	0	154.0	127.0	136.0	10	104592367	2203	4300	6503	SO:0001583	missense	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17	1347802	Standard	NM_000102	Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.1040G>A	10.37:g.104592367C>T	ENSP00000358903:p.Arg347His	Q5TZV7	ENST00000369887.3	37	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466936	0.63625	.	.	ENSG00000148795	ENST00000369887	T	0.70164	-0.46	5.37	4.46	0.54185	.	0.107006	0.64402	D	0.000007	T	0.81631	0.4863	M	0.81802	2.56	0.58432	D	0.999995	D	0.89917	1.0	D	0.77004	0.989	D	0.84511	0.0622	10	0.87932	D	0	.	13.9121	0.63873	0.0:0.9253:0.0:0.0747	rs61754278	347	P05093	CP17A_HUMAN	H	347	ENSP00000358903:R347H	ENSP00000358903:R347H	R	-	2	0	CYP17A1	104582357	1.000000	0.71417	0.952000	0.39060	0.049000	0.14656	7.368000	0.79567	1.393000	0.46605	0.561000	0.74099	CGT	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1		49.991615	0	-17	91	0	0	1	0	NM_000102	19	53.789695	54	0.260274
MYL10	93408	broad.mit.edu	hg19	7	101259574	101259574	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:101259574C>T	ENST00000223167.4	-	6	636	c.459G>A	c.(457-459)acG>acA	p.T153T		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	153			mitochondrion	calcium ion binding	breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12					CCTCTGGGTCCGTGCCTATAA	0.592	0	101.0	80.0	87.0	7	101259574	2203	4300	6503	SO:0001819	synonymous_variant	BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436	"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product					1628631	Standard	NM_138403	Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.459G>A	7.37:g.101259574C>T			ENST00000223167.4	37	CCDS34713.1																																																																																			MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347575.1		9.891388	0	18	37	0	0	1	0	NM_138403	4	10.980863	13	0.235294
VWF	7450	broad.mit.edu	hg19	12	6128639	6128639	+	Silent	SNP	G	G	A	rs143009893		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:6128639G>A	ENST00000261405.5	-	28	4199	c.3945C>T	c.(3943-3945)cgC>cgT	p.R1315R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1315	VWFA 1; binding site for platelet glycoprotein Ib.	blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					CCACGGCCACGCGGACCCACT	0.632	0	58.0	58.0	58.0	12	6128639	2203	4300	6503	SO:0001819	synonymous_variant		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799	"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF	2251280	Standard	NM_000552	Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3945C>T	12.37:g.6128639G>A		Q8TCE8|Q99806	ENST00000261405.5	37	CCDS8539.1																																																																																			VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1		85.325797	0	-14	70	0	0	1	0	NM_000552	27	85.488720	21	0.562500
KMT2C	58508	broad.mit.edu	hg19	7	151879152	151879152	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:151879152C>T	ENST00000355193.2	-	36	6011	c.5793G>A	c.(5791-5793)tcG>tcA	p.S1931S	KMT2C_ENST00000262189.6_Silent_p.S1931S					lysine (K)-specific methyltransferase 2C												GCCTAGATACCGATGATAAAG	0.448	0	96.0	99.0	98.0	7	151879152	2203	4300	6503	SO:0001819	synonymous_variant	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3	10819331	Standard	XM_005250026	Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5793G>A	7.37:g.151879152C>T		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	ENST00000262189.6	37	CCDS5931.1																																																																																			KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		14.928640	0	-13	77	0	0	1	0		9	24.093327	60	0.130435
ADIPOR1	51094	broad.mit.edu	hg19	1	202920081	202920081	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:202920081G>A	ENST00000340990.5	-	2	416	c.118C>T	c.(118-120)Cgg>Tgg	p.R40W	ADIPOR1_ENST00000367254.3_Missense_Mutation_p.R40W|ADIPOR1_ENST00000436244.1_Missense_Mutation_p.R40W	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	40		fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane|plasma membrane	hormone binding|protein kinase binding|receptor activity	breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)		GCGATTACCCGTTTGCCCTTC	0.512	0	184.0	169.0	174.0	1	202920081	2203	4300	6503	SO:0001583	missense		CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346	"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945			12802337	Standard	XM_006711360	Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.118C>T	1.37:g.202920081G>A	ENSP00000341785:p.Arg40Trp	B3KMB0|Q53HS7|Q53YY6|Q9Y360	ENST00000340990.5	37	CCDS1430.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436512	0.62955	.	.	ENSG00000159346	ENST00000340990;ENST00000436244;ENST00000417068;ENST00000367254;ENST00000426229	D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16	5.96	5.96	0.96718	.	0.307883	0.35235	N	0.003343	D	0.90638	0.7064	N	0.22421	0.69	0.52501	D	0.999959	P	0.48589	0.912	B	0.26969	0.075	D	0.92131	0.5712	10	0.66056	D	0.02	.	17.1315	0.86727	0.0:0.0:1.0:0.0	.	40	Q96A54	ADR1_HUMAN	W	40	ENSP00000341785:R40W;ENSP00000395469:R40W;ENSP00000402178:R40W;ENSP00000356223:R40W;ENSP00000392946:R40W	ENSP00000341785:R40W	R	-	1	2	ADIPOR1	201186704	1.000000	0.71417	0.918000	0.36340	0.729000	0.41735	6.601000	0.74136	2.824000	0.97209	0.655000	0.94253	CGG	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2		79.743232	0	-22	94	0	0	1	0	NM_015999	26	80.309671	39	0.400000
HUWE1	10075	broad.mit.edu	hg19	X	53602625	53602625	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:53602625G>A	ENST00000342160.3	-	44	6465	c.6008C>T	c.(6007-6009)aCg>aTg	p.T2003M	HUWE1_ENST00000262854.6_Missense_Mutation_p.T2003M			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2003		base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153					ACCTGACTGCGTATCAAAGTC	0.458	0	111.0	87.0	95.0	X	53602625	2203	4300	6503	SO:0001583	missense	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758		30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""		9205841, 10998601	Standard	NM_031407	Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6008C>T	X.37:g.53602625G>A	ENSP00000340648:p.Thr2003Met	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449154	0.26074	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37411	1.2;1.2	5.43	4.55	0.56014	.	0.844996	0.10359	N	0.684181	T	0.22627	0.0546	N	0.08118	0	0.09310	N	1	D;D	0.56521	0.958;0.976	B;B	0.41571	0.197;0.36	T	0.06935	-1.0799	10	0.45353	T	0.12	.	12.7868	0.57510	0.0:0.3067:0.6933:0.0	.	2003;2003	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	M	2003	ENSP00000340648:T2003M;ENSP00000262854:T2003M	ENSP00000262854:T2003M	T	-	2	0	HUWE1	53619350	0.951000	0.32395	0.464000	0.27143	0.881000	0.50899	5.027000	0.64109	1.049000	0.40321	0.600000	0.82982	ACG	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1		5.943443	0	-2	57	0	0	1	0	XM_497119	5	12.422090	39	0.113636
CACNA1D	776	broad.mit.edu	hg19	3	53769529	53769529	+	Splice_Site	SNP	C	C	T	rs145327253		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:53769529C>T	ENST00000288139.4	+	21	2928	c.2810C>T	c.(2809-2811)aCg>aTg	p.T937M	CACNA1D_ENST00000422281.2_Splice_Site_p.T917M|CACNA1D_ENST00000350061.5_Splice_Site_p.T917M	NM_000720.2	NP_000711.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit			axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	TTCCGGAACACGGTAAGTCCC	0.622	0	54.0	49.0	51.0	3	53769529	2203	4300	6503	SO:0001630	splice_region_variant	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388	"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2	1664412	Standard	NM_000720	Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000422281.2:c.2751+1C>T	3.37:g.53769529C>T		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	ENST00000422281.2	37	CCDS46849.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.245047	0.22796	2.27E-4	0.0	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.22	4.33	0.51752	.	0.213333	0.39475	N	0.001349	D	0.93413	0.7899	N	0.24115	0.695	0.80722	D	1	P;P;P;D	0.54047	0.939;0.82;0.68;0.964	B;B;B;P	0.47075	0.335;0.172;0.172;0.536	D	0.91665	0.5345	10	0.46703	T	0.11	.	7.7477	0.28879	0.2688:0.6458:0.0:0.0853	.	917;610;917;937	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	M	917;937;917;610	ENSP00000288133:T917M;ENSP00000288139:T937M;ENSP00000409174:T917M;ENSP00000418014:T610M	ENSP00000288139:T937M	T	+	2	0	CACNA1D	53744569	0.979000	0.34478	0.968000	0.41197	0.332000	0.28634	2.257000	0.43240	2.604000	0.88044	0.555000	0.69702	ACG	CACNA1D-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000350556.1		27.158392	0	-12	38	0	0	1	0	NM_000720	8	28.451255	1	0.888889
ROBO1	6091	broad.mit.edu	hg19	3	78700895	78700895	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:78700895C>T	ENST00000436010.2	-	17	3679	c.2682G>A	c.(2680-2682)gcG>gcA	p.A894A	ROBO1_ENST00000464233.1_Silent_p.A933A|ROBO1_ENST00000495273.1_Silent_p.A897A|ROBO1_ENST00000467549.1_Silent_p.A897A			Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	933		activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	TTCTGATACCCGCGTAGGTAC	0.373	0	61.0	57.0	58.0	3	78700895	1880	4114	5994	SO:0001819	synonymous_variant	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""		9458045, 9608531	Standard	NM_002941	Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2799G>A	3.37:g.78700895C>T		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	ENST00000464233.1	37	CCDS54611.1																																																																																			ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1		35.294551	0	-5	17	0	0	1	0	NM_002941	9	35.292597	0	1.000000
EPPK1	83481	broad.mit.edu	hg19	8	144945210	144945210	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:144945210C>T	ENST00000525985.1	-	2	2283	c.2212G>A	c.(2212-2214)Gtg>Atg	p.V738M				P58107	EPIPL_HUMAN	epiplakin 1	738			cytoplasm|cytoskeleton	protein binding|structural molecule activity	NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		TCCACGGGCACGCGGTGGCTG	0.657	0	74.0	78.0	77.0	8	144945210	2038	4153	6191	SO:0001583	missense	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150		15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553			11278896, 15671067	Standard	NM_031308	Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2212G>A	8.37:g.144945210C>T	ENSP00000436337:p.Val738Met	Q76E58|Q9NSU9	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	18.36	3.606780	0.66558	.	.	ENSG00000227184	ENST00000525985	T	0.72725	-0.68	5.06	-0.187	0.13268	.	.	.	.	.	T	0.77512	0.4141	M	0.63208	1.945	0.19300	N	0.999978	D	0.69078	0.997	P	0.61003	0.882	T	0.68375	-0.5425	9	0.59425	D	0.04	.	11.4787	0.50312	0.0:0.4244:0.5017:0.0739	.	738	E9PPU0	.	M	738	ENSP00000436337:V738M	ENSP00000436337:V738M	V	-	1	0	EPPK1	145017198	0.000000	0.05858	0.707000	0.30419	0.869000	0.49853	-2.418000	0.01034	0.021000	0.15133	-0.165000	0.13383	GTG	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1		3.482423	0	-20	91	0	0	1	0	NM_031308	7	14.921057	64	0.098592
TCHH	7062	broad.mit.edu	hg19	1	152081633	152081633	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:152081633G>A	ENST00000368804.1	-	2	4059	c.4060C>T	c.(4060-4062)Cgc>Tgc	p.R1354C		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1354	23 X 26 AA approximate tandem repeats.	keratinization	cytoskeleton	calcium ion binding	NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)		TCTTGGCGGCGCAGCGGCTGT	0.572	0	138.0	144.0	142.0	1	152081633	1890	4107	5997	SO:0001583	missense	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450	"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH	1431214	Standard	NM_007113	Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4060C>T	1.37:g.152081633G>A	ENSP00000357794:p.Arg1354Cys	Q5VUI3	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	G	6.776	0.512198	0.12944	.	.	ENSG00000159450	ENST00000368804	T	0.07327	3.2	3.89	0.815	0.18763	.	.	.	.	.	T	0.01905	0.0060	L	0.46157	1.445	0.09310	N	1	P	0.34587	0.458	B	0.19391	0.025	T	0.42716	-0.9435	9	0.54805	T	0.06	-0.0532	5.1338	0.14924	0.2864:0.0:0.5642:0.1494	.	1354	Q07283	TRHY_HUMAN	C	1354	ENSP00000357794:R1354C	ENSP00000357794:R1354C	R	-	1	0	TCHH	150348257	0.005000	0.15991	0.001000	0.08648	0.067000	0.16453	0.756000	0.26419	-0.124000	0.11724	-1.135000	0.01939	CGC	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2		9.409212	0	-61	210	0	0	1	0	NM_007113	18	40.494369	171	0.095238
MRGPRX2	117194	broad.mit.edu	hg19	11	19077851	19077851	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:19077851C>T	ENST00000329773.2	-	2	186	c.99G>A	c.(97-99)ccG>ccA	p.P33P		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	33		sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding	NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15					TCAGGAAGACCGGGATCAGGG	0.562	0	148.0	158.0	154.0	11	19077851	2199	4293	6492	SO:0001819	synonymous_variant		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695	"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228			11551509	Standard	NM_054030	Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.99G>A	11.37:g.19077851C>T		B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	ENST00000329773.2	37	CCDS7847.1																																																																																			MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1		50.486404	0	-33	120	0	0	1	0	NM_054030	22	60.723103	93	0.191304
TXN2	25828	broad.mit.edu	hg19	22	36876736	36876736	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:36876736C>T	ENST00000216185.2	-	2	615	c.149G>A	c.(148-150)cGg>cAg	p.R50Q	TXN2_ENST00000487725.1_5'UTR|TXN2_ENST00000416967.1_5'UTR|TXN2_ENST00000403313.1_Missense_Mutation_p.R50Q			Q99757	THIOM_HUMAN	thioredoxin 2	50		cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	mitochondrion|nucleolus	electron carrier activity	breast(1)|lung(1)|prostate(1)	3					GTATATTGTCCGGGCTGGGTT	0.552	0	157.0	133.0	142.0	22	36876736	2203	4300	6503	SO:0001583	missense	U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348		17772	protein-coding gene	gene with protein product		609063			9006939, 17220299	Standard	NM_012473	Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.149G>A	22.37:g.36876736C>T	ENSP00000216185:p.Arg50Gln	Q5JZA0|Q6FH60|Q9UH29	ENST00000216185.2	37	CCDS13928.1	.	.	.	.	.	.	.	.	.	.	c	16.64	3.179378	0.57800	.	.	ENSG00000100348	ENST00000216185;ENST00000403313	T;T	0.13657	2.57;2.57	5.59	1.16	0.20824	Thioredoxin-like fold (1);	0.194220	0.42294	N	0.000734	T	0.13670	0.0331	M	0.66939	2.045	0.33751	D	0.620594	D	0.58620	0.983	B	0.43052	0.406	T	0.23976	-1.0173	10	0.46703	T	0.11	-13.0814	5.2403	0.15467	0.0:0.5432:0.1382:0.3186	.	50	Q99757	THIOM_HUMAN	Q	50	ENSP00000216185:R50Q;ENSP00000385393:R50Q	ENSP00000216185:R50Q	R	-	2	0	TXN2	35206682	0.912000	0.30974	0.969000	0.41365	0.090000	0.18270	2.182000	0.42556	0.343000	0.23821	-0.355000	0.07637	CGG	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1		77.665512	0	-37	73	0	0	1	0	NM_012473	25	78.029008	35	0.416667
COL5A1	1289	broad.mit.edu	hg19	9	137697060	137697060	+	Splice_Site	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:137697060G>A	ENST00000371817.3	+	41	3672	c.3258G>A	c.(3256-3258)gcG>gcA	p.A1086A		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1086	Triple-helical region.	axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	CAGGCCCTGCGGTGAGTCAAA	0.602	0	80.0	79.0	79.0	9	137697060	2203	4300	6503	SO:0001630	splice_region_variant	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635	"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215			1572660	Standard	NM_001278074	Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3258+1G>A	9.37:g.137697060G>A		Q15094|Q5SUX4	ENST00000371817.3	37	CCDS6982.1																																																																																			COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2		62.023428	0	-6	59	0	0	1	0	NM_000093	19	62.045121	21	0.475000
MAP3K19	80122	broad.mit.edu	hg19	2	135738851	135738851	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:135738851G>A	ENST00000375845.3	-	9	3490	c.3460C>T	c.(3460-3462)Cgt>Tgt	p.R1154C	MAP3K19_ENST00000392918.3_Missense_Mutation_p.R288C|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000392917.3_Missense_Mutation_p.R286C|MAP3K19_ENST00000375844.3_Missense_Mutation_p.R336C|MAP3K19_ENST00000315513.3_Missense_Mutation_p.R15C|MAP3K19_ENST00000358371.4_Missense_Mutation_p.R1041C	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3			mitogen-activated protein kinase kinase kinase 19												GGCCCAAAACGGTTTATAATA	0.418	0	120.0	118.0	119.0	2	135738851	2203	4300	6503	SO:0001583	missense	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4	12477932	Standard	NM_001282883	Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3460C>T	2.37:g.135738851G>A	ENSP00000365005:p.Arg1154Cys	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441430	0.63067	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000250	D	0.86272	0.5893	M	0.91354	3.2	0.46798	D	0.999206	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.981;0.996;0.99;0.99;0.999	D	0.88535	0.3105	10	0.72032	D	0.01	.	18.9458	0.92621	0.0:0.0:1.0:0.0	.	286;1041;288;336;1154	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	C	1154;1041;336;288;286;544;15	ENSP00000365005:R1154C;ENSP00000351140:R1041C;ENSP00000365004:R336C;ENSP00000376650:R288C;ENSP00000376649:R286C;ENSP00000392827:R544C;ENSP00000321160:R15C	ENSP00000321160:R15C	R	-	1	0	YSK4	135455321	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	4.931000	0.63469	2.714000	0.92807	0.563000	0.77884	CGT	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1		143.703909	0	-39	98	0	0	1	0	NM_025052	44	143.727027	41	0.517647
HSPG2	3339	broad.mit.edu	hg19	1	22176662	22176662	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:22176662G>A	ENST00000374695.3	-	57	7397	c.7318C>T	c.(7318-7320)Cgg>Tgg	p.R2440W	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2440	Ig-like C2-type 10.	angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	GACTCGATCCGGACCGTGGGG	0.637	0	45.0	50.0	48.0	1	22176662	2203	4300	6503	SO:0001583	missense	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798	"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1	1685141, 11941538	Standard	XM_005245863	Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.7318C>T	1.37:g.22176662G>A	ENSP00000363827:p.Arg2440Trp	Q16287|Q5SZI3|Q9H3V5	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844619	0.71488	.	.	ENSG00000142798	ENST00000374695	T	0.15487	2.42	5.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34725	N	0.003728	T	0.43942	0.1270	M	0.83603	2.65	0.47584	D	0.99946	D;D	0.89917	1.0;1.0	D;D	0.72982	0.978;0.979	T	0.47787	-0.9090	10	0.66056	D	0.02	.	14.2236	0.65843	0.0:0.0:0.8404:0.1596	.	380;2440	Q59EG0;P98160	.;PGBM_HUMAN	W	2440	ENSP00000363827:R2440W	ENSP00000363827:R2440W	R	-	1	2	HSPG2	22049249	0.919000	0.31177	1.000000	0.80357	0.875000	0.50365	1.513000	0.35823	2.478000	0.83669	0.561000	0.74099	CGG	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1		29.605460	0	-15	58	0	0	1	0	NM_005529	11	31.930212	32	0.255814
CDCP2	200008	broad.mit.edu	hg19	1	54610386	54610386	+	Silent	SNP	G	G	A	rs150004831		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:54610386G>A	ENST00000371330.1	-	2	1027	c.180C>T	c.(178-180)atC>atT	p.I60I	RP11-446E24.4_ENST00000311841.7_3'UTR|RP11-446E24.4_ENST00000525949.1_5'UTR	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	60	CUB 1.		extracellular region		kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24					CGGCCACCACGATCAGCCAGC	0.557	0	95.0	78.0	84.0	1	54610386	2203	4300	6503	SO:0001819	synonymous_variant		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211		27297	protein-coding gene	gene with protein product		612320			12477932	Standard	NM_201546	Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.180C>T	1.37:g.54610386G>A		Q6ZWJ3	ENST00000371330.1	37	CCDS588.2																																																																																			CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2		31.050285	0	-1	29	0	0	1	0	NM_201546	10	31.061722	9	0.526316
GIT1	28964	broad.mit.edu	hg19	17	27902157	27902157	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:27902157G>A	ENST00000225394.3	-	19	2261	c.2013C>T	c.(2011-2013)ttC>ttT	p.F671F	GIT1_ENST00000579937.1_Silent_p.F671F|GIT1_ENST00000394869.3_Silent_p.F680F|GIT1_ENST00000581348.1_Silent_p.F657F|RP11-68I3.2_ENST00000581474.1_RNA	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	671	Interaction with PXN and TGFB1I1 (By similarity).	regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|focal adhesion	ARF GTPase activator activity|protein binding|zinc ion binding	large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)	AGCAGGGCACGAAGCTGCGGG	0.607	0	69.0	70.0	70.0	17	27902157	2203	4300	6503	SO:0001819	synonymous_variant	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262	"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""		9826657, 10896954	Standard	NM_014030	Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000394869.3:c.2040C>T	17.37:g.27902157G>A		B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	ENST00000394869.3	37	CCDS42290.1																																																																																			GIT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256075.1		45.886716	0	4	78	0	0	1	0	NM_014030	16	46.826616	30	0.347826
THSD1	55901	broad.mit.edu	hg19	13	52952669	52952669	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:52952669G>A	ENST00000349258.4	-	4	1821	c.1277C>T	c.(1276-1278)tCg>tTg	p.S426L	THSD1_ENST00000258613.4_Missense_Mutation_p.S479L|THSD1_ENST00000544466.1_Missense_Mutation_p.S100L	NM_199263.2	NP_954872.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	479			extracellular region|integral to membrane|intracellular membrane-bounded organelle		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)	TCCCCCATCCGAGAAGCTCCC	0.652	0	45.0	51.0	49.0	13	52952669	2203	4300	6503	SO:0001583	missense	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114		17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""			Standard	NM_018676	Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1436C>T	13.37:g.52952669G>A	ENSP00000258613:p.Ser479Leu	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	ENST00000258613.4	37	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	g	16.22	3.061347	0.55432	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.47528	1.51;0.84;1.72	6.06	5.22	0.72569	.	0.069945	0.64402	D	0.000015	T	0.44767	0.1309	M	0.71581	2.175	0.47621	D	0.999472	P;P	0.37525	0.588;0.598	B;B	0.29524	0.103;0.076	T	0.51942	-0.8641	10	0.87932	D	0	-9.7381	12.488	0.55885	0.1382:0.0:0.8618:0.0	.	426;479	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	L	426;100;479	ENSP00000340650:S426L;ENSP00000438512:S100L;ENSP00000258613:S479L	ENSP00000258613:S479L	S	-	2	0	THSD1	51850670	1.000000	0.71417	0.909000	0.35828	0.012000	0.07955	5.899000	0.69846	1.577000	0.49804	0.650000	0.86243	TCG	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		38.869962	0	-6	45	0	0	1	0		13	39.045813	18	0.419355
ZDHHC5	25921	broad.mit.edu	hg19	11	57466582	57466582	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:57466582G>A	ENST00000287169.3	+	11	3036	c.1674G>A	c.(1672-1674)ccG>ccA	p.P558P	ZDHHC5_ENST00000527985.1_Silent_p.P505P	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	558			integral to membrane	acyltransferase activity|zinc ion binding	endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18					CCCCACTCCCGGGCCGTGAGG	0.592	0	63.0	69.0	67.0	11	57466582	2201	4296	6497	SO:0001819	synonymous_variant	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599	"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586			11214970	Standard	NM_015457	Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1674G>A	11.37:g.57466582G>A		Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	ENST00000287169.3	37	CCDS7965.1																																																																																			ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1		103.973015	0	17	117	0	0	1	0	NM_015457	33	104.001205	36	0.478261
KLHL26	55295	broad.mit.edu	hg19	19	18778890	18778890	+	Missense_Mutation	SNP	G	G	A	rs148044384		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:18778890G>A	ENST00000300976.4	+	3	773	c.683G>A	c.(682-684)cGc>cAc	p.R228H	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	228	BACK.				breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17					GACCTGTTCCGCGCGGCCGTC	0.687	0	31.0	31.0	31.0	19	18778890	2203	4297	6500	SO:0001583	missense		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487	"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""			Standard	XM_006722785	Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.683G>A	19.37:g.18778890G>A	ENSP00000300976:p.Arg228His	Q8TAP0|Q9NUX3	ENST00000300976.4	37	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	G	0.987	-0.695228	0.03303	2.27E-4	0.0	ENSG00000167487	ENST00000300976	T	0.68903	-0.36	5.04	0.0318	0.14172	BTB/Kelch-associated (2);	0.315983	0.35207	N	0.003378	T	0.31734	0.0806	N	0.02120	-0.675	0.32269	N	0.569086	B	0.06786	0.001	B	0.06405	0.002	T	0.26326	-1.0106	9	.	.	.	.	8.1212	0.30971	0.448:0.0:0.552:0.0	.	228	Q53HC5	KLH26_HUMAN	H	228	ENSP00000300976:R228H	.	R	+	2	0	KLHL26	18639890	0.018000	0.18449	0.188000	0.23233	0.110000	0.19582	0.301000	0.19174	0.077000	0.16863	0.591000	0.81541	CGC	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1		49.771245	0	-11	45	0	0	1	0	NM_018316	17	49.777510	18	0.485714
GGA1	26088	broad.mit.edu	hg19	22	38013030	38013030	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:38013030G>A	ENST00000381756.5	+	3	366	c.230G>A	c.(229-231)cGt>cAt	p.R77H	GGA1_ENST00000325180.8_Intron|GGA1_ENST00000337437.4_Intron|GGA1_ENST00000343632.4_Intron|GGA1_ENST00000406772.1_Intron|GGA1_ENST00000414350.3_Missense_Mutation_p.R77H|GGA1_ENST00000405147.3_Intron			Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	69	VHS.	intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding	breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)				GCCACCATCCGTCCCCCGCCA	0.627	0	47.0	47.0	47.0	22	38013030	2200	4294	6494	SO:0001583	missense	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083		17842	protein-coding gene	gene with protein product		606004			10747088, 10747089, 16407204	Standard	NM_013365	Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000381756.5:c.230G>A	22.37:g.38013030G>A	ENSP00000371175:p.Arg77His	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	ENST00000381756.5	37		.	.	.	.	.	.	.	.	.	.	A	11.15	1.553170	0.27739	0.001591	0.0	ENSG00000100083	ENST00000414350;ENST00000381756	T	0.18016	2.24	3.72	-3.1	0.05315	.	3.014390	0.01323	N	0.010992	T	0.09158	0.0226	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21518	-1.0243	8	.	.	.	20.4463	4.4418	0.11577	0.2843:0.0:0.4628:0.253	.	77	Q8NCS6	.	H	77	ENSP00000371175:R77H	.	R	+	2	0	GGA1	36342976	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.498000	0.06420	-0.516000	0.06470	-0.939000	0.02691	CGT	GGA1-002	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000104183.2		6.451906	0	-2	9	0	0	1	0	NM_013365	2	6.524597	1	0.666667
LRRC8A	56262	broad.mit.edu	hg19	9	131670351	131670351	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:131670351C>T	ENST00000259324.5	+	3	1431	c.908C>T	c.(907-909)aCg>aTg	p.T303M	LRRC8A_ENST00000372599.3_Missense_Mutation_p.T303M|LRRC8A_ENST00000372600.4_Missense_Mutation_p.T303M	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	303		pre-B cell differentiation	integral to membrane		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28					GAGAGCCTGACGGGCTACCGC	0.547	0	240.0	182.0	202.0	9	131670351	2203	4300	6503	SO:0001583	missense	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802		19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8		Standard	NM_001127244	Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.908C>T	9.37:g.131670351C>T	ENSP00000259324:p.Thr303Met	Q6UXM2|Q8NCI0|Q9P2B1	ENST00000259324.5	37	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956518	0.53293	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.52983	0.64;0.64;0.64	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.70272	0.3205	M	0.78456	2.415	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.73597	-0.3932	10	0.56958	D	0.05	.	17.4817	0.87674	0.0:1.0:0.0:0.0	.	303	Q8IWT6	LRC8A_HUMAN	M	303	ENSP00000361682:T303M;ENSP00000361680:T303M;ENSP00000259324:T303M	ENSP00000259324:T303M	T	+	2	0	LRRC8A	130710172	1.000000	0.71417	0.993000	0.49108	0.960000	0.62799	7.818000	0.86416	2.365000	0.80145	0.462000	0.41574	ACG	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2		115.041408	0	-1	85	0	0	1	0	NM_019594	38	115.206988	46	0.452381
SBF1	6305	broad.mit.edu	hg19	22	50899059	50899059	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:50899059G>A	ENST00000380817.3	-	24	3233	c.3050C>T	c.(3049-3051)cCg>cTg	p.P1017L	SBF1_ENST00000390679.3_Missense_Mutation_p.P1017L|SBF1_ENST00000348911.6_Missense_Mutation_p.P1018L	NM_002972.2	NP_002963.2	O95248	MTMR5_HUMAN	SET binding factor 1			protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity	breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	GATGTCCGGCGGGTACCGCAG	0.602	0	91.0	99.0	96.0	22	50899059	2053	4186	6239	SO:0001583	missense	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560			9537414, 9736772	Standard	NM_002972	Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000380817.3:c.3050C>T	22.37:g.50899059G>A	ENSP00000370196:p.Pro1017Leu	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	ENST00000380817.3	37	CCDS14091.2	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973524	0.53720	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	D;D;D	0.89415	-2.51;-2.51;-2.51	4.47	4.47	0.54385	.	0.061206	0.64402	D	0.000003	D	0.94248	0.8153	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.935;0.999	D	0.95181	0.8299	10	0.87932	D	0	.	16.711	0.85385	0.0:0.0:1.0:0.0	.	1017;1017	O95248;O95248-4	MTMR5_HUMAN;.	L	1017;1018;1027;1017	ENSP00000370196:P1017L;ENSP00000252027:P1018L;ENSP00000375097:P1017L	ENSP00000336522:P1027L	P	-	2	0	SBF1	49245925	1.000000	0.71417	0.899000	0.35326	0.199000	0.23934	6.301000	0.72782	2.027000	0.59764	0.467000	0.42956	CCG	SBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316819.2		48.525240	0	-7	144	0	0	1	0		18	52.608843	54	0.250000
CXCR2P1	0	broad.mit.edu	hg19	2	218925542	218925542	+	RNA	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:218925542C>T	ENST00000439871.1	-	0	838					NR_002712.1																TGTATTGTTGCCCATGTCCTC	0.517	0											M98335		2q35	2012-05-02	2010-04-14	2010-04-14	ENSG00000229754	ENSG00000229754		6028	pseudogene	pseudogene			"""interleukin 8 receptor, beta pseudogene"", ""chemokine (C-X-C motif) receptor 2 pseudogene"""	IL8RBP, CXCR2P	1427896, 1303245	Standard	NR_002712	Approved		uc002vgx.3		OTTHUMG00000155244		2.37:g.218925542C>T			ENST00000439871.1	37																																																																																				CXCR2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338985.1		18.210568	0	-2	47	0	0	1	0	NR_002712	7	19.979820	22	0.241379
MYCBPAP	84073	broad.mit.edu	hg19	17	48597028	48597028	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:48597028C>T	ENST00000323776.5	+	7	1087	c.925C>T	c.(925-927)Cga>Tga	p.R309*	MYCBPAP_ENST00000468821.1_3'UTR|MYCBPAP_ENST00000436259.2_Nonsense_Mutation_p.R272*	NM_032133.4	NP_115509.4	Q8TBZ2	MYBPP_HUMAN	MYCBP associated protein	272		cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding	breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)		GTTCTGGAGTCGACTGGAATA	0.532	0	90.0	81.0	84.0	17	48597028	2203	4300	6503	SO:0001587	stop_gained	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449		19677	protein-coding gene	gene with protein product		609835			12151104	Standard	NM_032133	Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.925C>T	17.37:g.48597028C>T	ENSP00000323184:p.Arg309*		ENST00000323776.5	37	CCDS32680.2	.	.	.	.	.	.	.	.	.	.	C	36	5.838983	0.97009	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	.	.	.	5.86	5.86	0.93980	.	0.756894	0.12151	N	0.494885	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	0.0517	9.8612	0.41116	0.0:0.7871:0.1406:0.0723	.	.	.	.	X	309;272	.	ENSP00000323184:R309X	R	+	1	2	MYCBPAP	45952027	0.082000	0.21442	0.886000	0.34754	0.931000	0.56810	2.335000	0.43929	2.775000	0.95449	0.563000	0.77884	CGA	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1		11.359220	0	7	65	0	0	1	0	NM_032133	5	13.867780	22	0.185185
SRSF4	6429	broad.mit.edu	hg19	1	29475634	29475634	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:29475634C>T	ENST00000373795.4	-	6	1007	c.773G>A	c.(772-774)cGc>cAc	p.R258H	SRSF4_ENST00000546138.1_Silent_p.P156P|SRSF4_ENST00000466448.1_5'UTR	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	258	Arg/Ser-rich (RS domain).	mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27					GCTATGGCTGCGGCTGCGGCT	0.597	0	133.0	148.0	143.0	1	29475634	2203	4300	6503	SO:0001583	missense	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350	"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4	8321209, 20516191	Standard	NM_005626	Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.773G>A	1.37:g.29475634C>T	ENSP00000362900:p.Arg258His	Q5VXP1|Q9BUA4|Q9UEB5	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679701	0.47886	.	.	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.16897	2.31	5.62	5.62	0.85841	.	0.230484	0.38548	N	0.001647	T	0.33469	0.0864	L	0.48642	1.525	0.80722	D	1	D	0.71674	0.998	P	0.59487	0.858	T	0.00787	-1.1566	10	0.52906	T	0.07	.	18.6474	0.91416	0.0:1.0:0.0:0.0	.	258	Q08170	SRSF4_HUMAN	H	258	ENSP00000362900:R258H	ENSP00000362900:R258H	R	-	2	0	SRSF4	29348221	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	2.380000	0.44327	2.653000	0.90120	0.655000	0.94253	CGC	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1		329.327359	0	-94	214	0	0	1	0	NM_005626	106	329.900290	131	0.447257
RBL1	5933	broad.mit.edu	hg19	20	35635830	35635830	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:35635830G>A	ENST00000373664.3	-	20	2921	c.2855C>T	c.(2854-2856)gCg>gTg	p.A952V	RBL1_ENST00000344359.3_Missense_Mutation_p.A952V	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1 (p107)	952		cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding	NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)			GTCCTGATTCGCCAAGTCGTA	0.323	0	136.0	131.0	133.0	20	35635830	2203	4300	6503	SO:0001583	missense	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839		9893	protein-coding gene	gene with protein product		116957			1833063	Standard	NM_183404	Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2855C>T	20.37:g.35635830G>A	ENSP00000362768:p.Ala952Val	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	ENST00000373664.3	37	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621766	0.66787	0.0	1.16E-4	ENSG00000080839	ENST00000373664;ENST00000344359	T;T	0.51071	0.72;0.72	5.29	5.29	0.74685	Cyclin-like (2);	0.303746	0.30302	N	0.009927	T	0.38825	0.1055	L	0.27053	0.805	0.22754	N	0.998774	B;B	0.25719	0.132;0.109	B;B	0.24269	0.049;0.052	T	0.20840	-1.0263	10	0.34782	T	0.22	-7.4906	19.1061	0.93296	0.0:0.0:1.0:0.0	.	952;952	P28749-2;P28749	.;RBL1_HUMAN	V	952	ENSP00000362768:A952V;ENSP00000343646:A952V	ENSP00000343646:A952V	A	-	2	0	RBL1	35069244	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.882000	0.87258	2.752000	0.94435	0.585000	0.79938	GCG	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2		17.709772	0	-9	54	0	0	1	0	NM_002895	7	19.662332	23	0.233333
TAS1R2	80834	broad.mit.edu	hg19	1	19181079	19181079	+	Silent	SNP	G	G	A	rs148401055		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:19181079G>A	ENST00000375371.3	-	3	906	c.885C>T	c.(883-885)ggC>ggT	p.G295G	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	295		detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	TCCACACGGCGCCAGTGAAGT	0.632	1	55.0	53.0	53.0	1	19181079	2203	4300	6503	SO:0001819	synonymous_variant		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002	"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71		Standard	NM_152232	Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.885C>T	1.37:g.19181079G>A		Q5TZ19	ENST00000375371.3	37	CCDS187.1																																																																																			TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		19.721867	0	-17	28	0	0	1	0		7	19.736468	8	0.466667
RXRG	6258	broad.mit.edu	hg19	1	165378811	165378811	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:165378811C>T	ENST00000359842.5	-	7	1332	c.1030G>A	c.(1030-1032)Ggc>Agc	p.G344S		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	344	Ligand-binding (By similarity).	regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				AAGATGGAGCCGACCCCAGCA	0.517	0	88.0	72.0	78.0	1	165378811	2203	4300	6503	SO:0001583	missense	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171	"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247			8034312	Standard	NR_033824	Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.1030G>A	1.37:g.165378811C>T	ENSP00000352900:p.Gly344Ser	A6NIP1|Q6IBU7	ENST00000359842.5	37	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	C	31	5.065622	0.93898	.	.	ENSG00000143171	ENST00000359842	D	0.96265	-3.96	5.08	5.08	0.68730	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97676	0.9238	M	0.77712	2.385	0.80722	D	1.000000	D	0.89917	1.0	D	0.97110	1.0	D	0.96886	0.9649	9	0.37606	T	0.19	.	17.222	0.86960	0.0:1.0:0.0:0.0	.	344	P48443	RXRG_HUMAN	S	344	ENSP00000352900:G344S	ENSP00000352900:G344S	G	-	1	0	RXRG	163645435	1.000000	0.71417	0.963000	0.40424	0.998000	0.95712	7.400000	0.79949	2.620000	0.88729	0.655000	0.94253	GGC	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2		19.150633	0	-18	11	0	0	1	0	NM_006917	6	19.170391	5	0.545455
RRNAD1	51093	broad.mit.edu	hg19	1	156703898	156703898	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:156703898C>T	ENST00000368216.4	+	6	1364	c.734C>T	c.(733-735)cCg>cTg	p.P245L	RRNAD1_ENST00000476229.1_Intron|RRNAD1_ENST00000368218.4_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	245			integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity	NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9					CTGGAGAACCCGTGTCAGGGC	0.622	0	71.0	71.0	71.0	1	156703898	2203	4300	6503	SO:0001583	missense	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303		24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66	10810093, 310876	Standard	NM_015997	Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.734C>T	1.37:g.156703898C>T	ENSP00000357199:p.Pro245Leu	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	ENST00000368216.4	37	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	C	4.524	0.097211	0.08681	.	.	ENSG00000143303	ENST00000368216;ENST00000519086	T	0.45276	0.9	4.76	4.76	0.60689	.	1.221540	0.05517	N	0.561443	T	0.09862	0.0242	N	0.02973	-0.45	0.27299	N	0.957646	B	0.02656	0.0	B	0.06405	0.002	T	0.16217	-1.0410	10	0.23891	T	0.37	-2.1015	13.1218	0.59331	0.0:1.0:0.0:0.0	.	245	Q96FB5	RRNAD_HUMAN	L	245;224	ENSP00000357199:P245L	ENSP00000357199:P245L	P	+	2	0	RRNAD1	154970522	0.000000	0.05858	0.005000	0.12908	0.241000	0.25554	0.750000	0.26334	2.494000	0.84150	0.561000	0.74099	CCG	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1		49.693684	0	-2	53	0	0	1	0	NM_015997	16	49.967837	23	0.410256
LRP8	7804	broad.mit.edu	hg19	1	53742398	53742398	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:53742398G>A	ENST00000306052.6	-	5	950	c.849C>T	c.(847-849)cgC>cgT	p.R283R	LRP8_ENST00000354412.3_Intron|LRP8_ENST00000371454.2_Silent_p.R283R|LRP8_ENST00000347547.2_Intron|LRP8_ENST00000465675.1_Intron	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	283	LDL-receptor class A 6.	cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity	endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21					CTTTGCAGTCGCGGTCGCCGT	0.731	0	8.0	5.0	6.0	1	53742398	1817	3584	5401	SO:0001819	synonymous_variant	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193	"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600			8626535, 9079678	Standard	NM_004631	Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.849C>T	1.37:g.53742398G>A		B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	ENST00000306052.6	37	CCDS578.1																																																																																			LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1		7.676970	0	4	9	0	0	1	0	NM_004631	2	7.453751	0	1.000000
SLC27A6	28965	broad.mit.edu	hg19	5	128363005	128363005	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:128363005C>T	ENST00000262462.4	+	7	2445	c.1435C>T	c.(1435-1437)Cgt>Tgt	p.R479C	SLC27A6_ENST00000395266.1_Missense_Mutation_p.R479C|SLC27A6_ENST00000506176.1_Missense_Mutation_p.R479C			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	479		long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	TTTTTGGGACCGTACTGGAGA	0.373	0	116.0	107.0	110.0	5	128363005	2203	4300	6503	SO:0001583	missense	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396	"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196			12556534, 10479480	Standard	XM_005271967	Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1435C>T	5.37:g.128363005C>T	ENSP00000262462:p.Arg479Cys	Q6IAM5|Q7Z6E6|Q86YF6	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097919	0.56075	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	D;D;D	0.83075	-1.68;-1.68;-1.68	4.31	3.44	0.39384	AMP-dependent synthetase/ligase (1);	0.101662	0.64402	D	0.000006	D	0.93314	0.7869	H	0.98466	4.24	0.58432	D	0.999996	D	0.76494	0.999	D	0.74023	0.982	D	0.92912	0.6348	9	.	.	.	1.3458	7.588	0.28004	0.3234:0.5433:0.1334:0.0	.	479	Q9Y2P4	S27A6_HUMAN	C	479	ENSP00000262462:R479C;ENSP00000378684:R479C;ENSP00000421024:R479C	.	R	+	1	0	SLC27A6	128390904	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.096000	0.50243	1.393000	0.46605	0.460000	0.39030	CGT	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1		5.344801	0	-23	69	0	0	1	0	NM_014031	5	11.576791	38	0.116279
ABCA3	21	broad.mit.edu	hg19	16	2373673	2373673	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:2373673C>T	ENST00000301732.5	-	7	1164	c.464G>A	c.(463-465)cGg>cAg	p.R155Q	ABCA3_ENST00000382381.3_Missense_Mutation_p.R155Q|ABCA3_ENST00000567910.1_Missense_Mutation_p.R155Q	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	155		response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			GTAACTGAACCGTAGGTGATA	0.498	1	212.0	237.0	228.0	16	2373673	2198	4300	6498	SO:0001583	missense	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972	"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3	8706931	Standard	NM_001089	Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000382381.3:c.464G>A	16.37:g.2373673C>T	ENSP00000371818:p.Arg155Gln	B2RU09|Q54A95|Q6P5P9|Q92473	ENST00000382381.3	37		.	.	.	.	.	.	.	.	.	.	C	36	5.693146	0.96793	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.97352	-4.35	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.95294	3.65	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.991;1.0;1.0	D;P;D;D	0.97110	1.0;0.782;0.997;1.0	D	0.99395	1.0926	10	0.87932	D	0	.	17.9832	0.89147	0.0:1.0:0.0:0.0	.	155;217;155;155	A7MBM9;Q4LE27;Q6P5P9;Q99758	.;.;.;ABCA3_HUMAN	Q	155;217	ENSP00000301732:R155Q	ENSP00000301732:R155Q	R	-	2	0	ABCA3	2313674	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	6.974000	0.76122	2.824000	0.97209	0.655000	0.94253	CGG	ABCA3-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000435440.1		92.829140	0	-44	284	0	0	1	0	NM_001089	45	117.546412	208	0.177866
KIR2DL4	0	broad.mit.edu	hg19	19	55316274	55316274	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:55316274G>A	ENST00000396284.2	+	3	97	c.97G>A	c.(97-99)Gcc>Acc	p.A33T	KIR2DL4_ENST00000357494.4_Missense_Mutation_p.A35T|KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000346587.4_Intron|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.A35T|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.A35T|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR3DL1_ENST00000402254.2_Intron					killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4						NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	17				GBM - Glioblastoma multiforme(193;0.0192)	CTTCTGCTCTGCCTGGCCCAG	0.567	0	34.0	33.0	33.0	19	55316274	2121	3783	5904	SO:0001583	missense	X97229	CCDS42619.1, CCDS42620.1	19q13.4	2013-01-29				ENSG00000189013	"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6332	protein-coding gene	gene with protein product		604945			8946682	Standard	NM_001080772	Approved	103AS, 15.212, CD158D		Q99706	OTTHUMG00000065880	ENST00000359085.4:c.103G>A	19.37:g.55316274G>A	ENSP00000351988:p.Ala35Thr	A8W795|O14621|O14622|O14623|O14624|O43534|P78400|P78401|Q8N738|Q99559|Q99560|Q99561|Q99562|Q9UQJ7	ENST00000359085.4	37	CCDS42620.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239658	0.39598	.	.	ENSG00000189013	ENST00000396284;ENST00000359085;ENST00000345540;ENST00000357494;ENST00000396289	T;T;T;T;T	0.00864	5.6;5.6;5.6;5.6;5.6	1.42	0.342	0.15996	Immunoglobulin-like fold (1);	0.551703	0.13505	U	0.382927	T	0.04048	0.0113	M	0.83603	2.65	0.09310	N	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.87578	0.989;0.993;0.992;0.998;0.996;0.993	T	0.32877	-0.9890	10	0.87932	D	0	.	3.5227	0.07748	0.2683:0.0:0.7317:0.0	.	35;33;35;35;35;35	Q99706;E7EST5;Q8N741;Q99706-4;Q99706-2;Q99706-3	KI2L4_HUMAN;.;.;.;.;.	T	33;35;35;35;33	ENSP00000379580:A33T;ENSP00000351988:A35T;ENSP00000339634:A35T;ENSP00000350088:A35T;ENSP00000379584:A33T	ENSP00000339634:A35T	A	+	1	0	KIR2DL4	60008086	0.000000	0.05858	0.001000	0.08648	0.103000	0.19146	0.244000	0.18124	0.156000	0.19299	0.205000	0.17691	GCC	KIR2DL4-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141136.1		12.330236	0	25	58	0	0	1	0		6	15.257325	26	0.187500
NCKAP5L	57701	broad.mit.edu	hg19	12	50188796	50188796	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:50188796C>T	ENST00000335999.6	-	8	3048	c.2847G>A	c.(2845-2847)ccG>ccA	p.P949P		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	945					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18					CCCTCCGGAGCGGGGAGCCCC	0.652	0	13.0	14.0	14.0	12	50188796	1915	4108	6023	SO:0001819	synonymous_variant	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566		29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602		Standard	NM_001037806	Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.2847G>A	12.37:g.50188796C>T		Q2TB26|Q71RH1|Q8N4W1|Q96HX2	ENST00000335999.6	37	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	C	2.115	-0.402750	0.04865	.	.	ENSG00000167566	ENST00000433948	.	.	.	5.23	-6.45	0.01914	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41875	-0.9484	4	.	.	.	-18.0814	3.866	0.09016	0.0958:0.4002:0.0947:0.4093	.	.	.	.	T	664	.	.	A	-	1	0	NCKAP5L	48475063	0.000000	0.05858	0.810000	0.32431	0.478000	0.33099	-2.900000	0.00704	-1.077000	0.03121	-0.448000	0.05591	GCT	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2		4.310418	0	-11	14	0	0	1	0	XM_035497	3	6.892390	18	0.142857
GIT1	28964	broad.mit.edu	hg19	17	27903361	27903361	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:27903361G>A	ENST00000225394.3	-	14	1736	c.1488C>T	c.(1486-1488)ggC>ggT	p.G496G	GIT1_ENST00000579937.1_Silent_p.G496G|GIT1_ENST00000394869.3_Silent_p.G505G|GIT1_ENST00000581348.1_Silent_p.G505G|RP11-68I3.2_ENST00000581474.1_RNA	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	496		regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|focal adhesion	ARF GTPase activator activity|protein binding|zinc ion binding	large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)	GTGTGCTCCCGCCTGGCGCCA	0.677	0	61.0	71.0	68.0	17	27903361	2203	4300	6503	SO:0001819	synonymous_variant	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262	"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""		9826657, 10896954	Standard	NM_014030	Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000394869.3:c.1515C>T	17.37:g.27903361G>A		B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	ENST00000394869.3	37	CCDS42290.1																																																																																			GIT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256075.1		7.319179	0	-10	100	0	0	1	0	NM_014030	6	14.398425	44	0.120000
ZSCAN10	84891	broad.mit.edu	hg19	16	3139813	3139813	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:3139813C>T	ENST00000252463.2	-	5	1544	c.1457G>A	c.(1456-1458)cGg>cAg	p.R486Q	ZSCAN10_ENST00000538082.2_Missense_Mutation_p.R404Q|ZSCAN10_ENST00000575108.1_Missense_Mutation_p.R147Q	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	486		negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24					GTGCACCCTCCGGTGGGCCAC	0.731	0	6.0	7.0	7.0	16	3139813	2101	4166	6267	SO:0001583	missense	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182	"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206	9653642	Standard	NM_032805	Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1457G>A	16.37:g.3139813C>T	ENSP00000252463:p.Arg486Gln	B3KQD3|H0YFS6|Q1WWM2	ENST00000252463.2	37	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	1.414	-0.574578	0.03882	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.07444	3.19	5.34	-0.863	0.10669	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.824186	0.10424	N	0.676268	T	0.02380	0.0073	N	0.04148	-0.265	0.58432	D	0.999999	B;B;B	0.26120	0.014;0.142;0.03	B;B;B	0.14578	0.009;0.011;0.004	T	0.48043	-0.9069	10	0.02654	T	1	-11.4591	3.7963	0.08740	0.1993:0.2839:0.0:0.5169	.	147;419;486	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	Q	419;486	ENSP00000252463:R486Q	ENSP00000252463:R486Q	R	-	2	0	ZSCAN10	3079814	0.000000	0.05858	0.914000	0.36105	0.946000	0.59487	-2.348000	0.01094	-0.024000	0.13941	-0.253000	0.11424	CGG	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2		9.325414	0	-8	9	0	0	1	0	NM_032805	3	9.369058	2	0.600000
DSCAML1	57453	broad.mit.edu	hg19	11	117651409	117651409	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:117651409C>T	ENST00000321322.6	-	2	344	c.343G>A	c.(343-345)Gcg>Acg	p.A115T	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	55	Ig-like C2-type 1.|Ig-like C2-type 2.	axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	CGAAGGGCCGCGCTGGGGGAG	0.657	0	43.0	49.0	47.0	11	117651409	2201	4295	6496	SO:0001583	missense		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782			11453658	Standard	NM_020693	Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.343G>A	11.37:g.117651409C>T	ENSP00000315465:p.Ala115Thr	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	36	5.604637	0.96626	.	.	ENSG00000177103	ENST00000321322	T	0.39787	1.06	5.1	5.1	0.69264	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46483	0.1395	L	0.27053	0.805	0.80722	D	1	D	0.64830	0.994	P	0.53954	0.738	T	0.48375	-0.9041	9	0.59425	D	0.04	.	18.9124	0.92491	0.0:1.0:0.0:0.0	.	55	Q8TD84	DSCL1_HUMAN	T	115	ENSP00000315465:A115T	ENSP00000315465:A115T	A	-	1	0	DSCAML1	117156619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.536000	0.85505	0.563000	0.77884	GCG	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2		81.453087	0	7	66	0	0	1	0	NM_020693	26	81.470653	24	0.520000
ZHX3	23051	broad.mit.edu	hg19	20	39831218	39831218	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:39831218C>T	ENST00000309060.3	-	4	2754	c.2339G>A	c.(2338-2340)cGg>cAg	p.R780Q	ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000540170.1_Missense_Mutation_p.R780Q|ZHX3_ENST00000544979.2_Missense_Mutation_p.R780Q|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000432768.2_Missense_Mutation_p.R780Q|ZHX3_ENST00000559234.1_Missense_Mutation_p.R780Q|ZHX3_ENST00000560361.1_Missense_Mutation_p.R780Q			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	780		negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)			AAAGAGCTGCCGCAGCAAGTG	0.587	0	77.0	82.0	80.0	20	39831218	2203	4300	6503	SO:0001583	missense	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306	"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1	9455477	Standard	XM_005260343	Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2339G>A	20.37:g.39831218C>T	ENSP00000312222:p.Arg780Gln	E1P5W5|F5H820|O43145|Q6NUJ7	ENST00000309060.3	37	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788874	0.70337	2.27E-4	0.0	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262	D;D;D	0.91686	-2.89;-2.89;-2.89	6.07	6.07	0.98685	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.051068	0.64402	D	0.000001	D	0.92479	0.7612	M	0.70275	2.135	0.47153	D	0.999331	P;D;D	0.60575	0.919;0.963;0.988	B;P;P	0.51999	0.407;0.489;0.687	D	0.91027	0.4861	10	0.42905	T	0.14	-26.6728	7.9852	0.30207	0.0:0.8162:0.0:0.1838	.	780;780;780	A8K8Q0;Q9H4I2;F5H820	.;ZHX3_HUMAN;.	Q	780;780;780;780;558	ENSP00000362360:R780Q;ENSP00000442290:R780Q;ENSP00000443783:R780Q	ENSP00000312222:R780Q	R	-	2	0	ZHX3	39264632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.085000	0.57657	2.884000	0.98904	0.655000	0.94253	CGG	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3		2.862408	0	-3	123	0	0	1	0	NM_015035	7	17.155861	75	0.085366
DCDC1	100506627	hgsc.bcm.edu	hg19	11	30938461	30938461	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										GCCCTTTTTCCGTTTTCTTTG	0.413	0	143.0	142.0	142.0	11	30938461	2202	4299	6501	SO:0001819	synonymous_variant	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959		20625	protein-coding gene	gene with protein product		608062			12820024	Standard	NM_181807	Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3408G>A	11.37:g.30938461C>T		A6PVL6|B7WNX6|Q6ZU04	ENST00000597505.1	37																																																																																				DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1				9	51					NM_181807	8		24	
SYTL3	94120	broad.mit.edu	hg19	6	159181683	159181683	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:159181683C>T	ENST00000297239.9	+	14	1514	c.1320C>T	c.(1318-1320)taC>taT	p.Y440Y	SYTL3_ENST00000360448.3_Silent_p.Y372Y|SYTL3_ENST00000367081.3_Silent_p.Y166Y			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	440		intracellular protein transport	endomembrane system|membrane	Rab GTPase binding	endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)	CGGAGAAATACGAAGACAGCG	0.547	0	114.0	106.0	109.0	6	159181683	2203	4300	6503	SO:0001819	synonymous_variant	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674		15587	protein-coding gene	gene with protein product					11773082	Standard	NM_001242384	Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1320C>T	6.37:g.159181683C>T		Q496J4|Q496J6|Q5U3B9	ENST00000297239.9	37	CCDS56458.1																																																																																			SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		50.690701	0	-17	100	0	0	1	0		19	54.832200	56	0.253333
STON1	11037	broad.mit.edu	hg19	2	48809431	48809431	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:48809431G>A	ENST00000309835.3	+	1	1669	c.1659G>A	c.(1657-1659)gcG>gcA	p.A553A	STON1-GTF2A1L_ENST00000309827.2_Silent_p.A553A|STON1-GTF2A1L_ENST00000402114.2_Silent_p.A553A|STON1_ENST00000404752.1_Silent_p.A553A|STON1-GTF2A1L_ENST00000394751.3_Silent_p.A553A|STON1-GTF2A1L_ENST00000405008.1_Silent_p.A553A|STON1-GTF2A1L_ENST00000394754.1_Silent_p.A553A|STON1_ENST00000406226.1_Silent_p.A553A					stonin 1						NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		CCTCATTGGCGCAGAGGTCAT	0.478	2	148.0	146.0	146.0	2	48809431	2203	4300	6503	SO:0001819	synonymous_variant	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244		17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357			14504226, 10364255	Standard	NM_001198595	Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1659G>A	2.37:g.48809431G>A		A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	ENST00000406226.1	37	CCDS1841.1																																																																																			STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2		91.037351	0	-23	90	0	0	1	0	NM_006873	30	91.121560	35	0.461538
FXR2	9513	broad.mit.edu	hg19	17	7499190	7499190	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:7499190G>A	ENST00000250113.7	-	8	1117	c.783C>T	c.(781-783)acC>acT	p.T261T		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	261	KH 1.		cytosolic large ribosomal subunit	protein binding|RNA binding	NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)	ACTCAATGGCGGTCACCCCAG	0.547	0	87.0	87.0	87.0	17	7499190	1980	4161	6141	SO:0001819	synonymous_variant	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245		4024	protein-coding gene	gene with protein product		605339		FMR1L2	7489725, 9259278	Standard	NM_004860	Approved		uc002gia.2	P51116		ENST00000250113.7:c.783C>T	17.37:g.7499190G>A		B2R9M2|D3DTQ1|Q86V09|Q8WUM2	ENST00000250113.7	37	CCDS45604.1																																																																																			FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		19.145113	0	-30	57	0	0	1	0		9	24.174684	42	0.176471
KIR2DL1	3802	broad.mit.edu	hg19	19	55284980	55284980	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:55284980G>A	ENST00000336077.6	+	3	306	c.266G>A	c.(265-267)cGc>cAc	p.R89H	KIR2DL3_ENST00000434419.2_Intron|KIR2DL4_ENST00000396284.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.R89H|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron	NM_014218.2	NP_055033.2	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1	89	Ig-like C2-type 1.	immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity	breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17				GBM - Glioblastoma multiforme(193;0.0192)	TCCATCAGTCGCATGACGCAA	0.537	1	254.0	223.0	233.0	19	55284980	2178	4210	6388	SO:0001583	missense	L41267	CCDS12904.1	19q13.4	2013-01-29			ENSG00000125498	ENSG00000125498	"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6329	protein-coding gene	gene with protein product		604936			7749980, 7716543	Standard	NM_014218	Approved	cl-42, nkat1, 47.11, p58.1, CD158A	uc002qhb.1	P43626	OTTHUMG00000065885	ENST00000336077.6:c.266G>A	19.37:g.55284980G>A	ENSP00000336769:p.Arg89His	O43470|Q32WE6|Q6IST4	ENST00000336077.6	37	CCDS12904.1	.	.	.	.	.	.	.	.	.	.	a	7.047	0.563636	0.13498	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.23147	1.92;1.92	1.24	0.114	0.14639	.	.	.	.	.	T	0.12263	0.0298	N	0.11756	0.17	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.25187	-1.0139	9	0.66056	D	0.02	.	3.5284	0.07768	0.2873:0.4304:0.2823:0.0	.	89;89	Q6IST4;Q6H2H3	.;.	H	89	ENSP00000336769:R89H;ENSP00000291633:R89H	ENSP00000291633:R89H	R	+	2	0	KIR2DL1	59976792	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.081000	0.14823	-0.274000	0.09232	-2.943000	0.00086	CGC	KIR2DL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141148.2		72.348324	0	83	239	0	0	1	0		31	85.111598	123	0.201299
KIF4B	285643	broad.mit.edu	hg19	5	154395374	154395374	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:154395374G>A	ENST00000435029.4	+	1	2115	c.1955G>A	c.(1954-1956)cGt>cAt	p.R652H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	652		axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		CAGTTAATGCGTCAAATGAAA	0.408	2	157.0	156.0	156.0	5	154395374	2203	4300	6503	SO:0001583	missense	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650	"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184				Standard	NM_001099293	Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1955G>A	5.37:g.154395374G>A	ENSP00000387875:p.Arg652His		ENST00000435029.4	37	CCDS47324.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	12.12	1.842099	0.32513	.	.	ENSG00000226650	ENST00000435029	T	0.18174	2.23	2.54	0.587	0.17439	.	.	.	.	.	T	0.12178	0.0296	L	0.47716	1.5	0.48236	D	0.999614	B	0.31256	0.316	B	0.24269	0.052	T	0.09164	-1.0687	9	0.59425	D	0.04	.	5.0708	0.14606	0.3293:0.0:0.6707:0.0	.	652	Q2VIQ3	KIF4B_HUMAN	H	652	ENSP00000387875:R652H	ENSP00000387875:R652H	R	+	2	0	KIF4B	154375567	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	4.427000	0.59888	-0.177000	0.10690	0.563000	0.77884	CGT	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		-2.954351	0	-25	117	0	0	1	0		7	15.595008	91	0.071429
LRRC8A	56262	broad.mit.edu	hg19	9	131670589	131670589	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:131670589C>T	ENST00000259324.5	+	3	1669	c.1146C>T	c.(1144-1146)taC>taT	p.Y382Y	LRRC8A_ENST00000372599.3_Silent_p.Y382Y|LRRC8A_ENST00000372600.4_Silent_p.Y382Y	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	382		pre-B cell differentiation	integral to membrane		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28					TTGACCAATACGACCCGCTCT	0.562	0	132.0	112.0	119.0	9	131670589	2203	4300	6503	SO:0001819	synonymous_variant	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802		19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8		Standard	NM_001127244	Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1146C>T	9.37:g.131670589C>T		Q6UXM2|Q8NCI0|Q9P2B1	ENST00000259324.5	37	CCDS35155.1																																																																																			LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2		56.982212	0	-21	72	0	0	1	0	NM_019594	20	58.457144	40	0.333333
MLST8	64223	broad.mit.edu	hg19	16	2258519	2258519	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:2258519C>T	ENST00000569417.1	+	8	1121	c.767C>T	c.(766-768)aCg>aTg	p.T256M	MLST8_ENST00000565250.1_Missense_Mutation_p.T256M|MLST8_ENST00000382450.4_Missense_Mutation_p.T255M|MLST8_ENST00000301725.7_3'UTR|MLST8_ENST00000564088.1_Missense_Mutation_p.T256M|MLST8_ENST00000397124.1_Missense_Mutation_p.T256M|MLST8_ENST00000301724.10_Missense_Mutation_p.T256M	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	256		insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding	large_intestine(3)|lung(2)|skin(1)	6					TCCCTGATGACGGAGCTGAGC	0.647	0	70.0	85.0	80.0	16	2258519	2129	4239	6368	SO:0001583	missense		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965	"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190			12477932	Standard	NM_022372	Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.767C>T	16.37:g.2258519C>T	ENSP00000456405:p.Thr256Met	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	ENST00000569417.1	37	CCDS10462.2	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576300	0.65878	.	.	ENSG00000167965	ENST00000382450;ENST00000301724;ENST00000397124	T;T	0.40225	1.57;1.04	4.83	4.83	0.62350	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30448	0.0765	L	0.31120	0.905	0.80722	D	1	P;P	0.43094	0.799;0.783	B;B	0.33890	0.172;0.115	T	0.20840	-1.0263	10	0.51188	T	0.08	-16.3781	16.4983	0.84251	0.0:1.0:0.0:0.0	.	190;256	Q9BVC4-3;Q9BVC4	.;LST8_HUMAN	M	256	ENSP00000301724:T256M;ENSP00000380313:T256M	ENSP00000301724:T256M	T	+	2	0	MLST8	2198520	1.000000	0.71417	0.967000	0.41034	0.899000	0.52679	7.766000	0.85320	2.235000	0.73313	0.313000	0.20887	ACG	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2		-5.292687	0	-13	151	0	0	1	0	NM_022372	5	11.211553	77	0.060976
MATK	4145	broad.mit.edu	hg19	19	3778526	3778526	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:3778526C>T	ENST00000310132.6	-	13	1663	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	MATK_ENST00000395045.2_Missense_Mutation_p.R423Q|MATK_ENST00000585778.1_Missense_Mutation_p.R421Q|MATK_ENST00000395040.2_Missense_Mutation_p.R381Q	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	422	Protein kinase.	cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	GTACGGAGCCCGTCCATATGA	0.647	0	55.0	59.0	58.0	19	3778526	2203	4299	6502	SO:0001583	missense	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14					"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038			8288563, 7530249	Standard	NM_139355	Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000395045.2:c.1268G>A	19.37:g.3778526C>T	ENSP00000378485:p.Arg423Gln	B3KNZ9|Q9NST8	ENST00000395045.2	37	CCDS12113.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221554	0.79464	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	D;D;D	0.82255	-1.59;-1.59;-1.59	3.74	3.74	0.42951	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.079304	0.51477	D	0.000084	T	0.81669	0.4871	N	0.05510	-0.035	0.48830	D	0.999713	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.992	D	0.86103	0.1557	10	0.87932	D	0	-28.0087	14.7571	0.69572	0.0:1.0:0.0:0.0	.	422;423;422	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	Q	423;422;381	ENSP00000378485:R423Q;ENSP00000308734:R422Q;ENSP00000378481:R381Q	ENSP00000308734:R422Q	R	-	2	0	MATK	3729526	1.000000	0.71417	0.906000	0.35671	0.542000	0.35054	4.592000	0.61027	1.944000	0.56390	0.543000	0.68304	CGG	MATK-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453641.2		17.145791	0	1	24	0	0	1	0	NM_139355	6	17.365341	10	0.375000
ELOVL2	54898	broad.mit.edu	hg19	6	10990061	10990061	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:10990061C>T	ENST00000354666.3	-	7	723	c.640G>A	c.(640-642)Gtg>Atg	p.V214M		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	214		fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)		ATGGTGAGCACGAACTGCACC	0.542	0	90.0	77.0	82.0	6	10990061	2203	4300	6503	SO:0001583	missense	AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977		14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""		12371743, 16564093	Standard	NM_017770	Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.640G>A	6.37:g.10990061C>T	ENSP00000346693:p.Val214Met	Q6P9E1|Q86W94	ENST00000354666.3	37	CCDS4518.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	16.46	3.130076	0.56721	.	.	ENSG00000197977	ENST00000354666	T	0.26660	1.72	5.81	-0.939	0.10408	.	0.741921	0.12335	N	0.478022	T	0.32224	0.0822	M	0.76727	2.345	0.22719	N	0.998812	P	0.46706	0.883	P	0.51016	0.656	T	0.57106	-0.7868	10	0.66056	D	0.02	-0.011	24.2674	0.99989	0.0:0.261:0.739:0.0	.	214	Q9NXB9	ELOV2_HUMAN	M	214	ENSP00000346693:V214M	ENSP00000346693:V214M	V	-	1	0	ELOVL2	11098047	0.000000	0.05858	0.418000	0.26571	0.910000	0.53928	-0.857000	0.04286	-0.168000	0.10853	0.655000	0.94253	GTG	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1		12.732002	0	2	53	0	0	1	0		6	15.449361	25	0.193548
ASMTL	8623	broad.mit.edu	hg19	X	1546804	1546804	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:1546804G>A	ENST00000534940.1	-	7	771	c.546C>T	c.(544-546)gaC>gaT	p.D182D	ASMTL_ENST00000381333.4_Silent_p.D224D|ASMTL_ENST00000381317.3_Silent_p.D240D|ASMTL_ENST00000416733.2_Silent_p.D164D|ASMTL_ENST00000463763.1_5'UTR	NM_001173473.1	NP_001166944.1	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	240	MAF-like.	melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity	NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			CCCCCTCCACGTCACTGAGGT	0.697	0	47.0	60.0	56.0	X	1546804	2016	4131	6147	SO:0001819	synonymous_variant	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093	"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011			9736779	Standard	NM_004192	Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.720C>T	X.37:g.1546804G>A		B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	ENST00000381317.3	37	CCDS43917.1																																																																																			ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1		-3.515046	0	-34	42	0	0	1	0	NM_004192	3	6.605552	47	0.060000
B4GALNT2	124872	broad.mit.edu	hg19	17	47233948	47233948	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:47233948G>A	ENST00000300404.2	+	5	720	c.661G>A	c.(661-663)Gat>Aat	p.D221N	B4GALNT2_ENST00000393354.2_Missense_Mutation_p.D161N|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.D135N	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	221		lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity	endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)		TGAAGGACCCGATGCCCCCGT	0.562	0	174.0	156.0	162.0	17	47233948	2203	4300	6503	SO:0001583	missense	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2	8782649, 12678917	Standard	NM_153446	Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000393354.2:c.481G>A	17.37:g.47233948G>A	ENSP00000377022:p.Asp161Asn	B4DZE4|Q14CP1|Q86Y40	ENST00000393354.2	37	CCDS54139.1	.	.	.	.	.	.	.	.	.	.	G	4.019	0.001034	0.07819	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.30182	1.54;1.54;1.54	3.68	0.539	0.17156	.	1.417150	0.04375	N	0.359868	T	0.24353	0.0590	L	0.43152	1.355	0.09310	N	1	B;B	0.21688	0.014;0.059	B;B	0.11329	0.003;0.006	T	0.18116	-1.0347	10	0.29301	T	0.29	-1.2571	3.9275	0.09270	0.2324:0.2195:0.5481:0.0	.	161;221	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	N	135;161;221	ENSP00000425510:D135N;ENSP00000377022:D161N;ENSP00000300404:D221N	ENSP00000300404:D221N	D	+	1	0	B4GALNT2	44588947	0.004000	0.15560	0.060000	0.19600	0.017000	0.09413	0.311000	0.19380	0.165000	0.19558	-0.251000	0.11542	GAT	B4GALNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364478.1		114.930334	0	-21	101	0	0	1	0	NM_153446	35	115.014056	30	0.538462
PLA2G6	8398	broad.mit.edu	hg19	22	38539156	38539156	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:38539156C>T	ENST00000332509.3	-	4	748	c.565G>A	c.(565-567)Gtc>Atc	p.V189I	PLA2G6_ENST00000335539.3_Missense_Mutation_p.V189I|PLA2G6_ENST00000436218.1_Intron|PLA2G6_ENST00000402064.1_Missense_Mutation_p.V189I	NM_003560.2	NP_003551.2	O60733	PA2G6_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	189		cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				TAATGGAAGACGGTCTCTCCC	0.597	0	338.0	287.0	304.0	22	38539156	2203	4300	6503	SO:0001583	missense	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604			9417066, 16799181, 19029121	Standard	NM_001199562	Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.565G>A	22.37:g.38539156C>T	ENSP00000333142:p.Val189Ile	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	ENST00000332509.3	37	CCDS13967.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.03|13.03	2.116404|2.116404	0.37339|0.37339	.|.	.|.	ENSG00000184381|ENSG00000184381	ENST00000427114|ENST00000332509;ENST00000335539;ENST00000402064;ENST00000335538;ENST00000396860;ENST00000430886	.|T;T;T;T	.|0.64438	.|-0.1;-0.1;-0.1;-0.1	6.03|6.03	6.03|6.03	0.97812|0.97812	.|Ankyrin repeat-containing domain (3);	.|0.301152	.|0.38959	.|N	.|0.001506	T|T	0.44307|0.44307	0.1287|0.1287	N|N	0.11560|0.11560	0.145|0.145	0.80722|0.80722	D|D	1|1	.|B;B	.|0.30526	.|0.283;0.03	.|B;B	.|0.21917	.|0.035;0.037	T|T	0.35475|0.35475	-0.9787|-0.9787	5|10	.|0.29301	.|T	.|0.29	-14.6809|-14.6809	18.7374|18.7374	0.91761|0.91761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|189;189	.|O60733-2;O60733	.|.;PA2G6_HUMAN	H|I	56|189;189;189;117;189;117	.|ENSP00000333142:V189I;ENSP00000335149:V189I;ENSP00000386100:V189I;ENSP00000395464:V117I	.|ENSP00000333142:V189I	R|V	-|-	2|1	0|0	PLA2G6|PLA2G6	36869102|36869102	1.000000|1.000000	0.71417|0.71417	0.929000|0.929000	0.37066|0.37066	0.772000|0.772000	0.43724|0.43724	4.365000|4.365000	0.59486|0.59486	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	CGT|GTC	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1		130.395707	0	-5	285	0	0	1	0	NM_001004426	50	140.356003	142	0.260417
TNS3	64759	broad.mit.edu	hg19	7	47408251	47408251	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:47408251C>T	ENST00000398879.1	-	17	2358	c.1992G>A	c.(1990-1992)gcG>gcA	p.A664A	TNS3_ENST00000311160.9_Silent_p.A664A|TNS3_ENST00000355730.3_Silent_p.A424A			Q68CZ2	TENS3_HUMAN	tensin 3	664			focal adhesion	protein binding	NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64					TGGGTTTGAACGCTTTGCTGG	0.647	0	112.0	129.0	123.0	7	47408251	2077	4207	6284	SO:0001819	synonymous_variant	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205	"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1	11559528	Standard	NM_022748	Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1992G>A	7.37:g.47408251C>T		B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	ENST00000398879.1	37	CCDS5506.2																																																																																			TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1		55.166091	0	-34	180	0	0	1	0	NM_022748	26	69.622395	121	0.176871
RBM22	55696	broad.mit.edu	hg19	5	150075212	150075212	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:150075212C>T	ENST00000199814.4	-	7	723	c.602G>A	c.(601-603)cGt>cAt	p.R201H	RBM22_ENST00000540000.1_Missense_Mutation_p.R152H|RBM22_ENST00000447771.2_Missense_Mutation_p.R152H	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	201		protein import into nucleus, translocation	catalytic step 2 spliceosome|cytoplasm	calcium-dependent protein binding|nucleotide binding|RNA binding|zinc ion binding	breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		TCCGTAATAACGGTCTTTAAT	0.433	1	95.0	90.0	91.0	5	150075212	2203	4300	6503	SO:0001583	missense	AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589	"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430			20013661, 19133299	Standard	NM_018047	Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.602G>A	5.37:g.150075212C>T	ENSP00000199814:p.Arg201His	A6NDM5|B4DLI9|O95607	ENST00000199814.4	37	CCDS34278.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460270	0.63401	.	.	ENSG00000086589	ENST00000199814;ENST00000540000;ENST00000447771	T;T;T	0.06528	3.29;3.29;3.29	5.61	4.75	0.60458	.	0.115109	0.64402	D	0.000010	T	0.31544	0.0800	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.32693	-0.9897	10	0.72032	D	0.01	-1.7723	14.5396	0.67984	0.0:0.9294:0.0:0.0706	.	201	Q9NW64	RBM22_HUMAN	H	201;152;152	ENSP00000199814:R201H;ENSP00000441594:R152H;ENSP00000412118:R152H	ENSP00000199814:R201H	R	-	2	0	RBM22	150055405	1.000000	0.71417	0.990000	0.47175	0.013000	0.08279	7.729000	0.84864	1.374000	0.46228	-0.140000	0.14226	CGT	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374431.2		116.396595	0	-26	143	0	0	1	0	NM_018047	39	117.824137	65	0.375000
NGFR	4804	broad.mit.edu	hg19	17	47590285	47590285	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:47590285G>A	ENST00000172229.3	+	6	1323	c.1198G>A	c.(1198-1200)Gcc>Acc	p.A400T	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.A306T	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	400	Death.	anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)				CACACTGGACGCCCTCCTGGC	0.682	1	20.0	21.0	21.0	17	47590285	2201	4297	6498	SO:0001583	missense	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300	"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""		3022937, 3006050	Standard	NM_002507	Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1198G>A	17.37:g.47590285G>A	ENSP00000172229:p.Ala400Thr	B2R961|B4E096	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630411	0.46944	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.85339	-1.97;-1.97	4.55	3.56	0.40772	Death (3);DEATH-like (2);	0.684942	0.13412	N	0.389821	T	0.75206	0.3818	L	0.44542	1.39	0.35899	D	0.830258	P	0.43662	0.814	B	0.32022	0.139	T	0.73748	-0.3885	10	0.21540	T	0.41	-17.3422	11.0572	0.47925	0.097:0.0:0.903:0.0	.	400	P08138	TNR16_HUMAN	T	400;306	ENSP00000172229:A400T;ENSP00000421731:A306T	ENSP00000172229:A400T	A	+	1	0	NGFR	44945284	0.997000	0.39634	0.974000	0.42286	0.979000	0.70002	2.515000	0.45512	0.991000	0.38814	0.561000	0.74099	GCC	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		19.324203	0	-5	19	0	0	1	0		7	19.338473	8	0.466667
AGAP1	116987	broad.mit.edu	hg19	2	236659132	236659132	+	Splice_Site	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:236659132G>A	ENST00000304032.8	+	6	1253	c.673G>A	c.(673-675)Gtt>Att	p.V225I	AGAP1_ENST00000409538.1_Splice_Site_p.V490I|AGAP1_ENST00000428334.2_Splice_Site_p.V64I|AGAP1_ENST00000336665.5_Splice_Site_p.V225I|AGAP1_ENST00000409457.1_Splice_Site_p.V225I	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1		Small GTPase-like.	protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding	breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41					CTTCCAGGACGGTAAATGCGC	0.542	0	187.0	158.0	168.0	2	236659132	2203	4300	6503	SO:0001630	splice_region_variant	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985	"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2		Standard	NM_001037131	Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000336665.5:c.673+1G>A	2.37:g.236659132G>A		B2RTX7|Q541S5|Q6P9D7|Q9NV93	ENST00000336665.5	37	CCDS2514.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507040	0.85282	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000001	T	0.39091	0.1065	L	0.51422	1.61	0.80722	D	1	D;D	0.60160	0.969;0.987	P;P	0.61658	0.595;0.892	T	0.02526	-1.1146	10	0.34782	T	0.22	.	19.0122	0.92877	0.0:0.0:1.0:0.0	.	225;225	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	I	225;225;225;490;64	ENSP00000387174:V225I;ENSP00000307634:V225I;ENSP00000338378:V225I;ENSP00000386897:V490I;ENSP00000411824:V64I	ENSP00000307634:V225I	V	+	1	0	AGAP1	236323871	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.548000	0.98103	2.581000	0.87130	0.561000	0.74099	GTT	AGAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257077.1		35.584281	0	-25	87	0	0	1	0	NM_014914	15	41.657676	59	0.202703
TNNT3	7140	broad.mit.edu	hg19	11	1950366	1950366	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:1950366C>T	ENST00000278317.6	+	7	318	c.99C>T	c.(97-99)gaC>gaT	p.D33D	TNNT3_ENST00000381589.3_Intron|TNNT3_ENST00000381549.3_Intron|TNNT3_ENST00000360603.3_Intron|TNNT3_ENST00000381579.3_Intron|TNNT3_ENST00000446240.1_Intron|TNNT3_ENST00000381561.4_Intron|TNNT3_ENST00000397301.1_Silent_p.D44D|TNNT3_ENST00000397304.2_Intron|TNNT3_ENST00000381548.3_Silent_p.D35D|TNNT3_ENST00000381558.1_Intron	NM_006757.3	NP_006748.1	P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	44		muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding	breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)	CAGAGGAGGACGCGGAAGGTA	0.667	0	99.0	103.0	102.0	11	1950366	2202	4299	6501	SO:0001819	synonymous_variant	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595		11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""		8172653	Standard	NM_001042782	Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000278317.6:c.99C>T	11.37:g.1950366C>T		A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	ENST00000278317.6	37	CCDS7727.1																																																																																			TNNT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034756.4		26.570240	0	-18	123	0	0	1	0	NM_006757	12	30.988171	45	0.210526
ZMAT5	55954	broad.mit.edu	hg19	22	30134421	30134421	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:30134421C>T	ENST00000397781.3	-	6	531	c.281G>A	c.(280-282)cGa>cAa	p.R94Q	ZMAT5_ENST00000344318.3_Missense_Mutation_p.R94Q	NM_019103.2	NP_061976.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	94		mRNA processing	cytoplasm|U12-type spliceosomal complex	nucleic acid binding|zinc ion binding	large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)		CTCCCTGGCTCGCCTCTCCTC	0.612	0	48.0	44.0	45.0	22	30134421	2203	4300	6503	SO:0001583	missense		CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319	"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""				9847074	Standard	NM_019103	Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.281G>A	22.37:g.30134421C>T	ENSP00000344241:p.Arg94Gln	A8K9F6	ENST00000344318.3	37	CCDS13868.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.251849	0.39797	.	.	ENSG00000100319	ENST00000344318;ENST00000397781	.	.	.	5.14	2.94	0.34122	.	0.112278	0.64402	D	0.000015	T	0.39545	0.1082	M	0.65498	2.005	0.44227	D	0.997061	P	0.39737	0.685	B	0.24541	0.054	T	0.32188	-0.9916	9	0.27785	T	0.31	-35.6225	8.5325	0.33344	0.1618:0.7525:0.0:0.0856	.	94	Q9UDW3	ZMAT5_HUMAN	Q	94	.	ENSP00000344241:R94Q	R	-	2	0	ZMAT5	28464421	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	3.140000	0.50585	1.401000	0.46761	0.603000	0.83216	CGA	ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322114.1		11.163508	0	-7	44	0	0	1	0	NM_019103	5	12.665866	17	0.227273
ERC1	23085	broad.mit.edu	hg19	12	1137128	1137128	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:1137128G>A	ENST00000397203.2	+	2	465	c.59G>A	c.(58-60)cGt>cAt	p.R20H	ERC1_ENST00000360905.4_Missense_Mutation_p.R20H|ERC1_ENST00000589028.1_Missense_Mutation_p.R20H|ERC1_ENST00000355446.5_Missense_Mutation_p.R20H|ERC1_ENST00000543086.3_Missense_Mutation_p.R20H|ERC1_ENST00000546231.2_Missense_Mutation_p.R20H			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	20		I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding	NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)		AGCCCTGGGCGTTCACCCAGG	0.582	0	101.0	100.0	101.0	12	1137128	2203	4300	6503	SO:0001583	missense	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805		17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2	10697956, 11929610	Standard	NM_178040	Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.59G>A	12.37:g.1137128G>A	ENSP00000380386:p.Arg20His	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375417	0.82682	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394	D;D;D;D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.91935	0.7446	L	0.34521	1.04	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.984	D	0.92721	0.6191	10	0.87932	D	0	-9.6219	19.6214	0.95658	0.0:0.0:1.0:0.0	.	20;20;20	Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;RB6I2_HUMAN	H	20	ENSP00000340054:R20H;ENSP00000380386:R20H;ENSP00000438546:R20H;ENSP00000445336:R20H;ENSP00000442976:R20H;ENSP00000442739:R20H;ENSP00000347621:R20H;ENSP00000354158:R20H;ENSP00000410064:R20H	ENSP00000299183:R20H	R	+	2	0	ERC1	1007389	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	9.782000	0.99034	2.644000	0.89710	0.655000	0.94253	CGT	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2		134.485266	0	-7	94	0	0	1	0	NM_015064	44	134.961218	59	0.427184
ZMAT1	84460	broad.mit.edu	hg19	X	101159302	101159302	+	Translation_Start_Site	SNP	G	G	A	rs141888312		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:101159302G>A	ENST00000458570.1	-	0	316				ZMAT1_ENST00000540921.1_Splice_Site_p.D41D|ZMAT1_ENST00000372782.3_Splice_Site_p.D41D	NM_001282401.1	NP_001269330.1	A7MD47	A7MD47_HUMAN	zinc finger, matrin-type 1				nucleus	zinc ion binding	endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22					TCCAAATGGCGTCTGTGAATA	0.299	0	75.0	67.0	69.0	X	101159302	2202	4298	6500			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432	"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product						Standard	NM_001011657	Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000458570.1:c.-1015C>T	X.37:g.101159302G>A		Q8NDS3|Q96JN6	ENST00000458570.1	37																																																																																				ZMAT1-201	KNOWN	basic	protein_coding	protein_coding			10.190169	0	3	43	0	0	1	0		4	11.467911	14	0.222222
GPR101	83550	broad.mit.edu	hg19	X	136112961	136112961	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:136112961C>T	ENST00000298110.1	-	1	872	c.873G>A	c.(871-873)acG>acA	p.T291T		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	291			integral to membrane|plasma membrane	G-protein coupled receptor activity	autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)				CACTGGTCCCCGTGCTTCCTT	0.612	0	209.0	142.0	165.0	X	136112961	2203	4300	6503	SO:0001819	synonymous_variant	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370	"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393			11574155	Standard	NM_054021	Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.873G>A	X.37:g.136112961C>T		Q5JSM8|Q8NG93	ENST00000298110.1	37	CCDS14662.1																																																																																			GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		99.355377	0	-15	104	0	0	1	0		33	100.117324	50	0.397590
JPH2	57158	broad.mit.edu	hg19	20	42788529	42788529	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:42788529G>A	ENST00000372980.3	-	2	1770	c.898C>T	c.(898-900)Cgc>Tgc	p.R300C		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	300		calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		AAGCCCGAGCGTTTGTCGTTC	0.687	0	58.0	51.0	53.0	20	42788529	2203	4300	6503	SO:0001583	missense	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596		14202	protein-coding gene	gene with protein product		605267			10891348, 10949023	Standard	XM_006723832	Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.898C>T	20.37:g.42788529G>A	ENSP00000362071:p.Arg300Cys	E1P5X1|O95913|Q5JY74|Q9UJN4	ENST00000372980.3	37	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	g	16.62	3.175181	0.57692	.	.	ENSG00000149596	ENST00000372980	T	0.59638	0.25	3.1	3.1	0.35709	.	0.000000	0.85682	D	0.000000	T	0.75700	0.3885	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80957	-0.1150	10	0.87932	D	0	.	14.3498	0.66694	0.0:0.0:1.0:0.0	.	300	Q9BR39	JPH2_HUMAN	C	300	ENSP00000362071:R300C	ENSP00000362071:R300C	R	-	1	0	JPH2	42221943	1.000000	0.71417	0.998000	0.56505	0.192000	0.23643	9.137000	0.94496	1.545000	0.49373	0.298000	0.19748	CGC	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		6.616093	0	-14	20	0	0	1	0		3	7.872025	12	0.200000
ANKRD50	57182	broad.mit.edu	hg19	4	125592546	125592546	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:125592546G>A	ENST00000504087.1	-	4	2923	c.1886C>T	c.(1885-1887)gCa>gTa	p.A629V	ANKRD50_ENST00000515641.1_Missense_Mutation_p.A450V	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	629					NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55					ATAAAGTAGTGCAGAAACTAC	0.453	0	127.0	116.0	120.0	4	125592546	2203	4300	6503	SO:0001583	missense	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458	"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product						Standard	NM_020337	Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1886C>T	4.37:g.125592546G>A	ENSP00000425658:p.Ala629Val	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514877	0.27123	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.64618	-0.11;-0.06	5.21	5.21	0.72293	Ankyrin repeat-containing domain (4);	0.130432	0.50627	D	0.000115	T	0.52208	0.1720	N	0.10809	0.05	0.80722	D	1	P	0.45986	0.87	P	0.46718	0.525	T	0.54984	-0.8211	10	0.35671	T	0.21	.	18.9425	0.92610	0.0:0.0:1.0:0.0	.	629	Q9ULJ7	ANR50_HUMAN	V	629;450	ENSP00000425658:A629V;ENSP00000425355:A450V	ENSP00000425658:A629V	A	-	2	0	ANKRD50	125811996	1.000000	0.71417	0.813000	0.32504	0.342000	0.28953	7.095000	0.76952	2.714000	0.92807	0.585000	0.79938	GCA	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1		84.024732	0	-9	93	0	0	1	0	NM_020337	30	85.028998	49	0.379747
MLC1	23209	broad.mit.edu	hg19	22	50515862	50515862	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:50515862G>A	ENST00000311597.5	-	6	1099	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W	MLC1_ENST00000431262.2_Missense_Mutation_p.R135W|MLC1_ENST00000535444.1_Missense_Mutation_p.R86W|MLC1_ENST00000450140.2_Missense_Mutation_p.R113W|MLC1_ENST00000538737.1_Missense_Mutation_p.R131W|MLC1_ENST00000395876.2_Missense_Mutation_p.R165W	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	165			basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity	endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)	TCGCTGGACCGTGCAGCGATG	0.632	0	77.0	59.0	65.0	22	50515862	2203	4300	6503	SO:0001583	missense	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427		17082	protein-coding gene	gene with protein product		605908			7584026, 7584028	Standard	XR_430476	Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.493C>T	22.37:g.50515862G>A	ENSP00000310375:p.Arg165Trp	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	ENST00000311597.5	37	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.906176	0.52333	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140;ENST00000442311	D;D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	4.38	3.22	0.36961	.	0.000000	0.85682	D	0.000000	D	0.91209	0.7230	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.996;0.997	D	0.90994	0.4837	10	0.87932	D	0	-5.6194	8.6789	0.34196	0.0:0.0:0.6515:0.3485	.	131;135;113;165	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	W	165;165;131;135;86;113;135	ENSP00000379216:R165W;ENSP00000310375:R165W;ENSP00000445805:R131W;ENSP00000415877:R135W;ENSP00000438910:R86W;ENSP00000412448:R113W;ENSP00000401385:R135W	ENSP00000310375:R165W	R	-	1	2	MLC1	48857989	0.998000	0.40836	0.895000	0.35142	0.247000	0.25773	2.843000	0.48238	2.124000	0.65301	0.655000	0.94253	CGG	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2		54.173046	0	-5	55	0	0	1	0	NM_015166	17	54.225771	20	0.459459
HTT	3064	broad.mit.edu	hg19	4	3123053	3123053	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:3123053C>T	ENST00000355072.5	+	9	1312	c.1167C>T	c.(1165-1167)ccC>ccT	p.P389P		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	389		establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding	breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)	CGCCTCCACCCGAGCTTCTGC	0.567	0	65.0	66.0	66.0	4	3123053	1946	4153	6099	SO:0001819	synonymous_variant	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386	"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD	8458085	Standard	NM_002111	Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1167C>T	4.37:g.3123053C>T		Q9UQB7	ENST00000355072.5	37	CCDS43206.1																																																																																			HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2		54.975701	0	21	57	0	0	1	0	NM_002111	17	54.975701	17	0.500000
SLC9A3	6550	broad.mit.edu	hg19	5	476456	476456	+	Missense_Mutation	SNP	G	G	A	rs150973602		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:476456G>A	ENST00000264938.3	-	13	1937	c.1928C>T	c.(1927-1929)aCg>aTg	p.T643M	CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.T634M	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	643	Interaction with PDZD3 (By similarity).		cell surface|integral to membrane	sodium:hydrogen antiporter activity	NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)		CTCGTCCTCCGTGGGCGTGAG	0.612	0	119.0	117.0	118.0	5	476456	2203	4300	6503	SO:0001583	missense		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230	"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3	8096830	Standard	NM_004174	Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1928C>T	5.37:g.476456G>A	ENSP00000264938:p.Thr643Met	B7ZKR2|E9PF67|Q3MIW3	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270121	0.23221	2.27E-4	0.0	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.77358	-1.09;-1.09	4.85	-6.47	0.01902	.	1.774650	0.02765	N	0.119060	T	0.61198	0.2328	N	0.22421	0.69	0.09310	N	1	D;P	0.57571	0.98;0.923	B;B	0.40329	0.326;0.266	T	0.64812	-0.6319	10	0.66056	D	0.02	.	6.968	0.24632	0.0:0.3441:0.2995:0.3565	.	634;643	E9PF67;P48764	.;SL9A3_HUMAN	M	643;634	ENSP00000264938:T643M;ENSP00000422983:T634M	ENSP00000264938:T643M	T	-	2	0	SLC9A3	529456	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.709000	0.05030	-1.541000	0.01727	-0.499000	0.04595	ACG	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2		113.363144	0	-31	130	0	0	1	0	NM_004174	37	113.673254	48	0.435294
NCOA6	23054	broad.mit.edu	hg19	20	33328468	33328468	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:33328468G>A	ENST00000374796.2	-	12	8162	c.5592C>T	c.(5590-5592)ctC>ctT	p.L1864L	NCOA6_ENST00000359003.2_Silent_p.L1864L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1864	EP300/CRSP3-binding region.	brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding	NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107					CTGTTCCCATGAGCCCCGGAG	0.542	0	107.0	109.0	108.0	20	33328468	2203	4300	6503	SO:0001819	synonymous_variant	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646		15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299			8724849, 8263591	Standard	NM_014071	Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5592C>T	20.37:g.33328468G>A		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	ENST00000374796.2	37	CCDS13241.1																																																																																			NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2		105.731545	0	-13	87	0	0	1	0	NM_014071	35	105.744744	33	0.514706
VPS72	6944	broad.mit.edu	hg19	1	151149201	151149201	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:151149201G>A	ENST00000354473.4	-	6	1083	c.1047C>T	c.(1045-1047)gcC>gcT	p.A349A				Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	338	Poly-Pro.|Pro-rich.	chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		CGGGGCCCAGGGCTGAGGCAG	0.572	0	76.0	83.0	81.0	1	151149201	2203	4300	6503	SO:0001819	synonymous_variant	D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159		11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1	7702631	Standard	NM_001271087	Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.1047C>T	1.37:g.151149201G>A		A6NLK9|A6PW55|Q53GJ2|Q5U0R4	ENST00000354473.4	37	CCDS59201.1																																																																																			VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000034394.3		-6.423066	0	14	112	0	0	1	0	NM_005997	3	6.461739	57	0.050000
MED9	55090	broad.mit.edu	hg19	17	17394702	17394702	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:17394702G>A	ENST00000268711.3	+	2	390	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K		NM_018019.2	NP_060489.1	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	112		regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		protein binding	cervix(1)|endometrium(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7					CCTGAGCCCCGAACAGCAGCA	0.582	1	81.0	78.0	79.0	17	17394702	2203	4300	6503	SO:0001583	missense	BC000647	CCDS11184.1	17p11.2	2007-07-30	2007-07-30		ENSG00000141026	ENSG00000141026		25487	protein-coding gene	gene with protein product		609878	"""mediator of RNA polymerase II transcription, subunit 9 homolog (S. cerevisiae)"""		11997338	Standard	NM_018019	Approved	FLJ10193, MED25	uc002grh.1	Q9NWA0	OTTHUMG00000059293	ENST00000268711.3:c.334G>A	17.37:g.17394702G>A	ENSP00000268711:p.Glu112Lys		ENST00000268711.3	37	CCDS11184.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033615	0.93575	.	.	ENSG00000141026	ENST00000268711	.	.	.	4.71	4.71	0.59529	.	0.189070	0.44902	D	0.000401	T	0.63733	0.2536	M	0.78637	2.42	0.80722	D	1	D	0.53151	0.958	P	0.44597	0.454	T	0.72877	-0.4159	9	0.72032	D	0.01	-33.7092	16.8296	0.85940	0.0:0.0:1.0:0.0	.	112	Q9NWA0	MED9_HUMAN	K	112	.	ENSP00000268711:E112K	E	+	1	0	MED9	17335427	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	5.734000	0.68580	2.448000	0.82819	0.655000	0.94253	GAA	MED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131669.2		78.172852	0	-1	102	0	0	1	0	NM_018019	25	78.189528	27	0.480769
NUFIP2	57532	broad.mit.edu	hg19	17	27613317	27613317	+	Silent	SNP	G	G	A	rs150088850		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:27613317G>A	ENST00000225388.4	-	2	1753	c.1695C>T	c.(1693-1695)taC>taT	p.Y565Y	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	565			nucleus|polysomal ribosome	protein binding|RNA binding	breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)		TCTCCAGCTCGTAAGCCTTGG	0.463	1	85.0	84.0	84.0	17	27613317	2203	4300	6503	SO:0001819	synonymous_variant	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256		17634	protein-coding gene	gene with protein product		609356			12837692, 16407062	Standard	NM_020772	Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1695C>T	17.37:g.27613317G>A		A1L3A6|Q9P2M5	ENST00000225388.4	37	CCDS32600.1																																																																																			NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2		39.062160	0	3	83	0	0	1	0	NM_020772	16	43.982203	55	0.225352
C6orf136	221545	broad.mit.edu	hg19	6	30617438	30617438	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:30617438G>A	ENST00000293604.6	+	2	912	c.719G>A	c.(718-720)cGc>cAc	p.R240H	C6orf136_ENST00000493705.1_3'UTR|C6orf136_ENST00000376473.5_Missense_Mutation_p.R59H|C6orf136_ENST00000376471.4_Intron	NM_001161376.1	NP_001154848.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	59					endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10					CTGCCCCCACGCCTTCCCACC	0.612	0	120.0	127.0	125.0	6	30617438	2080	4220	6300	SO:0001583	missense	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564		21301	protein-coding gene	gene with protein product						Standard	NM_001109938	Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.176G>A	6.37:g.30617438G>A	ENSP00000365656:p.Arg59His	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	ENST00000376473.5	37	CCDS43443.1	.	.	.	.	.	.	.	.	.	.	G	8.403	0.842316	0.16963	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000446773	.	.	.	5.51	-5.96	0.02234	.	2.161400	0.01898	N	0.038983	T	0.05227	0.0139	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.12915	-1.0529	9	0.36615	T	0.2	0.8566	1.4301	0.02332	0.4817:0.1262:0.1846:0.2075	.	240;59	F8VX15;Q5SQH8	.;CF136_HUMAN	H	240;59;177	.	ENSP00000293604:R240H	R	+	2	0	C6orf136	30725417	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.939000	0.03933	-0.871000	0.04042	0.557000	0.71058	CGC	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4		-9.060148	0	-33	120	0	0	1	0	NM_145029	4	7.289579	73	0.051948
ZBTB7A	51341	broad.mit.edu	hg19	19	4054867	4054867	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:4054867C>T	ENST00000322357.4	-	2	642	c.364G>A	c.(364-366)Gtg>Atg	p.V122M	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.V122M	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	122		cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding	endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)	TCGGCGCACACGTGGCTCACG	0.677	0	22.0	21.0	21.0	19	4054867	2189	4295	6484	SO:0001583	missense	AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951	"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7	9973611, 9927193	Standard	NM_015898	Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.364G>A	19.37:g.4054867C>T	ENSP00000323670:p.Val122Met	D6W619|O00456|Q14D41|Q5XG86	ENST00000322357.4	37	CCDS12119.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555856	0.86231	.	.	ENSG00000178951	ENST00000322357	T	0.67865	-0.29	5.07	5.07	0.68467	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000004	T	0.78470	0.4288	L	0.53561	1.675	0.54753	D	0.999986	D	0.89917	1.0	D	0.71656	0.974	T	0.80209	-0.1477	10	0.62326	D	0.03	.	17.417	0.87503	0.0:1.0:0.0:0.0	.	122	O95365	ZBT7A_HUMAN	M	122	ENSP00000323670:V122M	ENSP00000323670:V122M	V	-	1	0	ZBTB7A	4005867	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.594000	0.82698	2.353000	0.79882	0.462000	0.41574	GTG	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457621.2		12.198189	0	-10	12	0	0	1	0	NM_015898	4	12.285584	6	0.400000
PLCD4	84812	broad.mit.edu	hg19	2	219483520	219483520	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:219483520C>T	ENST00000450993.2	+	4	739	c.400C>T	c.(400-402)Cgc>Tgc	p.R134C	PLCD4_ENST00000417849.1_Missense_Mutation_p.R134C|PLCD4_ENST00000432688.1_Missense_Mutation_p.R134C	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	134	EF-hand 1.	intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	CCATCAGGAGCGCCTGGACCA	0.577	0	19.0	20.0	20.0	2	219483520	2078	4203	6281	SO:0001583	missense	AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939			10702683, 9056492	Standard	NM_032726	Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000432688.1:c.400C>T	2.37:g.219483520C>T	ENSP00000396185:p.Arg134Cys	Q53FS8	ENST00000432688.1	37		.	.	.	.	.	.	.	.	.	.	C	14.75	2.628514	0.46944	.	.	ENSG00000115556	ENST00000450993;ENST00000251959;ENST00000457426;ENST00000417849;ENST00000432688	T;T;T	0.44482	0.92;0.92;0.92	4.89	-0.634	0.11516	.	0.932149	0.08653	U	0.913725	T	0.48241	0.1489	L	0.43923	1.385	0.35091	D	0.76433	D;D	0.89917	1.0;0.999	D;P	0.64595	0.927;0.724	T	0.57837	-0.7742	10	0.87932	D	0	.	4.2227	0.10565	0.4874:0.2579:0.0:0.2547	.	81;134	B4DN84;Q9BRC7	.;PLCD4_HUMAN	C	134	ENSP00000388631:R134C;ENSP00000396942:R134C;ENSP00000396185:R134C	ENSP00000251959:R134C	R	+	1	0	PLCD4	219191764	0.985000	0.35326	0.516000	0.27786	0.976000	0.68499	2.383000	0.44354	0.014000	0.14944	0.655000	0.94253	CGC	PLCD4-007	NOVEL	non_canonical_conserved|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000336882.1		20.252831	0	-2	13	0	0	1	0		6	20.474184	3	0.666667
C20orf26	26074	broad.mit.edu	hg19	20	20177279	20177279	+	Silent	SNP	C	C	T	rs78795550	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:20177279C>T	ENST00000245957.5	+	16	1732	c.1656C>T	c.(1654-1656)cgC>cgT	p.R552R	C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN	chromosome 20 open reading frame 26	552					NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)	ACCACCAGCGCGAAGAACACG	0.463	0	153.0	125.0	135.0	20	20177279	2203	4300	6503	SO:0001819	synonymous_variant																									ENST00000245957.5:c.1656C>T	20.37:g.20177279C>T		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	ENST00000245957.5	37	CCDS33447.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	9.621	1.133941	0.21123	2.27E-4	0.0	ENSG00000089101	ENST00000431753	.	.	.	5.83	-10.0	0.00425	.	.	.	.	.	T	0.32224	0.0822	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41378	-0.9512	4	.	.	.	.	1.8644	0.03195	0.2904:0.0963:0.3508:0.2625	.	.	.	.	V	92	.	.	A	+	2	0	C20orf26	20125279	0.000000	0.05858	0.178000	0.23040	0.981000	0.71138	-2.349000	0.01093	-1.563000	0.01680	-0.150000	0.13652	GCG	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		37.923168	0	-7	75	0	0	1	0		14	39.222537	30	0.318182
MYO1F	4542	broad.mit.edu	hg19	19	8601203	8601203	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:8601203G>A	ENST00000338257.8	-	19	2243	c.1976C>T	c.(1975-1977)gCg>gTg	p.A659V		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	659	Myosin head-like.		unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42					CATGTTGACCGCCCGAAGCAG	0.637	0	67.0	68.0	68.0	19	8601203	2030	4210	6240	SO:0001583	missense	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347	"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480			9119401, 8884266	Standard	NM_012335	Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1976C>T	19.37:g.8601203G>A	ENSP00000344871:p.Ala659Val	Q8WWN7	ENST00000338257.8	37	CCDS42494.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	22.8	4.333385	0.81801	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.87966	-2.32	4.51	4.51	0.55191	Myosin head, motor domain (2);	0.067309	0.64402	D	0.000010	D	0.84615	0.5511	M	0.65975	2.015	0.41335	D	0.987269	P	0.40250	0.709	B	0.33454	0.164	D	0.86832	0.2011	10	0.51188	T	0.08	.	16.2491	0.82473	0.0:0.0:1.0:0.0	.	659	O00160	MYO1F_HUMAN	V	704;659	ENSP00000344871:A659V	ENSP00000304899:A704V	A	-	2	0	MYO1F	8507203	1.000000	0.71417	0.624000	0.29186	0.904000	0.53231	9.781000	0.99029	2.076000	0.62316	0.454000	0.30748	GCG	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		8.522471	0	-2	53	0	0	1	0		6	12.997189	33	0.153846
RAD23B	5887	broad.mit.edu	hg19	9	110084367	110084367	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:110084367C>T	ENST00000358015.3	+	7	1136	c.785C>T	c.(784-786)aCg>aTg	p.T262M	RAD23B_ENST00000416373.2_Missense_Mutation_p.T190M	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	262	Poly-Thr.	nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleoplasm|proteasome complex|XPC complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding	breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14					GCAGCAACTACGACAGCAACA	0.488	0	63.0	67.0	65.0	9	110084367	2203	4300	6503	SO:0001583	missense		CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318		9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""		7851894, 8168482	Standard	NM_002874	Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.785C>T	9.37:g.110084367C>T	ENSP00000350708:p.Thr262Met	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	ENST00000358015.3	37	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770683	0.69992	0.0	1.16E-4	ENSG00000119318	ENST00000358015;ENST00000416373	T;T	0.18657	2.21;2.2	5.19	5.19	0.71726	.	0.210963	0.47852	D	0.000217	T	0.34250	0.0891	L	0.27053	0.805	0.50171	D	0.999857	D;P;D	0.89917	1.0;0.908;0.995	D;B;P	0.75020	0.985;0.394;0.661	T	0.04281	-1.0963	10	0.41790	T	0.15	-17.36	17.8341	0.88691	0.0:1.0:0.0:0.0	.	241;262;262	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	M	262;190	ENSP00000350708:T262M;ENSP00000405623:T190M	ENSP00000350708:T262M	T	+	2	0	RAD23B	109124188	0.882000	0.30256	0.747000	0.31113	0.714000	0.41099	3.929000	0.56514	2.579000	0.87056	0.555000	0.69702	ACG	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1		7.882316	0	19	63	0	0	1	0	NM_002874	7	16.068228	51	0.120690
KAT2A	2648	broad.mit.edu	hg19	17	40271407	40271407	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:40271407C>T	ENST00000225916.5	-	6	982	c.929G>A	c.(928-930)cGc>cAc	p.R310H		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	310		chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18					GGTTTCGTAGCGGGGGAGGCT	0.587	0	100.0	97.0	98.0	17	40271407	2203	4300	6503	SO:0001583	missense	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2	8552087	Standard	NM_021078	Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.929G>A	17.37:g.40271407C>T	ENSP00000225916:p.Arg310His	Q8N1A2|Q9UCW1	ENST00000225916.5	37	CCDS11417.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173070	0.38413	.	.	ENSG00000108773	ENST00000225916	T	0.05199	3.48	4.69	3.71	0.42584	PCAF, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05181	0.0138	N	0.20766	0.605	0.58432	D	0.999999	B	0.24675	0.109	B	0.27076	0.076	T	0.42430	-0.9452	10	0.17832	T	0.49	-18.4484	14.3531	0.66716	0.1492:0.8508:0.0:0.0	.	310	Q92830	KAT2A_HUMAN	H	310	ENSP00000225916:R310H	ENSP00000225916:R310H	R	-	2	0	KAT2A	37524933	1.000000	0.71417	0.824000	0.32777	0.855000	0.48748	7.651000	0.83577	1.198000	0.43158	0.555000	0.69702	CGC	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1		86.866145	0	-20	106	0	0	1	0	NM_021078	29	86.922493	33	0.467742
GJA1	2697	broad.mit.edu	hg19	6	121768726	121768726	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:121768726G>A	ENST00000282561.3	+	2	890	c.733G>A	c.(733-735)Gac>Aac	p.D245N		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	245		cell-cell signaling|cellular membrane organization|gap junction assembly|heart development|muscle contraction|positive regulation of I-kappaB kinase/NF-kappaB cascade	connexon complex|Golgi-associated vesicle membrane|integral to plasma membrane|membrane raft	ion transmembrane transporter activity|signal transducer activity	autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	GGGAAAGAGCGACCCTTACCA	0.507	0	100.0	99.0	99.0	6	121768726	2203	4300	6503	SO:0001583	missense	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661	"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL	10331943, 1646158	Standard	NM_000165	Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.733G>A	6.37:g.121768726G>A	ENSP00000282561:p.Asp245Asn	B2R5U9|Q6FHU1|Q9Y5I8	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	3.137	-0.177081	0.06380	0.0	1.16E-4	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.97066	-4.23	5.71	4.84	0.62591	.	0.730394	0.11003	U	0.610297	D	0.89174	0.6640	N	0.12182	0.205	0.42019	D	0.990972	B	0.17268	0.021	B	0.08055	0.003	T	0.78645	-0.2123	10	0.28530	T	0.3	.	16.7504	0.85484	0.0:0.1293:0.8707:0.0	.	245	P17302	CXA1_HUMAN	N	229;245	ENSP00000282561:D245N	ENSP00000282561:D245N	D	+	1	0	GJA1	121810425	1.000000	0.71417	0.843000	0.33291	0.010000	0.07245	4.206000	0.58473	1.404000	0.46819	0.585000	0.79938	GAC	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1		17.085984	0	8	65	0	0	1	0	NM_000165	8	20.027111	30	0.210526
ZNF629	23361	broad.mit.edu	hg19	16	30793309	30793309	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:30793309G>A	ENST00000262525.4	-	3	2547	c.2340C>T	c.(2338-2340)cgC>cgT	p.R780R		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	780		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)		TGAGGGCCACGCGGTCGAGGA	0.647	0	80.0	95.0	90.0	16	30793309	1915	4115	6030	SO:0001819	synonymous_variant	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870	"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65	9205841	Standard	NM_001080417	Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.2340C>T	16.37:g.30793309G>A		Q15938	ENST00000262525.4	37	CCDS45463.1																																																																																			ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1		52.397638	0	-28	132	0	0	1	0	NM_015309	22	59.424876	77	0.222222
PLEKHM3	389072	broad.mit.edu	hg19	2	208795810	208795810	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:208795810C>T	ENST00000457206.1	-	5	2153	c.1726G>A	c.(1726-1728)Gtg>Atg	p.V576M	PLEKHM3_ENST00000427836.2_Missense_Mutation_p.V576M|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.V576M			Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	576		intracellular signal transduction		metal ion binding	central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					TCTTCGTACACGTACTCCAGA	0.602	0	71.0	76.0	74.0	2	208795810	2051	4204	6255	SO:0001583	missense	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385	"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L	19028694	Standard	NM_001080475	Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1726G>A	2.37:g.208795810C>T	ENSP00000417003:p.Val576Met	B9EKV2|Q8WW68	ENST00000427836.2	37	CCDS42808.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.377049|4.377049	0.82682|0.82682	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000447645|ENST00000427836;ENST00000389247;ENST00000457206	.|D;D;D	.|0.84516	.|-1.85;-1.86;-1.84	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87438|0.87438	0.6177|0.6177	N|N	0.17474|0.17474	0.49|0.49	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.85130	.|0.966;0.997	D|D	0.87789|0.87789	0.2617|0.2617	5|10	.|0.45353	.|T	.|0.12	.|.	20.0292|20.0292	0.97532|0.97532	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|576;576	.|C9J119;Q6ZWE6	.|.;PKHM3_HUMAN	H|M	327|576	.|ENSP00000417003:V576M;ENSP00000373899:V576M;ENSP00000400150:V576M	.|ENSP00000373899:V576M	R|V	-|-	2|1	0|0	PLEKHM3|PLEKHM3	208504055|208504055	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	4.887000|4.887000	0.63156|0.63156	2.740000|2.740000	0.93945|0.93945	0.460000|0.460000	0.39030|0.39030	CGT|GTG	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1		38.730865	0	-21	78	0	0	1	0	NM_001080475	14	40.905231	36	0.280000
SF3B1	23451	broad.mit.edu	hg19	2	198267484	198267484	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:198267484G>A	ENST00000335508.6	-	14	1964	c.1873C>T	c.(1873-1875)Cgt>Tgt	p.R625C		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa			nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)		GTTGTGTTACGGACATACTCA	0.433	5	93.0	90.0	91.0	2	198267484	2203	4300	6503	SO:0001583	missense	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524		10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""		9585501	Standard	XM_005246428	Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1873C>T	2.37:g.198267484G>A	ENSP00000335321:p.Arg625Cys	E9PCH3	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873082	0.72180	.	.	ENSG00000115524	ENST00000335508	T	0.74421	-0.84	5.82	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.053241	0.64402	D	0.000001	D	0.90331	0.6975	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.93337	0.6706	10	0.87932	D	0	.	15.2676	0.73675	0.0:0.0:0.7451:0.2549	.	625	O75533	SF3B1_HUMAN	C	625	ENSP00000335321:R625C	ENSP00000335321:R625C	R	-	1	0	SF3B1	197975729	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.689000	0.61723	1.444000	0.47605	-0.182000	0.12963	CGT	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		59.951155	0	4	58	0	0	1	0		18	59.951155	18	0.500000
TADA3	10474	broad.mit.edu	hg19	3	9831435	9831435	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:9831435G>A	ENST00000343450.2	-	3	967	c.420C>T	c.(418-420)atC>atT	p.I140I	TADA3_ENST00000301964.2_Silent_p.I140I|TADA3_ENST00000492635.1_5'UTR|TADA3_ENST00000440161.1_Silent_p.I140I	NM_133480.1	NP_597814.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	140		estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity	endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16					GTGGCACGTCGATAGGGTCAT	0.572	0	127.0	114.0	118.0	3	9831435	2203	4300	6503	SO:0001819	synonymous_variant	AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148		19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L	9674425, 11707411	Standard	NM_006354	Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.420C>T	3.37:g.9831435G>A		Q6FI83|Q9UFS2	ENST00000301964.2	37	CCDS2583.1																																																																																			TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250236.1		12.760809	0	-42	123	0	0	1	0		8	19.416502	47	0.145455
AOX1	316	broad.mit.edu	hg19	2	201478596	201478596	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:201478596G>A	ENST00000374700.2	+	15	1759	c.1518G>A	c.(1516-1518)tcG>tcA	p.S506S	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	ADO_HUMAN	aldehyde oxidase 1	506		inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity	breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					TTTTGGGCTCGGCGCCAGGTG	0.473	0	94.0	90.0	92.0	2	201478596	2203	4300	6503	SO:0001819	synonymous_variant	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356		553	protein-coding gene	gene with protein product		602841			7570184	Standard	NM_001159	Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1518G>A	2.37:g.201478596G>A		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	ENST00000374700.2	37	CCDS33360.1																																																																																			AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1		-1.911030	0	6	57	0	0	1	0	NM_001159	3	6.846842	42	0.066667
KL	9365	broad.mit.edu	hg19	13	33635718	33635718	+	Silent	SNP	C	C	T	rs147748913		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:33635718C>T	ENST00000380099.3	+	4	2510	c.2502C>T	c.(2500-2502)acC>acT	p.T834T	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	834	Glycosyl hydrolase-1 2.	aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	AAGAAATGACCGACATCACGT	0.473	0	90.0	89.0	90.0	13	33635718	2203	4300	6503	SO:0001819	synonymous_variant	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116		6344	protein-coding gene	gene with protein product		604824			9464267	Standard	NM_004795	Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2502C>T	13.37:g.33635718C>T		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	ENST00000380099.3	37	CCDS9347.1																																																																																			KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		-2.413262	0	-9	72	0	0	1	0		3	7.159583	45	0.062500
ABHD8	79575	broad.mit.edu	hg19	19	17412110	17412110	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:17412110C>T	ENST00000247706.3	-	2	555	c.316G>A	c.(316-318)Ggg>Agg	p.G106R	MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000600434.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	106				hydrolase activity	central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9					CCATTCTGCCCGTGTAGGAGG	0.721	0	21.0	23.0	22.0	19	17412110	1985	3920	5905	SO:0001583	missense	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220	"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product					12477932	Standard	NM_024527	Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.316G>A	19.37:g.17412110C>T	ENSP00000247706:p.Gly106Arg	Q9HAE9	ENST00000247706.3	37	CCDS12355.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829729	0.32329	.	.	ENSG00000127220	ENST00000247706;ENST00000544788	T	0.30981	1.51	5.24	4.2	0.49525	.	0.175578	0.50627	D	0.000119	T	0.16428	0.0395	N	0.14661	0.345	0.36626	D	0.876051	P	0.37708	0.606	B	0.32289	0.143	T	0.16364	-1.0405	10	0.45353	T	0.12	-14.7149	10.6748	0.45778	0.387:0.613:0.0:0.0	.	106	Q96I13	ABHD8_HUMAN	R	106;52	ENSP00000247706:G106R	ENSP00000247706:G106R	G	-	1	0	ABHD8	17273110	0.530000	0.26330	0.281000	0.24762	0.875000	0.50365	1.025000	0.30090	1.151000	0.42436	0.491000	0.48974	GGG	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1		52.871376	0	10	81	0	0	1	0	NM_024527	17	52.962895	21	0.447368
GOLT1A	127845	broad.mit.edu	hg19	1	204170925	204170925	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:204170925C>T	ENST00000308302.3	-	3	317	c.132G>A	c.(130-132)acG>acA	p.T44T		NM_198447.1	NP_940849.1	Q6ZVE7	GOT1A_HUMAN	golgi transport 1A	44		protein transport|vesicle-mediated transport	Golgi membrane|integral to membrane		kidney(1)|lung(2)|urinary_tract(1)	4	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)		GGGACAGGCCCGTCAGGAACA	0.602	1	93.0	99.0	97.0	1	204170925	2203	4300	6503	SO:0001819	synonymous_variant	BC058832	CCDS1443.1	1q32.1	2010-06-24	2010-06-24		ENSG00000174567	ENSG00000174567		24766	protein-coding gene	gene with protein product			"""golgi transport 1 homolog A (S. cerevisiae)"""		12477932	Standard	NM_198447	Approved	FLJ42654, CGI-141, YMR292W, GOT1, MGC62027	uc001has.1	Q6ZVE7	OTTHUMG00000036056	ENST00000308302.3:c.132G>A	1.37:g.204170925C>T			ENST00000308302.3	37	CCDS1443.1																																																																																			GOLT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087887.1		-1.407282	0	8	75	0	0	1	0	NM_198447	3	6.541410	39	0.071429
TNS3	64759	broad.mit.edu	hg19	7	47408605	47408605	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:47408605G>A	ENST00000398879.1	-	17	2004	c.1638C>T	c.(1636-1638)gaC>gaT	p.D546D	TNS3_ENST00000311160.9_Silent_p.D546D|TNS3_ENST00000355730.3_Silent_p.D306D			Q68CZ2	TENS3_HUMAN	tensin 3	546			focal adhesion	protein binding	NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64					CATAGGGGCCGTCCATGCCAA	0.617	0	42.0	46.0	44.0	7	47408605	2038	4191	6229	SO:0001819	synonymous_variant	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205	"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1	11559528	Standard	NM_022748	Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1638C>T	7.37:g.47408605G>A		B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	ENST00000398879.1	37	CCDS5506.2																																																																																			TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1		31.981881	0	-6	68	0	0	1	0	NM_022748	12	33.869427	31	0.279070
ZNF425	155054	broad.mit.edu	hg19	7	148802334	148802334	+	Missense_Mutation	SNP	C	C	T	rs147910083		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:148802334C>T	ENST00000378061.2	-	4	761	c.629G>A	c.(628-630)cGg>cAg	p.R210Q		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	210		negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)		GGAGTGGCTCCGTTTGTGCTT	0.522	0	67.0	70.0	69.0	7	148802334	2203	4300	6503	SO:0001583	missense	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947	"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product						Standard	NM_001001661	Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.629G>A	7.37:g.148802334C>T	ENSP00000367300:p.Arg210Gln	B3KPM1|Q08AG3	ENST00000378061.2	37	CCDS34773.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.88	2.370085	0.42003	2.27E-4	0.0	ENSG00000204947	ENST00000378061	T	0.07444	3.19	2.89	0.995	0.19838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11793	0.0287	M	0.62266	1.93	0.24276	N	0.99523	D	0.58970	0.984	P	0.46419	0.516	T	0.16748	-1.0392	9	0.59425	D	0.04	.	6.6514	0.22965	0.0:0.7418:0.0:0.2582	.	210	Q6IV72	ZN425_HUMAN	Q	210	ENSP00000367300:R210Q	ENSP00000367300:R210Q	R	-	2	0	ZNF425	148433267	0.000000	0.05858	0.012000	0.15200	0.662000	0.39071	0.435000	0.21510	0.115000	0.18071	-0.136000	0.14681	CGG	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1		48.454381	0	5	80	0	0	1	0	XM_088140	17	50.527325	40	0.298246
MTMR14	64419	broad.mit.edu	hg19	3	9743591	9743591	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:9743591C>T	ENST00000296003.4	+	19	2009	c.1887C>T	c.(1885-1887)atC>atT	p.I629I	MTMR14_ENST00000353332.5_Silent_p.I577I|MTMR14_ENST00000420925.1_Silent_p.I271I|MTMR14_ENST00000351233.5_Silent_p.I517I	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	629			perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)				CCGGTGCCATCGGGGGCCTGC	0.612	0	66.0	74.0	72.0	3	9743591	1981	4165	6146	SO:0001819	synonymous_variant	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29	15186772	Standard	NM_022485	Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1887C>T	3.37:g.9743591C>T		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	ENST00000296003.4	37	CCDS43043.1																																																																																			MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1		73.337829	0	1	86	0	0	1	0	NM_022485	21	75.447593	1	0.954545
KIAA1211L	343990	broad.mit.edu	hg19	2	99449341	99449341	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:99449341C>T	ENST00000397899.2	-	4	690	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2			KIAA1211-like												AGCTTTAATCCGATCACACAC	0.463	0	232.0	241.0	238.0	2	99449341	1907	4139	6046	SO:0001583	missense	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872		33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55		Standard	NM_207362	Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.359G>A	2.37:g.99449341C>T	ENSP00000380996:p.Arg120Gln		ENST00000397899.2	37	CCDS42720.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901746	0.92035	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.52754	0.65	4.96	4.96	0.65561	.	0.190957	0.27031	N	0.021265	T	0.67915	0.2944	M	0.65498	2.005	0.32497	N	0.539363	D	0.89917	1.0	D	0.91635	0.999	T	0.75379	-0.3338	10	0.87932	D	0	-13.8568	17.3797	0.87401	0.0:1.0:0.0:0.0	.	120	Q6NV74	CB055_HUMAN	Q	120;148;134;134	ENSP00000380996:R120Q	ENSP00000380996:R120Q	R	-	2	0	C2orf55	98815773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.508000	0.67006	2.556000	0.86216	0.655000	0.94253	CGG	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1		-43.610548	0	-48	279	0	0	1	0	NM_207362	4	6.554116	191	0.020513
ZNF764	92595	broad.mit.edu	hg19	16	30566853	30566853	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:30566853C>T	ENST00000395091.2	-	3	1201	c.886G>A	c.(886-888)Gcc>Acc	p.A296T	AC002310.13_ENST00000568114.1_Intron|ZNF764_ENST00000252797.2_Missense_Mutation_p.A297T			Q96H86	ZN764_HUMAN	zinc finger protein 764	297		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7					GAGGGGTAGGCGAAGGCGCGG	0.731	0									SO:0001583	missense	BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951	"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product					12477932	Standard	NM_033410	Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.889G>A	16.37:g.30566853C>T	ENSP00000252797:p.Ala297Thr	A8MZF4|B3KSN2|H9KV99|Q9BWS1	ENST00000252797.2	37	CCDS10683.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645688	0.29246	.	.	ENSG00000169951	ENST00000252797;ENST00000395091	T;T	0.17691	2.26;2.26	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38720	N	0.001581	T	0.17662	0.0424	N	0.11870	0.19	0.23813	N	0.996776	D;D	0.89917	1.0;0.962	D;P	0.91635	0.999;0.613	T	0.29882	-0.9997	10	0.12430	T	0.62	-19.7122	6.6707	0.23066	0.1786:0.7339:0.0:0.0875	.	296;297	B3KSN2;Q96H86	.;ZN764_HUMAN	T	297;296	ENSP00000252797:A297T;ENSP00000378526:A296T	ENSP00000252797:A297T	A	-	1	0	ZNF764	30474354	0.000000	0.05858	0.993000	0.49108	0.042000	0.13812	-1.697000	0.01910	2.709000	0.92574	0.561000	0.74099	GCC	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1		15.675857	0	-8	16	0	0	1	0	NM_033410	5	15.700072	4	0.555556
ARHGEF11	9826	broad.mit.edu	hg19	1	156907251	156907251	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:156907251C>T	ENST00000368194.3	-	39	5269	c.4230G>A	c.(4228-4230)ccG>ccA	p.P1410P	ARHGEF11_ENST00000315174.8_Silent_p.P786P|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000361409.2_Silent_p.P1370P	NM_198236.2	NP_937879.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1370		actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				TGCTTGAGTCCGGGGGTCCTG	0.592	0	70.0	66.0	67.0	1	156907251	2203	4300	6503	SO:0001819	synonymous_variant	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694	"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708			10526156, 9205841	Standard	NM_014784	Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000368194.3:c.4230G>A	1.37:g.156907251C>T		D3DVD0|Q5VY40|Q6PFW2	ENST00000368194.3	37	CCDS1163.1																																																																																			ARHGEF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000098930.1		2.803857	0	-2	73	0	0	1	0	NM_198236	3	7.343873	26	0.103448
TTN	7273	broad.mit.edu	hg19	2	179634804	179634804	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:179634804G>A	ENST00000589042.1	-	36	8848	c.8624C>T	c.(8623-8625)gCa>gTa	p.A2875V	TTN_ENST00000360870.5_Missense_Mutation_p.A2875V|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A2829V|TTN_ENST00000359218.5_Missense_Mutation_p.A2829V|TTN_ENST00000591111.1_Missense_Mutation_p.A2875V|TTN_ENST00000342992.6_Missense_Mutation_p.A2875V|TTN_ENST00000460472.2_Missense_Mutation_p.A2829V	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	2613				ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		AAACAGTTTTGCTTTGCATTC	0.458	0	151.0	142.0	145.0	2	179634804	2203	4300	6503	SO:0001583	missense	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.8624C>T	2.37:g.179634804G>A	ENSP00000467141:p.Ala2875Val	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922487	0.52653	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	6.06	6.06	0.98353	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87220	0.6123	M	0.92268	3.29	0.46954	D	0.999265	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	D	0.88851	0.3319	9	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	2829;2829;2829;2875;2875	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	V	2875;2829;2829;2829;2829;2875	ENSP00000343764:A2875V;ENSP00000434586:A2829V;ENSP00000340554:A2829V;ENSP00000352154:A2829V;ENSP00000354117:A2875V	ENSP00000340554:A2829V	A	-	2	0	TTN	179343049	1.000000	0.71417	0.972000	0.41901	0.768000	0.43524	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	GCA	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		100.735809	0	-4	117	0	0	1	0	NM_133378	34	100.739161	35	0.492754
FOXM1	2305	broad.mit.edu	hg19	12	2973852	2973852	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:2973852C>T	ENST00000342628.2	-	7	1200	c.1087G>A	c.(1087-1089)Gca>Aca	p.A363T	FOXM1_ENST00000359843.3_Missense_Mutation_p.A363T|FOXM1_ENST00000361953.3_Missense_Mutation_p.A348T	NM_202002.2	NP_973731.1	Q08050	FOXM1_HUMAN	forkhead box M1	363		cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)		TACTAACGTGCGCCCAGGGGG	0.552	0	142.0	125.0	131.0	12	2973852	2203	4300	6503	SO:0001583	missense	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206	"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16	9032290, 9441747	Standard	NM_202002	Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000361953.3:c.1042G>A	12.37:g.2973852C>T	ENSP00000354492:p.Ala348Thr	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	ENST00000361953.3	37	CCDS8517.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.63|13.63	2.294084|2.294084	0.40594|0.40594	.|.	.|.	ENSG00000111206|ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843|ENST00000535350	D;D;D|.	0.93426|.	-3.14;-3.22;-3.15|.	4.73|4.73	2.9|2.9	0.33743|0.33743	.|.	0.421116|.	0.27393|.	N|.	0.019561|.	T|T	0.24431|0.24431	0.0592|0.0592	N|N	0.12182|0.12182	0.205|0.205	0.30685|0.30685	N|N	0.751927|0.751927	B;B;B;B;B|.	0.31077|.	0.056;0.099;0.093;0.099;0.307|.	B;B;B;B;B|.	0.27380|.	0.015;0.019;0.034;0.019;0.079|.	T|T	0.25257|0.25257	-1.0137|-1.0137	10|5	0.42905|.	T|.	0.14|.	.|.	8.0561|8.0561	0.30606|0.30606	0.0:0.8117:0.0:0.1883|0.0:0.8117:0.0:0.1883	.|.	347;363;348;363;363|.	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3|.	.;.;.;FOXM1_HUMAN;.|.	T|H	363;348;363|88	ENSP00000342307:A363T;ENSP00000354492:A348T;ENSP00000352901:A363T|.	ENSP00000342307:A363T|.	A|R	-|-	1|2	0|0	FOXM1|FOXM1	2844113|2844113	0.815000|0.815000	0.29118|0.29118	1.000000|1.000000	0.80357|0.80357	0.605000|0.605000	0.37080|0.37080	0.332000|0.332000	0.19751|0.19751	0.598000|0.598000	0.29829|0.29829	0.462000|0.462000	0.41574|0.41574	GCA|CGC	FOXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398271.1		-7.862464	0	-3	92	0	0	1	0	NM_021953	4	7.657626	70	0.054054
LLGL2	3993	broad.mit.edu	hg19	17	73569290	73569290	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:73569290C>T	ENST00000392550.3	+	20	2773	c.2656C>T	c.(2656-2658)Cgc>Tgc	p.R886C	LLGL2_ENST00000577200.1_Missense_Mutation_p.R886C|LLGL2_ENST00000167462.5_Missense_Mutation_p.R886C	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	886		cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding	NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)		GCCCCAGGTGCGCTACAGCTG	0.652	0	60.0	53.0	55.0	17	73569290	2203	4300	6503	SO:0001583	missense	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350	"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""			Standard	XR_243659	Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2656C>T	17.37:g.73569290C>T	ENSP00000376333:p.Arg886Cys	Q14521|Q9BR62	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741877	0.49151	0.0	1.16E-4	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.05199	3.48;3.59	4.63	4.63	0.57726	.	0.172598	0.51477	D	0.000089	T	0.24122	0.0584	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;P;D;D;P	0.67900	0.954;0.828;0.917;0.921;0.836	T	0.01042	-1.1471	10	0.72032	D	0.01	1.0738	17.7269	0.88367	0.0:1.0:0.0:0.0	.	513;875;875;886;886	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	C	886;886;875	ENSP00000167462:R886C;ENSP00000376333:R886C	ENSP00000167462:R886C	R	+	1	0	LLGL2	71080885	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.604000	0.82830	2.408000	0.81797	0.400000	0.26472	CGC	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1		27.336539	0	-11	79	0	0	1	0	NM_004524	13	32.779405	52	0.200000
RAC2	5880	broad.mit.edu	hg19	22	37628860	37628860	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:37628860G>A	ENST00000249071.6	-	3	327	c.206C>T	c.(205-207)cCg>cTg	p.P69L	RAC2_ENST00000405484.1_Missense_Mutation_p.P62L|RAC2_ENST00000406508.1_Missense_Mutation_p.P25L	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	69		axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding	breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					ATAGGAGAGCGGCCGGAGACG	0.592	0	87.0	61.0	70.0	22	37628860	2203	4300	6503	SO:0001583	missense	M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340	"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049			2674130	Standard	NM_002872	Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000405484.1:c.185C>T	22.37:g.37628860G>A	ENSP00000385590:p.Pro62Leu	Q9UDJ4	ENST00000405484.1	37		.	.	.	.	.	.	.	.	.	.	G	25.3	4.624131	0.87560	.	.	ENSG00000128340	ENST00000249071;ENST00000406508;ENST00000405484;ENST00000441619	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.69	4.69	0.59074	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.87884	0.6290	M	0.93106	3.38	0.80722	D	1	D	0.67145	0.996	D	0.79784	0.993	D	0.91254	0.5031	10	0.87932	D	0	.	17.9764	0.89129	0.0:0.0:1.0:0.0	.	69	P15153	RAC2_HUMAN	L	69;25;62;69	ENSP00000249071:P69L;ENSP00000385270:P25L;ENSP00000385590:P62L;ENSP00000403778:P69L	ENSP00000249071:P69L	P	-	2	0	RAC2	35958806	1.000000	0.71417	0.935000	0.37517	0.847000	0.48162	9.617000	0.98361	2.301000	0.77427	0.462000	0.41574	CCG	RAC2-007	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000318818.1		42.078279	0	12	31	0	0	1	0		13	42.163705	10	0.565217
ALPL	249	broad.mit.edu	hg19	1	21903969	21903969	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:21903969C>T	ENST00000374840.3	+	12	1653	c.1403C>T	c.(1402-1404)gCg>gTg	p.A468V	ALPL_ENST00000425315.2_Missense_Mutation_p.A468V|ALPL_ENST00000540617.1_Missense_Mutation_p.A413V|ALPL_ENST00000374830.1_Missense_Mutation_p.A114V|ALPL_ENST00000539907.1_Missense_Mutation_p.A391V|ALPL_ENST00000374829.1_Missense_Mutation_p.A114V|ALPL_ENST00000374832.1_Missense_Mutation_p.A468V	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	468		response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	GGCCCCATGGCGCACCTGCTG	0.677	0	48.0	45.0	46.0	1	21903969	2203	4297	6500	SO:0001583	missense	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551		438	protein-coding gene	gene with protein product		171760		HOPS	3532105, 3446011	Standard	NM_001127501	Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1403C>T	1.37:g.21903969C>T	ENSP00000363973:p.Ala468Val	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	ENST00000374840.3	37	CCDS217.1	.	.	.	.	.	.	.	.	.	.	c	32	5.190715	0.94923	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315;ENST00000374830;ENST00000374829	D;D;D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13	4.91	4.91	0.64330	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	H	0.97852	4.09	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.992;0.999	D	0.99260	1.0890	10	0.87932	D	0	0.79	15.6427	0.77020	0.0:1.0:0.0:0.0	.	391;416;468	B7Z387;B7Z1D1;P05186	.;.;PPBT_HUMAN	V	391;413;468;468;468;114;114	ENSP00000437674:A391V;ENSP00000442672:A413V;ENSP00000363973:A468V;ENSP00000363965:A468V;ENSP00000394765:A468V;ENSP00000363963:A114V;ENSP00000363962:A114V	ENSP00000363962:A114V	A	+	2	0	ALPL	21776556	1.000000	0.71417	0.956000	0.39512	0.920000	0.55202	7.228000	0.78079	2.565000	0.86533	0.556000	0.70494	GCG	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1		0.766218	0	-16	59	0	0	1	0	NM_000478	4	7.946457	39	0.093023
PCSK7	9159	broad.mit.edu	hg19	11	117089817	117089817	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:117089817C>T	ENST00000320934.3	-	11	2017	c.1387G>A	c.(1387-1389)Ggt>Agt	p.G463S	PCSK7_ENST00000540028.1_Missense_Mutation_p.G104S	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	463	Catalytic.	peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity	NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)	AGGCCGAAACCGTGCTGGTGG	0.597	0	70.0	56.0	60.0	11	117089817	2201	4296	6497	SO:0001583	missense	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613		8748	protein-coding gene	gene with protein product		604872			8615762, 9820811	Standard	XM_006718938	Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1387G>A	11.37:g.117089817C>T	ENSP00000325917:p.Gly463Ser	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	ENST00000320934.3	37	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	C	33	5.221747	0.95139	.	.	ENSG00000160613	ENST00000320934;ENST00000540028;ENST00000543900	D;D	0.97752	-4.52;-4.52	5.2	5.2	0.72013	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.99248	0.9738	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98847	1.0757	10	0.87932	D	0	-17.8281	17.3108	0.87210	0.0:1.0:0.0:0.0	.	463	Q16549	PCSK7_HUMAN	S	463;104;463	ENSP00000325917:G463S;ENSP00000441944:G104S	ENSP00000325917:G463S	G	-	1	0	PCSK7	116595027	1.000000	0.71417	0.473000	0.27253	0.667000	0.39255	7.208000	0.77907	2.442000	0.82660	0.591000	0.81541	GGT	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2		8.086884	0	-4	22	0	0	1	0	NM_004716	4	10.394433	19	0.173913
IGDCC3	9543	broad.mit.edu	hg19	15	65622132	65622132	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:65622132G>A	ENST00000327987.4	-	12	2180	c.1929C>T	c.(1927-1929)atC>atT	p.I643I		NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	643					breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30					TGTGGATGCCGATGACGATGC	0.637	0	126.0	72.0	90.0	15	65622132	2201	4299	6500	SO:0001819	synonymous_variant	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC	9922388	Standard	NM_004884	Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1929C>T	15.37:g.65622132G>A		O95215	ENST00000327987.4	37	CCDS10205.1																																																																																			IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1		28.472851	0	-19	33	0	0	1	0	NM_004884	9	28.566046	12	0.428571
LPCAT1	79888	broad.mit.edu	hg19	5	1501684	1501684	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:1501684C>T	ENST00000283415.3	-	2	302	c.170G>A	c.(169-171)cGg>cAg	p.R57Q		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	57		phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding	breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)	AACCAGGAGCCGGACCGGGAA	0.662	0	42.0	50.0	47.0	5	1501684	2202	4300	6502	SO:0001583	missense	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395	"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2	8619474, 16704971	Standard	NM_024830	Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.170G>A	5.37:g.1501684C>T	ENSP00000283415:p.Arg57Gln	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	ENST00000283415.3	37	CCDS3864.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.426510	0.62733	.	.	ENSG00000153395	ENST00000283415	D	0.81499	-1.5	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.90511	0.7027	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92555	0.6053	10	0.87932	D	0	-29.7716	16.8769	0.86054	0.0:1.0:0.0:0.0	.	57	Q8NF37	PCAT1_HUMAN	Q	57	ENSP00000283415:R57Q	ENSP00000283415:R57Q	R	-	2	0	LPCAT1	1554684	1.000000	0.71417	0.990000	0.47175	0.047000	0.14425	6.984000	0.76186	1.970000	0.57323	0.491000	0.48974	CGG	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1		28.148746	0	9	78	0	0	1	0	NM_024830	10	29.144593	22	0.312500
DHPS	1725	broad.mit.edu	hg19	19	12790677	12790677	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:12790677C>T	ENST00000210060.7	-	3	567	c.432G>A	c.(430-432)gcG>gcA	p.A144A	DHPS_ENST00000599481.1_5'UTR|DHPS_ENST00000351660.5_Silent_p.A144A|DHPS_ENST00000594424.1_Silent_p.A102A	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	144		peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|post-translational protein modification|spermidine catabolic process to deoxyhypusine, using deoxyhypusine synthase|translation	cytosol	deoxyhypusine synthase activity|protein binding	central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8					AGTATGTGGGCGCCAGGCACT	0.597	0	69.0	69.0	69.0	19	12790677	2203	4300	6503	SO:0001819	synonymous_variant	U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059		2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944			7673224	Standard	NM_001930	Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.432G>A	19.37:g.12790677C>T		A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	ENST00000210060.7	37	CCDS12276.1																																																																																			DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462708.1		2.974288	0	-16	44	0	0	1	0	NM_001930	4	8.608022	33	0.108108
APBA2	321	broad.mit.edu	hg19	15	29406154	29406154	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:29406154G>A	ENST00000558402.1	+	15	2712	c.2113G>A	c.(2113-2115)Ggg>Agg	p.G705R	APBA2_ENST00000558259.1_Missense_Mutation_p.G705R|APBA2_ENST00000558330.1_Missense_Mutation_p.G693R|APBA2_ENST00000561069.1_Missense_Mutation_p.G705R|APBA2_ENST00000411764.1_Missense_Mutation_p.G693R			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	705	PDZ 2.	nervous system development|protein transport		protein binding	NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)	CGAGATCAACGGGCAGAGCGT	0.607	0	129.0	96.0	107.0	15	29406154	2203	4300	6503	SO:0001583	missense	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053		579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2	8955346	Standard	NM_005503	Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.2113G>A	15.37:g.29406154G>A	ENSP00000453293:p.Gly705Arg	E9PGI4|O60571|Q5XKC0	ENST00000558402.1	37	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944749	0.92593	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.42513	0.97	4.36	4.36	0.52297	PDZ/DHR/GLGF (4);	0.178298	0.36268	N	0.002691	T	0.72211	0.3432	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.976	T	0.81263	-0.1012	10	0.87932	D	0	.	15.8783	0.79182	0.0:0.0:1.0:0.0	.	693;705	E9PGI4;Q99767	.;APBA2_HUMAN	R	693;705	ENSP00000409312:G693R	ENSP00000219865:G705R	G	+	1	0	APBA2	27193446	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.620000	0.98373	1.959000	0.56917	0.462000	0.41574	GGG	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3		-0.873159	0	18	63	0	0	1	0	NM_005503	3	6.775436	38	0.073171
BBOX1	8424	broad.mit.edu	hg19	11	27148866	27148866	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:27148866C>T	ENST00000263182.3	+	9	1398	c.1030C>T	c.(1030-1032)Cgc>Tgc	p.R344C	RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.R344C|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000529202.1_Missense_Mutation_p.R344C|BBOX1_ENST00000528583.1_Missense_Mutation_p.R344C	NM_003986.2	NP_003977.1	O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	344		carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					TGATAACTGGCGCTTACTTCA	0.403	0	117.0	104.0	109.0	11	27148866	2202	4299	6501	SO:0001583	missense	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151		964	protein-coding gene	gene with protein product		603312		BBOX	9753662	Standard	XM_005253159	Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.1030C>T	11.37:g.27148866C>T	ENSP00000435781:p.Arg344Cys	B2R8L7|D3DQZ1|Q6IBJ2	ENST00000529202.1	37	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887968	0.91814	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.94282	0.8163	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94861	0.8022	10	0.87932	D	0	.	18.7825	0.91939	0.0:1.0:0.0:0.0	.	344	O75936	BODG_HUMAN	C	344	ENSP00000435781:R344C;ENSP00000263182:R344C;ENSP00000434918:R344C;ENSP00000433772:R344C	ENSP00000263182:R344C	R	+	1	0	BBOX1	27105442	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.835000	0.75344	2.780000	0.95670	0.655000	0.94253	CGC	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1		33.718054	0	10	82	0	0	1	0	NM_003986	14	37.441138	45	0.237288
ZFP1	162239	broad.mit.edu	hg19	16	75203964	75203964	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:75203964C>T	ENST00000393430.2	+	4	1080	c.956C>T	c.(955-957)aCg>aTg	p.T319M	ZFP1_ENST00000568079.1_3'UTR|ZFP1_ENST00000570010.1_Missense_Mutation_p.T319M|ZFP1_ENST00000464850.1_3'UTR|ZFP1_ENST00000332307.4_Missense_Mutation_p.T286M			Q6P2D0	ZFP1_HUMAN	ZFP1 zinc finger protein	319		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	12					AAGATTCACACGGGGGAGAAA	0.418	0	75.0	75.0	75.0	16	75203964	2198	4300	6498	SO:0001583	missense	AK094761	CCDS10914.2	16q22.3	2013-01-08	2012-11-27		ENSG00000184517	ENSG00000184517	"""Zinc fingers, C2H2-type"", ""-"""	23328	protein-coding gene	gene with protein product			"""zinc finger protein 1 homolog (mouse)"", ""zinc finger protein 1"""		2574853	Standard	NM_153688	Approved	FLJ34243, ZNF475	uc002fdo.3	Q6P2D0	OTTHUMG00000137602	ENST00000393430.2:c.956C>T	16.37:g.75203964C>T	ENSP00000377080:p.Thr319Met	A8K5Q7|B4DKG9|Q8N188|Q8N9F9	ENST00000393430.2	37	CCDS10914.2	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077911	0.55753	.	.	ENSG00000184517	ENST00000332307;ENST00000393430	T	0.26373	1.74	4.42	4.42	0.53409	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000134	T	0.53786	0.1818	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.59979	-0.7352	10	0.87932	D	0	-18.9255	15.3445	0.74324	0.0:1.0:0.0:0.0	.	319	Q6P2D0	ZFP1_HUMAN	M	319	ENSP00000377080:T319M	ENSP00000333192:T319M	T	+	2	0	ZFP1	73761465	0.930000	0.31532	0.970000	0.41538	0.666000	0.39218	2.042000	0.41222	2.744000	0.94065	0.655000	0.94253	ACG	ZFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269013.2		60.085598	0	-10	60	0	0	1	0	NM_153688	20	60.985206	35	0.363636
SCN2A	6326	broad.mit.edu	hg19	2	166210904	166210904	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:166210904C>T	ENST00000375437.2	+	17	3412	c.3122C>T	c.(3121-3123)cCg>cTg	p.P1041L	SCN2A_ENST00000375427.2_Missense_Mutation_p.P1041L|SCN2A_ENST00000283256.6_Missense_Mutation_p.P1041L|SCN2A_ENST00000357398.3_Missense_Mutation_p.P1041L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1041		myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					GAAATTAAACCGCTTGAAGAT	0.338	0	66.0	72.0	70.0	2	166210904	2202	4300	6502	SO:0001583	missense	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531	"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2	1317301, 16382098	Standard	XM_005246753	Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3122C>T	2.37:g.166210904C>T	ENSP00000364586:p.Pro1041Leu	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602897	0.46423	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.5	5.5	0.81552	Sodium ion transport-associated (1);	1.448160	0.04529	N	0.386002	D	0.83811	0.5335	M	0.63428	1.95	0.58432	D	0.999999	B;P	0.34826	0.008;0.471	B;B	0.32624	0.006;0.149	T	0.70995	-0.4720	10	0.56958	D	0.05	.	14.2513	0.66021	0.1491:0.8509:0.0:0.0	.	1041;1041	Q99250-2;Q99250	.;SCN2A_HUMAN	L	1041	ENSP00000364586:P1041L;ENSP00000349973:P1041L;ENSP00000283256:P1041L;ENSP00000364576:P1041L	ENSP00000283256:P1041L	P	+	2	0	SCN2A	165919150	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.659000	0.61504	2.563000	0.86464	0.591000	0.81541	CCG	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2		14.398858	0	6	64	0	0	1	0	NM_021007	7	18.822936	35	0.166667
GPA33	10223	broad.mit.edu	hg19	1	167024307	167024307	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:167024307C>T	ENST00000367868.3	-	6	1076	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	GPA33_ENST00000527955.1_5'UTR|RP11-102C16.3_ENST00000417644.1_RNA	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	245			integral to plasma membrane	receptor activity	endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15					GCTGCAACCACGCCCACCGCG	0.577	0	123.0	95.0	105.0	1	167024307	2203	4300	6503	SO:0001583	missense	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171			9012807, 9245713	Standard	NM_005814	Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.733G>A	1.37:g.167024307C>T	ENSP00000356842:p.Val245Met	Q5VZP6	ENST00000367868.3	37	CCDS1258.1	.	.	.	.	.	.	.	.	.	.	C	8.157	0.788591	0.16258	.	.	ENSG00000143167	ENST00000367868	T	0.39056	1.1	4.76	1.63	0.23807	.	0.559233	0.17383	N	0.176258	T	0.18002	0.0432	M	0.81497	2.545	0.09310	N	1	P	0.38711	0.643	B	0.23150	0.044	T	0.08146	-1.0736	10	0.54805	T	0.06	.	6.5687	0.22527	0.0:0.5217:0.3778:0.1005	.	245	Q99795	GPA33_HUMAN	M	245	ENSP00000356842:V245M	ENSP00000356842:V245M	V	-	1	0	GPA33	165290931	0.000000	0.05858	0.005000	0.12908	0.342000	0.28953	0.144000	0.16135	0.425000	0.26087	-0.234000	0.12200	GTG	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1		16.240921	0	6	52	0	0	1	0	NM_005814	6	17.264748	16	0.272727
LRP2	4036	broad.mit.edu	hg19	2	170012798	170012798	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:170012798C>T	ENST00000263816.3	-	65	12422	c.12137G>A	c.(12136-12138)cGa>cAa	p.R4046Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4046	EGF-like 15; calcium-binding (Potential).	hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	AGCTGCACATCGTTTTCCAGG	0.438	0	166.0	155.0	159.0	2	170012798	2203	4300	6503	SO:0001583	missense		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479	"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073			7959795	Standard	NM_004525	Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12137G>A	2.37:g.170012798C>T	ENSP00000263816:p.Arg4046Gln	O00711|Q16215	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	8.986	0.976503	0.18736	.	.	ENSG00000081479	ENST00000263816	D	0.89196	-2.48	5.77	3.61	0.41365	Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.168923	0.52532	N	0.000062	T	0.73313	0.3571	N	0.14661	0.345	0.80722	D	1	B	0.26041	0.14	B	0.20384	0.029	T	0.64228	-0.6457	10	0.13470	T	0.59	.	4.4745	0.11729	0.0:0.5775:0.0:0.4225	.	4046	P98164	LRP2_HUMAN	Q	4046	ENSP00000263816:R4046Q	ENSP00000263816:R4046Q	R	-	2	0	LRP2	169721044	0.989000	0.36119	0.832000	0.32986	0.321000	0.28281	2.561000	0.45905	1.571000	0.49722	0.655000	0.94253	CGA	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		6.050122	0	-5	98	0	0	1	0	NM_004525	7	15.065544	54	0.114754
RADIL	55698	broad.mit.edu	hg19	7	4917502	4917502	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:4917502C>T	ENST00000399583.3	-	2	456	c.269G>A	c.(268-270)cGt>cAt	p.R90H	RADIL_ENST00000536091.1_Missense_Mutation_p.R90H	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	90	Ras-associating.	cell adhesion|multicellular organismal development|signal transduction		protein binding	NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	CACCAGCTCACGGGCGCTGGA	0.677	0	22.0	27.0	26.0	7	4917502	2003	4126	6129	SO:0001583	missense	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927		22226	protein-coding gene	gene with protein product		611491			16051602, 17704304	Standard	NM_018059	Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.269G>A	7.37:g.4917502C>T	ENSP00000382492:p.Arg90His	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071178	0.36566	2.5E-4	0.0	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	T;T;T	0.18960	2.18;2.18;2.18	5.83	-4.73	0.03259	Ras-association (3);	0.676927	0.14831	N	0.295865	T	0.12475	0.0303	L	0.35854	1.095	0.20196	N	0.999926	B	0.26775	0.159	B	0.15870	0.014	T	0.12967	-1.0527	10	0.45353	T	0.12	-12.2738	9.556	0.39339	0.0872:0.2855:0.0:0.6273	.	90	Q96JH8	RADIL_HUMAN	H	90;64;90;90	ENSP00000382492:R90H;ENSP00000442533:R90H;ENSP00000398057:R90H	ENSP00000320946:R64H	R	-	2	0	RADIL	4884028	0.042000	0.20092	0.777000	0.31699	0.586000	0.36452	-0.269000	0.08596	-0.651000	0.05415	-0.378000	0.06908	CGT	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2		34.591729	0	3	42	0	0	1	0	NM_018059	12	34.716906	16	0.428571
MYO3B	140469	broad.mit.edu	hg19	2	171371513	171371513	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:171371513C>T	ENST00000334231.6	+	29	3480	c.3480C>T	c.(3478-3480)agC>agT	p.S1160S	MYO3B_ENST00000409044.3_Silent_p.S1124S|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000408978.4_Silent_p.S1151S			Q8WXR4	MYO3B_HUMAN	myosin IIIB	1151		response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity	breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59					AAGACTGCAGCGAGCCTGGTG	0.507	0	79.0	80.0	80.0	2	171371513	1930	4135	6065	SO:0001819	synonymous_variant		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909	"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040				Standard	NM_001083615	Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3453C>T	2.37:g.171371513C>T		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	ENST00000408978.4	37	CCDS42773.1																																																																																			MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		10.157354	0	2	29	0	0	1	0		5	13.097255	24	0.172414
HRASLS5	117245	broad.mit.edu	hg19	11	63257788	63257788	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:63257788C>T	ENST00000540857.1	-	2	298	c.166G>A	c.(166-168)Gca>Aca	p.A56T	HRASLS5_ENST00000301790.4_Missense_Mutation_p.A66T|HRASLS5_ENST00000539221.1_Missense_Mutation_p.A66T	NM_001146728.1|NM_001146729.1|NM_054108.3	NP_001140200.1|NP_001140201|NP_473449.1	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	66					endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14					ACCAACGCTGCGAATCCCACG	0.537	1	167.0	184.0	178.0	11	63257788	2201	4298	6499	SO:0001583	missense	AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004		24978	protein-coding gene	gene with protein product		611474				Standard	NM_001146729	Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000539221.1:c.196G>A	11.37:g.63257788C>T	ENSP00000443873:p.Ala66Thr	B7X6T1|F5GZ87|F5H4Y9	ENST00000539221.1	37	CCDS53647.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827867	0.32329	.	.	ENSG00000168004	ENST00000540857;ENST00000539221;ENST00000301790	T;T;T	0.28454	1.61;2.11;1.62	3.89	1.98	0.26296	.	3.704160	0.00868	N	0.001990	T	0.23727	0.0574	N	0.24115	0.695	0.09310	N	1	B;B;B	0.33904	0.431;0.431;0.305	B;B;B	0.26770	0.073;0.037;0.033	T	0.34254	-0.9836	10	0.56958	D	0.05	-9.0494	10.3308	0.43820	0.0:0.4139:0.5861:0.0	.	66;56;66	F5GZ87;F5H4Y9;Q96KN8	.;.;HRSL5_HUMAN	T	56;66;66	ENSP00000444809:A56T;ENSP00000443873:A66T;ENSP00000301790:A66T	ENSP00000301790:A66T	A	-	1	0	HRASLS5	63014364	0.002000	0.14202	0.004000	0.12327	0.023000	0.10783	0.629000	0.24538	0.598000	0.29829	-0.165000	0.13383	GCA	HRASLS5-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000396374.1		89.726544	0	-48	216	0	0	1	0	NM_054108	39	103.065165	141	0.216667
ANKRD2	26287	broad.mit.edu	hg19	10	99343422	99343422	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:99343422C>T	ENST00000307518.5	+	9	1290	c.1023C>T	c.(1021-1023)aaC>aaT	p.N341N	ANKRD2_ENST00000298808.5_Silent_p.N308N|ANKRD2_ENST00000370655.1_Silent_p.N314N|ANKRD2_ENST00000455090.1_Silent_p.N281N			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	341		muscle contraction|muscle organ development		structural constituent of muscle	breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)	CTGAGCATAACGGGCTGGAGG	0.677	0	25.0	22.0	23.0	10	99343422	2196	4299	6495	SO:0001819	synonymous_variant	AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887	"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734			10873377, 15136035, 15677738	Standard	NM_001129981	Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000370655.1:c.942C>T	10.37:g.99343422C>T		Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	ENST00000370655.1	37																																																																																				ANKRD2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049728.1		7.318175	0	-7	11	0	0	1	0		3	8.181745	10	0.230769
GNAQ	2776	broad.mit.edu	hg19	9	80412493	80412493	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:80412493C>T	ENST00000286548.4	-	4	770	c.548G>A	c.(547-549)cGa>cAa	p.R183Q	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	183		activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302					GGTGGGGACTCGAACTCTAAG	0.468	9	154.0	118.0	130.0	9	80412493	2203	4300	6503	SO:0001583	missense		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052		4390	protein-coding gene	gene with protein product		600998			8825633	Standard	NM_002072	Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.548G>A	9.37:g.80412493C>T	ENSP00000286548:p.Arg183Gln	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	C	37	6.263420	0.97421	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.91740	-2.9;-2.9	5.88	5.88	0.94601	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	H	0.96547	3.84	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	D	0.98057	1.0391	10	0.87932	D	0	.	20.2279	0.98344	0.0:1.0:0.0:0.0	.	183	P50148	GNAQ_HUMAN	Q	183;154	ENSP00000286548:R183Q;ENSP00000391501:R154Q	ENSP00000286548:R183Q	R	-	2	0	GNAQ	79602313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.048000	0.71046	2.778000	0.95560	0.655000	0.94253	CGA	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1		-2.042747	0	9	66	0	0	1	0	NM_002072	4	8.554581	52	0.071429
ERCC6L	54821	broad.mit.edu	hg19	X	71427099	71427099	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:71427099G>A	ENST00000373657.1	-	3	1751	c.1149C>T	c.(1147-1149)atC>atT	p.I383I	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000334463.3_Silent_p.I506I			Q2NKX8	ERC6L_HUMAN	excision repair cross-complementing rodent repair deficiency, complementation group 6-like	506		cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)				CTGTCCCATCGATTCGCAATG	0.373	0	109.0	100.0	103.0	X	71427099	2203	4300	6503	SO:0001819	synonymous_variant	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871		20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""		17218258	Standard	NM_017669	Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000373657.1:c.1149C>T	X.37:g.71427099G>A		Q8NCI1|Q96H93|Q9NXQ8	ENST00000373657.1	37																																																																																				ERCC6L-001	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000057173.1		52.258273	0	-2	140	0	0	1	0	NM_017669	20	56.631957	59	0.253165
TECTA	7007	broad.mit.edu	hg19	11	121000772	121000772	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:121000772C>T	ENST00000392793.1	+	10	3064	c.2793C>T	c.(2791-2793)aaC>aaT	p.N931N	TECTA_ENST00000264037.2_Silent_p.N931N			O75443	TECTA_HUMAN	tectorin alpha	931		cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	GGGTGGTGAACGTCACTGCCT	0.587	0	72.0	69.0	70.0	11	121000772	2203	4299	6502	SO:0001819	synonymous_variant	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927		11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21	9503015, 9590290	Standard	NM_005422	Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2793C>T	11.37:g.121000772C>T			ENST00000392793.1	37	CCDS8434.1																																																																																			TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1		28.019489	0	7	89	0	0	1	0	NM_005422	11	30.165176	31	0.261905
CASC3	22794	broad.mit.edu	hg19	17	38320407	38320407	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:38320407C>T	ENST00000264645.7	+	7	1685	c.1459C>T	c.(1459-1461)Cgg>Tgg	p.R487W		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	487	Necessary for localization in cytoplasmic stress granules.	mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding	endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16					CCTGCAACCACGGGAACTTCG	0.493	0	32.0	30.0	31.0	17	38320407	2203	4300	6503	SO:0001583	missense	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349		17040	protein-coding gene	gene with protein product		606504			7490069, 18332872	Standard	NM_007359	Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1459C>T	17.37:g.38320407C>T	ENSP00000264645:p.Arg487Trp	A8K8R0	ENST00000264645.7	37	CCDS11362.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320969	0.23994	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.08	4.06	0.47325	.	0.094683	0.46758	D	0.000274	T	0.60689	0.2288	N	0.14661	0.345	0.44946	D	0.997969	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.67964	-0.5534	9	0.87932	D	0	-14.6551	15.8446	0.78876	0.1447:0.8553:0.0:0.0	.	487;487	B4DKR6;O15234	.;CASC3_HUMAN	W	487	.	ENSP00000264645:R487W	R	+	1	2	CASC3	35573933	0.998000	0.40836	0.983000	0.44433	0.930000	0.56654	3.419000	0.52728	2.648000	0.89879	0.563000	0.77884	CGG	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3		12.398752	0	11	28	0	0	1	0	NM_007359	4	12.485969	6	0.400000
HTR2B	3357	broad.mit.edu	hg19	2	231973446	231973446	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:231973446G>A	ENST00000258400.3	-	4	1743	c.1231C>T	c.(1231-1233)Cgc>Tgc	p.R411C	PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000308696.6_Intron|PSMD1_ENST00000373635.4_Intron|PSMD1_ENST00000488354.1_3'UTR	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	411		activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cardiac muscle hypertrophy|cellular response to calcium ion|cellular response to temperature stimulus|cGMP biosynthetic process|embryonic morphogenesis|ERK1 and ERK2 cascade|G-protein coupled receptor internalization|heart morphogenesis|intestine smooth muscle contraction|negative regulation of apoptosis|negative regulation of autophagy|neural crest cell migration|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|phosphorylation|positive regulation of cell division|positive regulation of cytokine production|positive regulation of cytokine secretion|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAP kinase activity|positive regulation of nitric-oxide synthase activity|protein kinase C signaling cascade|regulation of behavior|release of sequestered calcium ion into cytosol|response to drug|vasoconstriction	cytoplasm|integral to membrane|plasma membrane	calcium channel activity|drug binding|G-protein alpha-subunit binding|phosphatidylinositol phospholipase C activity|Ras GTPase activator activity|serotonin binding|serotonin receptor activity	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	TTACTGGAGCGTTTTCTGAGA	0.428	0	135.0	133.0	133.0	2	231973446	2203	4300	6503	SO:0001583	missense		CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914	"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""		8143856	Standard	NM_000867	Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.1231C>T	2.37:g.231973446G>A	ENSP00000258400:p.Arg411Cys	B2R9D5|Q53TI1|Q62221|Q6P523	ENST00000258400.3	37	CCDS2483.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	2.320	-0.355782	0.05138	.	.	ENSG00000135914	ENST00000258400	T	0.62498	0.02	5.9	0.692	0.18050	.	0.474985	0.25321	N	0.031519	T	0.20536	0.0494	N	0.00197	-1.87	0.34176	D	0.670379	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10520	-1.0626	10	0.36615	T	0.2	.	6.7167	0.23308	0.6341:0.1135:0.2524:0.0	.	226;411	B3VRC5;P41595	.;5HT2B_HUMAN	C	411	ENSP00000258400:R411C	ENSP00000258400:R411C	R	-	1	0	HTR2B	231681690	0.305000	0.24481	0.083000	0.20561	0.019000	0.09904	1.592000	0.36676	-0.100000	0.12241	-0.781000	0.03364	CGC	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256957.2		52.538002	0	-29	74	0	0	1	0	NM_000867	18	53.295677	31	0.367347
APOA4	337	broad.mit.edu	hg19	11	116691776	116691776	+	Missense_Mutation	SNP	G	G	A	rs113263292		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:116691776G>A	ENST00000357780.3	-	3	1112	c.998C>T	c.(997-999)gCg>gTg	p.A333V		NM_000482.3	NP_000473.2			apolipoprotein A-IV						cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)	CACGTCCCCCGCATGGGGGCC	0.587	0	70.0	66.0	67.0	11	116691776	2201	4292	6493	SO:0001583	missense		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244	"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690				Standard	NM_000482	Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.998C>T	11.37:g.116691776G>A	ENSP00000350425:p.Ala333Val	A8MSL6|Q14CW8|Q6Q787	ENST00000357780.3	37	CCDS31681.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893194	0.72524	.	.	ENSG00000110244	ENST00000357780	T	0.77620	-1.11	5.39	5.39	0.77823	Apolipoprotein/apolipophorin (1);	0.922519	0.09103	N	0.848216	D	0.86822	0.6025	M	0.87180	2.865	0.20196	N	0.999928	D	0.55385	0.971	P	0.49192	0.602	T	0.80358	-0.1416	10	0.62326	D	0.03	-17.4676	18.7213	0.91694	0.0:0.0:1.0:0.0	.	333	P06727	APOA4_HUMAN	V	333	ENSP00000350425:A333V	ENSP00000350425:A333V	A	-	2	0	APOA4	116196986	0.066000	0.20996	0.812000	0.32479	0.461000	0.32589	2.435000	0.44811	2.522000	0.85027	0.557000	0.71058	GCG	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2		28.405043	0	-46	75	0	0	1	0	NM_000482	11	30.560016	31	0.261905
GLTSCR1	29998	broad.mit.edu	hg19	19	48204593	48204593	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:48204593G>A	ENST00000396720.3	+	15	3798	c.3604G>A	c.(3604-3606)Gtg>Atg	p.V1202M	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1202				protein binding	breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)	AGACGAGTACGTGTCTTCCTC	0.662	0	17.0	21.0	20.0	19	48204593	2019	4142	6161	SO:0001583	missense	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169		4332	protein-coding gene	gene with protein product		605690			10708517	Standard	NM_015711	Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3604G>A	19.37:g.48204593G>A	ENSP00000379946:p.Val1202Met	A8MW01	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	9.263	1.043815	0.19748	.	.	ENSG00000063169	ENST00000396720	T	0.35789	1.29	3.58	3.58	0.41010	.	.	.	.	.	T	0.49695	0.1572	L	0.36672	1.1	0.32700	N	0.513025	D	0.89917	1.0	D	0.87578	0.998	T	0.61347	-0.7081	9	0.72032	D	0.01	.	14.1173	0.65161	0.0:0.0:1.0:0.0	.	1202	Q9NZM4	GSCR1_HUMAN	M	1202	ENSP00000379946:V1202M	ENSP00000379946:V1202M	V	+	1	0	GLTSCR1	52896405	1.000000	0.71417	0.988000	0.46212	0.059000	0.15707	3.698000	0.54771	1.834000	0.53371	0.462000	0.41574	GTG	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1		11.198627	0	3	24	0	0	1	0	NM_015711	4	11.198627	4	0.500000
TMEM45B	120224	broad.mit.edu	hg19	11	129722455	129722455	+	Silent	SNP	G	G	A	rs145339290	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:129722455G>A	ENST00000281441.3	+	2	166	c.78G>A	c.(76-78)ccG>ccA	p.P26P	TMEM45B_ENST00000524567.1_Silent_p.P26P	NM_138788.3	NP_620143.1	Q96B21	TM45B_HUMAN	transmembrane protein 45B	26			integral to membrane		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)	TGAAGTACCCGCTGAAGTACT	0.498	0	143.0	128.0	133.0	11	129722455	2201	4297	6498	SO:0001819	synonymous_variant	AK098106	CCDS8482.1	11q24.3	2008-02-05				ENSG00000151715		25194	protein-coding gene	gene with protein product					12477932	Standard	NM_138788	Approved	BC016153, FLJ40787	uc001qfe.1	Q96B21		ENST00000524567.1:c.78G>A	11.37:g.129722455G>A		A8K2L8	ENST00000524567.1	37	CCDS8482.1																																																																																			TMEM45B-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386062.1		121.544170	0	-4	114	0	0	1	0	NM_138788	41	122.736521	65	0.386792
ARHGEF17	9828	broad.mit.edu	hg19	11	73021350	73021350	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:73021350G>A	ENST00000263674.3	+	1	2017	c.1667G>A	c.(1666-1668)cGc>cAc	p.R556H		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	556		actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32					CCCATGGCCCGCCGCCTGCCC	0.657	0	40.0	44.0	42.0	11	73021350	2200	4292	6492	SO:0001583	missense	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237	"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""				11559528, 12071859	Standard	NM_014786	Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1667G>A	11.37:g.73021350G>A	ENSP00000263674:p.Arg556His	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781588	0.31502	2.27E-4	0.0	ENSG00000110237	ENST00000263674	T	0.60920	0.15	4.62	3.71	0.42584	.	0.239416	0.34268	N	0.004104	T	0.41627	0.1167	L	0.27053	0.805	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.39820	-0.9595	10	0.87932	D	0	-4.1359	8.1662	0.31228	0.1846:0.0:0.8154:0.0	.	556	Q96PE2	ARHGH_HUMAN	H	556	ENSP00000263674:R556H	ENSP00000263674:R556H	R	+	2	0	ARHGEF17	72698998	0.834000	0.29399	0.677000	0.29947	0.446000	0.32137	4.087000	0.57671	1.159000	0.42565	-0.258000	0.10820	CGC	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1		7.785671	0	0	50	0	0	1	0	NM_014786	4	10.094310	19	0.173913
FOXP2	93986	broad.mit.edu	hg19	7	114304409	114304409	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:114304409G>A	ENST00000408937.3	+	17	2370	c.1996G>A	c.(1996-1998)Gtc>Atc	p.V666I	FOXP2_ENST00000350908.4_Missense_Mutation_p.V641I|FOXP2_ENST00000393489.3_Missense_Mutation_p.V549I|FOXP2_ENST00000403559.4_Missense_Mutation_p.V658I|FOXP2_ENST00000393491.3_Missense_Mutation_p.V456I|FOXP2_ENST00000393498.2_Missense_Mutation_p.V620I|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000393494.2_Missense_Mutation_p.V641I	NM_001172766.2|NM_014491.3|NM_148898.3	NP_001166237.1|NP_055306.1|NP_683696.2	O15409	FOXP2_HUMAN	forkhead box P2	641		camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52					ACTGCAGGCCGTCCACGAAGA	0.483	0	91.0	82.0	85.0	7	114304409	2203	4300	6503	SO:0001583	missense	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573	"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1	11586359, 9225980	Standard	NM_014491	Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1921G>A	7.37:g.114304409G>A	ENSP00000377132:p.Val641Ile	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	7.019	0.558337	0.13436	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.91180	-2.52;-2.53;-2.53;-2.52;-2.59;-2.8	5.57	5.57	0.84162	.	0.180845	0.48286	D	0.000188	T	0.77844	0.4191	N	0.01874	-0.695	0.80722	D	1	B;B;B;B;B	0.25235	0.001;0.002;0.121;0.001;0.004	B;B;B;B;B	0.22152	0.001;0.001;0.038;0.001;0.002	T	0.74990	-0.3475	10	0.11794	T	0.64	.	19.5416	0.95277	0.0:0.0:1.0:0.0	.	640;658;456;641;666	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	I	641;666;658;641;618;549;456	ENSP00000377132:V641I;ENSP00000386200:V666I;ENSP00000385069:V658I;ENSP00000265436:V641I;ENSP00000377129:V549I;ENSP00000377130:V456I	ENSP00000265436:V641I	V	+	1	0	FOXP2	114091645	1.000000	0.71417	0.960000	0.40013	0.950000	0.60333	3.026000	0.49689	2.614000	0.88457	0.655000	0.94253	GTC	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1		62.997483	0	-15	45	0	0	1	0	NM_014491	20	63.018194	22	0.476190
PI4K2A	55361	broad.mit.edu	hg19	10	99416154	99416154	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:99416154G>A	ENST00000370631.3	+	3	806	c.749G>A	c.(748-750)cGc>cAc	p.R250H	PI4K2A_ENST00000555577.1_Missense_Mutation_p.R220H|PI4K2A_ENST00000370649.3_Missense_Mutation_p.R220H	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	250	PI3K/PI4K.	phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding	endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)	CGGTTTAACCGCATCGGGCTA	0.498	0	74.0	69.0	71.0	10	99416154	2203	4300	6503	SO:0001583	missense	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252		30031	protein-coding gene	gene with protein product		609763			11244087, 11279162	Standard	NM_018425	Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.749G>A	10.37:g.99416154G>A	ENSP00000359665:p.Arg250His	D3DR59|Q9NSG8	ENST00000370631.3	37	CCDS7469.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751536	0.69533	.	.	ENSG00000155252;ENSG00000155252;ENSG00000249967	ENST00000555577;ENST00000370631;ENST00000370649	T;T;T	0.77229	-1.08;-1.08;-1.08	4.39	4.39	0.52855	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	M	0.88031	2.925	0.80722	D	1	D;P	0.89917	1.0;0.909	D;P	0.79784	0.993;0.48	D	0.91320	0.5081	10	0.56958	D	0.05	-11.2823	17.5611	0.87908	0.0:0.0:1.0:0.0	.	220;250	E9PAM4;Q9BTU6	.;P4K2A_HUMAN	H	220;250;220	ENSP00000452243:R220H;ENSP00000359665:R250H;ENSP00000359683:R220H	ENSP00000359665:R250H	R	+	2	0	PI4K2A;RP11-548K23.11	99406144	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	9.601000	0.98297	2.437000	0.82529	0.650000	0.86243	CGC	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1		22.857722	0	5	62	0	0	1	0	NM_018425	9	24.902944	27	0.250000
DSCAML1	57453	broad.mit.edu	hg19	11	117301699	117301699	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:117301699C>T	ENST00000321322.6	-	32	5606	c.5605G>A	c.(5605-5607)Gag>Aag	p.E1869K	DSCAML1_ENST00000527706.1_Missense_Mutation_p.E1599K	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1809		axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	GCCAGCTCCTCGTAGGTGGAA	0.562	0	140.0	129.0	133.0	11	117301699	2201	4296	6497	SO:0001583	missense		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782			11453658	Standard	NM_020693	Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5605G>A	11.37:g.117301699C>T	ENSP00000315465:p.Glu1869Lys	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	34	5.401603	0.96030	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.70282	-0.42;-0.47	5.04	5.04	0.67666	.	.	.	.	.	T	0.77212	0.4097	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80317	-0.1433	9	0.87932	D	0	.	18.5658	0.91116	0.0:1.0:0.0:0.0	.	1809	Q8TD84	DSCL1_HUMAN	K	1599;1869;1576	ENSP00000434335:E1599K;ENSP00000315465:E1869K	ENSP00000315465:E1869K	E	-	1	0	DSCAML1	116806909	1.000000	0.71417	0.990000	0.47175	0.954000	0.61252	7.651000	0.83577	2.628000	0.89032	0.591000	0.81541	GAG	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2		122.856198	0	-29	104	0	0	1	0	NM_020693	38	123.347053	26	0.593750
KRI1	65095	broad.mit.edu	hg19	19	10671902	10671902	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:10671902G>A	ENST00000312962.6	-	7	565	c.546C>T	c.(544-546)ggC>ggT	p.G182G	KRI1_ENST00000361821.5_Silent_p.G178G|KRI1_ENST00000537964.1_5'UTR	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	182	Glu-rich.				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		CCTCCCCAGCGCCGTCCTCGT	0.642	0	75.0	74.0	74.0	19	10671902	2203	4300	6503	SO:0001819	synonymous_variant		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347		25769	protein-coding gene	gene with protein product					12878157	Standard	NM_023008	Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.546C>T	19.37:g.10671902G>A		Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	ENST00000312962.6	37	CCDS12242.1	.	.	.	.	.	.	.	.	.	.	G	2.682	-0.275109	0.05679	.	.	ENSG00000129347	ENST00000543682	.	.	.	4.23	-8.47	0.00939	.	.	.	.	.	T	0.44953	0.1318	.	.	.	0.38895	D	0.957201	.	.	.	.	.	.	T	0.53322	-0.8455	4	.	.	.	-2.9809	6.5943	0.22664	0.2534:0.0837:0.5271:0.1357	.	.	.	.	V	120	.	.	A	-	2	0	KRI1	10532902	0.000000	0.05858	0.002000	0.10522	0.397000	0.30659	-2.795000	0.00764	-3.223000	0.00211	-0.369000	0.07265	GCG	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1		-0.405859	0	-24	64	0	0	1	0	NM_023008	3	7.005850	37	0.075000
NEB	4703	broad.mit.edu	hg19	2	152348986	152348986	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:152348986C>T	ENST00000427231.2	-	177	24990	c.24788G>A	c.(24787-24789)cGg>cAg	p.R8263Q	NEB_ENST00000509223.2_Missense_Mutation_p.R176Q|NEB_ENST00000397336.2_Missense_Mutation_p.R238Q|NEB_ENST00000498015.2_5'UTR|NEB_ENST00000172853.10_Missense_Mutation_p.R6407Q|RIF1_ENST00000457745.1_Intron|NEB_ENST00000603639.1_Missense_Mutation_p.R8263Q|NEB_ENST00000409198.1_Missense_Mutation_p.R6407Q|NEB_ENST00000397345.3_Missense_Mutation_p.R8263Q|NEB_ENST00000604864.1_Missense_Mutation_p.R8263Q	NM_001164507.1|NM_001271208.1	NP_001157979|NP_001258137.1	P20929	NEBU_HUMAN	nebulin	6573		muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)	TATTTGTTTCCGGAAACTATC	0.483	0	84.0	87.0	86.0	2	152348986	1878	4113	5991	SO:0001583	missense	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091		7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2	10051637, 9359044	Standard	NM_001164507	Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000604864.1:c.24788G>A	2.37:g.152348986C>T	ENSP00000474498:p.Arg8263Gln	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	ENST00000604864.1	37	CCDS54408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.423854|5.423854	0.96111|0.96111	.|.	.|.	ENSG00000183091|ENSG00000183091	ENST00000397337;ENST00000434685|ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853;ENST00000397336;ENST00000509223	.|T;T;T;T;T;T;T	.|0.46063	.|0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.176577	.|0.50627	.|D	.|0.000120	T|T	0.59418|0.59418	0.2192|0.2192	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	.|D;D;P;D;P;D	.|0.76494	.|0.999;0.996;0.9;0.999;0.95;0.995	.|D;D;B;D;B;D	.|0.80764	.|0.994;0.939;0.362;0.948;0.316;0.935	T|T	0.52931|0.52931	-0.8509|-0.8509	5|10	.|0.35671	.|T	.|0.21	.|.	19.2633|19.2633	0.93977|0.93977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|176;238;176;6407;2745;8263	.|B7Z6B9;B7Z6P9;B7Z6N8;P20929;Q14215;F8WCL5	.|.;.;.;NEBU_HUMAN;.;.	R|Q	397;504|6407;8263;8263;2363;2745;6407;238;176	.|ENSP00000386259:R6407Q;ENSP00000380505:R8263Q;ENSP00000416578:R8263Q;ENSP00000410961:R2745Q;ENSP00000172853:R6407Q;ENSP00000380497:R238Q;ENSP00000427083:R176Q	.|ENSP00000172853:R6407Q	G|R	-|-	1|2	0|0	NEB|NEB	152057232|152057232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.651000|7.651000	0.83577|0.83577	2.639000|2.639000	0.89480|0.89480	0.655000|0.655000	0.94253|0.94253	GGA|CGG	NEB-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469063.1		33.925825	0	-33	75	0	0	1	0	NM_004543	14	38.777040	51	0.215385
PTPRU	10076	broad.mit.edu	hg19	1	29638168	29638168	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:29638168G>A	ENST00000356870.3	+	22	3097	c.2987G>A	c.(2986-2988)cGg>cAg	p.R996Q	PTPRU_ENST00000428026.2_Missense_Mutation_p.R987Q|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000323874.8_Missense_Mutation_p.R996Q|PTPRU_ENST00000373779.3_Missense_Mutation_p.R990Q|PTPRU_ENST00000345512.3_Missense_Mutation_p.R1000Q|PTPRU_ENST00000460170.2_Missense_Mutation_p.R996Q	NM_133177.3	NP_573438.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1000	Tyrosine-protein phosphatase 1.	canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity	breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	AAATGCTCACGGTACTGGCCG	0.617	0	95.0	88.0	90.0	1	29638168	2203	4300	6503	SO:0001583	missense	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454			8700514, 9434160	Standard	NM_133178	Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2999G>A	1.37:g.29638168G>A	ENSP00000334941:p.Arg1000Gln	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	7.767	0.706569	0.15239	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68;1.68	4.67	4.67	0.58626	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.071954	0.56097	D	0.000038	T	0.04182	0.0116	N	0.00358	-1.6	0.39989	D	0.975012	P;P;P;P;P	0.46395	0.741;0.851;0.741;0.877;0.877	B;B;B;B;B	0.31614	0.081;0.081;0.081;0.133;0.133	T	0.26052	-1.0114	9	.	.	.	.	6.6842	0.23136	0.1925:0.0:0.8075:0.0	.	987;996;990;996;1000	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	Q	1000;990;996;996;987;996	ENSP00000334941:R1000Q;ENSP00000362884:R990Q;ENSP00000349333:R996Q;ENSP00000314987:R996Q;ENSP00000392332:R987Q;ENSP00000432906:R996Q	.	R	+	2	0	PTPRU	29510755	1.000000	0.71417	0.987000	0.45799	0.685000	0.39939	7.439000	0.80444	2.592000	0.87571	0.591000	0.81541	CGG	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		75.696483	0	-27	76	0	0	1	0		24	75.798804	29	0.452830
OR5C1	392391	broad.mit.edu	hg19	9	125551867	125551867	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:125551867C>T	ENST00000373680.2	+	1	718	c.656C>T	c.(655-657)aCg>aTg	p.T219M		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	219		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20					TTAGCTATCACGGTGTCTTAT	0.597	0	85.0	80.0	82.0	9	125551867	2203	4300	6503	SO:0001583	missense	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215	"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P		Standard	NM_001001923	Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.656C>T	9.37:g.125551867C>T	ENSP00000362784:p.Thr219Met	B2RN54|B9EGT0|Q96RC4	ENST00000373680.2	37	CCDS35131.1	.	.	.	.	.	.	.	.	.	.	C	3.407	-0.121022	0.06838	.	.	ENSG00000148215	ENST00000373680	T	0.00084	8.75	5.26	-1.88	0.07713	GPCR, rhodopsin-like superfamily (1);	0.215125	0.23211	U	0.050663	T	0.00073	0.0002	N	0.16066	0.365	0.09310	N	1	P	0.45594	0.862	B	0.36418	0.224	T	0.49762	-0.8905	10	0.56958	D	0.05	.	11.0123	0.47669	0.0:0.3217:0.0:0.6783	.	219	Q8NGR4	OR5C1_HUMAN	M	219	ENSP00000362784:T219M	ENSP00000362784:T219M	T	+	2	0	OR5C1	124591688	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	0.348000	0.20031	-0.590000	0.05866	0.655000	0.94253	ACG	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1		56.913817	0	-13	59	0	0	1	0		19	57.545134	31	0.380000
SLC45A4	57210	hgsc.bcm.edu	hg19	8	142227253	142227253	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										TGACCCCGGCGTTGTAGGCTT	0.627	0	70.0	69.0	69.0	8	142227253	2203	4300	6503	SO:0001819	synonymous_variant	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22					"""Solute carriers"""	29196	protein-coding gene	gene with protein product						Standard	NM_001080431	Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1512C>T	8.37:g.142227253G>A		Q6ZRI2|Q9ULU3	ENST00000024061.3	37	CCDS34948.1																																																																																			SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3				-1	67					XM_050325	15		28	
ARSF	416	broad.mit.edu	hg19	X	3002384	3002384	+	Silent	SNP	C	C	T	rs141924849	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:3002384C>T	ENST00000381127.1	+	6	728	c.507C>T	c.(505-507)ctC>ctT	p.L169L	ARSF_ENST00000359361.2_Silent_p.L169L|ARSF_ENST00000537104.1_Silent_p.L169L	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	169			extracellular region	arylsulfatase activity|metal ion binding	NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			CGTTCACTCTCGTTGACAGCT	0.532	0	146.0	111.0	123.0	X	3002384	2203	4300	6503	SO:0001819	synonymous_variant	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096	"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003			7720070	Standard	NM_004042	Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.507C>T	X.37:g.3002384C>T		Q8TCC5	ENST00000381127.1	37	CCDS14123.1																																																																																			ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		96.519665	0	0	77	0	0	1	0		31	96.634620	37	0.455882
CD93	22918	broad.mit.edu	hg19	20	23065702	23065702	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:23065702G>A	ENST00000246006.4	-	1	1275	c.1128C>T	c.(1126-1128)ggC>ggT	p.G376G		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	376	EGF-like 3; calcium-binding (Potential).	cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)				CTCCAGGACCGCCCGGCTCAT	0.632	0	44.0	45.0	45.0	20	23065702	2203	4300	6503	SO:0001819	synonymous_variant	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810	"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1	9047234, 10648005	Standard	NM_012072	Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1128C>T	20.37:g.23065702G>A		O00274	ENST00000246006.4	37	CCDS13149.1																																																																																			CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2		2.003013	0	-21	30	0	0	1	0	NM_012072	3	6.544737	26	0.103448
BICD1	636	broad.mit.edu	hg19	12	32480498	32480498	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:32480498G>A	ENST00000548411.1	+	5	1290	c.1109G>A	c.(1108-1110)cGg>cAg	p.R370Q	BICD1_ENST00000281474.5_Missense_Mutation_p.R370Q	NM_001003398.1	NP_001003398.1	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	370		anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton	NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)		CGGGTGCACCGGCTCACAGAG	0.622	0	55.0	51.0	53.0	12	32480498	2203	4300	6503	SO:0001583	missense	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746		1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""		9367685	Standard	NM_001714	Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1109G>A	12.37:g.32480498G>A	ENSP00000281474:p.Arg370Gln	A8K2C3|F8W113|O43892|O43893	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622932	0.46840	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.44881	0.91;0.91	5.21	4.3	0.51218	.	0.061324	0.64402	D	0.000009	T	0.38825	0.1055	L	0.61036	1.89	0.80722	D	1	P;B	0.52577	0.954;0.035	B;B	0.39738	0.308;0.008	T	0.31971	-0.9924	10	0.27082	T	0.32	.	14.6784	0.68998	0.074:0.0:0.926:0.0	.	370;370	F8W113;Q96G01	.;BICD1_HUMAN	Q	370	ENSP00000446793:R370Q;ENSP00000281474:R370Q	ENSP00000281474:R370Q	R	+	2	0	BICD1	32371765	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.561000	0.60809	2.592000	0.87571	0.650000	0.86243	CGG	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1		18.146394	0	-9	29	0	0	1	0	NM_001714	6	18.365733	10	0.375000
DNAH17	8632	broad.mit.edu	hg19	17	76421569	76421569	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:76421569C>T	ENST00000389840.5	-	80	13192	c.13068G>A	c.(13066-13068)acG>acA	p.T4356T	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000585328.1_Silent_p.T4328T					dynein, axonemal, heavy chain 17						NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		GCATGATGGCCGTGAGGAACG	0.597	0	71.0	69.0	70.0	17	76421569	2203	4300	6503	SO:0001819	synonymous_variant	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775	"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1	9545504	Standard	NM_173628	Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.12984G>A	17.37:g.76421569C>T		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	ENST00000585328.1	37																																																																																				DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2		39.437106	0	16	58	0	0	1	0	NM_173628	14	40.469779	28	0.333333
ESR1	2099	broad.mit.edu	hg19	6	152332878	152332878	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:152332878C>T	ENST00000440973.1	+	7	1554	c.1184C>T	c.(1183-1185)tCc>tTc	p.S395F	ESR1_ENST00000456483.2_Missense_Mutation_p.S283F|ESR1_ENST00000427531.2_Missense_Mutation_p.S222F|ESR1_ENST00000443427.1_Missense_Mutation_p.S395F|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000206249.3_Missense_Mutation_p.S395F|ESR1_ENST00000338799.5_Missense_Mutation_p.S395F	NM_001122742.1	NP_001116214.1	P03372	ESR1_HUMAN	estrogen receptor 1	395	Interaction with AKAP13.|Steroid-binding.	positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding	NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	GTCTGGCGCTCCATGGAGCAC	0.493	0	144.0	129.0	134.0	6	152332878	2203	4300	6503	SO:0001583	missense	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831	"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR	3754034	Standard	NM_000125	Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1184C>T	6.37:g.152332878C>T	ENSP00000206249:p.Ser395Phe	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	ENST00000206249.3	37	CCDS5234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.4|29.4	4.999208|4.999208	0.93227|0.93227	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000427531|ENST00000440973;ENST00000338799;ENST00000456483;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394;ENST00000415488	.|D;D;D;D;D;D;D	.|0.97378	.|-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99080|0.99080	0.9684|0.9684	H|H	0.96489|0.96489	3.83|3.83	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.998;0.999;0.998;0.999;0.998;0.999	D|D	0.99421|0.99421	1.0933|1.0933	5|10	.|0.87932	.|D	.|0	.|.	19.21|19.21	0.93749|0.93749	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|299;176;90;394;395;395	.|B0QYW6;E7EVR3;C8CJL6;A8KAF4;G4XH65;P03372	.|.;.;.;.;.;ESR1_HUMAN	S|F	300|395;395;283;176;395;395;323;222;68	.|ENSP00000405330:S395F;ENSP00000342630:S395F;ENSP00000415934:S283F;ENSP00000387500:S395F;ENSP00000206249:S395F;ENSP00000445454:S222F;ENSP00000401995:S68F	.|ENSP00000206249:S395F	P|S	+|+	1|2	0|0	ESR1|ESR1	152374571|152374571	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.487000|7.487000	0.81328|0.81328	2.541000|2.541000	0.85698|0.85698	0.591000|0.591000	0.81541|0.81541	CCA|TCC	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		149.420684	0	-23	119	0	0	1	0		47	149.440879	50	0.484536
SLC19A1	6573	broad.mit.edu	hg19	21	46951857	46951857	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr21:46951857G>A	ENST00000311124.4	-	3	547	c.395C>T	c.(394-396)gCg>gTg	p.A132V	SLC19A1_ENST00000485649.2_Missense_Mutation_p.A92V|SLC19A1_ENST00000380010.4_Missense_Mutation_p.A132V|SLC19A1_ENST00000567670.1_Missense_Mutation_p.A132V	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	132		folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity	endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	GGCGATGCGCGCGGCCATGGT	0.667	0	20.0	22.0	21.0	21	46951857	2193	4292	6485	SO:0001583	missense	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638	"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424			9570943	Standard	NM_194255	Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000380010.4:c.395C>T	21.37:g.46951857G>A	ENSP00000369347:p.Ala132Val	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	ENST00000380010.4	37	CCDS56218.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518952	0.64634	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649;ENST00000427839;ENST00000443742	D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46	4.95	4.95	0.65309	Major facilitator superfamily domain, general substrate transporter (1);	0.114089	0.56097	D	0.000022	D	0.95522	0.8545	M	0.91196	3.185	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;0.998;0.998;0.994	D;P;P;P	0.72982	0.979;0.87;0.87;0.87	D	0.96378	0.9279	10	0.72032	D	0.01	-37.0548	17.1012	0.86651	0.0:0.0:1.0:0.0	.	92;154;132;132	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	V	132;132;92;132;132	ENSP00000308895:A132V;ENSP00000369347:A132V;ENSP00000441772:A92V;ENSP00000401850:A132V;ENSP00000411345:A132V	ENSP00000308895:A132V	A	-	2	0	SLC19A1	45776285	1.000000	0.71417	0.076000	0.20297	0.002000	0.02628	7.113000	0.77095	2.460000	0.83146	0.462000	0.41574	GCG	SLC19A1-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000206797.1		16.677804	0	-3	12	0	0	1	0		5	16.966272	2	0.714286
SNRNP25	79622	broad.mit.edu	hg19	16	105487	105487	+	Missense_Mutation	SNP	T	T	C			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:105487T>C	ENST00000383018.3	+	2	259	c.98T>C	c.(97-99)aTa>aCa	p.I33T	SNRNP25_ENST00000493672.1_3'UTR	NM_024571.3	NP_078847.1	Q9BV90	SNR25_HUMAN	small nuclear ribonucleoprotein 25kDa (U11/U12)	33		mRNA processing	U12-type spliceosomal complex		large_intestine(1)|lung(2)	3					AACTCCCAAATAGCCCTAGAA	0.498	0	205.0	179.0	188.0	16	105487	2203	4300	6503	SO:0001583	missense	BC001381	CCDS10396.1	16p13.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000161981	ENSG00000161981		14161	protein-coding gene	gene with protein product	"""U11/U12 snRNP 25K"""		"""chromosome 16 open reading frame 33"""	C16orf33	15146077	Standard	NM_024571	Approved		uc002cfj.4	Q9BV90	OTTHUMG00000060720	ENST00000383018.3:c.98T>C	16.37:g.105487T>C	ENSP00000372482:p.Ile33Thr	Q1W6H3|Q6IEF8|Q9H5W4	ENST00000383018.3	37	CCDS10396.1	.	.	.	.	.	.	.	.	.	.	.	13.46	2.242658	0.39598	.	.	ENSG00000161981	ENST00000293861;ENST00000383018;ENST00000417493	.	.	.	5.58	4.5	0.54988	.	0.051814	0.85682	D	0.000000	T	0.67924	0.2945	M	0.82323	2.585	0.49798	D	0.99982	D	0.63046	0.992	P	0.51657	0.676	T	0.71994	-0.4424	9	0.87932	D	0	-19.6039	10.0521	0.42221	0.0:0.0788:0.0:0.9212	.	33	Q9BV90	SNR25_HUMAN	T	24;33;24	.	ENSP00000293861:I24T	I	+	2	0	SNRNP25	45487	1.000000	0.71417	0.998000	0.56505	0.386000	0.30323	6.967000	0.76079	0.980000	0.38523	0.460000	0.39030	ATA	SNRNP25-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			-5.631902	0	4	170	0	0	1	0	NM_024571	5	12.182110	82	0.057471
AZI1	22994	broad.mit.edu	hg19	17	79193765	79193765	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:79193765C>T	ENST00000269392.4	-	2	339	c.92G>A	c.(91-93)cGg>cAg	p.R31Q	AZI1_ENST00000575907.1_Missense_Mutation_p.R31Q|AZI1_ENST00000450824.2_Missense_Mutation_p.R31Q|AZI1_ENST00000374782.3_Missense_Mutation_p.R31Q	NM_014984.2	NP_055799.2	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1	31		cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		GCCAGGACGCCGGGACACAGG	0.662	0	95.0	86.0	89.0	17	79193765	2203	4300	6503	SO:0001583	missense																									ENST00000450824.2:c.92G>A	17.37:g.79193765C>T	ENSP00000393583:p.Arg31Gln	A6NHI8|B2RN11|Q96F50	ENST00000450824.2	37	CCDS45808.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526782	0.27299	2.27E-4	0.0	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.23348	1.91;1.91;1.91	4.01	1.36	0.22044	.	0.633633	0.14040	N	0.345497	T	0.15003	0.0362	L	0.34521	1.04	0.27817	N	0.941921	B;B;B;B	0.29188	0.093;0.093;0.236;0.038	B;B;B;B	0.16722	0.011;0.011;0.016;0.008	T	0.18398	-1.0338	10	0.28530	T	0.3	-9.6986	6.4005	0.21636	0.0:0.5742:0.0:0.4258	.	31;31;31;31	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	Q	31	ENSP00000393583:R31Q;ENSP00000363914:R31Q;ENSP00000269392:R31Q	ENSP00000269392:R31Q	R	-	2	0	AZI1	76808360	0.937000	0.31787	0.817000	0.32601	0.629000	0.37895	0.189000	0.17037	0.070000	0.16634	0.462000	0.41574	CGG	AZI1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439201.1		96.149057	0	7	103	0	0	1	0		30	96.203002	34	0.468750
CUL7	9820	broad.mit.edu	hg19	6	43010840	43010840	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:43010840C>T	ENST00000535468.1	-	18	3772	c.3686G>A	c.(3685-3687)cGc>cAc	p.R1229H	CUL7_ENST00000265348.3_Missense_Mutation_p.R1145H	NM_001168370.1|NM_014780.4	NP_001161842.1|NP_055595.2	Q14999	CUL7_HUMAN	cullin 7	1145		interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding	breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		CCGCCAACAGCGCGTCAGGTT	0.592	0	55.0	56.0	55.0	6	43010840	2203	4300	6503	SO:0001583	missense	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090		21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076	12481031, 12904573	Standard	NM_014780	Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3434G>A	6.37:g.43010840C>T	ENSP00000265348:p.Arg1145His	B4DYZ0|F5H0L1|Q5T654	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024918	0.75390	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.80123	-1.33;-1.34	5.61	4.63	0.57726	.	0.430196	0.28042	N	0.016821	T	0.61274	0.2334	L	0.45581	1.43	0.80722	D	1	B;P;B;B	0.34934	0.421;0.476;0.251;0.253	B;B;B;B	0.33392	0.034;0.057;0.163;0.117	T	0.67948	-0.5538	10	0.52906	T	0.07	-13.0531	6.9955	0.24780	0.0:0.7421:0.0:0.2579	.	1229;1145;1229;1145	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	H	1145;1229	ENSP00000265348:R1145H;ENSP00000438788:R1229H	ENSP00000265348:R1145H	R	-	2	0	CUL7	43118818	0.988000	0.35896	1.000000	0.80357	0.915000	0.54546	0.382000	0.20635	2.641000	0.89580	0.591000	0.81541	CGC	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1		26.871420	0	-3	56	0	0	1	0	NM_014780	12	29.780974	37	0.244898
EIF5A	1984	broad.mit.edu	hg19	17	7213113	7213113	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:7213113C>T	ENST00000336458.8	+	2	560	c.159C>T	c.(157-159)caC>caT	p.H53H	EIF5A_ENST00000419711.2_Silent_p.H53H|EIF5A_ENST00000573542.1_Silent_p.H53H|EIF5A_ENST00000336452.7_Silent_p.H83H|EIF5A_ENST00000416016.2_Silent_p.H53H|EIF5A_ENST00000571955.1_Silent_p.H53H|EIF5A_ENST00000576930.1_Silent_p.H53H|EIF5A_ENST00000572815.1_Silent_p.H53H	NM_001970.4	NP_001961.1	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A	53	DOHH-binding.	induction of apoptosis|mRNA export from nucleus|peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein export from nucleus|translational frameshifting|transmembrane transport	annulate lamellae|cytosol|endoplasmic reticulum membrane|nuclear pore	protein N-terminus binding|ribosome binding|translation elongation factor activity|U6 snRNA binding	endometrium(2)|kidney(1)|large_intestine(2)|urinary_tract(1)	6					AGCACGGCCACGCCAAGGTTA	0.527	0	133.0	117.0	122.0	17	7213113	2203	4300	6503	SO:0001819	synonymous_variant		CCDS11099.1, CCDS45601.1	17p13-p12	2009-05-01			ENSG00000132507	ENSG00000132507		3300	protein-coding gene	gene with protein product		600187			7759117	Standard	NM_001143760	Approved	EIF5A1, EIF-5A, MGC99547, MGC104255	uc002gfr.3	P63241	OTTHUMG00000102197	ENST00000336458.8:c.159C>T	17.37:g.7213113C>T		A8K9A0|D3DTP2|P10159|Q16182|Q7L7L3|Q7Z4L1|Q9D0G2	ENST00000336458.8	37	CCDS11099.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243257	0.22796	.	.	ENSG00000132507	ENST00000355068	.	.	.	4.55	-5.91	0.02269	.	.	.	.	.	T	0.49660	0.1570	.	.	.	0.80722	D	1	B	0.24186	0.099	B	0.17098	0.017	T	0.17684	-1.0361	7	0.87932	D	0	-17.9213	13.8611	0.63561	0.0:0.5405:0.0:0.4595	.	51	F5H5Z4	.	M	51	.	ENSP00000347180:T51M	T	+	2	0	EIF5A	7153837	0.699000	0.27786	0.948000	0.38648	0.987000	0.75469	-0.258000	0.08733	-1.174000	0.02754	-0.362000	0.07510	ACG	EIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220047.3		2.836141	0	-18	73	0	0	1	0	NM_001970	5	11.854012	49	0.092593
MUC4	4585	broad.mit.edu	hg19	3	195474130	195474130	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:195474130C>T	ENST00000463781.3	-	25	16615	c.16156G>A	c.(16156-16158)Ggg>Agg	p.G5386R	MUC4_ENST00000349607.4_Missense_Mutation_p.G1099R|MUC4_ENST00000346145.4_Missense_Mutation_p.G1150R|MUC4_ENST00000475231.1_Missense_Mutation_p.G5334R	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2143		cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	ACGAACGTCCCGACCCCCAGC	0.637	0	77.0	81.0	80.0	3	195474130	2203	4300	6503	SO:0001583	missense	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113	"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""		1673336	Standard	NM_004532	Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3448G>A	3.37:g.195474130C>T	ENSP00000304207:p.Gly1150Arg	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	ENST00000346145.4	37	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	c	12.97	2.097113	0.37048	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.37584	1.19;1.55;1.41;1.47	5.14	2.27	0.28462	.	1.906250	0.03227	N	0.178498	T	0.37892	0.1020	L	0.43152	1.355	0.09310	N	1	D;D;D;D;D;D	0.67145	0.996;0.98;0.98;0.967;0.967;0.98	P;P;P;B;B;P	0.47915	0.561;0.482;0.482;0.289;0.289;0.482	T	0.13045	-1.0524	10	0.62326	D	0.03	0.2878	4.248	0.10680	0.189:0.616:0.0:0.195	.	5258;1099;1150;5386;5334;2091	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	R	1099;1150;5386;5334;1886	ENSP00000338109:G1099R;ENSP00000304207:G1150R;ENSP00000417498:G5386R;ENSP00000420243:G5334R	ENSP00000304207:G1150R	G	-	1	0	MUC4	196959801	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.162000	0.10012	0.164000	0.19529	0.543000	0.68304	GGG	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1		23.733853	0	35	110	0	0	1	0	NM_018406	10	26.181793	31	0.243902
ZNF324	25799	broad.mit.edu	hg19	19	58983109	58983109	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:58983109G>A	ENST00000536459.2	+	4	1959	c.1250G>A	c.(1249-1251)cGc>cAc	p.R417H	ZNF324_ENST00000196482.3_Missense_Mutation_p.R417H|ZNF324_ENST00000535298.1_Missense_Mutation_p.R194H			O75467	Z324A_HUMAN	zinc finger protein 324	417		regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)	AAGCACCAGCGCGTGCACACA	0.662	0	41.0	41.0	41.0	19	58983109	2203	4299	6502	SO:0001583	missense	AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812	"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product						Standard	NM_014347	Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.1250G>A	19.37:g.58983109G>A	ENSP00000444812:p.Arg417His	B3KRX1	ENST00000536459.2	37	CCDS12981.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.565449	0.65651	.	.	ENSG00000083812	ENST00000196482;ENST00000536459;ENST00000539101;ENST00000535298	T;T;T	0.25749	1.78;1.78;1.78	3.84	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38663	N	0.001606	T	0.52901	0.1763	M	0.82823	2.61	0.39593	D	0.969614	D	0.89917	1.0	D	0.85130	0.997	T	0.62282	-0.6887	10	0.72032	D	0.01	.	14.0557	0.64767	0.0:0.0:1.0:0.0	.	417	O75467	Z324A_HUMAN	H	417;417;407;194	ENSP00000196482:R417H;ENSP00000444812:R417H;ENSP00000439588:R194H	ENSP00000196482:R417H	R	+	2	0	ZNF324	63674921	0.855000	0.29742	0.948000	0.38648	0.519000	0.34347	4.700000	0.61803	2.433000	0.82419	0.400000	0.26472	CGC	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467044.1		75.030971	0	-12	45	0	0	1	0	NM_014347	24	75.092981	28	0.461538
AGAP1	116987	broad.mit.edu	hg19	2	237032585	237032585	+	Missense_Mutation	SNP	G	G	A	rs138364081		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:237032585G>A	ENST00000304032.8	+	18	2973	c.2393G>A	c.(2392-2394)cGa>cAa	p.R798Q	AGAP1_ENST00000409538.1_Missense_Mutation_p.R1010Q|AGAP1_ENST00000428334.2_Missense_Mutation_p.R637Q|AGAP1_ENST00000336665.5_Missense_Mutation_p.R745Q	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1			protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding	breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41					GTCACGGCCCGAGATGCCCAC	0.647	0	47.0	49.0	48.0	2	237032585	2203	4300	6503	SO:0001583	missense	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985	"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2		Standard	NM_001037131	Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000336665.5:c.2234G>A	2.37:g.237032585G>A	ENSP00000338378:p.Arg745Gln	B2RTX7|Q541S5|Q6P9D7|Q9NV93	ENST00000336665.5	37	CCDS2514.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101250	0.37048	4.54E-4	3.49E-4	ENSG00000157985	ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	4.21	4.21	0.49690	Ankyrin repeat-containing domain (4);	0.122857	0.51477	D	0.000089	T	0.63105	0.2483	N	0.13235	0.315	0.58432	D	0.999999	D;D	0.89917	0.997;1.0	P;D	0.79784	0.897;0.993	T	0.61073	-0.7136	10	0.19147	T	0.46	.	16.5628	0.84570	0.0:0.0:1.0:0.0	.	745;798	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	Q	798;745;1010;637	ENSP00000307634:R798Q;ENSP00000338378:R745Q;ENSP00000386897:R1010Q;ENSP00000411824:R637Q	ENSP00000307634:R798Q	R	+	2	0	AGAP1	236697324	1.000000	0.71417	0.997000	0.53966	0.018000	0.09664	9.570000	0.98174	1.901000	0.55032	0.591000	0.81541	CGA	AGAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257077.1		33.118749	0	4	51	0	0	1	0	NM_014914	11	33.693275	20	0.354839
HCN4	10021	broad.mit.edu	hg19	15	73615896	73615896	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:73615896C>T	ENST00000261917.3	-	8	3531	c.2538G>A	c.(2536-2538)ccG>ccA	p.P846P		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	846		blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity	NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)	CCACCTGGGACGGGCTGCTGG	0.667	0	52.0	55.0	54.0	15	73615896	2195	4291	6486	SO:0001819	synonymous_variant	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622	"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206			10228147, 10430953, 16382102	Standard	NM_005477	Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2538G>A	15.37:g.73615896C>T		Q9UMQ7	ENST00000261917.3	37	CCDS10248.1																																																																																			HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2		63.435567	0	-14	78	0	0	1	0	NM_005477	22	64.176871	36	0.379310
MSRB3	253827	broad.mit.edu	hg19	12	65857066	65857066	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:65857066C>T	ENST00000308259.5	+	7	796	c.522C>T	c.(520-522)gtC>gtT	p.V174V	MSRB3_ENST00000355192.3_Silent_p.V181V|MSRB3_ENST00000535664.1_Silent_p.V174V	NM_001031679.2|NM_001193460.1	NP_001026849.1|NP_001180389.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	181		protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding	breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)	GCAGTGGGGTCGCCAGCCCGG	0.502	0	58.0	54.0	55.0	12	65857066	2203	4300	6503	SO:0001819	synonymous_variant	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099		27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74	21185009	Standard	NM_198080	Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000308259.5:c.522C>T	12.37:g.65857066C>T		B4DR19|B7ZAQ0|Q6UXS2	ENST00000308259.5	37	CCDS31853.1																																																																																			MSRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401422.1		7.346651	0	-29	43	0	0	1	0	NM_198080	7	15.721318	52	0.118644
DPF3	8110	broad.mit.edu	hg19	14	73137976	73137976	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:73137976G>A	ENST00000541685.1	-	9	954	c.942C>T	c.(940-942)ttC>ttT	p.F314F	DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000556509.1_Intron|DPF3_ENST00000546183.1_Silent_p.F324F	NM_012074.3	NP_036206.3	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	142		chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)	ACGTGGAACCGAATAAGTCCT	0.547	0	84.0	90.0	88.0	14	73137976	2202	4297	6499	SO:0001819	synonymous_variant	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683	"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672			11845289, 8812431	Standard	NM_012074	Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000546183.1:c.972C>T	14.37:g.73137976G>A		A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	ENST00000546183.1	37																																																																																				DPF3-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413156.1		6.580514	0	-15	49	0	0	1	0		4	10.256916	25	0.137931
NPAS2	4862	broad.mit.edu	hg19	2	101541694	101541694	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:101541694C>T	ENST00000335681.5	+	3	404	c.119C>T	c.(118-120)aCg>aTg	p.T40M	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Missense_Mutation_p.T105M	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	40	Helix-loop-helix motif.	central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					CCTGGCAACACGCGGAAAATG	0.453	0	115.0	107.0	110.0	2	101541694	2203	4300	6503	SO:0001583	missense	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485	"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347			9012850, 9079689	Standard	NM_002518	Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.119C>T	2.37:g.101541694C>T	ENSP00000338283:p.Thr40Met	Q4ZFV9|Q53SQ3|Q86V96|Q99629	ENST00000335681.5	37	CCDS2048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.4|28.4	4.920888|4.920888	0.92249|0.92249	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000427413|ENST00000335681;ENST00000542504;ENST00000451740	D|D;D;D	0.98060|0.97924	-4.69|-4.61;-4.61;-4.61	5.65|5.65	4.77|4.77	0.60923|0.60923	.|Helix-loop-helix DNA-binding (5);	.|0.109289	.|0.64402	.|N	.|0.000007	D|D	0.97857|0.97857	0.9296|0.9296	L|L	0.46157|0.46157	1.445|1.445	0.54753|0.54753	D|D	0.999984|0.999984	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.75020	.|0.975;0.985	D|D	0.98565|0.98565	1.0643|1.0643	6|10	.|0.66056	.|D	.|0.02	.|.	14.3258|14.3258	0.66518|0.66518	0.0:0.9291:0.0:0.0709|0.0:0.9291:0.0:0.0709	.|.	.|105;40	.|F5H027;Q99743	.|.;NPAS2_HUMAN	C|M	106|40;105;24	ENSP00000397595:R106C|ENSP00000338283:T40M;ENSP00000438428:T105M;ENSP00000395265:T24M	.|ENSP00000338283:T40M	R|T	+|+	1|2	0|0	NPAS2|NPAS2	100908126|100908126	0.997000|0.997000	0.39634|0.39634	0.857000|0.857000	0.33713|0.33713	0.924000|0.924000	0.55760|0.55760	3.680000|3.680000	0.54641|0.54641	1.378000|1.378000	0.46305|0.46305	0.655000|0.655000	0.94253|0.94253	CGC|ACG	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		-2.009628	0	10	78	0	0	1	0		3	6.477819	41	0.068182
CSN1S1	0	broad.mit.edu	hg19	4	70810661	70810661	+	Missense_Mutation	SNP	G	G	A	rs149927680	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:70810661G>A	ENST00000246891.4	+	15	545	c.496G>A	c.(496-498)Gac>Aac	p.D166N	CSN1S1_ENST00000444405.3_Missense_Mutation_p.D157N|CSN1S1_ENST00000505782.1_Missense_Mutation_p.D150N|CSN1S1_ENST00000507772.1_Missense_Mutation_p.D158N|CSN1S1_ENST00000507763.1_Missense_Mutation_p.D157N	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	166			extracellular region	protein binding|transporter activity	lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7					ACCGTTTTCCGACATCTCCAA	0.418	0	266.0	251.0	256.0	4	70810661	1919	4131	6050	SO:0001583	missense	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545		2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1	9050925, 7619062	Standard	NM_001890	Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.496G>A	4.37:g.70810661G>A	ENSP00000246891:p.Asp166Asn	A1A510|A1A511|E9PB60|Q4PNR5	ENST00000246891.4	37	CCDS47067.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236426	0.22711	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782;ENST00000510936	T;T;T;T;T;T	0.47869	1.03;1.02;1.02;1.02;1.0;0.83	4.28	-3.58	0.04597	.	1.284450	0.05448	N	0.548891	T	0.21962	0.0529	N	0.11927	0.2	0.22926	N	0.998559	P;P;P	0.36125	0.538;0.538;0.538	B;B;B	0.24155	0.051;0.051;0.051	T	0.10451	-1.0629	9	0.37606	T	0.19	-0.132	5.695	0.17851	0.5235:0.2806:0.1959:0.0	.	158;157;166	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	N	166;157;158;157;158;150;57	ENSP00000246891:D166N;ENSP00000413157:D157N;ENSP00000422611:D157N;ENSP00000427490:D158N;ENSP00000426684:D150N;ENSP00000421314:D57N	ENSP00000246891:D166N	D	+	1	0	CSN1S1	70845250	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.279000	0.08479	-0.873000	0.04032	-0.175000	0.13238	GAC	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1		55.004985	0	-18	106	0	0	1	0		22	60.182931	67	0.247191
AGRN	375790	broad.mit.edu	hg19	1	977395	977395	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:977395C>T	ENST00000379370.2	+	7	1287	c.1237C>T	c.(1237-1239)Cgc>Tgc	p.R413C		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	413	Kazal-like 4.	axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton	breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)	TGGCCGTCCCCGCTGCTCCTG	0.692	0	35.0	38.0	37.0	1	977395	2202	4295	6497	SO:0001583	missense	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157	"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320			1851019, 12270958	Standard	NM_198576	Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1237C>T	1.37:g.977395C>T	ENSP00000368678:p.Arg413Cys	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	ENST00000379370.2	37	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231172	0.58777	.	.	ENSG00000188157	ENST00000379370	T	0.31769	1.48	4.89	3.94	0.45596	.	0.254698	0.32093	N	0.006588	T	0.59046	0.2165	M	0.87547	2.89	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	T	0.66440	-0.5923	10	0.59425	D	0.04	-14.3216	14.1156	0.65151	0.1518:0.8482:0.0:0.0	.	413	O00468	AGRIN_HUMAN	C	413	ENSP00000368678:R413C	ENSP00000368678:R413C	R	+	1	0	AGRN	967258	0.985000	0.35326	0.796000	0.32109	0.628000	0.37860	4.321000	0.59209	0.972000	0.38314	0.609000	0.83330	CGC	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2		35.358454	0	-11	53	0	0	1	0	NM_198576	13	36.858665	30	0.302326
LARP1	23367	broad.mit.edu	hg19	5	154173236	154173236	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:154173236G>A	ENST00000336314.4	+	5	614	c.590G>A	c.(589-591)cGc>cAc	p.R197H		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	274				protein binding|RNA binding	breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		CGCCCCACTCGCCCACCGGAG	0.547	0	123.0	135.0	131.0	5	154173236	2203	4300	6503	SO:0001583	missense	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506	"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059			9872452, 10878606	Standard	NM_015315	Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.590G>A	5.37:g.154173236G>A	ENSP00000336721:p.Arg197His	O94836|Q8N4M2|Q8NB73|Q9UFD7	ENST00000336314.4	37	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538203	0.85917	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000519931;ENST00000524248;ENST00000523163	T;T;T;T	0.48836	1.75;1.31;1.36;0.8	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.54095	0.1837	N	0.12182	0.205	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.78314	0.959;0.991	T	0.57843	-0.7741	10	0.44086	T	0.13	-13.7021	20.2985	0.98592	0.0:0.0:1.0:0.0	.	274;197	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	H	197;274;69;69;49	ENSP00000336721:R197H;ENSP00000428589:R274H;ENSP00000429904:R69H;ENSP00000430438:R49H	ENSP00000336721:R197H	R	+	2	0	LARP1	154153429	1.000000	0.71417	0.994000	0.49952	0.591000	0.36615	5.496000	0.66918	2.793000	0.96121	0.655000	0.94253	CGC	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1		115.087380	0	-10	136	0	0	1	0	NM_033551	42	115.090602	43	0.494118
TTN	7273	broad.mit.edu	hg19	2	179431174	179431174	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:179431174C>T	ENST00000589042.1	-	326	79909	c.79685G>A	c.(79684-79686)cGa>cAa	p.R26562Q	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R17689Q|TTN_ENST00000359218.5_Missense_Mutation_p.R17622Q|TTN_ENST00000591111.1_Missense_Mutation_p.R24921Q|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R23994Q|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R17497Q|TTN-AS1_ENST00000592600.1_RNA	NM_001267550.1	NP_001254479.1	Q8WZ42	TITIN_HUMAN	titin	24921	Fibronectin type-III 93.			ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		GGCACAGACTCGTATTTTATA	0.423	0	144.0	145.0	144.0	2	179431174	1921	4121	6042	SO:0001583	missense	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G	2129545, 10051295	Standard	NM_003319	Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000589042.1:c.79685G>A	2.37:g.179431174C>T	ENSP00000467141:p.Arg26562Gln	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	ENST00000589042.1	37	CCDS59435.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227950	0.58777	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.92	5.92	0.95590	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71508	0.3348	M	0.74546	2.27	0.51767	D	0.99993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.72603	-0.4243	9	0.87932	D	0	.	20.3207	0.98668	0.0:1.0:0.0:0.0	.	17497;17622;17689;24921	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	23994;17497;17689;17622;17495	ENSP00000343764:R23994Q;ENSP00000434586:R17497Q;ENSP00000340554:R17689Q;ENSP00000352154:R17622Q	ENSP00000340554:R17689Q	R	-	2	0	TTN	179139420	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.917000	0.56424	2.813000	0.96785	0.561000	0.74099	CGA	TTN-018	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450680.2		73.882082	0	-22	135	0	0	1	0	NM_133378	27	78.817970	74	0.267327
S1PR4	8698	broad.mit.edu	hg19	19	3179432	3179432	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:3179432C>T	ENST00000246115.3	+	1	697	c.642C>T	c.(640-642)ggC>ggT	p.G214G	S1PR4_ENST00000591346.1_3'UTR	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	214		activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13					TCTTCGCCGGCGTCCTGGCCA	0.682	0	118.0	124.0	122.0	19	3179432	2203	4300	6503	SO:0001819	synonymous_variant	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910	"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6	9790765	Standard	NM_003775	Approved		uc002lxg.3	O95977		ENST00000246115.3:c.642C>T	19.37:g.3179432C>T		D6W612	ENST00000246115.3	37	CCDS12105.1																																																																																			S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1		109.682530	0	-17	224	0	0	1	0	NM_003775	42	117.344314	115	0.267516
PTPN21	11099	broad.mit.edu	hg19	14	88945353	88945353	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:88945353G>A	ENST00000556564.1	-	13	2706	c.2422C>T	c.(2422-2424)Cga>Tga	p.R808*	PTPN21_ENST00000328736.3_Nonsense_Mutation_p.R808*	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	808			cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity	breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45					CTCCGGGCTCGGTAGCGGCCT	0.662	0	45.0	50.0	49.0	14	88945353	2203	4300	6503	SO:0001587	stop_gained	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271			7519780	Standard	NM_007039	Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2422C>T	14.37:g.88945353G>A	ENSP00000452414:p.Arg808*		ENST00000556564.1	37	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	G	38	7.146204	0.98096	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	.	.	.	5.55	4.59	0.56863	.	0.240363	0.41500	D	0.000872	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0944	0.48134	0.0:0.0:0.591:0.409	.	.	.	.	X	808	.	ENSP00000330276:R808X	R	-	1	2	PTPN21	88015106	1.000000	0.71417	0.989000	0.46669	0.053000	0.15095	5.038000	0.64177	2.612000	0.88384	0.655000	0.94253	CGA	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		11.725805	0	-12	71	0	0	1	0		6	16.192613	33	0.153846
NYX	60506	broad.mit.edu	hg19	X	41333540	41333540	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:41333540C>T	ENST00000342595.2	+	2	1290	c.834C>T	c.(832-834)gcC>gcT	p.A278A	NYX_ENST00000378220.1_Silent_p.A278A	NM_022567.2	NP_072089.1	Q9GZU5	NYX_HUMAN	nyctalopin	278		response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(11)|upper_aerodigestive_tract(1)	17					CTGACCTGGCCGAGCTCGAGC	0.711	0	22.0	22.0	22.0	X	41333540	2200	4293	6493	SO:0001819	synonymous_variant	AF254868	CCDS14256.1	Xp11.4	2014-01-28			ENSG00000188937	ENSG00000188937		8082	protein-coding gene	gene with protein product		300278		CSNB1, CSNB4	11062471, 11062472	Standard	NM_022567	Approved	CLRP, CSNB1A	uc004dfh.2	Q9GZU5	OTTHUMG00000021370	ENST00000342595.2:c.834C>T	X.37:g.41333540C>T		D3DWC0|Q2M1S4|Q5H983|Q9H4J0	ENST00000342595.2	37	CCDS14256.1																																																																																			NYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056256.1		18.617040	0	-11	24	0	0	1	0	NM_022567	7	19.703308	18	0.280000
GRIK3	2899	broad.mit.edu	hg19	1	37307503	37307503	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:37307503G>A	ENST00000373091.3	-	10	1380	c.1364C>T	c.(1363-1365)aCg>aTg	p.T455M	GRIK3_ENST00000373093.4_Missense_Mutation_p.T455M	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	455		negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity	breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			CCCGTATAGCGTCCTGTCTGA	0.577	1	171.0	157.0	162.0	1	37307503	2203	4300	6503	SO:0001583	missense	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873	"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243			8128318	Standard	NM_000831	Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1364C>T	1.37:g.37307503G>A	ENSP00000362183:p.Thr455Met	A9Z1Z8|B1AMS6|Q13004|Q16136	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014316	0.35511	0.0	1.16E-4	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.77750	-1.12;-1.12	4.95	4.95	0.65309	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.060705	0.64402	D	0.000003	T	0.73729	0.3624	L	0.28054	0.825	0.36253	D	0.854055	P;P	0.40970	0.734;0.734	P;P	0.49665	0.618;0.492	T	0.76152	-0.3064	10	0.29301	T	0.29	.	12.9613	0.58460	0.0783:0.0:0.9217:0.0	.	455;455	A9Z1Z8;Q13003	.;GRIK3_HUMAN	M	455	ENSP00000362183:T455M;ENSP00000362185:T455M	ENSP00000362183:T455M	T	-	2	0	GRIK3	37080090	1.000000	0.71417	0.924000	0.36721	0.340000	0.28889	6.789000	0.75110	2.446000	0.82766	0.655000	0.94253	ACG	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1		135.626158	0	-7	112	0	0	1	0	NM_000831	43	135.628586	44	0.494253
PVRIG	79037	broad.mit.edu	hg19	7	99817744	99817744	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:99817744G>A	ENST00000317271.2	+	3	489	c.126G>A	c.(124-126)ccG>ccA	p.P42P	GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA	NM_024070.3	NP_076975.2	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin domain containing	42			integral to membrane		breast(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)	11	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				CAGGGACCCCGGAGGTGTGGG	0.637	0	24.0	27.0	26.0	7	99817744	2203	4300	6503	SO:0001819	synonymous_variant	BC001129	CCDS5690.1	7q22.1	2013-06-26			ENSG00000213413	ENSG00000213413		32190	protein-coding gene	gene with protein product					16926269	Standard	NM_024070	Approved	MGC2463, C7orf15	uc003uuf.1	Q6DKI7	OTTHUMG00000156798	ENST00000317271.2:c.126G>A	7.37:g.99817744G>A		D6W5U9|Q9BVK3	ENST00000317271.2	37	CCDS5690.1																																																																																			PVRIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345870.2		16.476832	0	-8	8	0	0	1	0	NM_024070	5	16.586576	3	0.625000
IVD	3712	broad.mit.edu	hg19	15	40702919	40702919	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:40702919G>A	ENST00000249760.2	+	4	722	c.379G>A	c.(379-381)Ggt>Agt	p.G127S	IVD_ENST00000479013.2_Missense_Mutation_p.G100S|IVD_ENST00000490194.1_3'UTR|IVD_ENST00000487418.2_Missense_Mutation_p.G130S	NM_002225.3	NP_002216.2	P26440	IVD_HUMAN	isovaleryl-CoA dehydrogenase	127		leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity	kidney(1)|lung(5)|ovary(2)|prostate(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	GCTCAGTTACGGTGCCCACTC	0.547	0	80.0	67.0	71.0	15	40702919	2203	4300	6503	SO:0001583	missense	AF038317	CCDS10057.1, CCDS10057.2, CCDS53930.1	15q14-q15	2010-05-11	2010-05-11		ENSG00000128928	ENSG00000128928		6186	protein-coding gene	gene with protein product		607036	"""isovaleryl Coenzyme A dehydrogenase"", ""isovaleryl CoA dehydrogenase"""		2063866	Standard	NM_002225	Approved	ACAD2	uc001zls.3	P26440	OTTHUMG00000129984	ENST00000487418.2:c.388G>A	15.37:g.40702919G>A	ENSP00000418397:p.Gly130Ser	B2RCV5|B3KVI7|J3KR54|Q53XZ9|Q96AF6	ENST00000487418.2	37	CCDS10057.2	.	.	.	.	.	.	.	.	.	.	G	34	5.389874	0.95988	.	.	ENSG00000128928	ENST00000249760;ENST00000479013;ENST00000487418	D;D;D	0.99704	-6.46;-6.46;-6.46	5.17	5.17	0.71159	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.045090	0.85682	D	0.000000	D	0.99462	0.9809	L	0.41573	1.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.988	D	0.98808	1.0742	10	0.52906	T	0.07	.	18.8538	0.92242	0.0:0.0:1.0:0.0	.	127;100	P26440;B3KVI7	IVD_HUMAN;.	S	127;100;130	ENSP00000249760:G127S;ENSP00000417990:G100S;ENSP00000418397:G130S	ENSP00000249760:G127S	G	+	1	0	IVD	38490211	1.000000	0.71417	0.253000	0.24343	0.909000	0.53808	9.623000	0.98386	2.691000	0.91804	0.655000	0.94253	GGT	IVD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252250.3		37.798110	0	-2	50	0	0	1	0		12	37.831503	14	0.461538
AP3B2	8120	broad.mit.edu	hg19	15	83346476	83346476	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:83346476C>T	ENST00000261722.3	-	12	1532	c.1325G>A	c.(1324-1326)cGa>cAa	p.R442Q	AP3B2_ENST00000535359.1_Missense_Mutation_p.R442Q|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Missense_Mutation_p.R410Q	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	442		endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)		GTCACGGACTCGGCCGATGTT	0.532	0	49.0	50.0	50.0	15	83346476	2148	4259	6407	SO:0001583	missense	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723		567	protein-coding gene	gene with protein product		602166			7671305, 1851215	Standard	NM_004644	Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000535348.1:c.1229G>A	15.37:g.83346476C>T	ENSP00000438721:p.Arg410Gln	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	ENST00000535348.1	37		.	.	.	.	.	.	.	.	.	.	C	17.29	3.351296	0.61183	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.12255	2.7;2.7;2.7	4.98	4.05	0.47172	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.125658	0.51477	D	0.000082	T	0.04003	0.0112	N	0.02685	-0.53	0.80722	D	1	B;B;B	0.32507	0.373;0.064;0.032	B;B;B	0.23150	0.044;0.009;0.009	T	0.42464	-0.9450	10	0.33141	T	0.24	-4.6877	3.3267	0.07070	0.2273:0.5763:0.0:0.1964	.	410;442;442	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Q	442;410;442	ENSP00000261722:R442Q;ENSP00000438721:R410Q;ENSP00000440984:R442Q	ENSP00000261722:R442Q	R	-	2	0	AP3B2	81143531	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.969000	0.70422	1.298000	0.44778	0.655000	0.94253	CGA	AP3B2-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000397466.1		40.606596	0	-7	10	0	0	1	0		12	41.251450	5	0.705882
SMARCAD1	56916	broad.mit.edu	hg19	4	95198183	95198183	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:95198183G>A	ENST00000354268.4	+	16	2028	c.1955G>A	c.(1954-1956)cGt>cAt	p.R652H	SMARCAD1_ENST00000509418.1_Missense_Mutation_p.R222H|SMARCAD1_ENST00000457823.2_Missense_Mutation_p.R652H			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	652	Helicase ATP-binding.	chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity	breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)	GCAAATAACCGTTTGCTGCTC	0.413	1	146.0	139.0	141.0	4	95198183	2203	4300	6503	SO:0001583	missense	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104		18398	protein-coding gene	gene with protein product		612761			11031099	Standard	NM_001128430	Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000509418.1:c.665G>A	4.37:g.95198183G>A	ENSP00000423286:p.Arg222His	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	ENST00000509418.1	37	CCDS58914.1	.	.	.	.	.	.	.	.	.	.	G	33	5.247895	0.95305	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75	5.24	5.24	0.73138	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.47455	D	0.000223	D	0.98406	0.9470	H	0.94264	3.515	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71414	0.973;0.954	D	0.99581	1.0973	10	0.87932	D	0	-10.8601	18.8643	0.92285	0.0:0.0:1.0:0.0	.	652;652	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	H	652;652;652;222	ENSP00000351947:R652H;ENSP00000415576:R652H;ENSP00000346217:R652H;ENSP00000423286:R222H	ENSP00000346217:R652H	R	+	2	0	SMARCAD1	95417206	1.000000	0.71417	0.985000	0.45067	0.942000	0.58702	9.333000	0.96459	2.463000	0.83235	0.555000	0.69702	CGT	SMARCAD1-006	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362981.2		-9.103287	0	-29	83	0	0	1	0	NM_020159	5	10.983255	90	0.052632
MUC2	4583	broad.mit.edu	hg19	11	1095811	1095811	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:1095811G>A	ENST00000441003.2	+	33	6349	c.6322G>A	c.(6322-6324)Ggc>Agc	p.G2108S	MUC2_ENST00000333592.6_3'UTR|MUC2_ENST00000361558.6_Missense_Mutation_p.G246S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4470			inner mucus layer|outer mucus layer	protein binding	NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	GGACCCCGACGGCTGCTGCTG	0.701	0	26.0	35.0	32.0	11	1095811	2130	4229	6359	SO:0001583	missense	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788	"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""		15081123	Standard	NM_002457	Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6322G>A	11.37:g.1095811G>A	ENSP00000415183:p.Gly2108Ser	Q14878	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	5.123	0.208280	0.09757	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.31769	2.54;1.48	3.62	-1.48	0.08745	.	.	.	.	.	T	0.18841	0.0452	L	0.35542	1.07	0.09310	N	1	D	0.59357	0.985	B	0.40602	0.334	T	0.24154	-1.0168	9	0.29301	T	0.29	.	8.196	0.31396	0.1804:0.3911:0.4285:0.0	.	2108	E7EUV1	.	S	2108;246	ENSP00000415183:G2108S;ENSP00000354885:G246S	ENSP00000354885:G246S	G	+	1	0	MUC2	1085811	0.003000	0.15002	0.017000	0.16124	0.165000	0.22458	0.514000	0.22786	-0.050000	0.13356	0.491000	0.48974	GGC	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		5.714073	0	-5	17	0	0	1	0	NM_002457	3	7.833363	16	0.157895
FBXW7	0	broad.mit.edu	hg19	4	153247366	153247366	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:153247366C>T	ENST00000281708.4	-	10	2665	c.1436G>A	c.(1435-1437)cGa>cAa	p.R479Q	FBXW7_ENST00000603841.1_Missense_Mutation_p.R479Q|FBXW7_ENST00000603548.1_Missense_Mutation_p.R479Q|FBXW7_ENST00000296555.5_Missense_Mutation_p.R361Q|FBXW7_ENST00000393956.3_Missense_Mutation_p.R303Q|FBXW7_ENST00000263981.5_Missense_Mutation_p.R399Q	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	479		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleoplasm|SCF ubiquitin ligase complex	protein binding	NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)			AGTGGCATCTCGAGAACCGCT	0.403	47	85.0	80.0	82.0	4	153247366	2203	4299	6502	SO:0001583	missense	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""		10531037, 11425854	Standard	NM_018315	Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1436G>A	4.37:g.153247366C>T	ENSP00000281708:p.Arg479Gln	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	33	5.283775	0.95489	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	N	0.12527	0.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.56529	-0.7964	10	0.56958	D	0.05	-12.7081	20.2406	0.98372	0.0:1.0:0.0:0.0	.	303;479;361;399	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	Q	479;361;399;303	ENSP00000281708:R479Q;ENSP00000296555:R361Q;ENSP00000263981:R399Q;ENSP00000377528:R303Q	ENSP00000263981:R399Q	R	-	2	0	FBXW7	153466816	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.715000	0.84713	2.857000	0.98124	0.650000	0.86243	CGA	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		12.728966	0	-4	54	0	0	1	0		6	16.300053	29	0.171429
WDR25	79446	broad.mit.edu	hg19	14	100992227	100992227	+	Silent	SNP	G	G	A	rs143825676		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:100992227G>A	ENST00000335290.6	+	5	1348	c.1122G>A	c.(1120-1122)gcG>gcA	p.A374A	WDR25_ENST00000554998.1_Silent_p.A374A|WDR25_ENST00000557502.1_3'UTR|WDR25_ENST00000402312.3_Silent_p.A374A|WDR25_ENST00000542471.2_Silent_p.A117A	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	374					central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)			GCTACAAGGCGACCATCCAGC	0.622	0	92.0	75.0	81.0	14	100992227	2203	4300	6503	SO:0001819	synonymous_variant	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473	"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67	15587985	Standard	NM_001161476	Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.1122G>A	14.37:g.100992227G>A		A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	ENST00000335290.6	37	CCDS32157.1																																																																																			WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1		7.483996	0	-11	57	0	0	1	0	NM_024515	4	10.235947	21	0.160000
C4orf32	132720	broad.mit.edu	hg19	4	113107979	113107979	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:113107979G>A	ENST00000309733.5	+	2	468	c.284G>A	c.(283-285)cGa>cAa	p.R95Q		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32				integral to membrane					Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)	TTTGGAGAACGAATAGTGGAA	0.413	0	246.0	233.0	237.0	4	113107979	2203	4300	6503	SO:0001583	missense	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749		26813	protein-coding gene	gene with protein product					12477932	Standard	NM_152400	Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.284G>A	4.37:g.113107979G>A	ENSP00000310182:p.Arg95Gln	Q49A91|Q4W5C7|Q8TBF9	ENST00000309733.5	37	CCDS3695.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.501929	0.44455	.	.	ENSG00000174749	ENST00000309733	T	0.48522	0.81	5.71	3.92	0.45320	.	0.345720	0.31589	N	0.007398	T	0.29491	0.0735	N	0.22421	0.69	0.43137	D	0.994883	B	0.26258	0.145	B	0.17722	0.019	T	0.06058	-1.0848	10	0.20046	T	0.44	-2.9118	9.6288	0.39768	0.0751:0.0:0.7831:0.1418	.	95	Q8N8J7	CD032_HUMAN	Q	95	ENSP00000310182:R95Q	ENSP00000310182:R95Q	R	+	2	0	C4orf32	113327428	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	3.202000	0.51067	0.698000	0.31739	0.585000	0.79938	CGA	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2		58.067861	0	-18	178	0	0	1	0	NM_152400	26	70.817709	113	0.187050
OXLD1	339229	broad.mit.edu	hg19	17	79632514	79632514	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:79632514C>T	ENST00000374741.3	-	2	171	c.161G>A	c.(160-162)cGc>cAc	p.R54H	OXLD1_ENST00000571503.1_3'UTR|OXLD1_ENST00000573786.1_5'UTR	NM_001039842.1	NP_001034931.1			oxidoreductase-like domain containing 1												GAATTTTCTGCGCCCATCAGG	0.672	0	37.0	40.0	39.0	17	79632514	2203	4298	6501	SO:0001583	missense		CCDS32766.1	17q25.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000204237	ENSG00000204237		27901	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 90"""	C17orf90		Standard	NM_001039842	Approved	MGC104712	uc002kba.3	Q5BKU9	OTTHUMG00000178063	ENST00000374741.3:c.161G>A	17.37:g.79632514C>T	ENSP00000363873:p.Arg54His	A6ND24	ENST00000374741.3	37	CCDS32766.1	.	.	.	.	.	.	.	.	.	.	C	8.849	0.944049	0.18281	.	.	ENSG00000204237	ENST00000374741	.	.	.	3.82	-7.49	0.01355	.	1.052130	0.07613	N	0.925722	T	0.17323	0.0416	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32348	-0.9910	9	0.17832	T	0.49	-2.5493	9.9797	0.41806	0.1064:0.6937:0.0:0.2	.	54	Q5BKU9	CQ090_HUMAN	H	54	.	ENSP00000363873:R54H	R	-	2	0	C17orf90	77242919	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.118000	0.00596	-1.833000	0.01195	-0.137000	0.14449	CGC	OXLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440380.1		4.774666	0	-1	68	0	0	1	0	NM_001039842	4	10.156218	32	0.111111
MAN1A1	4121	broad.mit.edu	hg19	6	119509576	119509576	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:119509576G>A	ENST00000368468.3	-	11	2154	c.1713C>T	c.(1711-1713)gcC>gcT	p.A571A		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	571		post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)	TCACCTCTACGGCTTCCCAGG	0.348	0	133.0	134.0	133.0	6	119509576	2203	4300	6503	SO:0001819	synonymous_variant	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885		6821	protein-coding gene	gene with protein product		604344			8223597	Standard	NM_005907	Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1713C>T	6.37:g.119509576G>A		E7EU32|Q6P052|Q9NU44|Q9UJI3	ENST00000368468.3	37	CCDS5122.1																																																																																			MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1		20.744504	0	2	104	0	0	1	0	NM_005907	12	31.535716	74	0.139535
FBXO46	23403	broad.mit.edu	hg19	19	46216077	46216077	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:46216077C>T	ENST00000317683.3	-	2	810	c.677G>A	c.(676-678)cGt>cAt	p.R226H		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	226				protein binding	breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)	CTCGGCTACACGGCTGCAGTC	0.701	0	20.0	24.0	23.0	19	46216077	2015	4146	6161	SO:0001583	missense	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051	"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L	9585442	Standard	NM_001080469	Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.677G>A	19.37:g.46216077C>T	ENSP00000410007:p.Arg226His		ENST00000317683.3	37	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292612	0.40594	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.89	3.86	0.44501	.	.	.	.	.	T	0.44265	0.1285	L	0.46157	1.445	0.34418	D	0.697129	B	0.29232	0.238	B	0.22601	0.04	T	0.57323	-0.7831	8	0.72032	D	0.01	-5.7976	10.954	0.47347	0.0:0.9082:0.0:0.0918	.	226	Q6PJ61	FBX46_HUMAN	H	226	.	ENSP00000410007:R226H	R	-	2	0	FBXO46	50907917	0.978000	0.34361	0.810000	0.32431	0.142000	0.21351	3.564000	0.53791	1.077000	0.40990	-0.251000	0.11542	CGT	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1		7.851637	0	-25	23	0	0	1	0	XM_371179	5	12.153725	30	0.142857
SLCO2B1	11309	broad.mit.edu	hg19	11	74907638	74907638	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:74907638G>A	ENST00000289575.5	+	10	1908	c.1513G>A	c.(1513-1515)Gac>Aac	p.D505N	SLCO2B1_ENST00000341411.4_Missense_Mutation_p.D278N|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.D361N|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.D278N|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.D483N|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.D389N|SLCO2B1_ENST00000531756.1_Missense_Mutation_p.D250N	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	505	Kazal-like.	sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity	breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					CCCTGTCTGCGACCCCAGCAC	0.617	0	78.0	66.0	70.0	11	74907638	2200	4293	6493	SO:0001583	missense	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26			"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9		Standard	NM_007256	Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000531756.1:c.748G>A	11.37:g.74907638G>A	ENSP00000432650:p.Asp250Asn	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	ENST00000531756.1	37		.	.	.	.	.	.	.	.	.	.	G	16.12	3.032254	0.54790	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000531756;ENST00000525650;ENST00000454962;ENST00000428359	T;T;T;T;T;T;T	0.42900	1.12;1.14;1.26;1.5;0.96;1.14;1.13	4.22	4.22	0.49857	Major facilitator superfamily domain, general substrate transporter (1);	0.203908	0.43110	D	0.000612	T	0.36386	0.0965	L	0.43152	1.355	0.43043	D	0.994635	P;P;P;P	0.46784	0.678;0.843;0.884;0.678	B;B;B;B	0.41571	0.254;0.36;0.245;0.254	T	0.36986	-0.9725	10	0.66056	D	0.02	.	12.2779	0.54747	0.0:0.0:1.0:0.0	.	361;250;278;505	E9PPU8;E9PPJ4;O94956-2;O94956	.;.;.;SO2B1_HUMAN	N	505;278;389;250;361;278;483	ENSP00000289575:D505N;ENSP00000341286:D278N;ENSP00000434112:D389N;ENSP00000432650:D250N;ENSP00000436324:D361N;ENSP00000389653:D278N;ENSP00000388912:D483N	ENSP00000289575:D505N	D	+	1	0	SLCO2B1	74585286	1.000000	0.71417	0.292000	0.24919	0.598000	0.36846	6.305000	0.72805	2.367000	0.80283	0.555000	0.69702	GAC	SLCO2B1-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000383935.1		45.188018	0	-9	49	0	0	1	0	NM_007256	16	46.014927	29	0.355556
COL5A1	1289	broad.mit.edu	hg19	9	137712052	137712052	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:137712052G>A	ENST00000371817.3	+	58	4951	c.4537G>A	c.(4537-4539)Ggt>Agt	p.G1513S		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1513	Triple-helical region.	axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	GGGCTCCTCCGGTCCTAAGGG	0.637	0	70.0	66.0	68.0	9	137712052	2203	4300	6503	SO:0001583	missense	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635	"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215			1572660	Standard	NM_001278074	Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4537G>A	9.37:g.137712052G>A	ENSP00000360882:p.Gly1513Ser	Q15094|Q5SUX4	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634724	0.47049	.	.	ENSG00000130635	ENST00000371817;ENST00000355306	D	0.99607	-6.27	4.69	3.78	0.43462	.	0.000000	0.85682	U	0.000000	D	0.99687	0.9882	H	0.94503	3.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.97889	1.0296	10	0.87932	D	0	.	12.4942	0.55918	0.0821:0.0:0.9179:0.0	.	1513	P20908	CO5A1_HUMAN	S	1513;50	ENSP00000360882:G1513S	ENSP00000347458:G50S	G	+	1	0	COL5A1	136851873	1.000000	0.71417	0.385000	0.26158	0.170000	0.22686	9.713000	0.98740	0.946000	0.37632	0.643000	0.83706	GGT	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2		17.308735	0	-15	48	0	0	1	0	NM_000093	7	19.449321	24	0.225806
PANK4	55229	broad.mit.edu	hg19	1	2445850	2445850	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:2445850G>A	ENST00000378466.3	-	11	1442	c.1430C>T	c.(1429-1431)gCg>gTg	p.A477V	PANK4_ENST00000435556.3_Missense_Mutation_p.A438V	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	477		coenzyme A biosynthetic process	cytoplasm	ATP binding|pantothenate kinase activity	breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)	GAACTTCTCCGCCCTCTCGGC	0.622	0	61.0	63.0	62.0	1	2445850	2203	4300	6503	SO:0001583	missense	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881		19366	protein-coding gene	gene with protein product		606162			11479594	Standard	XR_241034	Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1430C>T	1.37:g.2445850G>A	ENSP00000367727:p.Ala477Val	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	ENST00000378466.3	37	CCDS42.1	.	.	.	.	.	.	.	.	.	.	g	19.74	3.883731	0.72410	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.16196	2.36;2.36	5.1	5.1	0.69264	Domain of unknown function DUF89 (2);	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.968	T	0.53265	-0.8463	10	0.72032	D	0.01	-18.1651	17.482	0.87675	0.0:0.0:1.0:0.0	.	438;477	E9PHT6;Q9NVE7	.;PANK4_HUMAN	V	477;438	ENSP00000367727:A477V;ENSP00000421433:A438V	ENSP00000367727:A477V	A	-	2	0	PANK4	2435710	1.000000	0.71417	0.941000	0.38009	0.023000	0.10783	9.173000	0.94815	2.388000	0.81334	0.556000	0.70494	GCG	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1		44.486467	0	-24	82	0	0	1	0		16	45.543904	31	0.340426
TRIM56	81844	broad.mit.edu	hg19	7	100731056	100731056	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:100731056G>A	ENST00000306085.6	+	3	760	c.463G>A	c.(463-465)Ggg>Agg	p.G155R		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	155		defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding	breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)				CTACAGGGCCGGGTGGTATGA	0.701	0	11.0	15.0	14.0	7	100731056	1999	4143	6142	SO:0001583	missense	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871	"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""			Standard	NM_030961	Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.463G>A	7.37:g.100731056G>A	ENSP00000305161:p.Gly155Arg	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	ENST00000306085.6	37	CCDS43625.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.364795	0.41902	.	.	ENSG00000169871	ENST00000306085;ENST00000412507	T;T	0.47528	0.84;1.26	3.99	3.99	0.46301	.	0.153396	0.30742	N	0.008966	T	0.56485	0.1988	L	0.54965	1.715	0.25879	N	0.983618	D;D	0.76494	0.999;0.999	P;D	0.64042	0.902;0.921	T	0.45527	-0.9255	10	0.20046	T	0.44	.	11.893	0.52641	0.0:0.0:1.0:0.0	.	155;155	C9JI91;Q9BRZ2	.;TRI56_HUMAN	R	155	ENSP00000305161:G155R;ENSP00000404186:G155R	ENSP00000305161:G155R	G	+	1	0	TRIM56	100517776	1.000000	0.71417	0.473000	0.27253	0.510000	0.34073	3.342000	0.52159	2.501000	0.84356	0.655000	0.94253	GGG	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1		14.470644	0	-3	19	0	0	1	0	NM_030961	5	14.970580	11	0.312500
HSD17B1	3292	broad.mit.edu	hg19	17	40706497	40706497	+	Missense_Mutation	SNP	T	T	C			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:40706497T>C	ENST00000585807.1	+	5	4334	c.614T>C	c.(613-615)cTg>cCg	p.L205P	RP11-400F19.8_ENST00000585572.1_RNA|HSD17B1_ENST00000225929.5_Missense_Mutation_p.L206P|RP11-400F19.6_ENST00000590513.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	205		estrogen biosynthetic process	cytosol	binding|estradiol 17-beta-dehydrogenase activity	NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	GAGGAGGTGCTGGACCGCACG	0.637	0	61.0	47.0	52.0	17	40706497	2203	4300	6503	SO:0001583	missense		CCDS11428.1	17q11-q21	2011-09-14					"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2	2330005, 19027726	Standard	NM_000413	Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.614T>C	17.37:g.40706497T>C	ENSP00000466799:p.Leu205Pro	B3KXS1|Q2M2L8	ENST00000585807.1	37	CCDS11428.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.500208	0.64298	.	.	ENSG00000108786	ENST00000225929	.	.	.	4.32	4.32	0.51571	NAD(P)-binding domain (1);	0.562171	0.17562	N	0.169795	T	0.66519	0.2797	M	0.62723	1.935	0.58432	D	0.999998	D;P	0.59357	0.985;0.709	P;B	0.58266	0.836;0.147	T	0.66280	-0.5963	9	0.46703	T	0.11	.	9.7863	0.40677	0.0:0.0:0.0:1.0	.	236;205	B3RFR9;P14061	.;DHB1_HUMAN	P	205	.	ENSP00000225929:L205P	L	+	2	0	HSD17B1	37960023	1.000000	0.71417	0.491000	0.27477	0.050000	0.14768	3.004000	0.49513	1.830000	0.53286	0.402000	0.26972	CTG	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1		36.831545	0	5	29	0	0	1	0	NM_000413	11	37.333465	5	0.687500
GABRD	2563	hgsc.bcm.edu	hg19	1	1961509	1961509	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										GCAGCGCCGCGTCCCGGGGAA	0.692	0	24.0	28.0	26.0	1	1961509	2199	4294	6493	SO:0001583	missense	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730	"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163			2176788, 10965146	Standard	NM_000815	Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.1147G>A	1.37:g.1961509G>A	ENSP00000367848:p.Val383Ile	Q8N4N9	ENST00000378585.4	37	CCDS36.1	.	.	.	.	.	.	.	.	.	.	G	0.343	-0.949286	0.02304	.	.	ENSG00000187730	ENST00000378585	D	0.85773	-2.03	3.82	-7.14	0.01527	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.625020	0.01431	N	0.014756	T	0.63390	0.2507	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.56294	-0.8003	10	0.32370	T	0.25	-19.1726	4.0475	0.09779	0.5989:0.1211:0.158:0.122	.	383	O14764	GBRD_HUMAN	I	383	ENSP00000367848:V383I	ENSP00000367848:V383I	V	+	1	0	GABRD	1951369	0.000000	0.05858	0.000000	0.03702	0.524000	0.34500	-1.926000	0.01562	-1.457000	0.01919	-0.332000	0.08345	GTC	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1				-8	47					NM_000815	9		25	
REC8	9985	broad.mit.edu	hg19	14	24642157	24642157	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:24642157G>A	ENST00000311457.3	+	4	774	c.175G>A	c.(175-177)Ggc>Agc	p.G59S	REC8_ENST00000559919.1_Missense_Mutation_p.G59S			O95072	REC8_HUMAN	REC8 meiotic recombination protein	59		mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(265;0.00839)	CCCGCAGCCCGGCCTGCCGCG	0.607	0	54.0	63.0	60.0	14	24642157	1971	4132	6103	SO:0001583	missense	AF006264	CCDS41932.1	14q11.2-q12	2013-08-06	2013-08-06	2007-04-03		ENSG00000100918		16879	protein-coding gene	gene with protein product		608193	"""REC8-like 1 (yeast)"", ""REC8 homolog (yeast)"""	REC8L1	10207075, 15935783, 12759374	Standard	NM_005132	Approved	Rec8p, kleisin-alpha	uc001wms.3	O95072		ENST00000311457.3:c.175G>A	14.37:g.24642157G>A	ENSP00000308699:p.Gly59Ser	A8K576|D3DS62|Q658V5|Q6IA92|Q8WUV8|Q9BTF2|Q9NVQ9	ENST00000311457.3	37	CCDS41932.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933634	0.92458	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.24723	1.84	5.39	4.5	0.54988	Rad21/Rec8-like protein, N-terminal (1);	0.114287	0.64402	N	0.000014	T	0.23688	0.0573	L	0.27053	0.805	0.39814	D	0.972744	D;D	0.56287	0.957;0.975	B;P	0.49922	0.336;0.626	T	0.03354	-1.1045	10	0.23302	T	0.38	-12.6272	11.2615	0.49085	0.0868:0.0:0.9132:0.0	.	59;59	O95072-2;O95072	.;REC8_HUMAN	S	59	ENSP00000308699:G59S	ENSP00000308699:G59S	G	+	1	0	REC8	23711997	0.948000	0.32251	0.773000	0.31616	0.922000	0.55478	2.279000	0.43435	1.253000	0.44018	0.561000	0.74099	GGC	REC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415889.3		21.057322	0	-22	39	0	0	1	0	NM_005132	9	24.219610	33	0.214286
RAC3	5881	broad.mit.edu	hg19	17	79990655	79990655	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:79990655C>T	ENST00000306897.4	+	3	314	c.176C>T	c.(175-177)gCg>gTg	p.A59V		NM_005052.2	NP_005043.1	P60763	RAC3_HUMAN	ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)	59		actin cytoskeleton organization|cell projection assembly|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endomembrane system|filamentous actin|growth cone|lamellipodium|neuronal cell body|plasma membrane	GTP binding|GTPase activity|protein binding	NS(1)|kidney(1)|skin(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)		TGGGACACAGCGGGTCAGGAG	0.617	0	82.0	82.0	82.0	17	79990655	2203	4300	6503	SO:0001583	missense	AF008591	CCDS11798.1	17q25.3	2014-01-30				ENSG00000169750	"""Endogenous ligands"""	9803	protein-coding gene	gene with protein product		602050				Standard	NM_005052	Approved		uc002kdf.3	P60763		ENST00000306897.4:c.176C>T	17.37:g.79990655C>T	ENSP00000304283:p.Ala59Val	O14658|Q5U0M8	ENST00000306897.4	37	CCDS11798.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800053	0.90538	.	.	ENSG00000169750	ENST00000306897	D	0.88818	-2.43	3.79	3.79	0.43588	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96497	0.8857	H	0.99507	4.6	0.80722	D	1	D	0.56746	0.977	P	0.58266	0.836	D	0.98660	1.0683	9	.	.	.	.	15.8343	0.78787	0.0:1.0:0.0:0.0	.	59	P60763	RAC3_HUMAN	V	59	ENSP00000304283:A59V	.	A	+	2	0	RAC3	77583944	1.000000	0.71417	0.067000	0.19924	0.647000	0.38526	5.585000	0.67497	1.935000	0.56089	0.561000	0.74099	GCG	RAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442064.1		27.569897	0	-20	86	0	0	1	0		12	31.987486	45	0.210526
MYBPC2	4606	broad.mit.edu	hg19	19	50958853	50958853	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:50958853G>A	ENST00000357701.5	+	20	2341	c.2290G>A	c.(2290-2292)Ggg>Agg	p.G764R		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	764	Fibronectin type-III 2.	cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle	breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)	GAACAGGATCGGGGCAGGTGG	0.612	0	78.0	84.0	82.0	19	50958853	2046	4194	6240	SO:0001583	missense		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967	"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""		8375400	Standard	NM_004533	Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2290G>A	19.37:g.50958853G>A	ENSP00000350332:p.Gly764Arg	A1L4G9	ENST00000357701.5	37	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	g	25.6	4.650724	0.87958	.	.	ENSG00000086967	ENST00000357701	T	0.56776	0.44	4.38	4.38	0.52667	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.34067	U	0.004290	T	0.74966	0.3786	M	0.86178	2.8	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	T	0.79470	-0.1790	10	0.54805	T	0.06	.	16.1092	0.81247	0.0:0.0:1.0:0.0	.	764	Q14324	MYPC2_HUMAN	R	764	ENSP00000350332:G764R	ENSP00000350332:G764R	G	+	1	0	MYBPC2	55650665	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	8.851000	0.92205	2.187000	0.69744	0.454000	0.30748	GGG	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1		47.649383	0	5	103	0	0	1	0	NM_004533	17	50.496237	45	0.274194
GSR	2936	broad.mit.edu	hg19	8	30541683	30541683	+	Missense_Mutation	SNP	C	C	T	rs138721223		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:30541683C>T	ENST00000221130.5	-	10	1165	c.1075G>A	c.(1075-1077)Gta>Ata	p.V359I	GSR_ENST00000546342.1_Missense_Mutation_p.V330I|GSR_ENST00000414019.1_Missense_Mutation_p.V316I|GSR_ENST00000537535.1_Missense_Mutation_p.V277I|GSR_ENST00000541648.1_Missense_Mutation_p.V306I	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	359		cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity	breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	AATTCGTCTACGATGATATGA	0.423	0	314.0	258.0	277.0	8	30541683	2203	4300	6503	SO:0001583	missense		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687		4623	protein-coding gene	gene with protein product		138300				Standard	NM_000637	Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1075G>A	8.37:g.30541683C>T	ENSP00000221130:p.Val359Ile	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	ENST00000221130.5	37	CCDS34877.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	20.7	4.037543	0.75617	2.27E-4	0.0	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	5.77	5.77	0.91146	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.052405	0.85682	D	0.000000	T	0.77870	0.4195	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78927	-0.2011	10	0.87932	D	0	-27.7358	17.5536	0.87884	0.0:1.0:0.0:0.0	.	359	P00390	GSHR_HUMAN	I	359;316;330;306;277	ENSP00000221130:V359I;ENSP00000390065:V316I;ENSP00000445516:V330I;ENSP00000444559:V306I;ENSP00000438845:V277I	ENSP00000221130:V359I	V	-	1	0	GSR	30661225	1.000000	0.71417	0.147000	0.22382	0.242000	0.25591	7.075000	0.76798	2.743000	0.94032	0.644000	0.83932	GTA	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		101.859858	0	-23	127	0	0	1	0		33	102.620833	50	0.397590
AP3D1	8943	broad.mit.edu	hg19	19	2118737	2118737	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:2118737C>T	ENST00000355272.6	-	15	1782	c.1576G>A	c.(1576-1578)Gtg>Atg	p.V526M	AP3D1_ENST00000356926.4_Missense_Mutation_p.V435M|AP3D1_ENST00000345016.5_Missense_Mutation_p.V526M|AP3D1_ENST00000350812.6_Missense_Mutation_p.V357M	NM_001261826.1	NP_001248755.1	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	526		eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	AGCTTGACCACGTTCTGCACA	0.652	0	58.0	65.0	63.0	19	2118737	2197	4297	6494	SO:0001583	missense	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000		568	protein-coding gene	gene with protein product		607246			9151686, 9303295	Standard	NM_003938	Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000355272.6:c.1576G>A	19.37:g.2118737C>T	ENSP00000347416:p.Val526Met	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	ENST00000355272.6	37	CCDS58638.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126098	0.37533	0.0	2.33E-4	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	4.82	3.55	0.40652	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.249984	0.40302	N	0.001127	T	0.11750	0.0286	L	0.49571	1.57	0.40710	D	0.982562	P;P;P	0.41265	0.676;0.709;0.744	B;B;B	0.34590	0.101;0.157;0.186	T	0.04693	-1.0933	10	0.56958	D	0.05	-44.5581	9.6945	0.40150	0.0:0.8407:0.0:0.1593	.	526;526;435	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	M	435;526;526;526;357	ENSP00000349398:V435M;ENSP00000344055:V526M;ENSP00000347416:V526M;ENSP00000342321:V357M	ENSP00000341579:V526M	V	-	1	0	AP3D1	2069737	0.996000	0.38824	1.000000	0.80357	0.771000	0.43674	3.004000	0.49513	2.239000	0.73571	0.561000	0.74099	GTG	AP3D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450910.2		19.380470	0	-14	26	0	0	1	0		8	22.128886	29	0.216216
CAMSAP1	157922	broad.mit.edu	hg19	9	138713079	138713079	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:138713079C>T	ENST00000389532.4	-	11	3492	c.3428G>A	c.(3427-3429)cGg>cAg	p.R1143Q	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.R1154Q|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.R865Q	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1143			cytoplasm|microtubule		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)	CGTGGGCGTCCGAGGGTGGCT	0.607	0	60.0	74.0	69.0	9	138713079	2203	4300	6503	SO:0001583	missense	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559		19946	protein-coding gene	gene with protein product		613774			12477932	Standard	NM_015447	Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.3428G>A	9.37:g.138713079C>T	ENSP00000374183:p.Arg1143Gln	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	7.177	0.588804	0.13812	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.12984	2.63;2.63;2.63	5.29	5.29	0.74685	.	1.087730	0.06978	N	0.819294	T	0.12050	0.0293	L	0.48362	1.52	0.24121	N	0.995802	P;P	0.43094	0.762;0.799	B;B	0.30572	0.057;0.117	T	0.23332	-1.0191	10	0.87932	D	0	.	7.2277	0.26024	0.0:0.7903:0.0:0.2097	.	1143;1154	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	Q	1143;865;1154	ENSP00000374183:R1143Q;ENSP00000312463:R865Q;ENSP00000386420:R1154Q	ENSP00000312463:R865Q	R	-	2	0	CAMSAP1	137852900	0.097000	0.21791	0.068000	0.19968	0.087000	0.18053	0.464000	0.21988	2.620000	0.88729	0.561000	0.74099	CGG	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2		99.126003	0	-20	83	0	0	1	0	XM_351857	31	99.126003	31	0.500000
CSMD2	114784	broad.mit.edu	hg19	1	34090146	34090146	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:34090146G>A	ENST00000373381.4	-	35	5774	c.5598C>T	c.(5596-5598)atC>atT	p.I1866I	CSMD2_ENST00000373380.1_Silent_p.I739I|CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373377.1_5'UTR	NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1826	CUB 11.		integral to membrane|plasma membrane	protein binding	NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)			CGGGGACCACGATCTTCCACA	0.647	0	129.0	106.0	114.0	1	34090146	2203	4300	6503	SO:0001819	synonymous_variant	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904		19290	protein-coding gene	gene with protein product		608398			11472063, 11572484	Standard	NM_001281956	Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2217C>T	1.37:g.34090146G>A		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	ENST00000373380.1	37																																																																																				CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4		17.372585	0	-13	71	0	0	1	0	NM_052896	8	21.988193	38	0.173913
RNASEH2A	10535	broad.mit.edu	hg19	19	12918311	12918311	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:12918311C>T	ENST00000221486.4	+	4	496	c.402C>T	c.(400-402)aaC>aaT	p.N134N		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	134		DNA replication|RNA catabolic process	nucleus|ribonuclease H2 complex	metal ion binding|ribonuclease H activity|RNA binding	breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14					AGGGCGTGAACGTCACCCAGG	0.498	0	130.0	113.0	119.0	19	12918311	2203	4300	6503	SO:0001819	synonymous_variant	Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""		9789007, 16845400	Standard	NM_006397	Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.402C>T	19.37:g.12918311C>T		B2RCY1|Q96F11	ENST00000221486.4	37	CCDS12282.1																																																																																			RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451507.1		93.779269	0	-3	67	0	0	1	0	NM_006397	29	93.988405	22	0.568627
BRD4	23476	broad.mit.edu	hg19	19	15364970	15364970	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:15364970G>A	ENST00000263377.2	-	11	2372	c.2151C>T	c.(2149-2151)tcC>tcT	p.S717S	BRD4_ENST00000371835.4_Silent_p.S717S|BRD4_ENST00000360016.5_Silent_p.S717S	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	717	Ser-rich.	interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)		AACCTGTTTCGGAGTCTTCGC	0.542	0	76.0	66.0	70.0	19	15364970	2203	4300	6503	SO:0001819	synonymous_variant	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867		13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""		10938129	Standard	NM_058243	Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2151C>T	19.37:g.15364970G>A		O60433|Q4G0X8|Q86YS8|Q96PD3	ENST00000263377.2	37	CCDS12328.1																																																																																			BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3		7.216647	0	-10	16	0	0	1	0	NM_058243	3	8.471963	12	0.200000
DDHD2	23259	broad.mit.edu	hg19	8	38095674	38095674	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:38095674G>A	ENST00000397166.2	+	5	1094	c.569G>A	c.(568-570)cGa>cAa	p.R190Q	DDHD2_ENST00000520272.2_Missense_Mutation_p.R190Q	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	190		lipid catabolic process	centrosome	hydrolase activity|metal ion binding	endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)		GAGCAGGGTCGACCAAGAACT	0.398	0	230.0	208.0	215.0	8	38095674	2203	4300	6503	SO:0001583	missense	AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07			"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1	9872452, 11788596, 19632984, 20932832	Standard	NM_015214	Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.569G>A	8.37:g.38095674G>A	ENSP00000380352:p.Arg190Gln	B3KWV2|B3KXB5|Q9H8X7	ENST00000397166.2	37	CCDS34883.1	.	.	.	.	.	.	.	.	.	.	G	36	5.678988	0.96764	.	.	ENSG00000085788	ENST00000397166;ENST00000532222;ENST00000520272	T;T;T	0.35973	1.28;1.28;1.28	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	L	0.50847	1.595	0.80722	D	1	P;D	0.89917	0.796;1.0	B;D	0.80764	0.126;0.994	T	0.52260	-0.8599	10	0.52906	T	0.07	-12.3436	19.3432	0.94352	0.0:0.0:1.0:0.0	.	190;190	O94830;E9PKE6	DDHD2_HUMAN;.	Q	190	ENSP00000380352:R190Q;ENSP00000433578:R190Q;ENSP00000429932:R190Q	ENSP00000380352:R190Q	R	+	2	0	DDHD2	38214831	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	9.475000	0.97721	2.812000	0.96745	0.558000	0.71614	CGA	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377251.2		111.427057	0	-9	106	0	0	1	0	XM_291291	35	111.427057	35	0.500000
CACHD1	57685	broad.mit.edu	hg19	1	65141094	65141094	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:65141094C>T	ENST00000371073.2	+	20	2738	c.2738C>T	c.(2737-2739)aCg>aTg	p.T913M	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.T862M			Q5VU97	CAHD1_HUMAN	cache domain containing 1	913		calcium ion transport	integral to membrane		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55					GGGGATTTGACGAACCTTGTG	0.463	0	134.0	123.0	127.0	1	65141094	2203	4300	6503	SO:0001583	missense	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966		29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1	10997877	Standard	NM_020925	Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000290039.5:c.2585C>T	1.37:g.65141094C>T	ENSP00000290039:p.Thr862Met	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	ENST00000290039.5	37	CCDS628.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	20.7	4.031369	0.75504	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.27720	1.65;1.66	5.85	5.85	0.93711	.	0.132555	0.64402	D	0.000002	T	0.25121	0.0610	M	0.67397	2.05	0.80722	D	1	P	0.51240	0.943	B	0.37304	0.246	T	0.26780	-1.0093	10	0.72032	D	0.01	-20.5642	20.1634	0.98142	0.0:1.0:0.0:0.0	.	913	Q5VU97	CAHD1_HUMAN	M	913;862	ENSP00000360113:T913M;ENSP00000290039:T862M	ENSP00000290039:T862M	T	+	2	0	CACHD1	64913682	1.000000	0.71417	0.984000	0.44739	0.798000	0.45092	7.304000	0.78882	2.773000	0.95371	0.655000	0.94253	ACG	CACHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025238.1		14.896492	0	8	90	0	0	1	0	NM_020925	10	25.162122	67	0.129870
KIAA1217	56243	broad.mit.edu	hg19	10	24810824	24810824	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:24810824C>T	ENST00000376451.2	+	7	1731	c.1471C>T	c.(1471-1473)Cgc>Tgc	p.R491C	KIAA1217_ENST00000376462.1_Missense_Mutation_p.R728C|KIAA1217_ENST00000376454.3_Missense_Mutation_p.R808C|KIAA1217_ENST00000458595.1_Missense_Mutation_p.R773C|KIAA1217_ENST00000396445.1_Missense_Mutation_p.R491C|KIAA1217_ENST00000307544.6_Missense_Mutation_p.R491C|KIAA1217_ENST00000376452.3_Missense_Mutation_p.R773C|KIAA1217_ENST00000396446.1_Missense_Mutation_p.R491C|KIAA1217_ENST00000430453.2_Intron			Q5T5P2	SKT_HUMAN	KIAA1217	808		embryonic skeletal system development	cytoplasm		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70					GAAGCGTGTGCGCAGCATGAC	0.612	0	61.0	56.0	58.0	10	24810824	2203	4300	6503	SO:0001583	missense	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549		25428	protein-coding gene	gene with protein product	"""sickle tail"""				10574462	Standard	XM_005252500	Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000307544.6:c.1471C>T	10.37:g.24810824C>T	ENSP00000302343:p.Arg491Cys	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	ENST00000307544.6	37		.	.	.	.	.	.	.	.	.	.	C	23.3	4.396720	0.83120	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.95	4.05	0.47172	.	0.111662	0.64402	D	0.000011	T	0.74627	0.3741	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.987;0.999;0.996;0.999;0.999;0.998;0.992	T	0.77613	-0.2522	10	0.87932	D	0	.	15.2148	0.73258	0.2575:0.7425:0.0:0.0	.	773;773;491;491;491;491;808;808	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	C	728;773;773;491;808;773;623;491;491;491;491;491	ENSP00000365645:R728C;ENSP00000365639:R773C;ENSP00000392625:R773C;ENSP00000365637:R808C;ENSP00000365635:R773C;ENSP00000404798:R623C;ENSP00000302343:R491C;ENSP00000379722:R491C;ENSP00000365634:R491C;ENSP00000379723:R491C	ENSP00000302343:R491C	R	+	1	0	KIAA1217	24850830	1.000000	0.71417	0.971000	0.41717	0.893000	0.52053	1.522000	0.35921	0.796000	0.33947	0.563000	0.77884	CGC	KIAA1217-001	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000047220.2		54.846785	0	-1	38	0	0	1	0	NM_019590	18	54.896917	21	0.461538
EFNA4	1945	broad.mit.edu	hg19	1	155041446	155041446	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:155041446G>A	ENST00000368409.3	+	4	680	c.587G>A	c.(586-588)cGt>cAt	p.R196H	EFNA3_ENST00000505139.1_Intron|EFNA4_ENST00000359751.4_Intron|EFNA3_ENST00000556931.1_Intron|EFNA4_ENST00000427683.2_Intron	NM_005227.2	NP_005218.1			ephrin-A4						breast(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)		CTGATTCTTCGTCTTCTGCGA	0.597	0	122.0	123.0	123.0	1	155041446	2203	4300	6503	SO:0001583	missense	AJ006352	CCDS1089.1, CCDS41407.1, CCDS44237.1	1q21-q22	2011-03-09			ENSG00000243364	ENSG00000243364	"""Ephrins"""	3224	protein-coding gene	gene with protein product		601380		EPLG4	8660976	Standard	NM_182690	Approved	LERK4		P52798	OTTHUMG00000035309	ENST00000368409.3:c.587G>A	1.37:g.155041446G>A	ENSP00000357394:p.Arg196His	C9JHJ8|G3XAK2|O95457|Q5SR71|Q6FI57	ENST00000368409.3	37	CCDS1089.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449242	0.43531	.	.	ENSG00000243364	ENST00000368409	D	0.94138	-3.36	5.11	5.11	0.69529	.	0.205916	0.22529	N	0.058864	D	0.91915	0.7440	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.92464	0.5980	10	0.49607	T	0.09	.	13.896	0.63773	0.0:0.0:1.0:0.0	.	196	P52798	EFNA4_HUMAN	H	196	ENSP00000357394:R196H	ENSP00000357394:R196H	R	+	2	0	EFNA4	153308070	0.989000	0.36119	0.998000	0.56505	0.917000	0.54804	4.168000	0.58216	2.665000	0.90641	0.655000	0.94253	CGT	EFNA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085421.2		28.103651	0	15	85	0	0	1	0	NM_005227	11	30.603647	33	0.250000
GNA11	2767	broad.mit.edu	hg19	19	3115012	3115012	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:3115012C>T	ENST00000078429.4	+	4	789	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C		NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	183		activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity	endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)	GCTGCGGGTCCGCGTGCCCAC	0.672	5	106.0	97.0	100.0	19	3115012	2203	4299	6502	SO:0001583	missense	AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256		4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2	1302014, 23802516	Standard	NM_002067	Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.547C>T	19.37:g.3115012C>T	ENSP00000078429:p.Arg183Cys	O15109|Q14350|Q6IB00	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.984974	0.74474	.	.	ENSG00000088256	ENST00000078429	D	0.92199	-2.99	3.92	2.82	0.32997	G protein alpha subunit, helical insertion (1);	0.000000	0.64402	D	0.000007	D	0.97448	0.9165	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96915	0.9670	10	0.87932	D	0	.	10.0525	0.42225	0.4339:0.5661:0.0:0.0	.	183	P29992	GNA11_HUMAN	C	183	ENSP00000078429:R183C	ENSP00000078429:R183C	R	+	1	0	GNA11	3066012	0.975000	0.34042	0.981000	0.43875	0.991000	0.79684	2.467000	0.45093	1.752000	0.51891	0.556000	0.70494	CGC	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2		106.340323	0	-27	135	0	0	1	0	NM_002067	34	106.619300	44	0.435897
UNC5CL	222643	broad.mit.edu	hg19	6	41000848	41000848	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:41000848C>T	ENST00000244565.3	-	4	812	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	UNC5CL_ENST00000373164.1_Missense_Mutation_p.E242K	NM_173561.2	NP_775832.2	Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	242	Interaction with RELA and NFKB1.	signal transduction	cytoplasm|integral to membrane		endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)				TTGCGGGCTTCGCGCCCCACA	0.602	0	38.0	34.0	36.0	6	41000848	2201	4300	6501	SO:0001583	missense	BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602		21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""				14769797	Standard	NM_173561	Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.724G>A	6.37:g.41000848C>T	ENSP00000362258:p.Glu242Lys	Q5TGU1	ENST00000373164.1	37	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	C	0.048	-1.260412	0.01445	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.13901	2.55;2.55	5.49	2.73	0.32206	.	1.324110	0.05320	N	0.526352	T	0.01835	0.0058	N	0.14661	0.345	0.09310	N	1	B	0.18013	0.025	B	0.08055	0.003	T	0.39187	-0.9626	10	0.06891	T	0.86	0.3977	7.2747	0.26277	0.0:0.7184:0.0:0.2816	.	242	Q8IV45	UN5CL_HUMAN	K	242	ENSP00000244565:E242K;ENSP00000362258:E242K	ENSP00000244565:E242K	E	-	1	0	UNC5CL	41108826	0.007000	0.16637	0.001000	0.08648	0.000000	0.00434	1.031000	0.30165	0.274000	0.22072	-0.140000	0.14226	GAA	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1		18.349028	0	1	14	0	0	1	0	NM_173561	6	18.365729	7	0.461538
OR2A14	135941	broad.mit.edu	hg19	7	143826996	143826996	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:143826996G>A	ENST00000408899.2	+	1	846	c.791G>A	c.(790-792)cGc>cAc	p.R264H		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	264		sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)				CCCAAGTCCCGCCATCCTGAG	0.542	0	116.0	122.0	120.0	7	143826996	1977	4168	6145	SO:0001583	missense		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938	"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6		Standard	NM_001001659	Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.791G>A	7.37:g.143826996G>A	ENSP00000386137:p.Arg264His	Q6IF41|Q8NGT8	ENST00000408899.2	37	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	2.913	-0.224927	0.06022	.	.	ENSG00000221938	ENST00000408899	T	0.00115	8.71	4.18	-5.3	0.02738	GPCR, rhodopsin-like superfamily (1);	2.119410	0.03153	U	0.168207	T	0.00109	0.0003	N	0.12746	0.255	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.28235	-1.0050	10	0.54805	T	0.06	0.4492	8.5452	0.33417	0.6459:0.1234:0.2307:0.0	.	264	Q96R47	O2A14_HUMAN	H	264	ENSP00000386137:R264H	ENSP00000386137:R264H	R	+	2	0	OR2A14	143457929	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.642000	0.00863	-1.416000	0.02019	-1.077000	0.02231	CGC	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		118.349831	0	-47	194	0	0	1	0		42	119.686936	68	0.381818
PCDHB7	0	broad.mit.edu	hg19	5	140554409	140554409	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:140554409G>A	ENST00000231137.3	+	1	2167	c.1993G>A	c.(1993-1995)Ggc>Agc	p.G665S		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN		665	Cadherin 6.	calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		CCTGGTGGACGGCTTCTCCCA	0.701	0	41.0	65.0	57.0	5	140554409	2178	4274	6452	SO:0001583	missense	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212	"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333			10380929	Standard	NM_018940	Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1993G>A	5.37:g.140554409G>A	ENSP00000231137:p.Gly665Ser	A1L3Y8	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043627	0.55003	.	.	ENSG00000113212	ENST00000231137	T	0.47869	0.83	3.98	3.98	0.46160	Cadherin (2);	.	.	.	.	T	0.49270	0.1547	N	0.17474	0.49	0.31529	N	0.661409	D	0.89917	1.0	D	0.97110	1.0	T	0.46884	-0.9159	9	0.20519	T	0.43	.	12.0813	0.53671	0.0:0.1742:0.8258:0.0	.	665	Q9Y5E2	PCDB7_HUMAN	S	665	ENSP00000231137:G665S	ENSP00000231137:G665S	G	+	1	0	PCDHB7	140534593	0.008000	0.16893	1.000000	0.80357	0.944000	0.59088	1.938000	0.40203	1.922000	0.55676	0.449000	0.29647	GGC	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2		82.966112	0	27	218	0	0	1	0	NM_018940	33	92.606359	111	0.229167
PPFIBP2	8495	broad.mit.edu	hg19	11	7652162	7652162	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:7652162C>T	ENST00000299492.4	+	11	1359	c.971C>T	c.(970-972)tCg>tTg	p.S324L	PPFIBP2_ENST00000533792.1_Missense_Mutation_p.S166L|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.S212L|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.S181L	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	324		cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding	breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)	GCAGGGCCTTCGGAGAGAACT	0.388	0	110.0	117.0	115.0	11	7652162	2201	4296	6497	SO:0001583	missense	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387	"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142			9624153	Standard	NM_003621	Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000530181.1:c.542C>T	11.37:g.7652162C>T	ENSP00000437321:p.Ser181Leu	B7Z433|E9PK77|O75337|Q8WW26	ENST00000530181.1	37	CCDS58117.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	23.7	4.447333	0.84101	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000537467;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	6.17	5.27	0.74061	.	0.186394	0.37669	N	0.002000	T	0.61362	0.2341	L	0.51422	1.61	0.40553	D	0.981138	B;B;B;P;B	0.34892	0.002;0.217;0.021;0.474;0.02	B;B;B;B;B	0.24394	0.001;0.038;0.006;0.053;0.003	T	0.62737	-0.6791	10	0.37606	T	0.19	0.0316	13.4735	0.61295	0.0:0.925:0.0:0.075	.	212;212;247;181;324	E9PK77;B7Z433;F5GWB0;E9PMU1;Q8ND30	.;.;.;.;LIPB2_HUMAN	L	324;166;166;247;212;181	ENSP00000299492:S324L;ENSP00000436498:S166L;ENSP00000435469:S212L;ENSP00000437321:S181L	ENSP00000299492:S324L	S	+	2	0	PPFIBP2	7608738	0.795000	0.28851	0.985000	0.45067	0.918000	0.54935	3.175000	0.50855	1.625000	0.50366	0.655000	0.94253	TCG	PPFIBP2-008	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000385403.2		56.774226	0	5	111	0	0	1	0	NM_003621	20	59.060116	46	0.303030
HIVEP3	59269	broad.mit.edu	hg19	1	42048953	42048953	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:42048953G>A	ENST00000372584.1	-	3	2530	c.1516C>T	c.(1516-1518)Cgg>Tgg	p.R506W	HIVEP3_ENST00000372583.1_Missense_Mutation_p.R506W|HIVEP3_ENST00000429157.2_Missense_Mutation_p.R506W|HIVEP3_ENST00000247584.5_Missense_Mutation_p.R506W	NM_001127714.2	NP_001121186.1	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	506	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN (By similarity).	positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)			AGGGGCTCCCGGTAGAGGCTG	0.632	0	77.0	85.0	82.0	1	42048953	2203	4300	6503	SO:0001583	missense	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124	"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""		11161801	Standard	NR_038260	Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1516C>T	1.37:g.42048953G>A	ENSP00000361664:p.Arg506Trp	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953963	0.53293	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	4.82	3.9	0.45041	.	0.000000	0.47093	D	0.000242	T	0.37652	0.1011	L	0.47716	1.5	0.37934	D	0.932111	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.987	T	0.37641	-0.9697	10	0.72032	D	0.01	-0.7334	12.4535	0.55691	0.0:0.0:0.6413:0.3587	.	506;506	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	W	506	ENSP00000361665:R506W;ENSP00000361664:R506W;ENSP00000247584:R506W;ENSP00000410828:R506W	ENSP00000247584:R506W	R	-	1	2	HIVEP3	41821540	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.030000	0.49720	1.246000	0.43901	0.561000	0.74099	CGG	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1		66.633699	0	-18	61	0	0	1	0	NM_024503	22	67.784457	40	0.354839
WDR59	79726	broad.mit.edu	hg19	16	74919625	74919625	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:74919625C>T	ENST00000262144.6	-	25	2745	c.2615G>A	c.(2614-2616)cGt>cAt	p.R872H		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	872					breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27					CAGACCCCAACGGTAGAGGAT	0.463	0	108.0	99.0	102.0	16	74919625	2198	4300	6498	SO:0001583	missense	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091	"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product					11572484	Standard	XM_005256146	Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.2615G>A	16.37:g.74919625C>T	ENSP00000262144:p.Arg872His	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	ENST00000262144.6	37	CCDS32488.1	.	.	.	.	.	.	.	.	.	.	C	32	5.128763	0.94473	2.27E-4	1.16E-4	ENSG00000103091	ENST00000262144	T	0.72051	-0.62	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.87095	0.6092	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.987;0.994	D	0.89098	0.3487	10	0.66056	D	0.02	-20.5611	19.0883	0.93215	0.0:1.0:0.0:0.0	.	872;317	Q6PJI9;Q6PJI9-4	WDR59_HUMAN;.	H	872	ENSP00000262144:R872H	ENSP00000262144:R872H	R	-	2	0	WDR59	73477126	1.000000	0.71417	0.928000	0.36995	0.871000	0.50021	7.800000	0.85949	2.500000	0.84329	0.561000	0.74099	CGT	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3		87.526536	0	-27	53	0	0	1	0	NM_030581	27	87.530663	26	0.509434
HDAC5	10014	broad.mit.edu	hg19	17	42162392	42162392	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:42162392C>T	ENST00000225983.6	-	15	2508	c.2185G>A	c.(2185-2187)Gag>Aag	p.E729K	HDAC5_ENST00000586802.1_Missense_Mutation_p.E728K|HDAC5_ENST00000336057.5_Intron|HDAC5_ENST00000393622.2_Missense_Mutation_p.E728K			Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	728	Histone deacetylase.	B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)	TCCCTTACCTCGCACTTGCTA	0.552	0	76.0	69.0	71.0	17	42162392	2203	4300	6503	SO:0001583	missense	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18						14068	protein-coding gene	gene with protein product		605315			10220385, 9610721	Standard	XM_005256905	Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000225983.6:c.2185G>A	17.37:g.42162392C>T	ENSP00000225983:p.Glu729Lys	C9JFV9|O60340|O60528|Q96DY4	ENST00000225983.6	37	CCDS32663.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356629	0.82243	.	.	ENSG00000108840	ENST00000225983;ENST00000393622	T;T	0.50548	0.74;0.74	5.38	5.38	0.77491	Histone deacetylase domain (2);	0.062618	0.64402	D	0.000007	T	0.50103	0.1596	L	0.41632	1.29	0.80722	D	1	D;P;P	0.58970	0.984;0.703;0.747	P;B;B	0.52823	0.71;0.114;0.182	T	0.43310	-0.9399	10	0.38643	T	0.18	-21.0677	13.6323	0.62202	0.0:0.8445:0.1555:0.0	.	728;729;728	B4DGT4;Q9UQL6-3;Q9UQL6	.;.;HDAC5_HUMAN	K	729;728	ENSP00000225983:E729K;ENSP00000377244:E728K	ENSP00000225983:E729K	E	-	1	0	HDAC5	39517918	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.954000	0.70298	2.517000	0.84864	0.655000	0.94253	GAG	HDAC5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457683.1		42.440763	0	-6	41	0	0	1	0	NM_001015053	14	43.018797	24	0.368421
FBXL18	80028	broad.mit.edu	hg19	7	5540761	5540761	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:5540761G>A	ENST00000382368.3	-	3	1262	c.1139C>T	c.(1138-1140)gCg>gTg	p.A380V	FBXL18_ENST00000453700.3_Missense_Mutation_p.A380V	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	380					central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)	GCAGCAGGACGCCACCAGAGT	0.687	0	17.0	25.0	22.0	7	5540761	2164	4263	6427	SO:0001583	missense	AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034	"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084				Standard	NM_024963	Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1139C>T	7.37:g.5540761G>A	ENSP00000371805:p.Ala380Val	Q9BR90|Q9BTC7|Q9HAK7	ENST00000382368.3	37	CCDS43546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.514|9.514	1.106525|1.106525	0.20632|0.20632	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000382368;ENST00000312577;ENST00000453700|ENST00000458142	T;T|.	0.01005|.	5.45;5.45|.	5.03|5.03	-4.22|-4.22	0.03800|0.03800	.|.	0.825130|.	0.11372|.	N|.	0.570784|.	T|T	0.09905|0.09905	0.0243|0.0243	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.12630|.	0.006;0.001|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.27191|0.27191	-1.0081|-1.0081	10|5	0.30854|.	T|.	0.27|.	.|.	0.8005|0.8005	0.01074|0.01074	0.3835:0.1244:0.2651:0.227|0.3835:0.1244:0.2651:0.227	.|.	380;380|.	F5H4Z4;Q96ME1-4|.	.;.|.	V|C	380|264	ENSP00000371805:A380V;ENSP00000444797:A380V|.	ENSP00000311990:A380V|.	A|R	-|-	2|1	0|0	FBXL18|FBXL18	5507287|5507287	0.000000|0.000000	0.05858|0.05858	0.117000|0.117000	0.21633|0.21633	0.991000|0.991000	0.79684|0.79684	-0.072000|-0.072000	0.11486|0.11486	-0.613000|-0.613000	0.05694|0.05694	-0.482000|-0.482000	0.04802|0.04802	GCG|CGT	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1		49.834208	0	2	45	0	0	1	0	NM_024963	18	49.858844	16	0.529412
CYP2A13	1553	broad.mit.edu	hg19	19	41594843	41594843	+	Missense_Mutation	SNP	C	C	T	rs72547586	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:41594843C>T	ENST00000330436.3	+	2	190	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	64		xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding	breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					GATCAGTGAGCGCTATGGCCC	0.612	0	84.0	77.0	80.0	19	41594843	2203	4300	6503	SO:0001583	missense	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838	"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""		7668294, 15128046	Standard	NM_000766	Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.190C>T	19.37:g.41594843C>T	ENSP00000332679:p.Arg64Cys	Q53YR8|Q6R569|Q6R570|Q9H2X2	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	12.17	1.857060	0.32791	.	.	ENSG00000197838	ENST00000330436	T	0.69435	-0.4	3.49	2.34	0.29019	.	0.527792	0.16699	U	0.203231	T	0.61961	0.2389	M	0.69185	2.1	0.09310	N	1	B	0.19073	0.033	B	0.16722	0.016	T	0.59500	-0.7443	10	0.59425	D	0.04	.	9.8633	0.41127	0.3098:0.6902:0.0:0.0	.	64	Q16696	CP2AD_HUMAN	C	64	ENSP00000332679:R64C	ENSP00000332679:R64C	R	+	1	0	CYP2A13	46286683	0.000000	0.05858	0.575000	0.28536	0.381000	0.30169	-0.327000	0.07955	1.965000	0.57142	0.444000	0.29173	CGC	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1		7.049305	0	-23	60	0	0	1	0	NM_000766	6	14.593958	46	0.115385
ARHGEF15	22899	broad.mit.edu	hg19	17	8221893	8221893	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:8221893C>T	ENST00000361926.3	+	11	1895	c.1785C>T	c.(1783-1785)atC>atT	p.I595I	ARHGEF15_ENST00000421050.1_Silent_p.I595I|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	595	DH.	negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37					CCTAGATCATCGAGCGTTGCA	0.597	2	59.0	59.0	59.0	17	8221893	2203	4300	6503	SO:0001819	synonymous_variant	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844	"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504			10048485	Standard	NM_173728	Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1785C>T	17.37:g.8221893C>T		A8K6G1|Q8N449|Q9H8B4	ENST00000361926.3	37	CCDS11139.1																																																																																			ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2		25.601762	0	-22	27	0	0	1	0	NM_173728	8	25.664104	6	0.571429
YPEL1	29799	broad.mit.edu	hg19	22	22057670	22057670	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:22057670C>T	ENST00000339468.3	-	4	642	c.259G>A	c.(259-261)Ggg>Agg	p.G87R		NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)	87			nucleus		breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)				TATTTCCACCCGAGCGTGGTC	0.622	0	148.0	116.0	127.0	22	22057670	2203	4300	6503	SO:0001583	missense	AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027		12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""		11473580	Standard	NM_013313	Approved		uc002zvl.3	O60688	OTTHUMG00000150830	ENST00000339468.3:c.259G>A	22.37:g.22057670C>T	ENSP00000342832:p.Gly87Arg	Q65ZA1|Q6GLI6	ENST00000339468.3	37	CCDS13794.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984089	0.93044	.	.	ENSG00000100027	ENST00000339468	.	.	.	4.06	4.06	0.47325	.	0.000000	0.85682	D	0.000000	D	0.89774	0.6812	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93527	0.6866	9	0.87932	D	0	.	17.6172	0.88071	0.0:1.0:0.0:0.0	.	87	O60688	YPEL1_HUMAN	R	87	.	ENSP00000342832:G87R	G	-	1	0	YPEL1	20387670	1.000000	0.71417	0.999000	0.59377	0.718000	0.41266	7.650000	0.83521	2.574000	0.86865	0.558000	0.71614	GGG	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320245.1		89.530416	0	-17	60	0	0	1	0	NM_013313	27	89.693654	21	0.562500
MAP2K3	5606	broad.mit.edu	hg19	17	21201792	21201792	+	Splice_Site	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:21201792G>A	ENST00000342679.4	+	2	365		c.e2+1		MAP2K3_ENST00000316920.6_Splice_Site|MAP2K3_ENST00000361818.5_Splice_Site	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3			activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity						COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	CCAACCCCACGTGAGTCTGCC	0.577	0	202.0	174.0	183.0	17	21201792	2203	4300	6503	SO:0001630	splice_region_variant	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3	9465908	Standard	NM_145109	Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.116+1G>A	17.37:g.21201792G>A		B3KSK7|Q99441|Q9UE71|Q9UE72	ENST00000342679.4	37	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353219	0.82132	2.27E-4	0.0	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8621	0.86021	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP2K3	21142385	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.020000	0.49643	2.837000	0.97791	0.655000	0.94253	.	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2		36.877828	0	-53	148	0	0	1	0	NM_145109	18	46.325124	81	0.181818
ATP2C2	9914	broad.mit.edu	hg19	16	84482210	84482210	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:84482210C>T	ENST00000416219.2	+	17	1664	c.1575C>T	c.(1573-1575)aaC>aaT	p.N525N	ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000262429.4_Silent_p.N525N			O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	525		ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33					TGTACAACAACGGGGGCATCC	0.552	0	78.0	88.0	84.0	16	84482210	1995	4146	6141	SO:0001819	synonymous_variant	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082			9734811	Standard	XM_006721355	Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000416219.2:c.1575C>T	16.37:g.84482210C>T		B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	ENST00000416219.2	37																																																																																				ATP2C2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000433405.1		53.308420	0	-15	80	0	0	1	0	NM_014861	19	54.138082	33	0.365385
PSMF1	9491	broad.mit.edu	hg19	20	1143802	1143802	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:1143802G>A	ENST00000335877.6	+	5	756	c.580G>A	c.(580-582)Ggg>Agg	p.G194R	PSMF1_ENST00000333082.3_Missense_Mutation_p.G194R|PSMF1_ENST00000438768.2_Missense_Mutation_p.G132R|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000381898.4_Missense_Mutation_p.G106R|PSMF1_ENST00000246015.4_Missense_Mutation_p.G194R	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	194	Pro-rich.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome core complex	endopeptidase inhibitor activity|protein binding	endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13					GTTTGTTGTCGGGGGAGAAGA	0.507	0	154.0	108.0	123.0	20	1143802	2203	4300	6503	SO:0001583	missense	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818	"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""				10363639	Standard	NM_006814	Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.580G>A	20.37:g.1143802G>A	ENSP00000338039:p.Gly194Arg	A0AVQ9|D3DVW3|Q9H4I1	ENST00000335877.6	37	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940451	0.92526	.	.	ENSG00000125818	ENST00000333082;ENST00000381898;ENST00000246015;ENST00000335877;ENST00000438768	T;D;T;T;T	0.82893	-0.31;-1.66;-0.57;-0.31;-0.62	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.92648	0.7664	M	0.89904	3.07	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.93658	0.6979	10	0.72032	D	0.01	-15.2157	16.8273	0.85934	0.0:0.0:1.0:0.0	.	132;106;106;194;194	E7ER20;F5H4Z3;B4DUJ0;Q5QPM7;Q92530	.;.;.;.;PSMF1_HUMAN	R	194;106;194;194;132	ENSP00000327704:G194R;ENSP00000371323:G106R;ENSP00000246015:G194R;ENSP00000338039:G194R;ENSP00000401404:G132R	ENSP00000246015:G194R	G	+	1	0	PSMF1	1091802	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.897000	0.87356	2.735000	0.93741	0.561000	0.74099	GGG	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2		43.277950	0	-6	49	0	0	1	0	NM_178578	13	43.314368	11	0.541667
DPEP2	64174	broad.mit.edu	hg19	16	68026047	68026047	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:68026047C>T	ENST00000412757.2	-	5	1105	c.440G>A	c.(439-441)cGc>cAc	p.R147H	DPEP2_ENST00000393847.1_Missense_Mutation_p.R147H|DPEP2_ENST00000572888.1_Missense_Mutation_p.R147H			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	147		hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity	cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)	CAGGGTGAGGCGCAGGGCATC	0.602	0	111.0	104.0	106.0	16	68026047	2198	4300	6498	SO:0001583	missense	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261		23028	protein-coding gene	gene with protein product		609925				Standard	NM_022355	Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.440G>A	16.37:g.68026047C>T	ENSP00000458977:p.Arg147His	B2RCF8|Q6UX92|Q8TC95	ENST00000572888.1	37	CCDS10857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.166270|4.166270	0.78339|0.78339	.|.	.|.	ENSG00000167261|ENSG00000167261	ENST00000268795|ENST00000393847;ENST00000412757;ENST00000322384	.|T;T	.|0.24151	.|1.87;1.87	4.77|4.77	2.64|2.64	0.31445|0.31445	.|.	.|0.187643	.|0.41712	.|N	.|0.000825	T|T	0.45617|0.45617	0.1351|0.1351	M|M	0.75150|0.75150	2.29|2.29	0.80722|0.80722	D|D	1|1	P|D;D	0.46952|0.89917	0.887|1.0;1.0	B|D;D	0.35240|0.91635	0.198|0.999;0.998	T|T	0.43988|0.43988	-0.9357|-0.9357	8|10	0.87932|0.87932	D|D	0|0	-18.7858|-18.7858	7.5897|7.5897	0.28015|0.28015	0.0:0.7378:0.168:0.0942|0.0:0.7378:0.168:0.0942	.|.	105|147;60	B4DNP7|Q9H4A9;Q9H4A9-2	.|DPEP2_HUMAN;.	T|H	105|147;147;60	.|ENSP00000377430:R147H;ENSP00000412549:R147H	ENSP00000268795:A105T|ENSP00000314702:R60H	A|R	-|-	1|2	0|0	DPEP2|DPEP2	66583548|66583548	0.402000|0.402000	0.25311|0.25311	1.000000|1.000000	0.80357|0.80357	0.820000|0.820000	0.46376|0.46376	0.055000|0.055000	0.14229|0.14229	1.337000|1.337000	0.45525|0.45525	0.561000|0.561000	0.74099|0.74099	GCC|CGC	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1		81.552107	0	-10	78	0	0	1	0	NM_022355	26	81.624494	22	0.541667
PLEC	5339	broad.mit.edu	hg19	8	144990788	144990788	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:144990788C>T	ENST00000322810.4	-	32	13781	c.13612G>A	c.(13612-13614)Gac>Aac	p.D4538N	PLEC_ENST00000357649.2_Missense_Mutation_p.D4405N|PLEC_ENST00000356346.3_Missense_Mutation_p.D4387N|PLEC_ENST00000527096.1_Missense_Mutation_p.D4424N|PLEC_ENST00000354958.2_Missense_Mutation_p.D4379N|PLEC_ENST00000436759.2_Missense_Mutation_p.D4428N|PLEC_ENST00000398774.2_Missense_Mutation_p.D4369N|PLEC_ENST00000354589.3_Missense_Mutation_p.D4401N|PLEC_ENST00000345136.3_Missense_Mutation_p.D4401N	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4538	Globular 2.	cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle	NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137					CCCGGCGTGTCGGGCTCGATC	0.706	0	19.0	23.0	22.0	8	144990788	1924	4095	6019	SO:0001583	missense	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209		9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1	8633055, 8696340	Standard	XM_005250976	Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13612G>A	8.37:g.144990788C>T	ENSP00000323856:p.Asp4538Asn	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	7.445	0.641434	0.14451	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.05	4.18	0.49190	.	0.077468	0.48286	U	0.000197	T	0.54565	0.1866	N	0.05534	-0.03	0.47819	D	0.999521	P;P;P;P;P;P;P;P	0.46578	0.854;0.854;0.854;0.88;0.854;0.854;0.854;0.854	B;B;B;B;B;B;B;B	0.43889	0.213;0.213;0.213;0.435;0.213;0.308;0.213;0.213	T	0.63994	-0.6511	10	0.72032	D	0.01	.	13.5481	0.61715	0.0:0.9238:0.0:0.0762	.	4428;4387;4379;4538;4369;4401;4405;4401	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	N	4401;4405;4401;4369;4538;4379;4387;4428;4424	ENSP00000344848:D4401N;ENSP00000350277:D4405N;ENSP00000346602:D4401N;ENSP00000381756:D4369N;ENSP00000323856:D4538N;ENSP00000347044:D4379N;ENSP00000348702:D4387N;ENSP00000388180:D4428N;ENSP00000434583:D4424N	ENSP00000323856:D4538N	D	-	1	0	PLEC	145062776	1.000000	0.71417	0.109000	0.21407	0.064000	0.16182	5.880000	0.69698	1.340000	0.45581	0.643000	0.83706	GAC	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1		51.975494	0	-21	53	0	0	1	0	NM_000445	17	51.975494	17	0.500000
PRPF8	10594	broad.mit.edu	hg19	17	1559772	1559772	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:1559772C>T	ENST00000572621.1	-	35	5972	c.5707G>A	c.(5707-5709)Ggg>Agg	p.G1903R	PRPF8_ENST00000304992.6_Missense_Mutation_p.G1903R			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1903	Involved in interaction with pre-mRNA 5' splice site.		catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding	NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)	ATGAGATCCCCGAATTTTTCC	0.483	0	118.0	114.0	115.0	17	1559772	2203	4300	6503	SO:0001583	missense	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231		17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13	11468273, 10411133	Standard	NM_006445	Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5707G>A	17.37:g.1559772C>T	ENSP00000460348:p.Gly1903Arg	O14547|O75965	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	32	5.127265	0.94473	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	T	0.81330	-1.48	5.62	5.62	0.85841	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.90868	0.7131	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91144	0.4948	10	0.59425	D	0.04	-13.6657	19.645	0.95773	0.0:1.0:0.0:0.0	.	1903	Q6P2Q9	PRP8_HUMAN	R	1903;428	ENSP00000304350:G1903R	ENSP00000304350:G1903R	G	-	1	0	PRPF8	1506522	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.818000	0.86416	2.647000	0.89833	0.655000	0.94253	GGG	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		29.999430	0	-12	78	0	0	1	0		13	35.804379	54	0.194030
TTC37	9652	broad.mit.edu	hg19	5	94858978	94858978	+	Missense_Mutation	SNP	G	G	A	rs143193581	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:94858978G>A	ENST00000358746.2	-	18	1983	c.1685C>T	c.(1684-1686)aCg>aTg	p.T562M		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	562				binding	breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47					CCATTTTGCCGTTCCAGCACT	0.358	0	200.0	196.0	197.0	5	94858978	2203	4300	6503	SO:0001583	missense	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677	"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372	9205841	Standard	NM_014639	Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1685C>T	5.37:g.94858978G>A	ENSP00000351596:p.Thr562Met	O15077|Q6PJI3	ENST00000358746.2	37	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138036	0.77775	4.54E-4	0.0	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.76060	0.71;-0.99	4.88	4.88	0.63580	Tetratricopeptide repeat-containing (1);	0.207799	0.42964	D	0.000623	T	0.73305	0.3570	L	0.29908	0.895	0.28657	N	0.906322	D;D	0.55385	0.971;0.959	P;P	0.53722	0.733;0.564	T	0.70178	-0.4943	10	0.51188	T	0.08	.	14.8409	0.70223	0.0:0.1444:0.8556:0.0	.	514;562	D6RCE2;Q6PGP7	.;TTC37_HUMAN	M	562;514	ENSP00000351596:T562M;ENSP00000423742:T514M	ENSP00000351596:T562M	T	-	2	0	TTC37	94884734	0.984000	0.35163	0.967000	0.41034	0.975000	0.68041	3.518000	0.53451	2.402000	0.81655	0.557000	0.71058	ACG	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1		223.034262	0	-8	238	0	0	1	0	NM_014639	70	223.434575	87	0.445860
TOMM40	10452	broad.mit.edu	hg19	19	45404590	45404590	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:45404590G>A	ENST00000592434.1	+	9	1062	c.969G>A	c.(967-969)acG>acA	p.T323T	TOMM40_ENST00000426677.2_Intron|TOMM40_ENST00000252487.5_Intron|TOMM40_ENST00000405636.2_Intron			O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)	0		protein targeting to mitochondrion	integral to membrane of membrane fraction|integral to mitochondrial outer membrane|mitochondrial outer membrane translocase complex|pore complex	porin activity|protein transmembrane transporter activity|voltage-gated anion channel activity	breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)	GTTCCCCTACGCGGGAAACAG	0.602	0	31.0	26.0	28.0	19	45404590	2203	4300	6503	SO:0001819	synonymous_variant	AF043250	CCDS12646.1	19q13	2008-07-04				ENSG00000130204		18001	protein-coding gene	gene with protein product		608061			10980201, 15644312	Standard	NM_006114	Approved	PEREC1, D19S1177E, C19orf1, TOM40, PER-EC1	uc002paa.4	O96008		ENST00000592434.1:c.969G>A	19.37:g.45404590G>A		Q86VW4|Q8WY09|Q8WY10|Q8WY11|Q9BR95	ENST00000592434.1	37																																																																																				TOMM40-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000453240.1		11.496197	0	-1	9	0	0	1	0		4	11.791306	8	0.333333
HDAC5	10014	broad.mit.edu	hg19	17	42171083	42171083	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:42171083G>A	ENST00000225983.6	-	4	540	c.217C>T	c.(217-219)Cgg>Tgg	p.R73W	HDAC5_ENST00000586802.1_Missense_Mutation_p.R72W|HDAC5_ENST00000336057.5_Missense_Mutation_p.R72W|HDAC5_ENST00000393622.2_Missense_Mutation_p.R72W			Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	72		B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)	tgctgctcccgcAGTGTGGGG	0.652	0	12.0	13.0	13.0	17	42171083	2200	4298	6498	SO:0001583	missense	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18						14068	protein-coding gene	gene with protein product		605315			10220385, 9610721	Standard	XM_005256905	Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000225983.6:c.217C>T	17.37:g.42171083G>A	ENSP00000225983:p.Arg73Trp	C9JFV9|O60340|O60528|Q96DY4	ENST00000225983.6	37	CCDS32663.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804943	0.50315	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.50813	0.77;0.77;0.73	4.16	3.17	0.36434	Histone deacetylase, glutamine rich N-terminal domain (1);	0.000000	0.64402	D	0.000014	T	0.53642	0.1809	L	0.28115	0.83	0.50632	D	0.999886	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.994;0.996;0.994;0.996	T	0.56013	-0.8049	10	0.87932	D	0	-16.6272	11.918	0.52776	0.0:0.0:0.8236:0.1763	.	72;72;73;72	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	W	73;72;72	ENSP00000225983:R73W;ENSP00000377244:R72W;ENSP00000337290:R72W	ENSP00000225983:R73W	R	-	1	2	HDAC5	39526609	1.000000	0.71417	0.820000	0.32676	0.872000	0.50106	3.192000	0.50989	0.704000	0.31869	0.462000	0.41574	CGG	HDAC5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457683.1		7.518541	0	4	14	0	0	1	0	NM_001015053	3	8.381823	10	0.230769
ATP6AP1L	92270	broad.mit.edu	hg19	5	81608483	81608483	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:81608483G>A	ENST00000380167.4	+	9	1510	c.185G>A	c.(184-186)cGc>cAc	p.R62H	ATP6AP1L_ENST00000439350.1_Missense_Mutation_p.R62H|ATP6AP1L_ENST00000508366.1_3'UTR			Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like	62		ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12					TTTAGTTTGCGCCGAGTCGAG	0.438	0	196.0	190.0	192.0	5	81608483	2203	4300	6503	SO:0001583	missense	AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464		28091	protein-coding gene	gene with protein product						Standard	XR_112744	Approved		uc003khw.3	Q52LC2		ENST00000380167.4:c.185G>A	5.37:g.81608483G>A	ENSP00000369513:p.Arg62His		ENST00000380167.4	37	CCDS34196.1	.	.	.	.	.	.	.	.	.	.	G	5.379	0.255166	0.10185	.	.	ENSG00000205464	ENST00000380167;ENST00000439350	.	.	.	5.68	3.32	0.38043	.	0.340897	0.31685	N	0.007234	T	0.16171	0.0389	N	0.01464	-0.85	0.29384	N	0.863128	B	0.02656	0.0	B	0.01281	0.0	T	0.15607	-1.0431	9	0.11182	T	0.66	.	13.2407	0.59995	0.9309:0.0:0.0691:0.0	.	62	Q52LC2	VAS1L_HUMAN	H	62	.	ENSP00000369513:R62H	R	+	2	0	ATP6AP1L	81644239	1.000000	0.71417	0.565000	0.28409	0.001000	0.01503	3.980000	0.56895	0.440000	0.26502	-1.074000	0.02243	CGC	ATP6AP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369562.3		-14.181744	0	-31	106	0	0	1	0	NM_001017971	4	7.494964	92	0.041667
TAF1C	9013	broad.mit.edu	hg19	16	84212998	84212998	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:84212998C>T	ENST00000567759.1	-	14	2341	c.2159G>A	c.(2158-2160)cGc>cAc	p.R720H	TAF1C_ENST00000341690.6_Missense_Mutation_p.R626H|TAF1C_ENST00000566732.1_Missense_Mutation_p.R694H|TAF1C_ENST00000570117.1_Missense_Mutation_p.R388H|TAF1C_ENST00000378541.4_Missense_Mutation_p.R720H|TAF1C_ENST00000541676.1_Missense_Mutation_p.R627H	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	720		regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding	endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26					TTCCCCCAGGCGCTCACTGAG	0.726	0	20.0	23.0	22.0	16	84212998	2199	4291	6490	SO:0001583	missense	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168		11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""		7801123	Standard	NM_005679	Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000566732.1:c.2081G>A	16.37:g.84212998C>T	ENSP00000455933:p.Arg694His	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	ENST00000566732.1	37	CCDS58489.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493965	0.84962	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000544090	T;T;T	0.02682	4.2;4.2;4.2	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000006	T	0.13884	0.0336	M	0.72118	2.19	0.37624	D	0.921407	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.995;0.996;0.998;0.989	T	0.00611	-1.1645	10	0.87932	D	0	-17.1242	14.0909	0.64990	0.0:1.0:0.0:0.0	.	694;243;720;626	Q15572-6;F5H0H4;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	H	720;627;626;243	ENSP00000367802:R720H;ENSP00000437900:R627H;ENSP00000345305:R626H	ENSP00000345305:R626H	R	-	2	0	TAF1C	82770499	0.002000	0.14202	0.440000	0.26846	0.858000	0.48976	0.384000	0.20668	2.390000	0.81377	0.561000	0.74099	CGC	TAF1C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433047.1		40.713912	0	-5	37	0	0	1	0	NM_139353	15	40.816988	19	0.441176
DPYSL4	10570	broad.mit.edu	hg19	10	134008389	134008389	+	Silent	SNP	G	G	A	rs138714632	by1000genomes	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:134008389G>A	ENST00000338492.4	+	4	518	c.354G>A	c.(352-354)gcG>gcA	p.A118A	DPYSL4_ENST00000493882.1_3'UTR|DPYSL4_ENST00000368627.1_Silent_p.A41A|DPYSL4_ENST00000368629.1_Silent_p.A41A	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	118		axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)	GCCTGCTGGCGGCCTACGAGC	0.662	0	71.0	66.0	68.0	10	134008389	2203	4298	6501	SO:0001819	synonymous_variant	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640		3016	protein-coding gene	gene with protein product		608407			8973361, 9652388	Standard	NM_006426	Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.354G>A	10.37:g.134008389G>A		B2RMQ1|D3DRG5|O00240|Q5T0Q7	ENST00000338492.4	37	CCDS7665.1																																																																																			DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		51.566805	0	-29	72	0	0	1	0		17	52.064083	27	0.386364
GDAP1L1	78997	broad.mit.edu	hg19	20	42885898	42885898	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:42885898G>A	ENST00000342560.5	+	2	374	c.286G>A	c.(286-288)Gag>Aag	p.E96K	GDAP1L1_ENST00000372952.3_Missense_Mutation_p.E96K|GDAP1L1_ENST00000537864.1_Intron	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	96	GST N-terminal.				endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		CAACCTGGGCGAGGAGGTGCC	0.612	1	122.0	75.0	91.0	20	42885898	2203	4300	6503	SO:0001583	missense		CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194		4213	protein-coding gene	gene with protein product						Standard	NM_024034	Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.286G>A	20.37:g.42885898G>A	ENSP00000341782:p.Glu96Lys	B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	ENST00000342560.5	37	CCDS13328.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.032983|5.032983	0.93575|0.93575	.|.	.|.	ENSG00000124194|ENSG00000124194	ENST00000342560;ENST00000372947;ENST00000372946;ENST00000545149;ENST00000438466;ENST00000372952|ENST00000445952	T;T;T|.	0.62498|.	0.02;0.02;1.84|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51534|0.51534	0.1680|0.1680	N|N	0.13098|0.13098	0.295|0.295	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;1.0;0.999;1.0|.	D;D;D;D|.	0.83275|.	0.993;0.941;0.913;0.996|.	T|T	0.42816|0.42816	-0.9429|-0.9429	10|5	0.59425|.	D|.	0.04|.	.|.	19.3061|19.3061	0.94163|0.94163	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	96;96;96;42|.	B7Z1I3;B7Z621;Q96MZ0;Q5JY50|.	.;.;GD1L1_HUMAN;.|.	K|Q	96;94;96;65;96;96|42	ENSP00000341782:E96K;ENSP00000392881:E96K;ENSP00000362043:E96K|.	ENSP00000341782:E96K|.	E|R	+|+	1|2	0|0	GDAP1L1|GDAP1L1	42319312|42319312	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.229000|9.229000	0.95273|0.95273	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GAG|CGA	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079356.1		17.643343	0	-12	25	0	0	1	0	NM_024034	6	18.216696	13	0.315789
RNF113B	140432	broad.mit.edu	hg19	13	98829458	98829458	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:98829458G>A	ENST00000267291.6	-	1	61	c.33C>T	c.(31-33)gcC>gcT	p.A11A	FARP1_ENST00000376581.5_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000319562.6_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	11				nucleic acid binding|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)		CTGCTTGGTCGGCCGTCCTTC	0.652	0	44.0	40.0	41.0	13	98829458	2203	4300	6503	SO:0001819	synonymous_variant	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797	"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1		Standard	NM_178861	Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.33C>T	13.37:g.98829458G>A		Q8WWF9|Q96QY9	ENST00000267291.6	37	CCDS9486.1																																																																																			RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3		23.358448	0	-31	35	0	0	1	0	NM_178861	9	25.403132	27	0.250000
BZW2	28969	broad.mit.edu	hg19	7	16720938	16720938	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:16720938C>T	ENST00000433922.2	+	4	426	c.248C>T	c.(247-249)aCg>aTg	p.T83M	BZW2_ENST00000258761.3_Missense_Mutation_p.T83M|BZW2_ENST00000452975.2_Missense_Mutation_p.T83M|BZW2_ENST00000405202.1_Missense_Mutation_p.T7M|BZW2_ENST00000432311.1_3'UTR	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	83		cell differentiation|nervous system development|RNA metabolic process		protein binding	cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)	CCTGGAGGAACGCGCATAGAT	0.403	0	124.0	110.0	115.0	7	16720938	2203	4300	6503	SO:0001583	missense	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261		18808	protein-coding gene	gene with protein product					11042152	Standard	NM_001159767	Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.248C>T	7.37:g.16720938C>T	ENSP00000397249:p.Thr83Met	A4D123|Q3B779|Q96JW5|Q9H3F7	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.371822	0.82573	2.27E-4	0.0	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000452975;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	T;T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93	5.9	5.9	0.94986	.	0.058233	0.64402	D	0.000003	T	0.64227	0.2579	M	0.75777	2.31	0.58432	D	0.999999	D;D;D	0.89917	0.993;1.0;0.993	P;D;P	0.69307	0.568;0.963;0.568	T	0.65162	-0.6235	10	0.59425	D	0.04	-6.3474	15.7199	0.77700	0.0:0.8641:0.1359:0.0	.	83;83;83	E7ETZ4;Q96JW5;Q9Y6E2	.;.;BZW2_HUMAN	M	83;83;83;83;7;83;83;83	ENSP00000403481:T83M;ENSP00000258761:T83M;ENSP00000397249:T83M;ENSP00000411715:T83M;ENSP00000385577:T7M;ENSP00000412750:T83M;ENSP00000415924:T83M;ENSP00000416531:T83M	ENSP00000258761:T83M	T	+	2	0	BZW2	16687463	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.947000	0.70242	2.793000	0.96121	0.563000	0.77884	ACG	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2		9.488852	0	-4	24	0	0	1	0	NM_014038	4	11.162637	16	0.200000
SLC34A3	142680	broad.mit.edu	hg19	9	140127061	140127061	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:140127061C>T	ENST00000538474.1	+	4	434	c.210C>T	c.(208-210)gcC>gcT	p.A70A	SLC34A3_ENST00000361134.2_Silent_p.A70A	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	70		cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity	kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)	GCCGCGTGGCCGGCAGCGTCC	0.697	0	34.0	38.0	37.0	9	140127061	2199	4286	6485	SO:0001819	synonymous_variant	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569	"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""		11880379, 16358215, 16358214	Standard	NM_080877	Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.210C>T	9.37:g.140127061C>T		A2BFA1	ENST00000538474.1	37	CCDS7038.1																																																																																			SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1		-0.208111	0	-10	88	0	0	1	0	NM_080877	6	13.287800	69	0.080000
CNTNAP5	129684	broad.mit.edu	hg19	2	125204489	125204489	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:125204489C>T	ENST00000431078.1	+	6	1257	c.893C>T	c.(892-894)aCg>aTg	p.T298M		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	298	Laminin G-like 1.	cell adhesion|signal transduction	integral to membrane	receptor binding	NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)	AAGGGCGAGACGGATGCCTTA	0.557	1	107.0	112.0	110.0	2	125204489	2168	4276	6444	SO:0001583	missense	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052		18748	protein-coding gene	gene with protein product		610519				Standard	NM_130773	Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.893C>T	2.37:g.125204489C>T	ENSP00000399013:p.Thr298Met	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791954	0.50102	0.0	1.17E-4	ENSG00000155052	ENST00000431078	T	0.78126	-1.15	5.78	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.424939	0.19905	N	0.103430	T	0.77772	0.4180	L	0.40543	1.245	0.20196	N	0.999928	P	0.41450	0.75	P	0.47528	0.549	T	0.72564	-0.4255	10	0.62326	D	0.03	.	16.6118	0.84885	0.0:0.8704:0.1296:0.0	.	298	Q8WYK1	CNTP5_HUMAN	M	298	ENSP00000399013:T298M	ENSP00000399013:T298M	T	+	2	0	CNTNAP5	124920959	0.987000	0.35691	0.028000	0.17463	0.881000	0.50899	3.600000	0.54052	2.894000	0.99253	0.655000	0.94253	ACG	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		34.189485	0	1	50	0	0	1	0		12	34.952978	23	0.342857
THBS3	7059	broad.mit.edu	hg19	1	155167889	155167889	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:155167889C>T	ENST00000368378.3	-	18	2217	c.2197G>A	c.(2197-2199)Gtc>Atc	p.V733I	RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.V613I|THBS3_ENST00000541990.1_Missense_Mutation_p.V262I|THBS3_ENST00000541576.1_Missense_Mutation_p.V130I	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	733	TSP C-terminal.	cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity	breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		GGATCCAGGACGACGGTCTGA	0.552	0	134.0	111.0	118.0	1	155167889	2203	4300	6503	SO:0001583	missense	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231		11787	protein-coding gene	gene with protein product		188062			1601886	Standard	NM_007112	Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2197G>A	1.37:g.155167889C>T	ENSP00000357362:p.Val733Ile	B1AVR8|B4DQ20|Q8WV34	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576926	0.28092	.	.	ENSG00000169231	ENST00000368378;ENST00000541576;ENST00000457183;ENST00000541990	D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76	5.08	4.15	0.48705	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (1);	0.142736	0.46758	N	0.000269	T	0.70159	0.3192	N	0.17674	0.51	0.80722	D	1	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.67309	-0.5703	10	0.30854	T	0.27	-15.494	6.9756	0.24672	0.0:0.797:0.0:0.203	.	613;733;733;733	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	I	733;130;613;262	ENSP00000357362:V733I;ENSP00000444792:V130I;ENSP00000392207:V613I;ENSP00000437353:V262I	ENSP00000357362:V733I	V	-	1	0	THBS3	153434513	0.439000	0.25610	0.806000	0.32338	0.998000	0.95712	0.916000	0.28651	1.340000	0.45581	0.563000	0.77884	GTC	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1		6.981658	0	-7	50	0	0	1	0	NM_007112	4	10.190752	23	0.148148
SLC18B1	116843	broad.mit.edu	hg19	6	133094153	133094153	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:133094153G>A	ENST00000275227.4	-	10	1160	c.1064C>T	c.(1063-1065)cCg>cTg	p.P355L	SLC18B1_ENST00000538764.1_Missense_Mutation_p.P229L	NM_052831.2	NP_439896.1	Q6NT16	CF192_HUMAN	solute carrier family 18, subfamily B, member 1	355		transmembrane transport	integral to membrane								GAGAATTTCCGGGAAAGTTGG	0.398	0	69.0	70.0	69.0	6	133094153	2203	4300	6503	SO:0001583	missense	AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409	"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192	19697161	Standard	XM_006715328	Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.1064C>T	6.37:g.133094153G>A	ENSP00000275227:p.Pro355Leu	A8K1K3|B3KW77|Q6ISF2	ENST00000275227.4	37	CCDS5163.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405589	0.83230	.	.	ENSG00000146409	ENST00000275227;ENST00000538764	T;T	0.57107	0.42;0.42	5.87	5.01	0.66863	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.050618	0.85682	D	0.000000	T	0.60547	0.2277	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;0.979	D;P	0.69307	0.963;0.781	T	0.63056	-0.6722	10	0.37606	T	0.19	-10.8111	12.305	0.54898	0.0793:0.0:0.9207:0.0	.	229;355	B7Z1S5;Q6NT16	.;CF192_HUMAN	L	355;229	ENSP00000275227:P355L;ENSP00000444098:P229L	ENSP00000275227:P355L	P	-	2	0	C6orf192	133135846	1.000000	0.71417	0.910000	0.35882	0.994000	0.84299	5.535000	0.67173	1.501000	0.48654	0.585000	0.79938	CCG	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042273.1		14.432651	0	17	53	0	0	1	0	NM_052831	6	17.148848	25	0.193548
SMPD3	55512	broad.mit.edu	hg19	16	68405352	68405352	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:68405352C>T	ENST00000219334.5	-	3	1336	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	SMPD3_ENST00000568373.1_Missense_Mutation_p.V245M|SMPD3_ENST00000563226.1_Missense_Mutation_p.V245M	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	245		cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity	breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	CCGATGCGCACGATGCAGGCA	0.726	1	17.0	19.0	18.0	16	68405352	2193	4288	6481	SO:0001583	missense	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056		14240	protein-coding gene	gene with protein product		605777			10823942	Standard	NM_018667	Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.733G>A	16.37:g.68405352C>T	ENSP00000219334:p.Val245Met	B7ZL82|Q2M1S8	ENST00000219334.5	37	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663374	0.47572	.	.	ENSG00000103056	ENST00000219334	.	.	.	5.47	4.43	0.53597	.	0.461133	0.24554	N	0.037525	T	0.25344	0.0616	N	0.19112	0.55	0.34592	D	0.715587	D;D;D	0.56035	0.974;0.974;0.974	B;B;B	0.42692	0.395;0.395;0.395	T	0.29761	-1.0001	9	0.49607	T	0.09	-19.6989	5.022	0.14365	0.0:0.7532:0.0:0.2468	.	245;245;245	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	M	245	.	ENSP00000219334:V245M	V	-	1	0	SMPD3	66962853	0.891000	0.30450	0.975000	0.42487	0.124000	0.20399	1.529000	0.35996	2.563000	0.86464	0.561000	0.74099	GTG	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3		40.007995	0	8	28	0	0	1	0	NM_018667	12	41.263580	3	0.800000
DTNA	1837	broad.mit.edu	hg19	18	32395925	32395925	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:32395925C>T	ENST00000283365.9	+	8	1007	c.656C>T	c.(655-657)cCg>cTg	p.P219L	DTNA_ENST00000399121.5_Missense_Mutation_p.P219L|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000269190.7_Missense_Mutation_p.P219L|DTNA_ENST00000444659.1_Missense_Mutation_p.P219L|DTNA_ENST00000554864.3_Missense_Mutation_p.P219L|DTNA_ENST00000597599.1_Missense_Mutation_p.P219L|DTNA_ENST00000315456.6_Missense_Mutation_p.P219L|DTNA_ENST00000598334.1_Missense_Mutation_p.P219L|DTNA_ENST00000598774.1_Missense_Mutation_p.P219L|DTNA_ENST00000399113.3_Missense_Mutation_p.P219L|DTNA_ENST00000348997.5_Missense_Mutation_p.P219L|DTNA_ENST00000598142.1_Missense_Mutation_p.P219L|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000595022.1_Missense_Mutation_p.P219L|DTNA_ENST00000269191.6_Missense_Mutation_p.P219L	NM_032975.3	NP_116757.2	Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	219	Interaction with MAGEE1 (By similarity).	neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29					GATCCTCCCCCGCAGTGTCTG	0.393	5	156.0	152.0	153.0	18	32395925	2203	4300	6503	SO:0001583	missense	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769		3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239			8081380, 15834686	Standard	NM_001390	Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.656C>T	18.37:g.32395925C>T	ENSP00000382064:p.Pro219Leu	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	ENST00000399113.3	37	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	C	34	5.392049	0.95988	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	D;D;D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	6.04	6.04	0.98038	EF-hand domain, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.96803	0.8956	M	0.92219	3.285	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;0.994;0.999;1.0;1.0;1.0;0.998;1.0	D	0.96821	0.9604	10	0.87932	D	0	-17.9229	20.5948	0.99439	0.0:1.0:0.0:0.0	.	219;219;219;219;219;219;230;219;219;219;219	Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-4;E9PEH8;Q59GK7;Q9BS59;Q9Y4J8-2;Q9Y4J8-5;Q9Y4J8-7	DTNA_HUMAN;.;.;.;.;.;.;.;.;.;.	L	219	ENSP00000283365:P219L;ENSP00000322519:P219L;ENSP00000269190:P219L;ENSP00000336682:P219L;ENSP00000382072:P219L;ENSP00000405819:P219L;ENSP00000269191:P219L;ENSP00000382064:P219L	ENSP00000269190:P219L	P	+	2	0	DTNA	30649923	1.000000	0.71417	0.664000	0.29753	0.943000	0.58893	7.743000	0.85020	2.873000	0.98535	0.563000	0.77884	CCG	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2		239.170479	0	-12	196	0	0	1	0	NM_001390	76	240.384592	108	0.413043
C1QTNF8	390664	broad.mit.edu	hg19	16	1143802	1143802	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:1143802G>A	ENST00000328449.5	-	4	731	c.458C>T	c.(457-459)gCg>gTg	p.A153V		NM_207419.3	NP_997302.2	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	153	C1q.		collagen		lung(2)|prostate(1)|skin(1)	4		Hepatocellular(780;0.00369)			GAAGCGGCCCGCGGCCAGGTC	0.667	0	33.0	38.0	36.0	16	1143802	2195	4292	6487	SO:0001583	missense	AY358832	CCDS32358.1	16p13.3	2014-08-12			ENSG00000184471	ENSG00000184471		31374	protein-coding gene	gene with protein product		614147			12975309	Standard	NM_207419	Approved	UNQ5829, CTRP8	uc010uuw.1	P60827	OTTHUMG00000167756	ENST00000328449.5:c.458C>T	16.37:g.1143802G>A	ENSP00000330426:p.Ala153Val	B7U178	ENST00000328449.5	37	CCDS32358.1	.	.	.	.	.	.	.	.	.	.	g	9.290	1.050284	0.19827	.	.	ENSG00000184471	ENST00000328449	T	0.75477	-0.94	3.52	0.366	0.16136	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.874660	0.09560	N	0.785696	T	0.62708	0.2450	L	0.48642	1.525	0.09310	N	1	P	0.49185	0.92	B	0.38106	0.265	T	0.53878	-0.8376	10	0.72032	D	0.01	.	6.4102	0.21686	0.1013:0.3577:0.541:0.0	.	153	P60827	C1QT8_HUMAN	V	153	ENSP00000330426:A153V	ENSP00000330426:A153V	A	-	2	0	C1QTNF8	1083803	0.002000	0.14202	0.000000	0.03702	0.009000	0.06853	1.090000	0.30902	-0.067000	0.12976	-0.127000	0.14921	GCG	C1QTNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396120.1		3.739690	0	9	68	0	0	1	0	XM_372606	5	11.476017	44	0.102041
PIGU	128869	broad.mit.edu	hg19	20	33169374	33169374	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:33169374G>A	ENST00000374820.2	-	9	989	c.969C>T	c.(967-969)ccC>ccT	p.P323P	PIGU_ENST00000480175.1_5'UTR|PIGU_ENST00000452740.2_Silent_p.P343P			Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class U	343		attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	9					GGTTCCACACGGGGAAGAAGG	0.532	0	62.0	46.0	51.0	20	33169374	2203	4300	6503	SO:0001819	synonymous_variant	AL118520	CCDS13239.1	20q11.22	2013-02-26	2006-11-07	2006-11-07	ENSG00000101464	ENSG00000101464	"""Phosphatidylinositol glycan anchor biosynthesis"""	15791	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	608528	"""CDC91 (cell division cycle 91, S. cerevisiae, homolog)-like 1"", ""CDC91 cell division cycle 91-like 1 (S. cerevisiae)"""	CDC91L1	12802054, 15034568	Standard	NM_080476	Approved	bA346K17.2, GAB1	uc002xas.3	Q9H490	OTTHUMG00000032304	ENST00000374820.2:c.969C>T	20.37:g.33169374G>A		Q7Z489|Q8N2F2	ENST00000374820.2	37																																																																																				PIGU-201	KNOWN	basic	protein_coding	protein_coding			14.169991	0	-6	10	0	0	1	0	NM_080476	5	14.539005	10	0.333333
FNDC1	84624	broad.mit.edu	hg19	6	159646638	159646638	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:159646638G>A	ENST00000297267.9	+	8	1156	c.956G>A	c.(955-957)cGt>cAt	p.R319H	FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Missense_Mutation_p.R319H	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	319	Fibronectin type-III 3.		extracellular region		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)	GCTAACAGGCGTGTGCTGATT	0.463	0	233.0	233.0	233.0	6	159646638	1966	4165	6131	SO:0001583	missense	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694	"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2	11347906	Standard	NM_032532	Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.956G>A	6.37:g.159646638G>A	ENSP00000297267:p.Arg319His	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019229	0.75275	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.57107	0.42;0.42	5.84	5.84	0.93424	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	L	0.55481	1.735	0.39551	D	0.968971	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65207	-0.6224	10	0.59425	D	0.04	-18.2714	20.1346	0.98019	0.0:0.0:1.0:0.0	.	319;319	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	H	319	ENSP00000297267:R319H;ENSP00000342460:R319H	ENSP00000297267:R319H	R	+	2	0	FNDC1	159566626	1.000000	0.71417	0.382000	0.26119	0.521000	0.34408	9.347000	0.97059	2.765000	0.95021	0.655000	0.94253	CGT	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3		133.944794	0	-12	163	0	0	1	0	NM_032532	45	135.591141	75	0.375000
COL22A1	169044	broad.mit.edu	hg19	8	139767423	139767423	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:139767423C>T	ENST00000303045.6	-	21	2454	c.2008G>A	c.(2008-2010)Gcc>Acc	p.A670T	COL22A1_ENST00000435777.1_Missense_Mutation_p.A670T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	670	Collagen-like 4.|Gly-rich.|Pro-rich.	cell adhesion	collagen|cytoplasm	structural molecule activity	breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)		GGACCGGGGGCGCCTTGGTGA	0.552	0	71.0	76.0	75.0	8	139767423	2203	4300	6503	SO:0001583	missense	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436	"""Collagens"""	22989	protein-coding gene	gene with protein product		610026				Standard	NM_152888	Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2008G>A	8.37:g.139767423C>T	ENSP00000303153:p.Ala670Thr	B7ZMH0|C9K0G4|Q8IVT9	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.403248	0.42613	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.94330	-3.4;-3.4	4.98	4.98	0.66077	.	0.990272	0.08191	N	0.983813	D	0.89001	0.6591	L	0.31845	0.965	0.09310	N	0.999995	B	0.09022	0.002	B	0.08055	0.003	T	0.74771	-0.3552	10	0.15499	T	0.54	.	11.4433	0.50109	0.0:0.1814:0.8186:0.0	.	670	Q8NFW1	COMA1_HUMAN	T	670;670;383	ENSP00000303153:A670T;ENSP00000387655:A670T	ENSP00000303153:A670T	A	-	1	0	COL22A1	139836605	1.000000	0.71417	0.788000	0.31933	0.084000	0.17831	1.926000	0.40084	1.350000	0.45770	-0.187000	0.12897	GCC	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2		51.265440	0	-6	58	0	0	1	0	XM_291257	17	51.854818	28	0.377778
CIITA	4261	broad.mit.edu	hg19	16	11001145	11001145	+	Missense_Mutation	SNP	G	G	A	rs141095229		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:11001145G>A	ENST00000324288.8	+	11	1929	c.1796G>A	c.(1795-1797)cGg>cAg	p.R599Q	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	599	NACHT.	interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding	central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12					ACGCTCCTCCGGGACCGGCCA	0.622	0	38.0	36.0	37.0	16	11001145	2195	4300	6495	SO:0001583	missense	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583	"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA	8402893	Standard	NM_000246	Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.1796G>A	16.37:g.11001145G>A	ENSP00000316328:p.Arg599Gln	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	6.458	0.452639	0.12283	0.0	1.16E-4	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.80909	-1.43	5.1	-4.74	0.03249	NACHT nucleoside triphosphatase (1);	1.375580	0.04775	N	0.428783	T	0.62183	0.2407	N	0.17278	0.47	0.09310	N	1	B;B;B;B	0.20261	0.002;0.002;0.043;0.001	B;B;B;B	0.16289	0.003;0.001;0.015;0.001	T	0.49579	-0.8925	10	0.14656	T	0.56	.	7.8264	0.29318	0.5702:0.0:0.3207:0.1091	.	599;599;551;599	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	Q	599;551	ENSP00000316328:R599Q	ENSP00000316328:R599Q	R	+	2	0	CIITA	10908646	0.000000	0.05858	0.000000	0.03702	0.210000	0.24377	-0.048000	0.11944	-1.468000	0.01892	-0.768000	0.03414	CGG	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2		18.344654	0	-2	32	0	0	1	0	NM_000246	6	18.787138	12	0.333333
COL4A1	1282	broad.mit.edu	hg19	13	110804776	110804776	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:110804776C>T	ENST00000375820.4	-	51	4954	c.4833G>A	c.(4831-4833)gcG>gcA	p.A1611A		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1611	Collagen IV NC1.	angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		CGATGAATGGCGCACTTCTAA	0.587	0	70.0	59.0	63.0	13	110804776	2203	4300	6503	SO:0001819	synonymous_variant	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498	"""Collagens"""	2202	protein-coding gene	gene with protein product		120130			3691802	Standard	NM_001845	Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4833G>A	13.37:g.110804776C>T		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	ENST00000375820.4	37	CCDS9511.1																																																																																			COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		78.941574	0	-2	111	0	0	1	0		26	79.292882	36	0.419355
NWD1	284434	broad.mit.edu	hg19	19	16860798	16860798	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:16860798C>T	ENST00000524140.2	+	6	1763	c.1345C>T	c.(1345-1347)Cgg>Tgg	p.R449W	NWD1_ENST00000552788.1_Missense_Mutation_p.R449W|NWD1_ENST00000339803.6_Missense_Mutation_p.R314W|NWD1_ENST00000379808.3_Missense_Mutation_p.R449W|NWD1_ENST00000549814.1_Missense_Mutation_p.R449W|NWD1_ENST00000523826.1_Missense_Mutation_p.R243W	NM_001007525.3	NP_001007526.3	Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	449	NACHT.			ATP binding	NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67					CCGCCATGCTCGGAGGGTTCC	0.597	0	75.0	73.0	73.0	19	16860798	2203	4300	6503	SO:0001583	missense	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039	"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product						Standard	NM_001007525	Approved		uc002neu.4	Q149M9		ENST00000524140.2:c.1345C>T	19.37:g.16860798C>T	ENSP00000428579:p.Arg449Trp	C9J021|Q68CT3	ENST00000524140.2	37	CCDS32945.2	.	.	.	.	.	.	.	.	.	.	c	11.50	1.655792	0.29425	0.0	1.16E-4	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	4.48	-1.01	0.10169	.	0.851889	0.10202	N	0.703233	D	0.85957	0.5818	M	0.78049	2.395	0.09310	N	1	D;D;D	0.71674	0.998;0.997;0.998	P;P;P	0.57846	0.761;0.736;0.828	T	0.77419	-0.2595	10	0.39692	T	0.17	-7.41	12.7226	0.57149	0.5394:0.4606:0.0:0.0	.	449;449;314	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	W	314;449;449;449;243;449;314	ENSP00000428579:R449W;ENSP00000447548:R449W;ENSP00000369136:R449W;ENSP00000428955:R243W;ENSP00000447224:R449W;ENSP00000340159:R314W	ENSP00000340159:R314W	R	+	1	2	NWD1	16721798	0.084000	0.21492	0.000000	0.03702	0.005000	0.04900	1.890000	0.39728	0.067000	0.16545	-0.183000	0.12914	CGG	NWD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379040.3		-9.059299	0	-17	111	0	0	1	0	NM_001007525	4	7.840602	75	0.050633
FMO3	2328	broad.mit.edu	hg19	1	171086253	171086253	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:171086253G>A	ENST00000367755.4	+	9	1381	c.1270G>A	c.(1270-1272)Gag>Aag	p.E424K	FMO3_ENST00000392085.2_Missense_Mutation_p.E424K|FMO3_ENST00000538429.1_Missense_Mutation_p.E361K|FMO3_ENST00000542847.1_Missense_Mutation_p.E404K	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	424		xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity	endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				TGGCAAAAGCGAGACCATACA	0.438	0	96.0	95.0	95.0	1	171086253	2203	4300	6503	SO:0001583	missense	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933		3771	protein-coding gene	gene with protein product		136132			8486388, 9417913	Standard	NM_001002294	Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1270G>A	1.37:g.171086253G>A	ENSP00000356729:p.Glu424Lys	B2R816|Q14854|Q8N5N5	ENST00000367755.4	37	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	G	8.806	0.934057	0.18206	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.34	-1.76	0.08006	.	0.656233	0.16519	N	0.210874	T	0.09512	0.0234	N	0.16833	0.445	0.09310	N	1	B;B;B	0.32071	0.355;0.013;0.0	B;B;B	0.23852	0.049;0.004;0.003	T	0.17776	-1.0358	10	0.38643	T	0.18	-0.1812	6.9481	0.24530	0.4067:0.3774:0.2159:0.0	.	361;404;424	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	K	424;424;404;361	ENSP00000356729:E424K;ENSP00000375935:E424K;ENSP00000444073:E404K;ENSP00000439500:E361K	ENSP00000356729:E424K	E	+	1	0	FMO3	169352877	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-1.213000	0.02991	-0.028000	0.13850	0.655000	0.94253	GAG	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1		78.834050	0	-23	51	0	0	1	0	NM_006894	23	79.314294	14	0.621622
ZC3H13	23091	broad.mit.edu	hg19	13	46616352	46616352	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:46616352C>T	ENST00000242848.4	-	4	634	c.286G>A	c.(286-288)Gtg>Atg	p.V96M	ZC3H13_ENST00000282007.3_Missense_Mutation_p.V96M			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	96				nucleic acid binding|zinc ion binding	cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)	TCAGTGTCCACGTCTTGGCGC	0.413	0	211.0	193.0	199.0	13	46616352	2203	4300	6503	SO:0001583	missense	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200	"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853	10048485	Standard	XM_005266301	Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000282007.3:c.286G>A	13.37:g.46616352C>T	ENSP00000282007:p.Val96Met	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	ENST00000282007.3	37	CCDS9400.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705657	0.30232	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000428921	T;T	0.38077	2.11;1.16	5.43	4.59	0.56863	.	0.000000	0.51477	D	0.000087	T	0.23806	0.0576	L	0.27053	0.805	0.80722	D	1	P;P	0.50369	0.892;0.934	B;B	0.37650	0.13;0.255	T	0.03651	-1.1016	10	0.54805	T	0.06	.	11.295	0.49274	0.0:0.8533:0.0:0.1467	.	96;96	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	M	96	ENSP00000242848:V96M;ENSP00000282007:V96M	ENSP00000242848:V96M	V	-	1	0	ZC3H13	45514353	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.503000	0.53340	1.300000	0.44818	0.467000	0.42956	GTG	ZC3H13-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044790.2		7.741504	0	3	87	0	0	1	0	NM_015070	8	19.765855	69	0.103896
F7	2155	broad.mit.edu	hg19	13	113772927	113772927	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:113772927G>A	ENST00000375581.3	+	9	1041	c.1006G>A	c.(1006-1008)Gtg>Atg	p.V336M	F7_ENST00000541084.1_Missense_Mutation_p.V267M|F7_ENST00000346342.3_Missense_Mutation_p.V314M	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	336	Peptidase S1.	anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity	large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		GCTGGCCTTCGTGCGCTTCTC	0.677	0	50.0	44.0	46.0	13	113772927	2202	4298	6500	SO:0001583	missense		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878			3264725, 2511201	Standard	NM_000131	Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.1006G>A	13.37:g.113772927G>A	ENSP00000364731:p.Val336Met	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	ENST00000375581.3	37	CCDS9528.1	.	.	.	.	.	.	.	.	.	.	G	9.376	1.071860	0.20147	2.27E-4	0.0	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.88509	-2.39;-2.39;-2.39	4.41	-2.42	0.06542	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.386281	0.26616	N	0.023387	D	0.89037	0.6601	L	0.46157	1.445	0.20563	N	0.99989	D;D;D	0.76494	0.998;0.998;0.999	D;P;P	0.64776	0.929;0.866;0.889	T	0.82502	-0.0425	10	0.45353	T	0.12	.	9.9882	0.41854	0.5973:0.0:0.4027:0.0	.	267;314;336	F5H8B0;P08709-2;P08709	.;.;FA7_HUMAN	M	314;267;336	ENSP00000329546:V314M;ENSP00000442051:V267M;ENSP00000364731:V336M	ENSP00000329546:V314M	V	+	1	0	F7	112820928	0.180000	0.23148	0.045000	0.18777	0.011000	0.07611	0.625000	0.24477	-0.303000	0.08856	-0.373000	0.07131	GTG	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4		18.715348	0	-9	29	0	0	1	0	NM_000131	7	19.648349	17	0.291667
NOTCH2	4853	broad.mit.edu	hg19	1	120506201	120506201	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:120506201C>T	ENST00000256646.2	-	11	2130	c.1911G>A	c.(1909-1911)acG>acA	p.T637T		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	637	EGF-like 16; calcium-binding (Potential).	anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity	breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	GCTTACCTGACGTGCCTGGCT	0.483	1	204.0	177.0	186.0	1	120506201	2203	4300	6503	SO:0001819	synonymous_variant	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250	"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""		7698746	Standard	NM_001200001	Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.1911G>A	1.37:g.120506201C>T		Q5T3X7|Q99734|Q9H240	ENST00000256646.2	37	CCDS908.1																																																																																			NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		-9.011320	0	-34	192	0	0	1	0	NM_024408	9	19.955321	136	0.062069
DNAH2	146754	broad.mit.edu	hg19	17	7696114	7696114	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:7696114G>A	ENST00000572933.1	+	47	8745	c.7285G>A	c.(7285-7287)Gtt>Att	p.V2429I	DNAH2_ENST00000389173.2_Missense_Mutation_p.V2429I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2429	AAA 3 (By similarity).	ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)			CGCCCAGAGCGTTCTGCAGTC	0.632	1	74.0	67.0	69.0	17	7696114	2203	4300	6503	SO:0001583	missense	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914	"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3	9256245	Standard	XM_005256470	Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7285G>A	17.37:g.7696114G>A	ENSP00000458355:p.Val2429Ile	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726781	0.69074	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.17054	2.3	5.47	5.47	0.80525	ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000001	T	0.21227	0.0511	L	0.61218	1.895	0.80722	D	1	P	0.46142	0.873	B	0.39590	0.304	T	0.02691	-1.1123	10	0.27785	T	0.31	.	18.1078	0.89526	0.0:0.0:1.0:0.0	.	2429	Q9P225	DYH2_HUMAN	I	2429	ENSP00000373825:V2429I	ENSP00000353818:V2429I	V	+	1	0	DNAH2	7636839	1.000000	0.71417	0.946000	0.38457	0.785000	0.44390	5.842000	0.69417	2.573000	0.86826	0.643000	0.83706	GTT	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		26.536550	0	2	64	0	0	1	0	NM_020877	10	28.134896	26	0.277778
KCNMA1	3778	broad.mit.edu	hg19	10	78651328	78651328	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:78651328G>A	ENST00000286627.5	-	25	4075	c.3123C>T	c.(3121-3123)cgC>cgT	p.R1041R	KCNMA1_ENST00000354353.5_Silent_p.R1102R|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000372443.1_Silent_p.R1068R|KCNMA1_ENST00000406533.3_Silent_p.R1103R|KCNMA1_ENST00000372440.1_Silent_p.R1041R|RP11-443A13.5_ENST00000609102.1_RNA|KCNMA1_ENST00000286628.8_Silent_p.R1099R|RP11-443A13.5_ENST00000429850.2_RNA|KCNMA1_ENST00000404771.3_Silent_p.R1099R|KCNMA1_ENST00000404857.1_Silent_p.R1082R|RP11-443A13.5_ENST00000595702.1_RNA	NM_001271519.1|NM_002247.3	NP_001258448.1|NP_002238.2	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1099	Segment S10.	cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity	breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		ACTGGGCCACGCGGCAGCGGT	0.607	0	42.0	40.0	41.0	10	78651328	2203	4300	6503	SO:0001819	synonymous_variant	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO	7987297, 16382103	Standard	NM_002247	Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286627.5:c.3123C>T	10.37:g.78651328G>A		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	ENST00000286627.5	37	CCDS7352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.688|2.688	-0.273736|-0.273736	0.05679|0.05679	0.0|0.0	1.16E-4|1.16E-4	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208	.|T	.|0.21932	.|1.98	5.61|5.61	-11.2|-11.2	0.00127|0.00127	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.17577|0.17577	0.0422|0.0422	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.61232|0.61232	-0.7104|-0.7104	4|7	.|0.87932	.|D	.|0	-9.6252|-9.6252	2.4339|2.4339	0.04478|0.04478	0.413:0.2406:0.0732:0.2732|0.413:0.2406:0.0732:0.2732	.|.	.|.	.|.	.|.	V|C	992|1030;749	.|ENSP00000402150:R749C	.|ENSP00000361498:R1030C	A|R	-|-	2|1	0|0	KCNMA1|KCNMA1	78321334|78321334	0.001000|0.001000	0.12720|0.12720	0.044000|0.044000	0.18714|0.18714	0.451000|0.451000	0.32288|0.32288	-1.897000|-1.897000	0.01603|0.01603	-3.516000|-3.516000	0.00148|0.00148	-0.143000|-0.143000	0.13931|0.13931	GCG|CGT	KCNMA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048877.3		31.319184	0	-11	25	0	0	1	0	NM_002247	11	31.521555	16	0.407407
CTTNBP2	83992	broad.mit.edu	hg19	7	117375046	117375046	+	Missense_Mutation	SNP	C	C	T	rs35288952		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:117375046C>T	ENST00000160373.3	-	16	3888	c.3797G>A	c.(3796-3798)cGc>cAc	p.R1266H		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1266					breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)	CTGCACCCAGCGGAAATGCTG	0.532	0	69.0	72.0	71.0	7	117375046	2203	4300	6503	SO:0001583	missense		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063	"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8	11707066	Standard	XM_005250635	Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3797G>A	7.37:g.117375046C>T	ENSP00000160373:p.Arg1266His	O43389|Q7LG11|Q9C0A5	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608420	0.87258	.	.	ENSG00000077063	ENST00000160373	T	0.77358	-1.09	5.38	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.87629	0.6225	M	0.87547	2.89	0.58432	D	0.999998	D	0.89917	1.0	D	0.69479	0.964	D	0.88751	0.3250	10	0.87932	D	0	-4.1387	10.1297	0.42672	0.1363:0.7925:0.0:0.0712	.	1266	Q8WZ74	CTTB2_HUMAN	H	1266	ENSP00000160373:R1266H	ENSP00000160373:R1266H	R	-	2	0	CTTNBP2	117162282	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.438000	0.66550	1.390000	0.46547	0.655000	0.94253	CGC	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4		19.791701	0	-2	37	0	0	1	0	NM_033427	8	22.149898	27	0.228571
WDR16	146845	broad.mit.edu	hg19	17	9532119	9532119	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:9532119G>A	ENST00000352665.5	+	9	1225	c.1156G>A	c.(1156-1158)Ggc>Agc	p.G386S	WDR16_ENST00000299764.5_Missense_Mutation_p.G396S|WDR16_ENST00000396219.3_Missense_Mutation_p.G318S	NM_145054.4	NP_659491.4	Q8N1V2	WDR16_HUMAN	WD repeat domain 16	386			cytoplasm|intracellular membrane-bounded organelle	protein binding	NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31					CATGAGGGACGGCAAAAGCAT	0.522	0	137.0	103.0	115.0	17	9532119	2203	4300	6503	SO:0001583	missense	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596	"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804			15967112	Standard	NM_001080556	Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1156G>A	17.37:g.9532119G>A	ENSP00000339449:p.Gly386Ser		ENST00000352665.5	37	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	G	32	5.156536	0.94686	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;T;T	0.56611	0.45;2.35;1.91	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	M	0.84773	2.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79235	-0.1887	10	0.59425	D	0.04	-24.8957	18.4726	0.90779	0.0:0.0:1.0:0.0	.	396;318;386	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	S	386;318;396	ENSP00000339449:G386S;ENSP00000379521:G318S;ENSP00000299764:G396S	ENSP00000299764:G396S	G	+	1	0	WDR16	9472844	1.000000	0.71417	0.966000	0.40874	0.829000	0.46940	9.250000	0.95477	2.637000	0.89404	0.563000	0.77884	GGC	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2		29.972805	0	0	81	0	0	1	0	NM_145054	12	33.614731	41	0.226415
CASKIN1	57524	broad.mit.edu	hg19	16	2231447	2231447	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:2231447G>A	ENST00000343516.6	-	18	2014	c.1922C>T	c.(1921-1923)cCg>cTg	p.P641L		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	641		signal transduction	cytoplasm		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28					GCAGTCGGCCGGTGTGGGCTC	0.672	0	16.0	24.0	22.0	16	2231447	1975	4138	6113	SO:0001583	missense	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971	"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184			12040031	Standard	NM_020764	Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1922C>T	16.37:g.2231447G>A	ENSP00000345436:p.Pro641Leu	Q9P2P0	ENST00000343516.6	37	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	G	9.554	1.116819	0.20795	2.53E-4	1.21E-4	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.68903	-0.36	4.41	4.41	0.53225	.	.	.	.	.	T	0.50069	0.1594	L	0.36672	1.1	0.48288	D	0.999623	P	0.42556	0.783	B	0.27887	0.084	T	0.60136	-0.7322	9	0.66056	D	0.02	-13.9855	12.367	0.55234	0.0:0.0:1.0:0.0	.	641	Q8WXD9	CSKI1_HUMAN	L	641;470	ENSP00000345436:P641L	ENSP00000345436:P641L	P	-	2	0	CASKIN1	2171448	0.998000	0.40836	0.308000	0.25141	0.173000	0.22820	4.591000	0.61019	2.286000	0.76751	0.555000	0.69702	CCG	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1		46.757618	0	7	30	0	0	1	0	NM_020764	14	47.472700	6	0.700000
TBC1D15	64786	broad.mit.edu	hg19	12	72288569	72288569	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:72288569G>A	ENST00000550746.1	+	8	876	c.812G>A	c.(811-813)cGa>cAa	p.R271Q	TBC1D15_ENST00000319106.8_Missense_Mutation_p.R262Q|TBC1D15_ENST00000393309.3_Missense_Mutation_p.R25Q|TBC1D15_ENST00000485960.2_Missense_Mutation_p.R254Q	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	271				protein binding|Rab GTPase activator activity	NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					ACACATCAACGACCACCTTCA	0.388	0	97.0	96.0	96.0	12	72288569	2203	4299	6502	SO:0001583	missense	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749		25694	protein-coding gene	gene with protein product		612662			16055087	Standard	NM_022771	Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000485960.2:c.761G>A	12.37:g.72288569G>A	ENSP00000420678:p.Arg254Gln	B4DMT9|B9A6L6|J3KNI9|Q9HA83	ENST00000485960.2	37	CCDS53814.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103992	0.94245	.	.	ENSG00000121749	ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960;ENST00000393309	T;T;T;T	0.08984	3.2;3.23;3.24;3.03	5.35	5.35	0.76521	.	0.066930	0.64402	D	0.000008	T	0.15522	0.0374	N	0.25485	0.75	0.58432	D	0.99999	D;D;D	0.76494	0.999;0.999;0.999	P;D;P	0.63793	0.83;0.918;0.652	T	0.17410	-1.0370	10	0.10636	T	0.68	-10.7911	19.1192	0.93355	0.0:0.0:1.0:0.0	.	262;254;271	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	Q	271;155;262;254;25	ENSP00000448182:R271Q;ENSP00000318262:R262Q;ENSP00000420678:R254Q;ENSP00000376986:R25Q	ENSP00000318262:R262Q	R	+	2	0	TBC1D15	70574836	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.962000	0.87912	2.519000	0.84933	0.644000	0.83932	CGA	TBC1D15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351267.2		85.481592	0	3	91	0	0	1	0	NM_022771	28	85.515395	31	0.474576
IL17RD	54756	broad.mit.edu	hg19	3	57131830	57131830	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:57131830C>T	ENST00000296318.7	-	12	1989	c.1901G>A	c.(1900-1902)cGg>cAg	p.R634Q	IL17RD_ENST00000320057.5_Missense_Mutation_p.R490Q|IL17RD_ENST00000463523.1_Missense_Mutation_p.R490Q|IL17RD_ENST00000427856.2_Missense_Mutation_p.R610Q	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	634			Golgi membrane|integral to membrane|plasma membrane	receptor activity	breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)	AAGGGCAGGCCGGGCCTCCCC	0.667	0	19.0	22.0	21.0	3	57131830	2203	4297	6500	SO:0001583	missense	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730	"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807			11802164, 12604616	Standard	NM_017563	Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.1901G>A	3.37:g.57131830C>T	ENSP00000296318:p.Arg634Gln	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	C	9.532	1.111154	0.20714	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.08896	3.05;3.04;3.04;3.04	5.4	-1.6	0.08426	.	1.456630	0.03805	N	0.265075	T	0.02848	0.0085	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.04013	0.001;0.0;0.001	T	0.39961	-0.9588	10	0.08381	T	0.77	-0.9368	6.0973	0.20027	0.1292:0.2996:0.0:0.5712	.	490;634;610	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	Q	634;490;610;490	ENSP00000296318:R634Q;ENSP00000322250:R490Q;ENSP00000399209:R610Q;ENSP00000417516:R490Q	ENSP00000296318:R634Q	R	-	2	0	IL17RD	57106870	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.247000	0.08866	-0.225000	0.09913	-0.229000	0.12294	CGG	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1		20.353039	0	-9	12	0	0	1	0	NM_017563	6	20.574593	3	0.666667
ZSCAN20	7579	broad.mit.edu	hg19	1	33960849	33960849	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:33960849C>T	ENST00000361328.3	+	8	3058	c.2905C>T	c.(2905-2907)Cgt>Tgt	p.R969C		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	969		viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)			AAAATTCTTCCGTGACCGTTC	0.498	0	86.0	98.0	94.0	1	33960849	2133	4266	6399	SO:0001583	missense	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903	"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31	2288909	Standard	NM_145238	Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2905C>T	1.37:g.33960849C>T	ENSP00000355053:p.Arg969Cys	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645830	0.47258	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.66	2.62	0.31277	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.214120	0.33199	N	0.005163	T	0.56292	0.1975	M	0.65975	2.015	0.23391	N	0.997777	D;D	0.89917	1.0;1.0	P;D	0.79784	0.878;0.993	T	0.42565	-0.9444	9	0.56958	D	0.05	-10.9767	7.3491	0.26680	0.4334:0.4902:0.0:0.0764	.	968;969	P17040-3;P17040	.;ZSC20_HUMAN	C	969;903;903	.	ENSP00000324450:R969C	R	+	1	0	ZSCAN20	33733436	0.156000	0.22821	0.986000	0.45419	0.997000	0.91878	0.294000	0.19047	0.705000	0.31890	0.655000	0.94253	CGT	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2		62.429652	0	6	62	0	0	1	0	NM_145238	19	62.594908	14	0.575758
GLP1R	2740	broad.mit.edu	hg19	6	39053698	39053698	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:39053698G>A	ENST00000373256.4	+	13	1284	c.1241G>A	c.(1240-1242)cGg>cAg	p.R414Q		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	414		activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled	breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					CTGGAATTTCGGAAGAGCTGG	0.547	0	139.0	142.0	141.0	6	39053698	2203	4300	6503	SO:0001583	missense		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164	"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032				Standard	NM_002062	Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.1241G>A	6.37:g.39053698G>A	ENSP00000362353:p.Arg414Gln	Q2M229|Q99669	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663489	0.47572	0.0	1.16E-4	ENSG00000112164	ENST00000373256	T	0.64803	-0.12	6.17	5.3	0.74995	.	0.000000	0.64402	D	0.000009	T	0.36248	0.0960	L	0.45285	1.41	0.41956	D	0.990683	B	0.18610	0.029	B	0.17433	0.018	T	0.14392	-1.0474	10	0.22109	T	0.4	.	10.3961	0.44201	0.1911:0.0:0.8089:0.0	.	414	P43220	GLP1R_HUMAN	Q	414	ENSP00000362353:R414Q	ENSP00000362353:R414Q	R	+	2	0	GLP1R	39161676	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.976000	0.40579	2.941000	0.99782	0.655000	0.94253	CGG	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		245.622614	0	-34	213	0	0	1	0		75	245.628300	77	0.493421
TTBK1	84630	broad.mit.edu	hg19	6	43251679	43251679	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:43251679G>A	ENST00000259750.4	+	14	3284	c.3201G>A	c.(3199-3201)tcG>tcA	p.S1067S		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1067			cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		ACACGGGCTCGGAGCCCTCAG	0.677	0	22.0	22.0	22.0	6	43251679	2175	4237	6412	SO:0001819	synonymous_variant	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216		19140	protein-coding gene	gene with protein product					11347906	Standard	XM_006715229	Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3201G>A	6.37:g.43251679G>A		A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	ENST00000259750.4	37	CCDS34455.1																																																																																			TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		25.197780	0	-3	31	0	0	1	0		8	25.246163	10	0.444444
BIRC5	332	broad.mit.edu	hg19	17	76212052	76212052	+	Missense_Mutation	SNP	C	C	T	rs115296168	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:76212052C>T	ENST00000301633.4	+	3	358	c.227C>T	c.(226-228)cCg>cTg	p.P76L	BIRC5_ENST00000350051.3_Intron|BIRC5_ENST00000374948.2_Intron|BIRC5_ENST00000592734.1_Intron|AC087645.1_ENST00000600484.1_Intron	NM_001012271.1	NP_001012271.1	O15392	BIRC5_HUMAN	baculoviral IAP repeat containing 5	74		anti-apoptosis|apoptosis|cell division|chromosome segregation|cytokinesis|establishment of chromosome localization|G2/M transition of mitotic cell cycle|mitosis|mitotic prometaphase|positive regulation of exit from mitosis|positive regulation of mitotic cell cycle|protein complex localization|spindle checkpoint	centriole|chromosome passenger complex|chromosome, centromeric region|cytoplasm|cytoplasmic microtubule|cytosol|interphase microtubule organizing center|midbody|nuclear chromosome|spindle|spindle microtubule	caspase inhibitor activity|chaperone binding|cobalt ion binding|cofactor binding|cysteine-type endopeptidase inhibitor activity|metal ion binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|Ran GTPase binding|zinc ion binding	kidney(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)		TACAGTGggccgggcacggtg	0.582	0	76.0	80.0	79.0	17	76212052	2203	4300	6503	SO:0001583	missense	U75285	CCDS11755.1, CCDS32751.1, CCDS32752.1	17q25.3	2013-01-17	2011-01-25		ENSG00000089685	ENSG00000089685	"""Baculoviral IAP repeat containing"""	593	protein-coding gene	gene with protein product	"""survivin variant 3 alpha"""	603352	"""apoptosis inhibitor 4"", ""baculoviral IAP repeat-containing 5"""	API4	8106347, 7947793	Standard	XR_243654	Approved	EPR-1, survivin	uc002jvf.3	O15392		ENST00000301633.4:c.227C>T	17.37:g.76212052C>T	ENSP00000301633:p.Pro76Leu	A2SUH6|B2R4R1|Q2I3N8|Q4VGX0|Q53F61|Q5MGC6|Q6FHL2|Q75SP2|Q9P2W8	ENST00000301633.4	37	CCDS32752.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	5.906	0.351257	0.11182	0.002497	0.0	ENSG00000089685	ENST00000301633;ENST00000432014	T	0.64803	-0.12	0.352	-0.704	0.11256	.	.	.	.	.	T	0.60340	0.2261	L	0.28400	0.85	0.09310	N	1	D;D	0.63046	0.99;0.992	P;D	0.63283	0.859;0.913	T	0.51140	-0.8743	8	0.51188	T	0.08	.	.	.	.	.	76;53	O15392-2;A3E0Z5	.;.	L	76	ENSP00000301633:P76L	ENSP00000301633:P76L	P	+	2	0	BIRC5	73723647	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	-0.277000	0.08502	-0.424000	0.07382	0.121000	0.15741	CCG	BIRC5-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000437234.3		55.446130	0	-13	50	0	0	1	0	NM_001168	20	55.945671	31	0.392157
PVRL1	5818	broad.mit.edu	hg19	11	119535574	119535574	+	Silent	SNP	G	G	A	rs141036439		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:119535574G>A	ENST00000264025.3	-	6	1967	c.1437C>T	c.(1435-1437)gaC>gaT	p.D479D	PVRL1_ENST00000341398.2_Intron	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	479		adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity	breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)	CCCCGTAGCCGTCCTGACGGG	0.627	0	53.0	48.0	49.0	11	119535574	2199	4295	6494	SO:0001819	synonymous_variant	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4	7721102, 9616127	Standard	NM_203285	Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1437C>T	11.37:g.119535574G>A		O75465|Q2M3D3|Q9HBE6|Q9HBW2	ENST00000264025.3	37	CCDS8426.1																																																																																			PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1		5.784922	0	-3	36	0	0	1	0		4	8.992273	23	0.148148
RERE	473	broad.mit.edu	hg19	1	8716302	8716302	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:8716302G>A	ENST00000337907.3	-	3	689	c.55C>T	c.(55-57)Cgg>Tgg	p.R19W	RERE_ENST00000400908.2_Missense_Mutation_p.R19W|RERE_ENST00000400907.2_Missense_Mutation_p.R19W	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	19		multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)	tctcggtcccggtctcggtcc	0.527	0	148.0	154.0	152.0	1	8716302	2203	4300	6503	SO:0001583	missense	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599	"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L	10814707, 10729226	Standard	NM_012102	Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.55C>T	1.37:g.8716302G>A	ENSP00000338629:p.Arg19Trp	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244346	0.59103	.	.	ENSG00000142599	ENST00000337907;ENST00000400907;ENST00000400908	T;T	0.52526	0.66;0.66	5.45	2.34	0.29019	.	.	.	.	.	T	0.52948	0.1766	N	0.24115	0.695	0.48395	D	0.999647	D	0.89917	1.0	D	0.77557	0.99	T	0.56944	-0.7895	9	0.87932	D	0	-17.8329	13.5119	0.61517	0.0:0.0:0.5942:0.4058	.	19	Q9P2R6	RERE_HUMAN	W	19	ENSP00000338629:R19W;ENSP00000383700:R19W	ENSP00000338629:R19W	R	-	1	2	RERE	8638889	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.103000	0.41806	0.623000	0.30267	0.557000	0.71058	CGG	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		6.075724	0	-33	130	0	0	1	0		10	23.593272	96	0.094340
FMNL1	752	broad.mit.edu	hg19	17	43320614	43320614	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:43320614C>T	ENST00000331495.3	+	17	2476	c.2140C>T	c.(2140-2142)Cgg>Tgg	p.R714W	FMNL1_ENST00000328118.3_Missense_Mutation_p.R714W|FMNL1_ENST00000587489.1_Missense_Mutation_p.R292W	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	714	FH2.	actin cytoskeleton organization		actin binding|Rho GTPase binding	biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33					TGAGGCCAACCGGGCCAAGAA	0.627	0	71.0	69.0	70.0	17	43320614	2203	4300	6503	SO:0001583	missense	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922		1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL	9799091	Standard	NM_005892	Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.2140C>T	17.37:g.43320614C>T	ENSP00000329219:p.Arg714Trp	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	ENST00000331495.3	37	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	c	18.97	3.735048	0.69189	.	.	ENSG00000184922	ENST00000328118;ENST00000331495;ENST00000539884	T;T	0.22336	1.96;1.96	4.24	2.13	0.27403	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.106801	0.64402	D	0.000010	T	0.53498	0.1800	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63501	-0.6623	10	0.87932	D	0	.	11.7488	0.51837	0.4334:0.5666:0.0:0.0	.	714	O95466	FMNL_HUMAN	W	714;714;369	ENSP00000327442:R714W;ENSP00000329219:R714W	ENSP00000327442:R714W	R	+	1	2	FMNL1	40676397	0.999000	0.42202	1.000000	0.80357	0.927000	0.56198	0.686000	0.25392	0.484000	0.27630	0.436000	0.28706	CGG	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1		8.919293	0	21	88	0	0	1	0	NM_005892	6	14.791251	39	0.133333
VWA2	340706	broad.mit.edu	hg19	10	116048825	116048825	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:116048825G>A	ENST00000603594.1	+	12	2020	c.1699G>A	c.(1699-1701)Gtg>Atg	p.V567M	VWA2_ENST00000392982.3_Missense_Mutation_p.V567M	NM_001272046.1	NP_001258975.1	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	567	VWFA 3.		extracellular region		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)	GAACCCTGACGTGACACAGGT	0.592	0	72.0	66.0	68.0	10	116048825	2203	4300	6503	SO:0001583	missense	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816		24709	protein-coding gene	gene with protein product					15580307, 14506275	Standard	NM_001272046	Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1699G>A	10.37:g.116048825G>A	ENSP00000376708:p.Val567Met	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	G	15.87	2.959384	0.53400	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	T	0.77750	-1.12	5.43	4.53	0.55603	von Willebrand factor, type A (3);	0.074249	0.53938	D	0.000042	D	0.85932	0.5812	M	0.70275	2.135	0.33620	D	0.604673	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.965;1.0;0.999	D	0.89553	0.3801	10	0.48119	T	0.1	.	12.1829	0.54221	0.0797:0.0:0.9203:0.0	.	263;567;567	Q5GFL6-3;Q5GFL6;Q5GFL6-2	.;VWA2_HUMAN;.	M	567	ENSP00000376708:V567M	ENSP00000298715:V567M	V	+	1	0	VWA2	116038815	1.000000	0.71417	0.853000	0.33588	0.402000	0.30811	5.569000	0.67391	1.297000	0.44761	-0.140000	0.14226	GTG	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3		51.505132	0	-4	34	0	0	1	0	NM_198496	16	51.573246	13	0.551724
KIAA1462	57608	broad.mit.edu	hg19	10	30318556	30318556	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:30318556C>T	ENST00000375377.1	-	3	622	c.521G>A	c.(520-522)cGa>cAa	p.R174Q		NM_020848.2	NP_065899.1	Q9P266	K1462_HUMAN	KIAA1462	174					breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75					ACCTGACATTCGCAATTCTTC	0.547	0	258.0	254.0	255.0	10	30318556	2095	4209	6304	SO:0001583	missense	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757		29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398			10819331, 21884682	Standard	NM_020848	Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.521G>A	10.37:g.30318556C>T	ENSP00000364526:p.Arg174Gln	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858732	0.51376	.	.	ENSG00000165757	ENST00000375377	T	0.14266	2.52	5.36	4.35	0.52113	.	0.241615	0.38959	N	0.001507	T	0.20170	0.0485	L	0.60455	1.87	0.31077	N	0.712407	D	0.76494	0.999	P	0.55871	0.786	T	0.18713	-1.0328	10	0.45353	T	0.12	-14.9531	2.987	0.05971	0.0:0.4948:0.307:0.1982	.	174	Q9P266	K1462_HUMAN	Q	174	ENSP00000364526:R174Q	ENSP00000364526:R174Q	R	-	2	0	KIAA1462	30358562	0.122000	0.22280	0.821000	0.32701	0.016000	0.09150	3.185000	0.50934	2.508000	0.84585	0.655000	0.94253	CGA	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1		2.853603	0	-43	177	0	0	1	0	NM_020848	13	29.855580	141	0.084416
GRHL3	57822	broad.mit.edu	hg19	1	24669203	24669203	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:24669203G>A	ENST00000361548.4	+	10	1456	c.1226G>A	c.(1225-1227)cGc>cAc	p.R409H	GRHL3_ENST00000342072.4_Missense_Mutation_p.R316H|GRHL3_ENST00000356046.2_Missense_Mutation_p.R363H|GRHL3_ENST00000350501.5_Missense_Mutation_p.R409H|GRHL3_ENST00000236255.4_Missense_Mutation_p.R414H	NM_198173.2	NP_937816.1	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	409		regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)	AGGAAGATGCGCGATGACGAG	0.607	0	91.0	91.0	91.0	1	24669203	2203	4300	6503	SO:0001583	missense	AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055		25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4	12549979	Standard	NM_021180	Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000361548.4:c.1226G>A	1.37:g.24669203G>A	ENSP00000354943:p.Arg409His	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	ENST00000361548.4	37	CCDS44088.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252673	0.95336	.	.	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.69824	0.963;0.966;0.966	T	0.54964	-0.8214	10	0.87932	D	0	-26.275	17.3827	0.87408	0.0:0.0:1.0:0.0	.	363;414;409	A2A297;Q8TE85-2;G3XAF0	.;.;.	H	409;316;409;363;414	ENSP00000354943:R409H;ENSP00000340543:R316H;ENSP00000288955:R409H;ENSP00000348333:R363H;ENSP00000236255:R414H	ENSP00000236255:R414H	R	+	2	0	GRHL3	24541790	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.306000	0.96204	2.585000	0.87301	0.655000	0.94253	CGC	GRHL3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392498.1		43.724237	0	0	112	0	0	1	0	NM_021180	16	45.702628	38	0.296296
ZNF423	23090	broad.mit.edu	hg19	16	49669602	49669602	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:49669602C>T	ENST00000561648.1	-	4	3514	c.3461G>A	c.(3460-3462)cGg>cAg	p.R1154Q	ZNF423_ENST00000562871.1_Missense_Mutation_p.R1094Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.R1094Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.R1037Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.R1037Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.R1094Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.R1154Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1154		cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)			GGTGCCTTTCCGGGGCCCACT	0.647	0	73.0	65.0	68.0	16	49669602	2199	4300	6499	SO:0001583	missense	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935	"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557			9872452, 10660046	Standard	NM_001271620	Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3461G>A	16.37:g.49669602C>T	ENSP00000455426:p.Arg1154Gln	O94860|Q76N04|Q9NZ13	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	6.234	0.411350	0.11812	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08370	3.1;3.14	5.04	5.04	0.67666	.	0.162594	0.53938	D	0.000047	T	0.04634	0.0126	N	0.08118	0	0.30752	N	0.744979	B	0.21309	0.054	B	0.17433	0.018	T	0.21552	-1.0242	9	.	.	.	-11.3172	12.7995	0.57578	0.0:0.9215:0.0:0.0785	.	1154	Q2M1K9	ZN423_HUMAN	Q	1154;1037	ENSP00000262383:R1154Q;ENSP00000442321:R1037Q	.	R	-	2	0	ZNF423	48227103	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.803000	0.38863	2.344000	0.79699	0.561000	0.74099	CGG	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1		47.454293	0	-16	92	0	0	1	0	NM_015069	17	49.240682	38	0.309091
PCDHGA6	0	broad.mit.edu	hg19	5	140754748	140754748	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:140754748C>T	ENST00000517434.1	+	1	1098	c.1098C>T	c.(1096-1098)atC>atT	p.I366I	PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1									breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		GAACAGTAATCGCCCTTTTTC	0.433	0	93.0	95.0	95.0	5	140754748	1916	4136	6052	SO:0001819	synonymous_variant	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731	"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293			10380929	Standard	NM_018919	Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1098C>T	5.37:g.140754748C>T		A6H8K7|B2RN55|Q9Y5D1	ENST00000517434.1	37	CCDS54926.1																																																																																			PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1		-2.043902	0	-18	63	0	0	1	0	NM_018919	4	8.822103	53	0.070175
COL9A2	1298	broad.mit.edu	hg19	1	40776803	40776803	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:40776803G>A	ENST00000372748.3	-	12	688	c.592C>T	c.(592-594)Cgc>Tgc	p.R198C		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	198	Triple-helical region 3 (COL3).	axon guidance|skeletal system development	collagen type IX		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)		AGAATCCCGCGTTTGCCCGCA	0.622	0	146.0	123.0	131.0	1	40776803	2203	4300	6503	SO:0001583	missense	M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089	"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2	8454052, 8528240, 1429648	Standard	NM_001852	Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.592C>T	1.37:g.40776803G>A	ENSP00000361834:p.Arg198Cys	B2RMP9	ENST00000372748.3	37	CCDS450.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.41|17.41	3.382468|3.382468	0.61845|0.61845	.|.	.|.	ENSG00000049089|ENSG00000049089	ENST00000372748|ENST00000417105	D|.	0.94376|.	-3.41|.	5.63|5.63	3.71|3.71	0.42584|0.42584	.|.	0.409517|.	0.26196|.	N|.	0.025765|.	T|T	0.59183|0.59183	0.2175|0.2175	M|M	0.78801|0.78801	2.425|2.425	0.09310|0.09310	N|N	1|1	D|.	0.59357|.	0.985|.	P|.	0.51101|.	0.659|.	T|T	0.51092|0.51092	-0.8749|-0.8749	10|5	0.66056|.	D|.	0.02|.	.|.	11.4791|11.4791	0.50316|0.50316	0.0:0.0:0.6746:0.3254|0.0:0.0:0.6746:0.3254	.|.	198|.	Q14055|.	CO9A2_HUMAN|.	C|M	198|186	ENSP00000361834:R198C|.	ENSP00000361834:R198C|.	R|T	-|-	1|2	0|0	COL9A2|COL9A2	40549390|40549390	0.078000|0.078000	0.21339|0.21339	0.036000|0.036000	0.18154|0.18154	0.150000|0.150000	0.21749|0.21749	1.534000|1.534000	0.36051|0.36051	0.699000|0.699000	0.31761|0.31761	0.558000|0.558000	0.71614|0.71614	CGC|ACG	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3		23.090744	0	-11	41	0	0	1	0	NM_001852	8	23.947601	18	0.307692
FOXS1	2307	broad.mit.edu	hg19	20	30433147	30433147	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:30433147G>A	ENST00000375978.3	-	1	273	c.199C>T	c.(199-201)Cgc>Tgc	p.R67C		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	67		anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|insulin receptor signaling pathway|lymphangiogenesis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|neural crest cell fate commitment|neuromuscular process controlling balance|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of multicellular organism growth|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|somitogenesis|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9					AGGTTGTGGCGGATGCTGTTC	0.642	0	85.0	69.0	74.0	20	30433147	2203	4300	6503	SO:0001583	missense	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772	"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18	9325056, 17062144	Standard	NM_004118	Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.199C>T	20.37:g.30433147G>A	ENSP00000365145:p.Arg67Cys	Q96D28	ENST00000375978.3	37	CCDS13192.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765813	0.69878	.	.	ENSG00000179772	ENST00000375978	D	0.98120	-4.73	4.76	4.76	0.60689	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.47093	D	0.000245	D	0.99315	0.9760	H	0.99642	4.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98085	1.0406	10	0.87932	D	0	.	11.7085	0.51612	0.0:0.0:0.8232:0.1768	.	67	O43638	FOXS1_HUMAN	C	67	ENSP00000365145:R67C	ENSP00000365145:R67C	R	-	1	0	FOXS1	29896808	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.058000	0.49939	2.484000	0.83849	0.555000	0.69702	CGC	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2		-0.004776	0	-6	87	0	0	1	0	NM_004118	3	6.875698	35	0.078947
PLA2G6	8398	broad.mit.edu	hg19	22	38531030	38531030	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:38531030C>T	ENST00000332509.3	-	6	1042	c.859G>A	c.(859-861)Gga>Aga	p.G287R	PLA2G6_ENST00000402064.1_Missense_Mutation_p.G287R|PLA2G6_ENST00000335539.3_Missense_Mutation_p.G287R	NM_003560.2	NP_003551.2	O60733	PA2G6_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	287		cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				GGGCTGGCTCCGTAACGGGGG	0.662	0	55.0	56.0	56.0	22	38531030	2203	4300	6503	SO:0001583	missense	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604			9417066, 16799181, 19029121	Standard	NM_001199562	Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.859G>A	22.37:g.38531030C>T	ENSP00000333142:p.Gly287Arg	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	ENST00000332509.3	37	CCDS13967.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821662	0.90873	.	.	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064;ENST00000335538;ENST00000396860;ENST00000451461	T;T;T	0.59772	0.24;0.24;0.24	5.67	5.67	0.87782	Ankyrin repeat-containing domain (3);	0.154883	0.64402	D	0.000018	T	0.77980	0.4212	M	0.85041	2.73	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.70935	0.962;0.884;0.971	T	0.81254	-0.1016	10	0.87932	D	0	-11.6042	15.2807	0.73781	0.0:0.8604:0.1396:0.0	.	252;287;287	B7Z6K3;O60733-2;O60733	.;.;PA2G6_HUMAN	R	287;148;287;287;215;287;252	ENSP00000333142:G287R;ENSP00000335149:G287R;ENSP00000386100:G287R	ENSP00000333142:G287R	G	-	1	0	PLA2G6	36860976	0.994000	0.37717	0.985000	0.45067	0.948000	0.59901	4.085000	0.57657	2.667000	0.90743	0.561000	0.74099	GGA	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1		31.915636	0	-11	37	0	0	1	0	NM_001004426	11	32.491534	20	0.354839
KIAA0586	9786	broad.mit.edu	hg19	14	58932657	58932657	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:58932657G>A	ENST00000423743.3	+	16	2290	c.2032G>A	c.(2032-2034)Gat>Aat	p.D678N	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Missense_Mutation_p.D775N|KIAA0586_ENST00000261244.5_Missense_Mutation_p.D646N|KIAA0586_ENST00000556134.1_Missense_Mutation_p.D707N	NM_001244191.1|NM_001244192.1	NP_001231120.1|NP_001231121.1	E9PGW8	E9PGW8_HUMAN	KIAA0586	646					endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					ACCTCATGGCGATCAGCAATA	0.368	0	166.0	159.0	161.0	14	58932657	1897	4110	6007	SO:0001583	missense	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578		19960	protein-coding gene	gene with protein product		610178			16702409	Standard	NM_014749	Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000354386.6:c.2323G>A	14.37:g.58932657G>A	ENSP00000346359:p.Asp775Asn	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	ENST00000354386.6	37	CCDS58320.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045182	0.75846	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.37	4.47	0.54385	.	0.973374	0.08476	N	0.940335	T	0.49915	0.1585	L	0.27053	0.805	0.09310	N	0.999998	P;P;P;D;P;P	0.61697	0.907;0.907;0.948;0.99;0.907;0.948	B;B;B;P;B;B	0.51016	0.187;0.187;0.325;0.656;0.187;0.246	T	0.50448	-0.8827	10	0.66056	D	0.02	.	15.4404	0.75178	0.0:0.3258:0.6742:0.0	.	582;582;775;646;707;678	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	N	775;707;678;646;582	ENSP00000346359:D775N;ENSP00000452351:D707N;ENSP00000399427:D678N;ENSP00000261244:D646N	ENSP00000261244:D646N	D	+	1	0	KIAA0586	58002410	0.260000	0.24053	0.071000	0.20095	0.316000	0.28119	2.676000	0.46883	1.225000	0.43566	0.655000	0.94253	GAT	KIAA0586-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411987.1		12.925203	0	-10	77	0	0	1	0	NM_014749	9	22.097437	60	0.130435
DGKQ	1609	broad.mit.edu	hg19	4	955530	955530	+	Missense_Mutation	SNP	C	C	T	rs143203696	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:955530C>T	ENST00000273814.3	-	20	2481	c.2408G>A	c.(2407-2409)cGg>cAg	p.R803Q		NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	803		activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding	breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)		CACCTCCTGCCGCTCCACCTG	0.647	0	56.0	61.0	60.0	4	955530	2203	4300	6503	SO:0001583	missense	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214		2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4	8617502, 9099683	Standard	NM_001347	Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2408G>A	4.37:g.955530C>T	ENSP00000273814:p.Arg803Gln	Q6P3W4	ENST00000273814.3	37	CCDS3342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.97|11.97	1.797748|1.797748	0.31777|0.31777	9.08E-4|9.08E-4	0.0|0.0	ENSG00000145214|ENSG00000145214	ENST00000509465|ENST00000273814	.|T	.|0.41400	.|1.0	5.27|5.27	-0.454|-0.454	0.12197|0.12197	.|Diacylglycerol kinase, accessory domain (2);	.|0.543849	.|0.21430	.|N	.|0.074670	T|T	0.15522|0.15522	0.0374|0.0374	N|N	0.02539|0.02539	-0.55|-0.55	0.20975|0.20975	N|N	0.999811|0.999811	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.19976|0.19976	-1.0289|-1.0289	5|10	.|0.30854	.|T	.|0.27	.|.	8.5696|8.5696	0.33561|0.33561	0.0:0.3318:0.0:0.6682|0.0:0.3318:0.0:0.6682	.|.	.|803;803	.|E9KL49;P52824	.|.;DGKQ_HUMAN	S|Q	737|803	.|ENSP00000273814:R803Q	.|ENSP00000273814:R803Q	G|R	-|-	1|2	0|0	DGKQ|DGKQ	945530|945530	0.005000|0.005000	0.15991|0.15991	0.994000|0.994000	0.49952|0.49952	0.584000|0.584000	0.36387|0.36387	-0.014000|-0.014000	0.12656|0.12656	-0.223000|-0.223000	0.09943|0.09943	-0.471000|-0.471000	0.05019|0.05019	GGC|CGG	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		25.765232	0	-5	54	0	0	1	0		9	26.558207	19	0.321429
XKR4	114786	broad.mit.edu	hg19	8	56436530	56436530	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:56436530G>A	ENST00000327381.6	+	3	1797	c.1697G>A	c.(1696-1698)cGg>cAg	p.R566Q		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4				integral to membrane		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)		TTCGCAGAGCGGGATGGGTGT	0.552	1	73.0	76.0	75.0	8	56436530	2203	4300	6503	SO:0001583	missense	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579		29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""			Standard	NM_052898	Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1697G>A	8.37:g.56436530G>A	ENSP00000328326:p.Arg566Gln	Q96PZ8	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849069	0.71603	0.0	1.16E-4	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.84070	-1.8	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	D	0.87919	0.2702	10	0.40728	T	0.16	-3.1323	20.3931	0.98965	0.0:0.0:1.0:0.0	.	566	Q5GH76	XKR4_HUMAN	Q	566	ENSP00000328326:R566Q	ENSP00000328326:R566Q	R	+	2	0	XKR4	56599084	1.000000	0.71417	0.998000	0.56505	0.133000	0.20885	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	CGG	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2		0.399209	0	-22	51	0	0	1	0	NM_052898	3	7.011696	34	0.081081
SLC4A2	6522	broad.mit.edu	hg19	7	150768837	150768837	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:150768837C>T	ENST00000485713.1	+	15	3293	c.2253C>T	c.(2251-2253)ggC>ggT	p.G751G	SLC4A2_ENST00000461735.1_Silent_p.G737G|SLC4A2_ENST00000310317.5_Silent_p.G669G|SLC4A2_ENST00000413384.2_Silent_p.G751G|SLC4A2_ENST00000392826.2_Silent_p.G742G	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	751	Membrane (anion exchange).	bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity	NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	CGCTCCAGGGCGTGGTCTTCT	0.622	0	82.0	88.0	86.0	7	150768837	2203	4300	6503	SO:0001819	synonymous_variant		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889	"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2	8434259	Standard	NM_003040	Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000461735.1:c.2211C>T	7.37:g.150768837C>T		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	ENST00000461735.1	37	CCDS56521.1																																																																																			SLC4A2-005	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351042.2		27.471236	0	-4	92	0	0	1	0	NM_003040	12	31.304580	42	0.222222
SLC13A1	6561	broad.mit.edu	hg19	7	122787322	122787322	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:122787322C>T	ENST00000194130.2	-	7	742	c.703G>A	c.(703-705)Gtg>Atg	p.V235M	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	235			integral to membrane|plasma membrane	sodium:sulfate symporter activity	breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					TTACGTGTCACGTGGCCCTTC	0.418	0	234.0	179.0	197.0	7	122787322	2203	4300	6503	SO:0001583	missense		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800	"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""		11161786	Standard	NM_022444	Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.703G>A	7.37:g.122787322C>T	ENSP00000194130:p.Val235Met	Q9H5Z0	ENST00000194130.2	37	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	C	0.150	-1.092159	0.01858	.	.	ENSG00000081800	ENST00000194130	T	0.03386	3.95	5.0	2.45	0.29901	.	0.219788	0.52532	N	0.000078	T	0.00875	0.0029	N	0.00119	-2.075	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.51060	-0.8753	10	0.42905	T	0.14	-27.0989	6.0605	0.19835	0.0:0.0891:0.1627:0.7482	.	235;235	A4D0X1;Q9BZW2	.;S13A1_HUMAN	M	235	ENSP00000194130:V235M	ENSP00000194130:V235M	V	-	1	0	SLC13A1	122574558	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	3.182000	0.50910	0.755000	0.32990	-0.414000	0.06135	GTG	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1		18.744524	0	-2	64	0	0	1	0	NM_022444	9	23.774717	42	0.176471
TTC8	123016	broad.mit.edu	hg19	14	89337996	89337996	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:89337996C>T	ENST00000338104.6	+	12	1253	c.1201C>T	c.(1201-1203)Cgt>Tgt	p.R401C	TTC8_ENST00000380656.2_Missense_Mutation_p.R385C|TTC8_ENST00000354441.6_Missense_Mutation_p.R120C|TTC8_ENST00000536576.1_Missense_Mutation_p.R146C|TTC8_ENST00000345383.5_Missense_Mutation_p.R375C|TTC8_ENST00000346301.4_Missense_Mutation_p.R345C|TTC8_ENST00000358622.5_Missense_Mutation_p.R187C			Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	411		cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding	endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15					CTCATTTGAACGTGCCCTTTC	0.443	0	142.0	130.0	134.0	14	89337996	2203	4300	6503	SO:0001583	missense	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533	"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132			14520415, 20451172	Standard	NM_144596	Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1123C>T	14.37:g.89337996C>T	ENSP00000339486:p.Arg375Cys	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	ENST00000345383.5	37	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.486612|4.486612	0.84854|0.84854	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000557580	T;T;T;T;T;T;T|.	0.68025|.	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86493|0.86493	0.5946|0.5946	M|M	0.91140|0.91140	3.18|3.18	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.91635|.	0.996;0.999;0.998;0.988;0.988|.	D|D	0.88431|0.88431	0.3035|0.3035	10|5	0.87932|.	D|.	0|.	-12.0124|-12.0124	19.8984|19.8984	0.96975|0.96975	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	120;146;411;355;385|.	Q8TAM2-2;B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4|.	.;.;TTC8_HUMAN;.;.|.	C|M	375;146;345;401;120;385;187|173	ENSP00000339486:R375C;ENSP00000445067:R146C;ENSP00000298324:R345C;ENSP00000337653:R401C;ENSP00000346427:R120C;ENSP00000370031:R385C;ENSP00000351439:R187C|.	ENSP00000337653:R401C|.	R|T	+|+	1|2	0|0	TTC8|TTC8	88407749|88407749	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.560000|3.560000	0.53763|0.53763	2.712000|2.712000	0.92718|0.92718	0.555000|0.555000	0.69702|0.69702	CGT|ACG	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1		109.483363	0	0	114	0	0	1	0	NM_144596	36	110.118802	52	0.409091
SLC6A5	9152	broad.mit.edu	hg19	11	20676288	20676288	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:20676288G>A	ENST00000525748.1	+	16	2541	c.2268G>A	c.(2266-2268)ccG>ccA	p.P756P	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	756		synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					CGCCACAGCCGGACTGGGGCC	0.562	0	114.0	111.0	112.0	11	20676288	2203	4300	6503	SO:0001819	synonymous_variant	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970	"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1	9845349	Standard	NM_004211	Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.2268G>A	11.37:g.20676288G>A		O95288|Q4VAM7|Q9BX77	ENST00000525748.1	37	CCDS7854.1																																																																																			SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2		76.096332	0	3	71	0	0	1	0	NM_004211	24	76.163140	28	0.461538
GRHL2	79977	broad.mit.edu	hg19	8	102570889	102570889	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:102570889G>A	ENST00000251808.3	+	4	865	c.527G>A	c.(526-528)cGg>cAg	p.R176Q	GRHL2_ENST00000395927.1_Missense_Mutation_p.R160Q	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	176			cytoplasm|nucleus	DNA binding	breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)		CACTATCCCCGGGGAGATGGG	0.567	0	80.0	73.0	75.0	8	102570889	2203	4300	6503	SO:0001583	missense	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307		2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3	12393799	Standard	NM_024915	Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.527G>A	8.37:g.102570889G>A	ENSP00000251808:p.Arg176Gln	A1L303|Q6NT03|Q9H8B8	ENST00000251808.3	37	CCDS34931.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026629	0.35797	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.11169	2.8;2.8	5.33	4.45	0.53987	.	0.317710	0.40469	N	0.001100	T	0.21227	0.0511	L	0.41236	1.265	0.47245	D	0.999365	D;P	0.76494	0.999;0.454	D;B	0.72625	0.978;0.029	T	0.03413	-1.1039	10	0.16420	T	0.52	-7.6427	13.8279	0.63361	0.0742:0.0:0.9258:0.0	.	176;176	B4DL28;Q6ISB3	.;GRHL2_HUMAN	Q	176;160;176	ENSP00000251808:R176Q;ENSP00000379260:R160Q	ENSP00000251808:R176Q	R	+	2	0	GRHL2	102640065	1.000000	0.71417	0.509000	0.27700	0.377000	0.30045	8.500000	0.90498	1.227000	0.43598	0.637000	0.83480	CGG	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1		35.555583	0	-5	81	0	0	1	0	NM_024915	13	37.666476	34	0.276596
FOXO3	2309	broad.mit.edu	hg19	6	108985561	108985561	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:108985561G>A	ENST00000406360.1	+	2	1868	c.1525G>A	c.(1525-1527)Gtg>Atg	p.V509M	FOXO3_ENST00000343882.6_Missense_Mutation_p.V509M|FOXO3_ENST00000540898.1_Missense_Mutation_p.V289M	NM_001455.3	NP_001446.1	O43524	FOXO3_HUMAN	forkhead box O3	509		antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)	CCGCCGGAACGTGATGCTTCG	0.557	1	19.0	21.0	20.0	6	108985561	2113	4099	6212	SO:0001583	missense	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689	"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A	9479491	Standard	NM_001455	Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1525G>A	6.37:g.108985561G>A	ENSP00000339527:p.Val509Met	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	ENST00000343882.6	37	CCDS5068.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.242929	0.22796	.	.	ENSG00000118689	ENST00000343882;ENST00000406360;ENST00000540258;ENST00000540898	D;D;D	0.96522	-4.04;-4.04;-4.04	5.59	5.59	0.84812	.	0.321110	0.33916	N	0.004438	D	0.89462	0.6722	L	0.55990	1.75	0.37317	D	0.909373	P	0.50443	0.935	B	0.36534	0.227	D	0.87932	0.2711	10	0.32370	T	0.25	-12.8009	7.3004	0.26418	0.2012:0.0:0.7988:0.0	.	509	O43524	FOXO3_HUMAN	M	509;509;289;289	ENSP00000339527:V509M;ENSP00000385824:V509M;ENSP00000446316:V289M	ENSP00000339527:V509M	V	+	1	0	FOXO3	109092254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.710000	0.54860	2.648000	0.89879	0.563000	0.77884	GTG	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2		24.667124	0	-6	24	0	0	1	0		9	24.996929	15	0.375000
CACFD1	11094	broad.mit.edu	hg19	9	136328663	136328663	+	Silent	SNP	C	C	T	rs113031528		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:136328663C>T	ENST00000316948.4	+	2	260	c.180C>T	c.(178-180)gcC>gcT	p.A60A	CACFD1_ENST00000291722.7_Silent_p.A60A|CACFD1_ENST00000540581.1_Silent_p.A60A|CACFD1_ENST00000489519.1_3'UTR|CACFD1_ENST00000542192.1_Silent_p.A60A	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	60			integral to membrane								ACATTGCGGCCGGCGTGTGGA	0.622	0	136.0	124.0	128.0	9	136328663	2203	4300	6503	SO:0001819	synonymous_variant		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325		1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7	19737521	Standard	NM_001242370	Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.180C>T	9.37:g.136328663C>T		B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	ENST00000316948.4	37	CCDS6974.1																																																																																			CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1		35.356487	0	-23	110	0	0	1	0	NM_017586	16	41.252076	60	0.210526
CLCA1	1179	broad.mit.edu	hg19	1	86959980	86959980	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:86959980G>A	ENST00000234701.3	+	12	2142	c.1791G>A	c.(1789-1791)acG>acA	p.T597T	CLCA1_ENST00000394711.1_Silent_p.T597T			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	597		calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)	CTTCCAAAACGAACAAGGACA	0.517	0	101.0	88.0	92.0	1	86959980	2203	4300	6503	SO:0001819	synonymous_variant		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490		2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""		9828122	Standard	NM_001285	Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1791G>A	1.37:g.86959980G>A		B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	ENST00000234701.3	37	CCDS709.1																																																																																			CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1		56.346517	0	-1	44	0	0	1	0	NM_001285	18	56.396704	21	0.461538
NEU2	4759	broad.mit.edu	hg19	2	233897559	233897559	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:233897559G>A	ENST00000233840.3	+	1	178	c.178G>A	c.(178-180)Gac>Aac	p.D60N		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	60				exo-alpha-sialidase activity	endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	AGGAGACTACGACGCACCCAC	0.637	0	37.0	33.0	34.0	2	233897559	2203	4300	6503	SO:0001583	missense	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488		7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528			10191093, 14613940	Standard	NM_005383	Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.178G>A	2.37:g.233897559G>A	ENSP00000233840:p.Asp60Asn	Q3KNW4|Q6NTB4	ENST00000233840.3	37	CCDS2501.1	.	.	.	.	.	.	.	.	.	.	G	6.367	0.435859	0.12104	0.0	1.16E-4	ENSG00000115488	ENST00000233840	D	0.83755	-1.76	5.54	-1.31	0.09230	Neuraminidase (2);	0.804728	0.10850	N	0.627229	T	0.61887	0.2383	N	0.04768	-0.165	0.09310	N	1	B	0.16166	0.016	B	0.06405	0.002	T	0.45026	-0.9289	10	0.14252	T	0.57	-8.1065	10.9659	0.47412	0.5948:0.0:0.4052:0.0	.	60	Q9Y3R4	NEUR2_HUMAN	N	60	ENSP00000233840:D60N	ENSP00000233840:D60N	D	+	1	0	NEU2	233605803	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.450000	0.06803	-0.059000	0.13154	0.591000	0.81541	GAC	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2		8.222010	0	-5	9	0	0	1	0	NM_005383	3	8.443411	6	0.333333
TCEB3CL	728929	broad.mit.edu	hg19	18	44549170	44549170	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr18:44549170G>A	ENST00000451265.1	-	1	1364	c.1129C>T	c.(1129-1131)Cgc>Tgc	p.R377C	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_001100817.1	NP_001094287.1			transcription elongation factor B polypeptide 3C-like						central_nervous_system(1)|lung(1)|prostate(1)	3					TTCTCTGTGCGGTACGGCTGA	0.572	0	228.0	194.0	205.0	18	44549170	1710	3416	5126	SO:0001583	missense			18q21.1	2007-07-10				ENSG00000275553		31007	protein-coding gene	gene with protein product						Standard	NM_001100817	Approved	HsT828		Q3SY89		ENST00000451265.1:c.1129C>T	18.37:g.44549170G>A	ENSP00000409932:p.Arg377Cys	Q3MI93	ENST00000451265.1	37	CCDS42433.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184174	0.38609	.	.	ENSG00000234298	ENST00000451265	T	0.33654	1.4	1.5	0.527	0.17084	.	0.813513	0.10476	N	0.670186	T	0.55625	0.1932	M	0.77486	2.375	0.27479	N	0.952621	D	0.89917	1.0	D	0.74674	0.984	T	0.43734	-0.9373	10	0.87932	D	0	-9.163	6.7137	0.23292	0.0:0.0:0.7186:0.2814	.	377	Q3SY89	EA3L1_HUMAN	C	377	ENSP00000409932:R377C	ENSP00000409932:R377C	R	-	1	0	TCEB3CL	42803168	1.000000	0.71417	0.000000	0.03702	0.002000	0.02628	0.919000	0.28692	0.177000	0.19895	0.556000	0.70494	CGC	TCEB3CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451071.1		12.035973	0	-2	354	0	0	1	0	XM_001132059	18	43.600688	173	0.094241
LZTS3	0	broad.mit.edu	hg19	20	3145195	3145195	+	Missense_Mutation	SNP	C	C	T	rs144495581		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:3145195C>T	ENST00000329152.3	-	3	3324	c.1927G>A	c.(1927-1929)Gca>Aca	p.A643T	LZTS3_ENST00000337576.5_Missense_Mutation_p.A597T|LZTS3_ENST00000360342.3_Missense_Mutation_p.A597T																	GCACCCCCTGCGGCCCCGCGC	0.647	0	47.0	46.0	46.0	20	3145195	2203	4299	6502	SO:0001583	missense																									ENST00000329152.3:c.1927G>A	20.37:g.3145195C>T	ENSP00000332123:p.Ala643Thr	A2A2Q7|D3DVX6|Q8IXX8	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	C	7.640	0.680649	0.14907	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.30182	1.54;1.54;1.54	4.69	1.46	0.22682	.	0.317648	0.31760	N	0.007114	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	P;P	0.46656	0.882;0.813	B;B	0.36030	0.216;0.081	T	0.23940	-1.0174	10	0.20519	T	0.43	-13.436	6.5022	0.22176	0.3173:0.5937:0.0:0.0891	.	597;643	O60299-2;O60299	.;PRIP1_HUMAN	T	643;597;597	ENSP00000332123:A643T;ENSP00000353496:A597T;ENSP00000338166:A597T	ENSP00000332123:A643T	A	-	1	0	RP5-1187M17.10	3093195	0.036000	0.19791	0.019000	0.16419	0.718000	0.41266	0.167000	0.16602	0.566000	0.29273	0.555000	0.69702	GCA	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		68.851441	0	7	52	0	0	1	0		22	68.856542	21	0.511628
HRNR	388697	broad.mit.edu	hg19	1	152187596	152187596	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:152187596G>A	ENST00000368801.2	-	3	6584	c.6509C>T	c.(6508-6510)tCg>tTg	p.S2170L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2170		keratinization		calcium ion binding|protein binding	autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)		GCCGTGGCCCGAAGACTGACG	0.627	0	122.0	154.0	143.0	1	152187596	2196	4279	6475	SO:0001583	missense	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915	"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""					Standard	NM_001009931	Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6509C>T	1.37:g.152187596G>A	ENSP00000357791:p.Ser2170Leu	Q5DT20|Q5U1F4	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	11.36	1.615170	0.28712	.	.	ENSG00000197915	ENST00000368801	T	0.05855	3.38	3.22	3.22	0.36961	.	.	.	.	.	T	0.07548	0.0190	L	0.55481	1.735	0.09310	N	1	D	0.76494	0.999	P	0.56612	0.802	T	0.12837	-1.0532	9	0.48119	T	0.1	.	12.3341	0.55056	0.0:0.0:1.0:0.0	.	2170	Q86YZ3	HORN_HUMAN	L	2170	ENSP00000357791:S2170L	ENSP00000357791:S2170L	S	-	2	0	HRNR	150454220	0.050000	0.20438	0.005000	0.12908	0.031000	0.12232	1.313000	0.33585	1.810000	0.52873	0.650000	0.86243	TCG	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1		-161.497204	0	388	1091	0	0	1	0	XM_373868	22	38.959947	790	0.027094
TNIP2	79155	broad.mit.edu	hg19	4	2746454	2746454	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:2746454C>T	ENST00000510267.1	-	4	982	c.555G>A	c.(553-555)gcG>gcA	p.A185A	TNIP2_ENST00000503235.1_Intron|TNIP2_ENST00000315423.7_Silent_p.A292A|TNIP2_ENST00000505186.1_5'UTR	NM_001161527.1	NP_001154999.1	Q8NFZ5	TNIP2_HUMAN	TNFAIP3 interacting protein 2	292			cytosol	protein binding	breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	CCCGCTCCAACGCAGCATCCC	0.612	0	38.0	43.0	41.0	4	2746454	2203	4300	6503	SO:0001819	synonymous_variant	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884		19118	protein-coding gene	gene with protein product		610669			11390377, 12933576	Standard	NM_024309	Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.876G>A	4.37:g.2746454C>T			ENST00000315423.7	37	CCDS3362.1																																																																																			TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5		31.980153	0	-5	75	0	0	1	0	NM_024309	12	34.192826	33	0.266667
CYTH3	9265	broad.mit.edu	hg19	7	6205175	6205175	+	Splice_Site	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:6205175C>T	ENST00000350796.3	-	11	1109		c.e11+1		CYTH3_ENST00000396741.2_Splice_Site	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3			regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19					GAAGAGCTTACGGGTTTCCGG	0.622	1	80.0	81.0	81.0	7	6205175	2203	4300	6503	SO:0001630	splice_region_variant	AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256	"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3	9072969	Standard	NM_004227	Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.972+1G>A	7.37:g.6205175C>T		A4D2N8	ENST00000350796.3	37	CCDS5346.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874511	0.91664	.	.	ENSG00000008256	ENST00000350796;ENST00000396741	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2844	0.90110	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYTH3	6171700	1.000000	0.71417	0.846000	0.33378	0.952000	0.60782	7.725000	0.84808	2.407000	0.81776	0.561000	0.74099	.	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207396.2		82.348250	0	-8	92	0	0	1	0	NM_004227	26	82.383658	29	0.472727
SLITRK3	22865	broad.mit.edu	hg19	3	164906265	164906265	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:164906265G>A	ENST00000475390.1	-	2	2797	c.2354C>T	c.(2353-2355)cCg>cTg	p.P785L	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P785L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	785			integral to membrane		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119					ACCCATTCCCGGTGGTTGTGT	0.552	1	87.0	93.0	91.0	3	164906265	2203	4300	6503	SO:0001583	missense	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871		23501	protein-coding gene	gene with protein product		609679			10048485, 14557068	Standard	NM_014926	Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2354C>T	3.37:g.164906265G>A	ENSP00000420091:p.Pro785Leu	Q1RMY6	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275349	0.23307	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.54279	0.58;0.58	5.44	5.44	0.79542	.	0.215496	0.23543	N	0.047051	T	0.29783	0.0744	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09552	-1.0669	10	0.21540	T	0.41	-0.9216	10.0662	0.42306	0.0882:0.0:0.9118:0.0	.	785	O94933	SLIK3_HUMAN	L	785	ENSP00000420091:P785L;ENSP00000241274:P785L	ENSP00000241274:P785L	P	-	2	0	SLITRK3	166388959	0.618000	0.27051	0.046000	0.18839	0.531000	0.34715	1.995000	0.40767	2.832000	0.97577	0.655000	0.94253	CCG	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1		49.594575	0	-15	78	0	0	1	0	NM_014926	16	49.868453	23	0.410256
MED25	81857	broad.mit.edu	hg19	19	50334046	50334046	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:50334046G>A	ENST00000312865.6	+	9	1056	c.1003G>A	c.(1003-1005)Gcc>Acc	p.A335T	MED25_ENST00000538643.1_Missense_Mutation_p.A122T	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	335	Pro-rich.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)	ACCCCCTGGCGCCCCCAAGCC	0.706	0	30.0	35.0	33.0	19	50334046	2201	4297	6498	SO:0001583	missense	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973		28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""		9110174, 11230166	Standard	NM_030973	Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1003G>A	19.37:g.50334046G>A	ENSP00000326767:p.Ala335Thr	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	ENST00000312865.6	37	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354663	0.82243	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070	T;T	0.78481	-1.18;-1.18	5.58	4.55	0.56014	Mediator complex, subunit Med25, synapsin 1 (1);	0.391114	0.27486	N	0.019141	T	0.69700	0.3140	N	0.19112	0.55	0.30512	N	0.769333	D;D;P	0.62365	0.991;0.99;0.898	P;P;B	0.52386	0.608;0.697;0.338	T	0.66168	-0.5991	10	0.21540	T	0.41	.	9.7827	0.40658	0.0775:0.1409:0.7817:0.0	.	122;335;335	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	T	335;335;335;335;335;122;70	ENSP00000326767:A335T;ENSP00000437496:A122T	ENSP00000326767:A335T	A	+	1	0	MED25	55025858	1.000000	0.71417	0.945000	0.38365	0.960000	0.62799	3.677000	0.54619	1.364000	0.46038	0.655000	0.94253	GCC	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1		13.243310	0	-10	28	0	0	1	0	NM_030973	6	15.347964	22	0.214286
CUEDC1	404093	broad.mit.edu	hg19	17	55950132	55950132	+	Missense_Mutation	SNP	G	G	A	rs150759994		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:55950132G>A	ENST00000577830.1	-	5	1089	c.676C>T	c.(676-678)Cgc>Tgc	p.R226C	CUEDC1_ENST00000360238.2_Missense_Mutation_p.R226C|CUEDC1_ENST00000577840.1_Missense_Mutation_p.R89C|CUEDC1_ENST00000407144.2_Missense_Mutation_p.R226C	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	226					endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12					TGCTTCCAGCGGCTCTCCTGG	0.637	0	80.0	73.0	75.0	17	55950132	2203	4300	6503	SO:0001583	missense	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891		31350	protein-coding gene	gene with protein product						Standard	NM_001271875	Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.676C>T	17.37:g.55950132G>A	ENSP00000462717:p.Arg226Cys	D3DTZ2|Q9NWD0	ENST00000577830.1	37	CCDS11599.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507195	0.85282	2.27E-4	1.16E-4	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.24908	1.83;1.83	5.46	4.43	0.53597	.	0.102694	0.64402	D	0.000006	T	0.37265	0.0997	L	0.56769	1.78	0.54753	D	0.999983	D	0.71674	0.998	P	0.53146	0.719	T	0.18429	-1.0337	10	0.72032	D	0.01	-0.3714	13.1899	0.59704	0.0:0.0:0.7512:0.2488	.	226	Q9NWM3	CUED1_HUMAN	C	226	ENSP00000384712:R226C;ENSP00000353373:R226C	ENSP00000353373:R226C	R	-	1	0	CUEDC1	53305131	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.218000	0.65257	2.561000	0.86390	0.655000	0.94253	CGC	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1		14.233331	0	0	82	0	0	1	0	NM_017949	9	22.445273	56	0.138462
PSMB11	122706	broad.mit.edu	hg19	14	23512169	23512169	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:23512169C>T	ENST00000408907.2	+	1	794	c.735C>T	c.(733-735)taC>taT	p.Y245Y		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	245		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity	endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)	GTGTGCTGTACGTGGAGTTAC	0.597	0	38.0	42.0	40.0	14	23512169	2180	4292	6472	SO:0001819	synonymous_variant		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028		31963	protein-coding gene	gene with protein product		611137			17540904	Standard	NM_001099780	Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.735C>T	14.37:g.23512169C>T			ENST00000408907.2	37	CCDS41923.1																																																																																			PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1		6.717185	0	-3	28	0	0	1	0	NM_001099780	4	9.669009	22	0.153846
ZFHX3	463	broad.mit.edu	hg19	16	72993166	72993166	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:72993166G>A	ENST00000268489.5	-	2	1551	c.879C>T	c.(877-879)taC>taT	p.Y293Y	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	293		muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)			ACGAACGGACGTACCCAAAGG	0.493	0	96.0	85.0	89.0	16	72993166	2198	4300	6498	SO:0001819	synonymous_variant	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836	"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1	1719379, 7592926	Standard	NM_006885	Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.879C>T	16.37:g.72993166G>A		D3DWS8|O15101|Q13719	ENST00000268489.5	37	CCDS10908.1																																																																																			ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1		96.954730	0	4	87	0	0	1	0	NM_006885	30	97.053643	25	0.545455
TG	7038	broad.mit.edu	hg19	8	133920513	133920513	+	Silent	SNP	C	C	T	rs143023529		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr8:133920513C>T	ENST00000220616.4	+	18	3970	c.3930C>T	c.(3928-3930)taC>taT	p.Y1310Y	TG_ENST00000377869.1_Silent_p.Y1310Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1310		hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	GTGCTGACTACGCGGATTTGC	0.597	0	76.0	69.0	71.0	8	133920513	2203	4300	6503	SO:0001819	synonymous_variant	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832		11764	protein-coding gene	gene with protein product		188450				Standard	NM_003235	Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3930C>T	8.37:g.133920513C>T		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	ENST00000220616.4	37	CCDS34944.1																																																																																			TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1		-2.613572	0	13	67	0	0	1	0	NM_003235	3	6.688579	44	0.063830
GPR4	2828	broad.mit.edu	hg19	19	46095082	46095082	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:46095082C>T	ENST00000323040.4	-	2	987	c.43G>A	c.(43-45)Gtg>Atg	p.V15M	OPA3_ENST00000544371.1_Intron	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	15			integral to plasma membrane	G-protein coupled receptor activity	breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)	AGGTGGTCCACGCGCGAGTCC	0.677	0	49.0	39.0	43.0	19	46095082	2203	4300	6503	SO:0001583	missense	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464	"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551			8595909	Standard	NM_005282	Approved		uc002pcm.3	P46093		ENST00000323040.4:c.43G>A	19.37:g.46095082C>T	ENSP00000319744:p.Val15Met	A8K3T3|B0M0K1|Q6NWM4	ENST00000323040.4	37	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397482	0.25205	.	.	ENSG00000177464	ENST00000323040	T	0.38077	1.16	5.11	2.98	0.34508	.	0.096661	0.39834	N	0.001244	T	0.20536	0.0494	N	0.08118	0	0.26810	N	0.969017	D	0.65815	0.995	P	0.48627	0.584	T	0.03555	-1.1025	10	0.40728	T	0.16	.	4.8501	0.13533	0.0:0.6326:0.1776:0.1899	.	15	P46093	GPR4_HUMAN	M	15	ENSP00000319744:V15M	ENSP00000319744:V15M	V	-	1	0	GPR4	50786922	0.001000	0.12720	0.812000	0.32479	0.076000	0.17211	-0.111000	0.10807	1.141000	0.42275	0.313000	0.20887	GTG	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1		11.362866	0	16	63	0	0	1	0	NM_005282	5	13.252805	19	0.208333
ASCC3	10973	broad.mit.edu	hg19	6	101075567	101075567	+	Missense_Mutation	SNP	C	C	T	rs142364575	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:101075567C>T	ENST00000369162.2	-	29	4885	c.4541G>A	c.(4540-4542)cGa>cAa	p.R1514Q		NM_006828.2	NP_006819.2	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit 3	1514		regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding	breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)	TACTGATGGTCGGAAGTTAAA	0.368	0	84.0	79.0	81.0	6	101075567	2203	4300	6503	SO:0001583	missense	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249		18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1	10218103	Standard	NM_006828	Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4541G>A	6.37:g.101075567C>T	ENSP00000358159:p.Arg1514Gln	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983016	0.93044	6.81E-4	0.0	ENSG00000112249	ENST00000369162	D	0.91295	-2.82	5.7	5.7	0.88788	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	D	0.93946	0.8062	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	P	0.61874	0.895	D	0.92596	0.6087	10	0.42905	T	0.14	.	19.8206	0.96591	0.0:1.0:0.0:0.0	.	1514	Q8N3C0	HELC1_HUMAN	Q	1514	ENSP00000358159:R1514Q	ENSP00000358159:R1514Q	R	-	2	0	ASCC3	101182288	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.689000	0.91719	0.561000	0.74099	CGA	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2		22.791116	0	12	39	0	0	1	0	NM_006828	8	23.510818	17	0.320000
AHI1	54806	broad.mit.edu	hg19	6	135778798	135778798	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:135778798G>A	ENST00000367800.4	-	7	1201	c.985C>T	c.(985-987)Cga>Tga	p.R329*	AHI1_ENST00000327035.6_Nonsense_Mutation_p.R329*|AHI1_ENST00000457866.2_Nonsense_Mutation_p.R329*	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	329			adherens junction|cilium|microtubule basal body		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)	GGGCTATCTCGGCTTGTTATT	0.358	0	169.0	162.0	164.0	6	135778798	1913	4114	6027	SO:0001587	stop_gained	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541	"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""		15060101, 16240161	Standard	NM_017651	Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.985C>T	6.37:g.135778798G>A	ENSP00000356774:p.Arg329*	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	ENST00000367800.4	37	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	G	38	6.781126	0.97833	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801	.	.	.	5.5	4.6	0.57074	.	1.206670	0.05757	N	0.604317	.	.	.	.	.	.	0.39994	D	0.975072	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-0.1692	5.6965	0.17859	0.1194:0.0:0.6911:0.1894	.	.	.	.	X	329	.	ENSP00000265602:R329X	R	-	1	2	AHI1	135820491	0.883000	0.30277	0.897000	0.35233	0.430000	0.31655	1.508000	0.35769	2.586000	0.87340	0.460000	0.39030	CGA	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1		123.443582	0	14	91	0	0	1	0	NM_017651	38	123.609082	46	0.452381
HLCS	3141	broad.mit.edu	hg19	21	38137355	38137355	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr21:38137355G>A	ENST00000399120.1	-	9	2868	c.1638C>T	c.(1636-1638)tcC>tcT	p.S546S	HLCS_ENST00000336648.4_Silent_p.S546S	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	546		cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			CGACAGCCACGGACATCAGAT	0.532	0	151.0	123.0	132.0	21	38137355	2203	4300	6503	SO:0001819	synonymous_variant		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""		7842009	Standard	NM_000411	Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1638C>T	21.37:g.38137355G>A		B2RAH1|D3DSG6|Q99451	ENST00000399120.1	37	CCDS13647.1																																																																																			HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		51.895509	0	0	62	0	0	1	0		16	52.101765	22	0.421053
CFP	5199	broad.mit.edu	hg19	X	47485874	47485874	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:47485874G>A	ENST00000247153.3	-	8	1226	c.985C>T	c.(985-987)Cga>Tga	p.R329*	CFP_ENST00000396992.3_Nonsense_Mutation_p.R329*|CFP_ENST00000377005.2_Nonsense_Mutation_p.R329*	NM_002621.2	NP_002612.1	P27918	PROP_HUMAN	complement factor properdin	329	TSP type-1 5.	complement activation, alternative pathway|defense response to bacterium	extracellular space		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18					ATGTTCCGTCGGATACAGGGG	0.612	0	51.0	41.0	45.0	X	47485874	2203	4300	6503	SO:0001587	stop_gained	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759	"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC	1783405	Standard	NM_001145252	Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.985C>T	X.37:g.47485874G>A	ENSP00000380189:p.Arg329*	O15134|O15135|O15136|O75826	ENST00000396992.3	37	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914217	0.72983	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	.	.	.	5.24	5.24	0.73138	.	0.279906	0.35708	N	0.003022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4259	0.61026	0.0:0.0:1.0:0.0	.	.	.	.	X	329	.	ENSP00000247153:R329X	R	-	1	2	CFP	47370818	0.962000	0.33011	0.230000	0.23976	0.015000	0.08874	3.938000	0.56583	2.324000	0.78689	0.468000	0.43344	CGA	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2		21.981094	0	-16	36	0	0	1	0	NM_002621	8	22.246494	13	0.380952
LYST	1130	broad.mit.edu	hg19	1	235827917	235827917	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:235827917G>A	ENST00000389794.3	-	51	11217	c.11043C>T	c.(11041-11043)ggC>ggT	p.G3681G	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Silent_p.G3681G			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3681		defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		CACTGCCTCCGCCAGCTAAAA	0.567	0	63.0	56.0	58.0	1	235827917	2203	4300	6503	SO:0001819	synonymous_variant	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669	"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1	8717042, 8896560	Standard	NM_000081	Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.11043C>T	1.37:g.235827917G>A		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	ENST00000389794.3	37	CCDS31062.1																																																																																			LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		21.253993	0	-1	49	0	0	1	0		9	23.845282	30	0.230769
ADRBK2	157	broad.mit.edu	hg19	22	26086189	26086189	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:26086189G>A	ENST00000324198.6	+	12	1183	c.991G>A	c.(991-993)Gca>Aca	p.A331T		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2		Protein kinase.			ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity	breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					ACATGGACACGCAAGAATATC	0.413	1	126.0	115.0	119.0	22	26086189	2203	4300	6503	SO:0001583	missense	X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077	"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636			7695743	Standard	NM_005160	Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.991G>A	22.37:g.26086189G>A	ENSP00000317578:p.Ala331Thr	Q9UGW9	ENST00000324198.6	37	CCDS13832.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082989	0.36758	.	.	ENSG00000100077	ENST00000324198;ENST00000545323	T	0.26223	1.75	4.49	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.066369	0.64402	D	0.000012	T	0.26774	0.0655	L	0.42529	1.33	0.33464	D	0.585318	B;B	0.21381	0.012;0.055	B;B	0.26202	0.01;0.067	T	0.36163	-0.9759	10	0.56958	D	0.05	-17.4726	16.7419	0.85461	0.0:0.0:1.0:0.0	.	331;331	A8K869;P35626	.;ARBK2_HUMAN	T	331	ENSP00000317578:A331T	ENSP00000317578:A331T	A	+	1	0	ADRBK2	24416189	1.000000	0.71417	0.169000	0.22859	0.058000	0.15608	9.003000	0.93577	2.485000	0.83878	0.655000	0.94253	GCA	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4		-1.106898	0	-22	96	0	0	1	0	NM_005160	6	14.245079	76	0.073171
WNT2	7472	broad.mit.edu	hg19	7	116937892	116937892	+	Silent	SNP	G	G	A	rs138318436		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:116937892G>A	ENST00000265441.3	-	4	926	c.627C>T	c.(625-627)caC>caT	p.H209H		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	209		atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity	breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	CGCTCACCCCGTGGCACTTGC	0.547	0	102.0	97.0	98.0	7	116937892	2203	4300	6503	SO:0001819	synonymous_variant	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989	"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1	2971536	Standard	NM_003391	Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.627C>T	7.37:g.116937892G>A		A4D0V1|Q75N05|Q9UDP9	ENST00000265441.3	37	CCDS5771.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	12.35	1.913113	0.33815	0.001362	0.0	ENSG00000105989	ENST00000491214	T	0.64438	-0.1	5.58	-7.11	0.01542	.	.	.	.	.	T	0.71953	0.3401	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79172	-0.1913	6	0.87932	D	0	.	17.7651	0.88475	0.7061:0.0:0.2939:0.0	.	.	.	.	W	117	ENSP00000419466:R117W	ENSP00000419466:R117W	R	-	1	2	WNT2	116725128	0.216000	0.23585	0.403000	0.26384	0.476000	0.33039	-0.256000	0.08757	-1.680000	0.01450	-1.134000	0.01955	CGG	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3		17.669577	0	-3	131	0	0	1	0	NM_003391	11	28.076733	70	0.135802
NOTUM	147111	broad.mit.edu	hg19	17	79914795	79914795	+	Missense_Mutation	SNP	G	G	A	rs138384810	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr17:79914795G>A	ENST00000409678.3	-	7	1234	c.851C>T	c.(850-852)aCg>aTg	p.T284M		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	284			extracellular region	hydrolase activity	breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		GGGCGCGCACGTGATCGTGTC	0.672	0	86.0	64.0	71.0	17	79914795	2203	4300	6503	SO:0001583	missense	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269		27106	protein-coding gene	gene with protein product		609847				Standard	NM_178493	Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.851C>T	17.37:g.79914795G>A	ENSP00000387310:p.Thr284Met	Q8N410|Q8NI82	ENST00000409678.3	37	CCDS32771.2	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	12.06	1.824093	0.32237	0.0	2.33E-4	ENSG00000185269	ENST00000409678;ENST00000425009	.	.	.	4.61	3.6	0.41247	.	0.244696	0.47455	D	0.000230	T	0.56411	0.1983	L	0.53249	1.67	0.35967	D	0.835019	D	0.56521	0.976	P	0.51055	0.657	T	0.65249	-0.6214	9	0.41790	T	0.15	.	13.4264	0.61028	0.0:0.0:0.8362:0.1638	.	284	Q6P988	NOTUM_HUMAN	M	284	.	ENSP00000387310:T284M	T	-	2	0	NOTUM	77508085	1.000000	0.71417	0.300000	0.25030	0.029000	0.11900	3.657000	0.54474	0.841000	0.35020	0.491000	0.48974	ACG	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2		3.308357	0	1	38	0	0	1	0	NM_178493	3	6.849380	22	0.120000
GRIA1	0	broad.mit.edu	hg19	5	153078528	153078528	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:153078528C>T	ENST00000285900.5	+	10	1690	c.1347C>T	c.(1345-1347)caC>caT	p.H449H	GRIA1_ENST00000340592.5_Silent_p.H449H|GRIA1_ENST00000448073.4_Silent_p.H459H|GRIA1_ENST00000518783.1_Silent_p.H459H|GRIA1_ENST00000521843.2_Silent_p.H380H|GRIA1_ENST00000518142.1_Silent_p.H369H	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	449		synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		TTGCCAAGCACGTGGGCTACT	0.537	0	110.0	98.0	102.0	5	153078528	2203	4300	6503	SO:0001819	synonymous_variant		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511	"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1	1652753, 1319477	Standard	NM_000827	Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000518783.1:c.1377C>T	5.37:g.153078528C>T		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	ENST00000518783.1	37	CCDS58987.1																																																																																			GRIA1-007	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373902.3		-4.918834	0	-16	43	0	0	1	0		3	6.853271	53	0.053571
CACNA1C	775	broad.mit.edu	hg19	12	2719791	2719791	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:2719791G>A	ENST00000399655.1	+	28	3908	c.3643G>A	c.(3643-3645)Gtg>Atg	p.V1215M	CACNA1C_ENST00000327702.7_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000347598.4_Missense_Mutation_p.V1235M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V1215M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V1240M|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V1215M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V1235M	NM_000719.6|NM_001129829.1|NM_001129834.1	NP_000710.5|NP_001123301.1|NP_001123306.1	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1235		axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	AGTGTGGTACGTGGTCAACTC	0.592	0	119.0	126.0	124.0	12	2719791	2198	4299	6497	SO:0001583	missense	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067	"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1	1650913, 16382099	Standard	NM_001129832	Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3703G>A	12.37:g.2719791G>A	ENSP00000266376:p.Val1235Met	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902190	0.92035	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96619	-3.99;-3.99;-4.01;-4.01;-4.0;-4.02;-4.01;-3.91;-3.95;-4.0;-3.94;-3.93;-3.99;-4.04;-3.91;-3.84;-4.05;-4.04;-4.0;-4.02;-3.96;-4.02;-4.07	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.97958	0.9328	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.984;0.993;1.0;1.0;0.984;1.0;0.996;0.971;1.0;1.0;0.972;1.0;1.0;1.0;1.0;0.99;1.0;0.994;1.0;1.0;1.0;1.0;0.999;0.984	D;P;P;D;D;P;D;P;P;D;D;P;D;D;D;D;P;D;P;D;D;D;D;D;P	0.91635	0.997;0.737;0.759;0.997;0.998;0.737;0.999;0.576;0.576;0.999;0.998;0.782;0.999;0.994;0.997;0.994;0.73;0.999;0.814;0.998;0.999;0.999;0.998;0.991;0.737	D	0.98567	1.0644	10	0.62326	D	0.03	.	18.7859	0.91954	0.0:0.0:1.0:0.0	.	1215;1212;1235;1215;1215;1215;1215;1215;1215;1235;1215;1186;1235;1215;1215;1215;1215;1215;1215;1215;1215;1215;1215;1215;1215	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	M	1240;1215;1215;1215;1215;1215;1215;1215;1215;1215;1235;1235;1215;1215;1215;1215;1215;1215;1215;1215;1215;1215;1215;1056	ENSP00000336982:V1240M;ENSP00000382563:V1215M;ENSP00000437936:V1215M;ENSP00000382552:V1215M;ENSP00000382547:V1215M;ENSP00000382506:V1215M;ENSP00000382530:V1215M;ENSP00000382546:V1215M;ENSP00000382500:V1215M;ENSP00000382549:V1215M;ENSP00000266376:V1235M;ENSP00000382515:V1235M;ENSP00000382510:V1215M;ENSP00000341092:V1215M;ENSP00000382537:V1215M;ENSP00000329877:V1215M;ENSP00000382557:V1215M;ENSP00000385724:V1215M;ENSP00000382512:V1215M;ENSP00000382542:V1215M;ENSP00000382526:V1215M;ENSP00000385896:V1215M;ENSP00000382504:V1215M	ENSP00000323129:V1056M	V	+	1	0	CACNA1C	2590052	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.932000	0.87634	2.508000	0.84585	0.655000	0.94253	GTG	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1		11.125676	0	-19	50	0	0	1	0	NM_000719	6	15.366337	32	0.157895
GPR83	10888	broad.mit.edu	hg19	11	94113805	94113805	+	Missense_Mutation	SNP	C	C	T	rs139287789		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:94113805C>T	ENST00000243673.2	-	4	953	c.782G>A	c.(781-783)cGt>cAt	p.R261H	GPR83_ENST00000539203.2_Missense_Mutation_p.R219H	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	261			integral to membrane|plasma membrane	neuropeptide Y receptor activity	NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)			CTTGGCCACACGAGCGTAGGC	0.527	0	72.0	64.0	67.0	11	94113805	2201	4298	6499	SO:0001583	missense	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901	"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72	10760605, 11060465	Standard	NM_016540	Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000539203.2:c.656G>A	11.37:g.94113805C>T	ENSP00000441550:p.Arg219His	B0M0K5|Q6NWR4|Q9P1Y8	ENST00000539203.2	37		.	.	.	.	.	.	.	.	.	.	C	9.499	1.102782	0.20632	0.0	1.16E-4	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.39056	1.1;1.1	5.41	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.258283	0.36703	N	0.002441	T	0.27524	0.0676	L	0.33093	0.98	0.23411	N	0.997737	B	0.18461	0.028	B	0.15870	0.014	T	0.09930	-1.0652	10	0.15499	T	0.54	.	8.617	0.33838	0.1509:0.586:0.2631:0.0	.	261	Q9NYM4	GPR83_HUMAN	H	261;219	ENSP00000243673:R261H;ENSP00000441550:R219H	ENSP00000243673:R261H	R	-	2	0	GPR83	93753453	0.995000	0.38212	0.363000	0.25875	0.982000	0.71751	2.604000	0.46274	2.535000	0.85469	0.655000	0.94253	CGT	GPR83-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000396233.2		3.809394	0	1	26	0	0	1	0	NM_016540	3	6.627531	19	0.136364
CYP27B1	1594	broad.mit.edu	hg19	12	58157521	58157521	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:58157521C>T	ENST00000228606.4	-	8	1495	c.1286G>A	c.(1285-1287)cGt>cAt	p.R429H		NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	429		bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding	central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		GCGAGCTGGACGAAAAGAATT	0.567	0	62.0	68.0	66.0	12	58157521	2203	4300	6503	SO:0001583	missense	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012	"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR	9295274, 9344864	Standard	NM_000785	Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.1286G>A	12.37:g.58157521C>T	ENSP00000228606:p.Arg429His	B2RC61|Q548T3	ENST00000228606.4	37	CCDS8954.1	.	.	.	.	.	.	.	.	.	.	C	9.747	1.166448	0.21621	.	.	ENSG00000111012	ENST00000228606	T	0.70045	-0.45	5.23	-0.551	0.11822	.	0.825490	0.11253	N	0.583388	T	0.54598	0.1868	L	0.45137	1.4	0.21553	N	0.999648	B	0.22146	0.065	B	0.24848	0.056	T	0.40346	-0.9568	10	0.15066	T	0.55	.	11.1924	0.48693	0.0:0.4814:0.0:0.5186	.	429	O15528	CP27B_HUMAN	H	429	ENSP00000228606:R429H	ENSP00000228606:R429H	R	-	2	0	CYP27B1	56443788	0.001000	0.12720	0.794000	0.32065	0.882000	0.50991	-0.098000	0.11024	-0.239000	0.09710	-1.598000	0.00824	CGT	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409248.1		-2.008182	0	11	76	0	0	1	0	NM_000785	3	6.478019	41	0.068182
PARD3	56288	broad.mit.edu	hg19	10	34648125	34648125	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:34648125G>A	ENST00000374789.3	-	14	2342	c.2017C>T	c.(2017-2019)Cga>Tga	p.R673*	PARD3_ENST00000374768.1_Nonsense_Mutation_p.R111*|PARD3_ENST00000374790.3_Nonsense_Mutation_p.R616*|PARD3_ENST00000545260.1_Nonsense_Mutation_p.R616*|PARD3_ENST00000374794.3_Nonsense_Mutation_p.R616*|PARD3_ENST00000350537.4_Nonsense_Mutation_p.R660*|PARD3_ENST00000374773.1_Nonsense_Mutation_p.R673*|PARD3_ENST00000374776.1_Nonsense_Mutation_p.R660*|PARD3_ENST00000340077.5_Nonsense_Mutation_p.R673*|PARD3_ENST00000544292.1_Nonsense_Mutation_p.R390*|PARD3_ENST00000545693.1_Nonsense_Mutation_p.R660*|PARD3_ENST00000374788.3_Nonsense_Mutation_p.R673*|PARD3_ENST00000346874.4_Nonsense_Mutation_p.R673*	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	673	PDZ 3.	activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding	NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)			ATCATTCCTCGTTTATTGCCT	0.378	0	220.0	202.0	208.0	10	34648125	2203	4300	6503	SO:0001587	stop_gained	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498		16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""		10934474	Standard	NM_001184790	Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2017C>T	10.37:g.34648125G>A	ENSP00000363921:p.Arg673*	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	42	9.710949	0.99245	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292;ENST00000374768	.	.	.	5.74	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8356	0.63408	0.0:0.0:0.725:0.275	.	.	.	.	X	660;616;673;673;673;616;660;616;660;673;673;390;111	.	ENSP00000341844:R673X	R	-	1	2	PARD3	34688131	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.847000	0.55895	2.719000	0.93026	0.655000	0.94253	CGA	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1		83.945150	0	-45	155	0	0	1	0	NM_019619	29	86.470095	61	0.322222
FAM127A	8933	broad.mit.edu	hg19	X	134166518	134166518	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:134166518C>T	ENST00000257013.7	+	1	186	c.105C>T	c.(103-105)ggC>ggT	p.G35G	FAM127A_ENST00000464369.1_3'UTR	NM_001078171.1	NP_001071639.1	A6ZKI3	F127A_HUMAN	family with sequence similarity 127, member A	35					endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)				CGTTTGACGGCGATACCGACC	0.622	0	106.0	108.0	107.0	X	134166518	2163	4233	6396	SO:0001819	synonymous_variant	Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590		2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1	9403077, 15716091, 16093683	Standard	NM_001078171	Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.105C>T	X.37:g.134166518C>T		Q6IBF1	ENST00000257013.7	37	CCDS43997.1																																																																																			FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058391.2		22.822118	0	-10	126	0	0	1	0	NM_001078171	13	31.491557	67	0.162500
MYO7A	4647	broad.mit.edu	hg19	11	76890115	76890115	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:76890115C>T	ENST00000409709.3	+	20	2579	c.2307C>T	c.(2305-2307)aaC>aaT	p.N769N	MYO7A_ENST00000409619.2_Silent_p.N758N|MYO7A_ENST00000409893.1_Silent_p.N769N|MYO7A_ENST00000458637.2_Silent_p.N769N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	769	IQ 2.	actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity	NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64					AGCTGAAGAACGCTGCCACAC	0.587	0	36.0	41.0	39.0	11	76890115	2127	4225	6352	SO:0001819	synonymous_variant	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474	"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11	8884266	Standard	NM_000260	Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000458637.2:c.2307C>T	11.37:g.76890115C>T		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	ENST00000458637.2	37	CCDS53684.1																																																																																			MYO7A-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328134.2		16.476987	0	-3	15	0	0	1	0	NM_000260	5	16.586818	3	0.625000
MAOB	4129	broad.mit.edu	hg19	X	43702951	43702951	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:43702951G>A	ENST00000378069.4	-	2	253	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	MAOB_ENST00000536181.1_Missense_Mutation_p.R20W|MAOB_ENST00000487544.1_5'UTR|MAOB_ENST00000538942.1_Missense_Mutation_p.R20W	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	36	Arg/Lys-rich (basic).	xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	electron carrier activity|primary amine oxidase activity	breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					ACACGGTCCCGGGCTTCCAGA	0.483	0	91.0	76.0	81.0	X	43702951	2203	4300	6503	SO:0001583	missense		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535		6834	protein-coding gene	gene with protein product		309860				Standard	NM_000898	Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.106C>T	X.37:g.43702951G>A	ENSP00000367309:p.Arg36Trp	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105717	0.77096	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.94828	-3.53;-3.53;-3.53	5.54	4.65	0.58169	Amine oxidase (1);	0.164390	0.53938	D	0.000057	D	0.97717	0.9251	H	0.96080	3.765	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.97717	1.0194	10	0.87932	D	0	-17.0957	7.9123	0.29798	0.0801:0.0:0.6339:0.286	.	20;36;36	B7Z5H3;Q8TBI1;P27338	.;.;AOFB_HUMAN	W	36;20;20	ENSP00000367309:R36W;ENSP00000441613:R20W;ENSP00000442240:R20W	ENSP00000367309:R36W	R	-	1	2	MAOB	43587895	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.899000	0.48679	2.318000	0.78349	0.600000	0.82982	CGG	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1		31.980307	0	-12	68	0	0	1	0	NM_000898	12	35.061463	38	0.240000
ANGPT4	51378	broad.mit.edu	hg19	20	860425	860425	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:860425C>T	ENST00000381922.3	-	6	1120	c.1018G>A	c.(1018-1020)Gtg>Atg	p.V340M	ANGPT4_ENST00000546022.1_Missense_Mutation_p.V340M	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	340	Fibrinogen C-terminal.	anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27					TGAAAATTCACGGTGCCATTC	0.617	0	82.0	75.0	78.0	20	860425	2203	4300	6503	SO:0001583	missense	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280	"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705			10051567, 10218486	Standard	NM_015985	Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1018G>A	20.37:g.860425C>T	ENSP00000371347:p.Val340Met	B4E3J9|Q5TFF4|Q9H4Z4	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	C	9.573	1.121658	0.20877	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.35236	1.82;1.32	5.44	2.45	0.29901	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.355854	0.25458	N	0.030524	T	0.49372	0.1553	H	0.97707	4.06	0.09310	N	0.999996	D;P	0.55385	0.971;0.945	B;B	0.41860	0.368;0.131	T	0.57957	-0.7721	10	0.87932	D	0	.	5.0409	0.14458	0.1203:0.6288:0.1165:0.1344	.	340;340	B4E3J9;Q9Y264	.;ANGP4_HUMAN	M	340	ENSP00000371347:V340M;ENSP00000439605:V340M	ENSP00000371347:V340M	V	-	1	0	ANGPT4	808425	0.123000	0.22298	0.001000	0.08648	0.205000	0.24178	0.891000	0.28309	0.411000	0.25702	0.655000	0.94253	GTG	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1		15.505245	0	11	66	0	0	1	0	NM_015985	7	18.233221	27	0.205882
CLP1	10978	broad.mit.edu	hg19	11	57428246	57428246	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:57428246C>T	ENST00000533682.1	+	3	1341	c.616C>T	c.(616-618)Cgt>Tgt	p.R206C	CLP1_ENST00000302731.4_Missense_Mutation_p.R142C|CLP1_ENST00000529430.1_Missense_Mutation_p.R217C|CLP1_ENST00000525602.1_Missense_Mutation_p.R206C			Q92989	CLP1_HUMAN	cleavage and polyadenylation factor I subunit 1	206		mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity	autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15					GATTACATCTCGTTTAGCAGA	0.438	0	101.0	97.0	99.0	11	57428246	2201	4296	6497	SO:0001583	missense	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""		8896421, 11060040	Standard	NM_006831	Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.424C>T	11.37:g.57428246C>T	ENSP00000304704:p.Arg142Cys	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	ENST00000302731.4	37	CCDS44600.1	.	.	.	.	.	.	.	.	.	.	c	13.52	2.262061	0.39995	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602;ENST00000302731	T;T;T;T	0.49139	0.79;0.79;0.79;0.97	6.05	5.14	0.70334	.	0.092787	0.85682	D	0.000000	T	0.43809	0.1264	L	0.46157	1.445	0.80722	D	1	B;B	0.13145	0.005;0.007	B;B	0.15484	0.001;0.013	T	0.32268	-0.9913	10	0.51188	T	0.08	-20.5558	14.9414	0.70997	0.0:0.9313:0.0:0.0687	.	142;206	Q92989-2;Q92989	.;CLP1_HUMAN	C	217;206;206;142	ENSP00000433406:R217C;ENSP00000434995:R206C;ENSP00000436066:R206C;ENSP00000304704:R142C	ENSP00000304704:R142C	R	+	1	0	CLP1	57184822	0.996000	0.38824	0.672000	0.29872	0.990000	0.78478	3.095000	0.50235	1.586000	0.49944	0.645000	0.84053	CGT	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1		9.180725	0	-13	73	0	0	1	0	NM_006831	7	17.609755	52	0.118644
PLCL1	5334	broad.mit.edu	hg19	2	198948757	198948757	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:198948757G>A	ENST00000428675.1	+	2	914	c.516G>A	c.(514-516)acG>acA	p.T172T	PLCL1_ENST00000437704.2_Silent_p.T74T	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	172	Interaction with PPP1C.|PH.	intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					GGAAAAACACGGAAACATTTA	0.463	4	115.0	121.0	119.0	2	198948757	2203	4300	6503	SO:0001819	synonymous_variant	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896		9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE	7633416	Standard	NM_006226	Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.516G>A	2.37:g.198948757G>A		Q3MJ90|Q53SD3|Q7Z3S3	ENST00000428675.1	37	CCDS2326.2																																																																																			PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1		95.173145	0	0	86	0	0	1	0	NM_006226	29	95.205099	32	0.475410
NBPF3	84224	broad.mit.edu	hg19	1	21809642	21809642	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:21809642C>T	ENST00000318220.6	+	18	2545	c.1497C>T	c.(1495-1497)aaC>aaT	p.N499N	NBPF3_ENST00000454000.2_Silent_p.N485N|NBPF3_ENST00000342104.5_Silent_p.N543N|NBPF3_ENST00000318249.5_Silent_p.N555N			Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	555	NBPF 4.		cytoplasm		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	CCAGGCTCAACGAGGTGCTGA	0.458	0	65.0	66.0	66.0	1	21809642	2199	4294	6493	SO:0001819	synonymous_variant	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794	"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992			11230166, 16079250	Standard	NM_032264	Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318220.6:c.1497C>T	1.37:g.21809642C>T		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	ENST00000318220.6	37																																																																																				NBPF3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000008190.2		103.694307	0	-16	130	0	0	1	0	NM_032264	32	103.725985	29	0.524590
PPP6R2	9701	broad.mit.edu	hg19	22	50861960	50861960	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:50861960C>T	ENST00000359139.3	+	10	1436	c.1042C>T	c.(1042-1044)Cgc>Tgc	p.R348C	PPP6R2_ENST00000395741.3_Missense_Mutation_p.R349C|PPP6R2_ENST00000395744.3_Missense_Mutation_p.R348C|PPP6R2_ENST00000216061.5_Missense_Mutation_p.R348C	NM_001242898.1|NM_001242899.1|NM_001242900.1|NM_014678.4	NP_001229827.1|NP_001229828.1|NP_001229829.1|NP_055493.2	O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	348			cytoplasm|intracellular membrane-bounded organelle	protein binding	NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22					GCATGGCGCCCGCCTCATGGC	0.597	0	103.0	85.0	91.0	22	50861960	2203	4300	6503	SO:0001583	missense	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239	"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2	16769727	Standard	NM_014678	Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000359139.3:c.1042C>T	22.37:g.50861960C>T	ENSP00000352051:p.Arg348Cys	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	ENST00000359139.3	37	CCDS56236.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971290	0.74246	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.67	5.67	0.87782	.	0.102883	0.64402	D	0.000004	T	0.59514	0.2199	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.984;0.991;0.977;0.984;0.977	T	0.63274	-0.6674	10	0.87932	D	0	-32.374	17.2603	0.87068	0.0:1.0:0.0:0.0	.	348;348;349;348;348	O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;PP6R2_HUMAN;.;.;.	C	348;349;348;348	ENSP00000352051:R348C;ENSP00000379090:R349C;ENSP00000379093:R348C;ENSP00000216061:R348C	ENSP00000216061:R348C	R	+	1	0	PPP6R2	49208826	0.899000	0.30636	1.000000	0.80357	0.987000	0.75469	1.752000	0.38349	2.685000	0.91497	0.591000	0.81541	CGC	PPP6R2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316806.1		15.537655	0	-10	51	0	0	1	0	NM_014678	7	19.065403	31	0.184211
DCP1B	196513	broad.mit.edu	hg19	12	2062235	2062235	+	Missense_Mutation	SNP	A	A	G			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:2062235A>G	ENST00000280665.6	-	7	950	c.871T>C	c.(871-873)Tgt>Cgt	p.C291R	DCP1B_ENST00000540622.1_Missense_Mutation_p.C165R|DCP1B_ENST00000397173.4_Missense_Mutation_p.C189R|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	291		exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding	NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)		ATGGCTGGACAGAGCTGCTTC	0.547	0	70.0	74.0	73.0	12	2062235	2203	4300	6503	SO:0001583	missense	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065		24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""		12417715, 15067023	Standard	NM_152640	Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000540622.1:c.493T>C	12.37:g.2062235A>G	ENSP00000444374:p.Cys165Arg	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	ENST00000540622.1	37		.	.	.	.	.	.	.	.	.	.	A	19.61	3.859306	0.71834	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.59638	0.69;0.52;0.25	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.73536	0.3599	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.76176	-0.3055	10	0.62326	D	0.03	-14.1539	14.2709	0.66152	1.0:0.0:0.0:0.0	.	189;291	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	R	291;189;165	ENSP00000280665:C291R;ENSP00000380358:C189R;ENSP00000444374:C165R	ENSP00000280665:C291R	C	-	1	0	DCP1B	1932496	1.000000	0.71417	0.986000	0.45419	0.974000	0.67602	6.917000	0.75782	2.153000	0.67306	0.528000	0.53228	TGT	DCP1B-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398246.1		53.140872	0	5	67	0	0	1	0	NM_152640	18	54.110723	33	0.352941
MYH9	4627	broad.mit.edu	hg19	22	36684926	36684926	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr22:36684926C>T	ENST00000216181.5	-	33	4847	c.4617G>A	c.(4615-4617)acG>acA	p.T1539T		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1539		actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86					CTTCCAGCTGCGTCTTCATCT	0.632	0	99.0	92.0	94.0	22	36684926	2203	4300	6503	SO:0001819	synonymous_variant		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345	"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17	1860190, 11023810	Standard	NM_002473	Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4617G>A	22.37:g.36684926C>T		A8K6E4|O60805|Q60FE2|Q86T83	ENST00000216181.5	37	CCDS13927.1																																																																																			MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3		-10.672674	0	-14	108	0	0	1	0	NM_002473	4	8.187794	82	0.046512
DPP4	1803	ucsc.edu	hg19	2	162877139	162877139	+	Missense_Mutation	SNP	G	G	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										CTTCTTCATTGCTGATGATCT	0.308	0	78.0	78.0	78.0	2	162877139	2203	4300	6503	SO:0001583	missense	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2	8101391	Standard	NM_001935	Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1128C>A	2.37:g.162877139G>T	ENSP00000353731:p.Ser376Arg	Q53TN1	ENST00000360534.3	37	CCDS2216.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.547277	0.65311	.	.	ENSG00000197635	ENST00000360534	T	0.31247	1.5	5.65	3.54	0.40534	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	M	0.83312	2.635	0.58432	D	0.999998	D	0.76494	0.999	D	0.66497	0.944	T	0.56214	-0.8016	10	0.66056	D	0.02	-20.0859	9.8978	0.41329	0.2547:0.0:0.7453:0.0	.	376	P27487	DPP4_HUMAN	R	376	ENSP00000353731:S376R	ENSP00000353731:S376R	S	-	3	2	DPP4	162585385	0.878000	0.30173	0.917000	0.36280	0.974000	0.67602	0.372000	0.20467	0.755000	0.32990	0.655000	0.94253	AGC	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2				1	42						4		33	
PUS3	83480	broad.mit.edu	hg19	11	125763823	125763823	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:125763823G>A	ENST00000227474.3	-	4	1400	c.1303C>T	c.(1303-1305)Cga>Tga	p.R435*	HYLS1_ENST00000425380.2_Intron|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000356438.3_Intron|PUS3_ENST00000530811.1_Nonsense_Mutation_p.R435*	NM_001271985.1|NM_031307.3	NP_001258914.1|NP_112597	Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	435			nucleus	RNA binding	NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)	TGCTCAATTCGTCCCCTACGT	0.453	0	224.0	217.0	219.0	11	125763823	2201	4299	6500	SO:0001587	stop_gained	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05						25461	protein-coding gene	gene with protein product					12477932	Standard	NM_031307	Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.1303C>T	11.37:g.125763823G>A	ENSP00000432386:p.Arg435*	B2RAM0|Q96D17|Q96J23|Q96NB4	ENST00000530811.1	37	CCDS8466.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434132	0.96150	.	.	ENSG00000110060	ENST00000227474;ENST00000530811	.	.	.	5.1	1.67	0.24075	.	0.113923	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0923	10.221	0.43196	0.0:0.1095:0.5456:0.3448	.	.	.	.	X	435	.	ENSP00000227474:R435X	R	-	1	2	PUS3	125269033	1.000000	0.71417	0.577000	0.28562	0.981000	0.71138	1.656000	0.37355	0.500000	0.27991	0.591000	0.81541	CGA	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1		-8.805168	0	-11	159	0	0	1	0	NM_031307	8	17.544990	123	0.061069
RPL10A	4736	broad.mit.edu	hg19	6	35437971	35437971	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:35437971C>T	ENST00000322203.6	+	5	353	c.326C>T	c.(325-327)gCg>gTg	p.A109V	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	109		anatomical structure morphogenesis|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	RNA binding|structural constituent of ribosome	breast(1)|large_intestine(2)|ovary(1)	4					AAGTATGATGCGTTTTTGGCC	0.498	0	101.0	91.0	94.0	6	35437971	2203	4300	6503	SO:0001583	missense	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755	"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6	7609734, 9647638	Standard	NM_007104	Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.326C>T	6.37:g.35437971C>T	ENSP00000363018:p.Ala109Val	B2R801|P52859|P53025|Q5TZT6|Q8J013	ENST00000322203.6	37	CCDS4806.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584210	0.65992	.	.	ENSG00000198755	ENST00000322203	T	0.37235	1.21	4.6	4.6	0.57074	Ribosomal protein L1, 3-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.056931	0.64402	D	0.000002	T	0.23766	0.0575	L	0.53249	1.67	0.80722	D	1	B	0.23442	0.085	B	0.24701	0.055	T	0.09250	-1.0683	10	0.46703	T	0.11	.	16.1008	0.81169	0.0:1.0:0.0:0.0	.	109	P62906	RL10A_HUMAN	V	109	ENSP00000363018:A109V	ENSP00000363018:A109V	A	+	2	0	RPL10A	35545949	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	7.609000	0.82925	2.124000	0.65301	0.456000	0.33151	GCG	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1		0.297658	0	16	57	0	0	1	0	NM_007104	3	6.649231	33	0.083333
JAG2	3714	broad.mit.edu	hg19	14	105618598	105618598	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:105618598G>A	ENST00000331782.3	-	6	1222	c.819C>T	c.(817-819)tgC>tgT	p.C273C	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Silent_p.C273C	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	273	EGF-like 1.	auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding	breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)	CACACTCATCGCAGAACCTCC	0.647	0	53.0	43.0	46.0	14	105618598	2201	4300	6501	SO:0001819	synonymous_variant	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916		6189	protein-coding gene	gene with protein product		602570			9315665, 10662552	Standard	NM_002226	Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.819C>T	14.37:g.105618598G>A		Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	ENST00000331782.3	37	CCDS9998.1																																																																																			JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		12.400683	0	7	29	0	0	1	0		4	12.431811	3	0.571429
CSF2RA	0	broad.mit.edu	hg19	X	1413315	1413315	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:1413315G>A	ENST00000381524.3	+	8	927	c.741G>A	c.(739-741)tcG>tcA	p.S247S	CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000381509.3_Silent_p.S247S|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000381529.3_Silent_p.S247S|CSF2RA_ENST00000355432.3_Silent_p.S247S|CSF2RA_ENST00000501036.2_Silent_p.S114S|CSF2RA_ENST00000381500.1_Silent_p.S247S|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000432318.2_Silent_p.S247S|CSF2RA_ENST00000417535.2_Silent_p.S247S|CSF2RA_ENST00000361536.3_Silent_p.S247S			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	247			extracellular region|integral to plasma membrane	cytokine receptor activity	central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			AGAAGCTGTCGTACCTGGACT	0.597	1	283.0	226.0	245.0	X	1413315	2203	4296	6499	SO:0001819	synonymous_variant	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223	"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R	1702217	Standard	NM_006140	Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.741G>A	X.37:g.1413315G>A		A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	ENST00000381524.3	37	CCDS35191.1																																																																																			CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2		25.760506	0	-17	69	0	0	1	0		12	32.037317	54	0.181818
LRRN4	164312	broad.mit.edu	hg19	20	6021826	6021826	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr20:6021826C>T	ENST00000378858.4	-	5	2289	c.2065G>A	c.(2065-2067)Gcc>Acc	p.A689T		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	689			integral to membrane		breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27					CCGCTGGCGGCGCACAGCCCA	0.716	0	9.0	10.0	10.0	20	6021826	2185	4257	6442	SO:0001583	missense	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872	"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75	15870286	Standard	NM_152611	Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.2065G>A	20.37:g.6021826C>T	ENSP00000368135:p.Ala689Thr	A8K258|Q5JWV6|Q9H419	ENST00000378858.4	37	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060641	0.36373	.	.	ENSG00000125872	ENST00000378858	T	0.59638	0.25	5.54	-0.18	0.13295	.	0.584607	0.17286	N	0.179835	T	0.34221	0.0890	L	0.34521	1.04	0.09310	N	1	B	0.29037	0.231	B	0.14023	0.01	T	0.12218	-1.0556	10	0.16896	T	0.51	-10.6341	4.9182	0.13856	0.1315:0.481:0.0:0.3876	.	689	Q8WUT4	LRRN4_HUMAN	T	689	ENSP00000368135:A689T	ENSP00000368135:A689T	A	-	1	0	LRRN4	5969826	0.000000	0.05858	0.032000	0.17829	0.159000	0.22180	-0.197000	0.09518	-0.021000	0.14009	0.655000	0.94253	GCC	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2		12.963135	0	5	14	0	0	1	0	NM_152611	4	12.902227	0	1.000000
CBL	867	broad.mit.edu	hg19	11	119144698	119144698	+	Silent	SNP	G	G	A	rs146662327		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:119144698G>A	ENST00000264033.4	+	4	1087	c.711G>A	c.(709-711)tcG>tcA	p.S237S		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	237	Cbl-PTB.|EF-hand-like.	epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)	ATTATATTTCGGTTTTTGAAT	0.418	0	105.0	103.0	104.0	11	119144698	2199	4295	6494	SO:0001819	synonymous_variant	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395	"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2	2013228	Standard	NM_005188	Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.711G>A	11.37:g.119144698G>A		A3KMP8	ENST00000264033.4	37	CCDS8418.1																																																																																			CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4		26.330825	0	-2	84	0	0	1	0	NM_005188	10	28.603337	30	0.250000
KCNT1	57582	broad.mit.edu	hg19	9	138651621	138651621	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:138651621C>T	ENST00000298480.5	+	11	1025	c.951C>T	c.(949-951)taC>taT	p.Y317Y	KCNT1_ENST00000371757.2_Silent_p.Y317Y|KCNT1_ENST00000263604.3_Silent_p.Y298Y|KCNT1_ENST00000488444.2_Silent_p.Y298Y|KCNT1_ENST00000486577.2_Silent_p.Y278Y|KCNT1_ENST00000490355.2_Silent_p.Y298Y|KCNT1_ENST00000491806.2_Silent_p.Y284Y|KCNT1_ENST00000487664.1_Silent_p.Y272Y			B7ZVY4	B7ZVY4_HUMAN	potassium channel, subfamily T, member 1	317			membrane	binding|calcium-activated potassium channel activity	breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	CCGTGGGCTACGGTGACGTCA	0.642	0	141.0	103.0	116.0	9	138651621	2202	4300	6502	SO:0001819	synonymous_variant	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147	"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167			10718198, 16382103	Standard	NM_020822	Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000371757.2:c.951C>T	9.37:g.138651621C>T		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	ENST00000371757.2	37	CCDS35175.2																																																																																			KCNT1-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055021.2		58.203150	0	-9	44	0	0	1	0	NM_020822	19	58.364692	14	0.575758
ARMCX2	9823	broad.mit.edu	hg19	X	100912019	100912019	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:100912019C>T	ENST00000328766.5	-	5	1009	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	ARMCX2_ENST00000330154.2_Missense_Mutation_p.E186K|ARMCX2_ENST00000356824.4_Missense_Mutation_p.E186K	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	186	Ala-rich.		integral to membrane	binding	NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29					GCTGCCGCTTCGGTAGGCACC	0.647	0	26.0	25.0	25.0	X	100912019	2188	4264	6452	SO:0001583	missense	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867	"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363			9628581, 11162520, 16221301, 22569362	Standard	XM_005278109	Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.556G>A	X.37:g.100912019C>T	ENSP00000331662:p.Glu186Lys	O60267|Q5H9D9	ENST00000328766.5	37	CCDS14490.1	.	.	.	.	.	.	.	.	.	.	C	3.139	-0.176697	0.06380	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.30448	1.53;1.53;1.53	4.49	-3.09	0.05331	.	5.841240	0.00357	N	0.000022	T	0.14830	0.0358	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09335	-1.0679	10	0.07482	T	0.82	-0.0177	1.4606	0.02394	0.1281:0.2008:0.2595:0.4116	.	186	Q7L311	ARMX2_HUMAN	K	186	ENSP00000331662:E186K;ENSP00000328631:E186K;ENSP00000349281:E186K	ENSP00000331662:E186K	E	-	1	0	ARMCX2	100798675	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.683000	0.25349	-0.688000	0.05155	0.468000	0.43344	GAA	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1		54.412367	0	-6	69	0	0	1	0	NM_014782	19	55.811424	38	0.333333
TNS3	64759	broad.mit.edu	hg19	7	47333375	47333375	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:47333375G>A	ENST00000398879.1	-	25	4094	c.3728C>T	c.(3727-3729)cCg>cTg	p.P1243L	TNS3_ENST00000311160.9_Missense_Mutation_p.P1243L|TNS3_ENST00000355730.3_Missense_Mutation_p.P1003L			Q68CZ2	TENS3_HUMAN	tensin 3	1243	SH2.		focal adhesion	protein binding	NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64					CACTCCCTTCGGGGTACACTC	0.458	1	104.0	103.0	103.0	7	47333375	1923	4126	6049	SO:0001583	missense	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205	"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1	11559528	Standard	NM_022748	Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3728C>T	7.37:g.47333375G>A	ENSP00000381854:p.Pro1243Leu	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218665	0.79464	2.6E-4	0.0	ENSG00000136205	ENST00000311160;ENST00000398879;ENST00000355730;ENST00000545849	D;D;D	0.88354	-2.37;-2.37;-2.37	5.05	5.05	0.67936	SH2 motif (4);	0.396370	0.27572	N	0.018761	D	0.91710	0.7379	M	0.74258	2.255	0.80722	D	1	D	0.55605	0.972	P	0.55055	0.767	D	0.92167	0.5740	10	0.72032	D	0.01	-29.9744	11.3714	0.49702	0.0:0.0:0.8189:0.181	.	1243	Q68CZ2	TENS3_HUMAN	L	1243;1243;1003;699	ENSP00000312143:P1243L;ENSP00000381854:P1243L;ENSP00000347968:P1003L	ENSP00000312143:P1243L	P	-	2	0	TNS3	47299900	1.000000	0.71417	0.957000	0.39632	0.995000	0.86356	3.405000	0.52630	2.500000	0.84329	0.655000	0.94253	CCG	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1		74.723037	0	-1	72	0	0	1	0	NM_022748	23	74.762842	26	0.469388
EHD1	10938	broad.mit.edu	hg19	11	64622812	64622812	+	Silent	SNP	C	C	T	rs144668933		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:64622812C>T	ENST00000320631.3	-	4	1316	c.1062G>A	c.(1060-1062)ccG>ccA	p.P354P	EHD1_ENST00000359393.2_Silent_p.P354P	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	354		blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding	breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12					TGCGGAGGCTCGGGAAGTCCC	0.577	0	78.0	78.0	78.0	11	64622812	2201	4297	6498	SO:0001819	synonymous_variant	AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047	"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1	10395801, 10673336	Standard	NM_001282444	Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.1062G>A	11.37:g.64622812C>T		O14611|Q2M3Q4|Q9UNR3	ENST00000320631.3	37	CCDS8084.1																																																																																			EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143229.2		21.387363	0	-10	57	0	0	1	0	NM_006795	8	22.699106	21	0.275862
FAM193B	54540	broad.mit.edu	hg19	5	176958324	176958324	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:176958324C>T	ENST00000329540.5	-	8	2941	c.112G>A	c.(112-114)Gcc>Acc	p.A38T	FAM193B_ENST00000443375.2_Missense_Mutation_p.A379T|FAM193B_ENST00000508298.1_Intron|FAM193B_ENST00000514747.1_Intron			Q6IPW0	Q6IPW0_HUMAN	family with sequence similarity 193, member B	420					kidney(1)|large_intestine(3)	4					GCGGCCCTGGCGCTGTTGGGG	0.657	0	23.0	26.0	25.0	5	176958324	1888	4104	5992	SO:0001583	missense		CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067		25524	protein-coding gene	gene with protein product		615813			11572484	Standard	NR_024019	Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000329540.5:c.112G>A	5.37:g.176958324C>T	ENSP00000332014:p.Ala38Thr	E9PET5|Q9NW00	ENST00000329540.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.627044|4.627044	0.87560|0.87560	.|.	.|.	ENSG00000146067|ENSG00000146067	ENST00000443375;ENST00000329540|ENST00000524677	T;T|.	0.52526|.	0.73;0.66|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	.|.	.|.	.|.	.|.	T|T	0.63581|0.63581	0.2523|0.2523	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999993|0.999993	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.71414|.	0.973;0.936|.	T|T	0.62163|0.62163	-0.6912|-0.6912	8|4	0.18276|.	T|.	0.48|.	-5.0806|-5.0806	11.8957|11.8957	0.52656|0.52656	0.0:0.9198:0.0:0.0802|0.0:0.9198:0.0:0.0802	.|.	38;379|.	E7ER81;E9PEZ8|.	.;.|.	T|H	379;38|97	ENSP00000410098:A379T;ENSP00000332014:A38T|.	ENSP00000332014:A38T|.	A|R	-|-	1|2	0|0	FAM193B|FAM193B	176890930|176890930	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.969000|4.969000	0.63735|0.63735	2.347000|2.347000	0.79759|0.79759	0.563000|0.563000	0.77884|0.77884	GCC|CGC	FAM193B-201	KNOWN	basic	protein_coding	protein_coding			23.098084	0	-2	13	0	0	1	0	NM_019057	8	23.110904	9	0.470588
ZFHX3	463	broad.mit.edu	hg19	16	72993655	72993655	+	Silent	SNP	G	G	A	rs144573608		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:72993655G>A	ENST00000268489.5	-	2	1062	c.390C>T	c.(388-390)gcC>gcT	p.A130A	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	130		muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)			CGATCTCCCCGGCCAGGTTCT	0.706	0	36.0	39.0	38.0	16	72993655	2198	4300	6498	SO:0001819	synonymous_variant	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836	"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1	1719379, 7592926	Standard	NM_006885	Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.390C>T	16.37:g.72993655G>A		D3DWS8|O15101|Q13719	ENST00000268489.5	37	CCDS10908.1																																																																																			ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1		46.620712	0	12	76	0	0	1	0	NM_006885	15	46.723178	19	0.441176
IGSF9B	22997	broad.mit.edu	hg19	11	133806051	133806051	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:133806051C>T	ENST00000321016.8	-	6	948	c.718G>A	c.(718-720)Gtc>Atc	p.V240I	IGSF9B_ENST00000533871.2_Missense_Mutation_p.V240I			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	240	Ig-like 3.		integral to membrane|plasma membrane		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	GAGATGTTGACGGTGATGTTC	0.617	0	58.0	63.0	62.0	11	133806051	2110	4220	6330	SO:0001583	missense	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20			"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773				Standard	NM_001277285	Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000533871.2:c.718G>A	11.37:g.133806051C>T	ENSP00000436552:p.Val240Ile	G5EA26	ENST00000533871.2	37		.	.	.	.	.	.	.	.	.	.	C	21.7	4.189872	0.78789	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.70282	-0.47;-0.47;-0.47	5.03	5.03	0.67393	Immunoglobulin I-set (1);Fibronectin, type III (2);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66177	0.2763	L	0.43923	1.385	0.51482	D	0.999925	B	0.22276	0.067	B	0.26202	0.067	T	0.61501	-0.7050	9	0.29301	T	0.29	.	18.3684	0.90399	0.0:1.0:0.0:0.0	.	240	Q9UPX0	TUTLB_HUMAN	I	240;82;240	ENSP00000317980:V240I;ENSP00000436552:V82I;ENSP00000436576:V240I	ENSP00000317980:V240I	V	-	1	0	IGSF9B	133311261	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.346000	0.79739	0.561000	0.74099	GTC	IGSF9B-002	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471431.1		11.062822	0	-15	11	0	0	1	0	XM_290502	5	12.380660	16	0.238095
COG2	22796	broad.mit.edu	hg19	1	230819334	230819334	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:230819334C>T	ENST00000534989.1	+	11	1339	c.1004C>T	c.(1003-1005)gCg>gTg	p.A335V	COG2_ENST00000535166.1_Missense_Mutation_p.A278V|COG2_ENST00000546013.1_Missense_Mutation_p.A83V|COG2_ENST00000366668.3_Missense_Mutation_p.A394V|COG2_ENST00000366669.4_Missense_Mutation_p.A394V			Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	394		Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity	NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)			AGAGAAATAGCGGGATCCTTA	0.388	0	147.0	145.0	146.0	1	230819334	2203	4300	6503	SO:0001583	missense	Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775	"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC	7962052	Standard	NM_007357	Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.1181C>T	1.37:g.230819334C>T	ENSP00000355629:p.Ala394Val	Q86U99	ENST00000366669.4	37	CCDS1584.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718312	0.89205	.	.	ENSG00000135775	ENST00000366669;ENST00000535166;ENST00000366668;ENST00000534989;ENST00000546013	T;T;T;T;T	0.54071	3.51;3.51;3.51;3.51;0.59	5.69	5.69	0.88448	.	0.047537	0.85682	D	0.000000	T	0.70263	0.3204	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.65140	0.859;0.932	T	0.65965	-0.6040	10	0.33141	T	0.24	-19.3267	19.8057	0.96531	0.0:1.0:0.0:0.0	.	394;394	Q86U99;Q14746	.;COG2_HUMAN	V	394;278;394;335;83	ENSP00000355629:A394V;ENSP00000445724:A278V;ENSP00000355628:A394V;ENSP00000440349:A335V;ENSP00000442147:A83V	ENSP00000355628:A394V	A	+	2	0	COG2	228885957	0.999000	0.42202	0.964000	0.40570	0.749000	0.42624	4.412000	0.59787	2.682000	0.91365	0.655000	0.94253	GCG	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092087.1		77.535707	0	3	88	0	0	1	0	NM_007357	26	77.769000	34	0.433333
KL	9365	broad.mit.edu	hg19	13	33638014	33638014	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr13:33638014C>T	ENST00000380099.3	+	5	2738	c.2730C>T	c.(2728-2730)tgC>tgT	p.C910C	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	910	Glycosyl hydrolase-1 2.	aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	TCAATCTTTGCGGATACTTTG	0.403	0	171.0	178.0	176.0	13	33638014	2203	4300	6503	SO:0001819	synonymous_variant	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116		6344	protein-coding gene	gene with protein product		604824			9464267	Standard	NM_004795	Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2730C>T	13.37:g.33638014C>T		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	ENST00000380099.3	37	CCDS9347.1																																																																																			KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		77.890673	0	0	194	0	0	1	0		30	85.420054	94	0.241935
HSD11B1L	374875	broad.mit.edu	hg19	19	5687649	5687649	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:5687649G>A	ENST00000581521.1	+	9	1113	c.638G>A	c.(637-639)cGa>cAa	p.R213Q	HSD11B1L_ENST00000339423.2_Missense_Mutation_p.R213Q|HSD11B1L_ENST00000301382.4_Missense_Mutation_p.R132Q|RPL36_ENST00000582380.2_Intron|RPL36_ENST00000579649.1_Intron|HSD11B1L_ENST00000577917.1_Missense_Mutation_p.R132Q|HSD11B1L_ENST00000411793.2_Missense_Mutation_p.R79Q|HSD11B1L_ENST00000581773.1_Missense_Mutation_p.R213Q|RPL36_ENST00000577222.1_Intron|HSD11B1L_ENST00000581893.1_Missense_Mutation_p.R79Q|HSD11B1L_ENST00000423665.2_Missense_Mutation_p.R213Q|HSD11B1L_ENST00000583928.1_Missense_Mutation_p.R79Q|HSD11B1L_ENST00000342970.2_Missense_Mutation_p.R126Q			Q7Z5J1	DHI1L_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1-like	213			extracellular region	binding|oxidoreductase activity							CTGGGCCTCCGAGATCGCGCC	0.721	0	17.0	19.0	18.0	19	5687649	2198	4293	6491	SO:0001583	missense	AY268353	CCDS12144.1, CCDS12145.1, CCDS12146.1, CCDS45931.1, CCDS45932.1, CCDS58641.1, CCDS58642.1, CCDS74266.1	19p13.3	2011-09-20				ENSG00000167733	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30419	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase 10"", ""short chain dehydrogenase/reductase family 26C, member 2"""				12477932	Standard	NM_001267868	Approved	SCDR10, SDR26C2	uc010dug.4	Q7Z5J1		ENST00000581521.1:c.638G>A	19.37:g.5687649G>A	ENSP00000463794:p.Arg213Gln	Q05D45|Q52LF4|Q7Z5I9|Q7Z5J0|Q7Z5P5|Q7Z5P6|Q7Z5P7|Q7Z5P8	ENST00000581521.1	37	CCDS12145.1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474145	0.26423	.	.	ENSG00000167733	ENST00000411793;ENST00000301382;ENST00000423665;ENST00000342970;ENST00000339423	D;T;T;T;T	0.82255	-1.59;0.73;0.73;0.73;0.73	2.78	0.379	0.16213	.	0.098975	0.42053	U	0.000762	T	0.61540	0.2355	L	0.27053	0.805	0.09310	N	1	B;B;P;B;B;P	0.38745	0.236;0.04;0.645;0.04;0.04;0.513	B;B;B;B;B;B	0.23150	0.036;0.003;0.044;0.01;0.005;0.019	T	0.58188	-0.7680	10	0.87932	D	0	.	3.5427	0.07818	0.2496:0.0:0.5084:0.242	.	126;79;132;213;132;213	Q7Z5J1-5;Q7Z5J1-7;Q7Z5J1-6;Q7Z5J1-2;Q7Z5J1-3;Q7Z5J1	.;.;.;.;.;DHI1L_HUMAN	Q	79;132;213;126;213	ENSP00000398955:R79Q;ENSP00000301382:R132Q;ENSP00000407154:R213Q;ENSP00000343451:R126Q;ENSP00000340436:R213Q	ENSP00000301382:R132Q	R	+	2	0	HSD11B1L	5638649	0.809000	0.29036	0.456000	0.27044	0.543000	0.35085	0.464000	0.21988	0.033000	0.15463	-0.266000	0.10368	CGA	HSD11B1L-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442581.1		8.421932	0	-3	7	0	0	1	0	NM_198706	3	8.643371	6	0.333333
GALNT2	2590	broad.mit.edu	hg19	1	230371780	230371780	+	Missense_Mutation	SNP	G	G	A	rs151140953		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:230371780G>A	ENST00000366672.4	+	4	467	c.395G>A	c.(394-396)cGg>cAg	p.R132Q	GALNT2_ENST00000541865.1_Missense_Mutation_p.R42Q|GALNT2_ENST00000543760.1_Missense_Mutation_p.R94Q	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)	132		immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)			AAGCAGTGGCGGGTGGATCTG	0.577	0	43.0	41.0	42.0	1	230371780	2203	4300	6503	SO:0001583	missense	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""		9592121, 7592619	Standard	NM_004481	Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.395G>A	1.37:g.230371780G>A	ENSP00000355632:p.Arg132Gln	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	ENST00000366672.4	37	CCDS1582.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442195	0.43326	2.27E-4	0.0	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000541865	T;T;T	0.59083	0.29;0.29;0.29	5.18	5.18	0.71444	.	0.598474	0.18343	N	0.144121	T	0.47154	0.1430	L	0.39020	1.185	0.53005	D	0.999966	B;B	0.23650	0.053;0.089	B;B	0.08055	0.002;0.003	T	0.39502	-0.9611	10	0.13108	T	0.6	.	17.4619	0.87622	0.0:0.0:1.0:0.0	.	132;94	Q10471;G3V1S6	GALT2_HUMAN;.	Q	94;132;42	ENSP00000445017:R94Q;ENSP00000355632:R132Q;ENSP00000444346:R42Q	ENSP00000355632:R132Q	R	+	2	0	GALNT2	228438403	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	5.387000	0.66243	2.415000	0.81967	0.563000	0.77884	CGG	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1		19.916762	0	7	42	0	0	1	0	NM_004481	7	20.848872	17	0.291667
RNPEPL1	57140	broad.mit.edu	hg19	2	241513964	241513964	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:241513964C>T	ENST00000270357.4	+	6	1107	c.514C>T	c.(514-516)Cgc>Tgc	p.R172C		NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1			leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding	central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)	GACTGCCTTCCGCCTGGACGC	0.647	0	40.0	38.0	38.0	2	241513964	2201	4300	6501	SO:0001583	missense			2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327		10079	protein-coding gene	gene with protein product		605287			19508204	Standard	NM_018226	Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.514C>T	2.37:g.241513964C>T	ENSP00000270357:p.Arg172Cys	Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	ENST00000270357.4	37		.	.	.	.	.	.	.	.	.	.	C	21.8	4.197781	0.79015	.	.	ENSG00000142327	ENST00000270357	T	0.02606	4.23	4.64	3.73	0.42828	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.058902	0.64402	D	0.000001	T	0.11623	0.0283	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.972;0.985	T	0.00573	-1.1664	10	0.72032	D	0.01	-16.6565	12.4432	0.55637	0.0:0.8288:0.1711:0.0	.	78;172	A4FTX9;Q9HAU8	.;RNPL1_HUMAN	C	172	ENSP00000270357:R172C	ENSP00000270357:R172C	R	+	1	0	RNPEPL1	241162637	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.310000	0.59141	1.013000	0.39391	0.591000	0.81541	CGC	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257190.4		30.879059	0	-5	17	0	0	1	0	NM_018226	9	31.130815	5	0.642857
SEC16A	9919	broad.mit.edu	hg19	9	139371003	139371003	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:139371003G>A	ENST00000313050.7	-	1	1138	c.1065C>T	c.(1063-1065)gcC>gcT	p.A355A	SEC16A_ENST00000431893.2_Silent_p.A177A|SEC16A_ENST00000290037.6_Silent_p.A177A|SEC16A_ENST00000371706.3_Silent_p.A177A	NM_014866.1	NP_055681.1	O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	177		protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)	AGCCAGACCCGGCCCCAGCCC	0.602	0	15.0	17.0	17.0	9	139371003	1845	4089	5934	SO:0001819	synonymous_variant	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396		29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310	9205841	Standard	NM_014866	Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.531C>T	9.37:g.139371003G>A		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	ENST00000371706.3	37																																																																																				SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1		19.319572	0	-11	23	0	0	1	0	XM_088459	7	19.716319	13	0.350000
GAPT	202309	broad.mit.edu	hg19	5	57790685	57790685	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:57790685G>A	ENST00000396776.2	+	3	784	c.322G>A	c.(322-324)Gat>Aat	p.D108N	GAPT_ENST00000318469.2_Missense_Mutation_p.D108N	NM_152687.2	NP_689900.1	Q8N292	GAPT_HUMAN	GRB2-binding adaptor protein, transmembrane	108		B cell activation	integral to membrane|plasma membrane		NS(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7					AGGAAAAACCGATAAGGAACT	0.418	0	77.0	79.0	78.0	5	57790685	2203	4300	6503	SO:0001583	missense	AK090960	CCDS3975.1	5q11.2	2011-11-01	2008-10-07	2008-10-07	ENSG00000175857	ENSG00000175857		26588	protein-coding gene	gene with protein product	"""GRB2-binding transmembrane adaptor"""		"""chromosome 5 open reading frame 29"""	C5orf29		Standard	NM_152687	Approved	FLJ33641	uc003jro.1	Q8N292	OTTHUMG00000131219	ENST00000396776.2:c.322G>A	5.37:g.57790685G>A	ENSP00000379997:p.Asp108Asn		ENST00000396776.2	37	CCDS3975.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494661	0.26774	.	.	ENSG00000175857	ENST00000396776;ENST00000318469	T;T	0.51071	0.72;0.72	5.05	1.33	0.21861	.	1.755270	0.02719	N	0.113789	T	0.33206	0.0855	N	0.14661	0.345	0.09310	N	1	B	0.25206	0.12	B	0.21151	0.033	T	0.31308	-0.9948	10	0.66056	D	0.02	0.0312	7.1449	0.25577	0.3584:0.0:0.6416:0.0	.	108	Q8N292	GAPT_HUMAN	N	108	ENSP00000379997:D108N;ENSP00000323075:D108N	ENSP00000323075:D108N	D	+	1	0	GAPT	57826442	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.112000	0.15479	0.125000	0.18397	0.655000	0.94253	GAT	GAPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253963.1		-4.520047	0	-25	58	0	0	1	0	NM_152687	3	6.702063	51	0.055556
ADCY5	111	broad.mit.edu	hg19	3	123049783	123049783	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:123049783G>A	ENST00000462833.1	-	5	2811	c.1599C>T	c.(1597-1599)caC>caT	p.H533H	ADCY5_ENST00000491190.1_Silent_p.H166H|ADCY5_ENST00000309879.5_Silent_p.H183H	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	533	Guanylate cyclase 1.	activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)	AGCAGTGGGCGTGGTCAGCCC	0.542	0	85.0	71.0	76.0	3	123049783	2203	4300	6503	SO:0001819	synonymous_variant	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293			10481931	Standard	NM_183357	Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000491190.1:c.498C>T	3.37:g.123049783G>A		B7Z8A6|Q7RTV7|Q8NFM3	ENST00000491190.1	37																																																																																				ADCY5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000355890.1		47.152089	0	-7	22	0	0	1	0	XM_171048	14	49.279047	1	0.933333
CDC20B	166979	broad.mit.edu	hg19	5	54420729	54420729	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:54420729C>T	ENST00000296733.1	-	9	1291	c.1117G>A	c.(1117-1119)Ggc>Agc	p.G373S	CDC20B_ENST00000381375.2_Missense_Mutation_p.G373S|CDC20B_ENST00000322374.6_Missense_Mutation_p.G373S|CDC20B_ENST00000334206.5_3'UTR	NM_001170402.1|NM_152623.2	NP_001163873.1|NP_689836.2	Q86Y33	CD20B_HUMAN	cell division cycle 20B	373					kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)		TCACTGCAGCCGCTGGAAAGC	0.567	0	113.0	100.0	104.0	5	54420729	2203	4300	6503	SO:0001583	missense	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287	"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""			Standard	NM_152623	Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.1117G>A	5.37:g.54420729C>T	ENSP00000370781:p.Gly373Ser	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	ENST00000381375.2	37	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886946	0.91814	.	.	ENSG00000164287	ENST00000296733;ENST00000381375;ENST00000322374	T;T;T	0.69806	-0.43;-0.43;-0.43	4.66	4.66	0.58398	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.43260	D	0.000589	T	0.80706	0.4674	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.83243	-0.0057	10	0.87932	D	0	-27.0194	17.3439	0.87305	0.0:1.0:0.0:0.0	.	373;373;373	Q86Y33-3;Q86Y33;Q86Y33-2	.;CD20B_HUMAN;.	S	373	ENSP00000296733:G373S;ENSP00000370781:G373S;ENSP00000315720:G373S	ENSP00000296733:G373S	G	-	1	0	CDC20B	54456486	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	3.443000	0.52907	2.402000	0.81655	0.650000	0.86243	GGC	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1		11.824914	0	-15	88	0	0	1	0	NM_152623	9	22.202590	65	0.121622
ALDH1A3	220	broad.mit.edu	hg19	15	101440860	101440860	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr15:101440860G>A	ENST00000329841.5	+	9	1496	c.964G>A	c.(964-966)Gtg>Atg	p.V322M	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.V215M|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	322		retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity	NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		CAGGGTGTTCGTGGAGGAGCA	0.607	0	63.0	56.0	59.0	15	101440860	2203	4300	6503	SO:0001583	missense	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6	7698756	Standard	XR_111558	Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.964G>A	15.37:g.101440860G>A	ENSP00000332256:p.Val322Met	Q6NT64	ENST00000329841.5	37	CCDS10389.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.764979	0.69878	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	D	0.86030	-2.06	5.7	5.7	0.88788	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.96414	0.8830	H	0.99391	4.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98041	1.0382	10	0.87932	D	0	.	19.8405	0.96681	0.0:0.0:1.0:0.0	.	226;322	Q7Z3A2;P47895	.;AL1A3_HUMAN	M	322;226	ENSP00000332256:V322M	ENSP00000332256:V322M	V	+	1	0	ALDH1A3	99258383	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	9.338000	0.96553	2.671000	0.90904	0.655000	0.94253	GTG	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		12.967092	0	11	30	0	0	1	0		5	13.930535	14	0.263158
CPNE6	9362	broad.mit.edu	hg19	14	24543954	24543954	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr14:24543954C>T	ENST00000397016.2	+	8	933	c.622C>T	c.(622-624)Cgc>Tgc	p.R208C	CPNE6_ENST00000537691.1_Missense_Mutation_p.R263C|CPNE6_ENST00000216775.2_Missense_Mutation_p.R208C	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	208	C2 2.	lipid metabolic process|nervous system development|synaptic transmission|vesicle-mediated transport		calcium ion binding|transporter activity	endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)	GGAGCCGTTCCGCCTGTCCCT	0.557	0	83.0	78.0	80.0	14	24543954	2203	4300	6503	SO:0001583	missense	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884		2319	protein-coding gene	gene with protein product		605688			9645480	Standard	NM_001280558	Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.622C>T	14.37:g.24543954C>T	ENSP00000380211:p.Arg208Cys	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896233	0.72639	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.70045	-0.45;-0.45;-0.45	4.89	4.89	0.63831	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000025	T	0.69548	0.3123	L	0.28556	0.865	0.49483	D	0.999795	D;D	0.89917	1.0;0.998	P;D	0.65443	0.894;0.935	T	0.72127	-0.4384	10	0.72032	D	0.01	-27.0527	11.0714	0.48006	0.1854:0.8146:0.0:0.0	.	263;208	F5GXN1;O95741	.;CPNE6_HUMAN	C	263;208;208	ENSP00000440077:R263C;ENSP00000380211:R208C;ENSP00000216775:R208C	ENSP00000216775:R208C	R	+	1	0	CPNE6	23613794	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	3.351000	0.52232	2.435000	0.82474	0.313000	0.20887	CGC	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		11.697111	0	2	22	0	0	1	0		4	11.877031	7	0.363636
PPL	5493	broad.mit.edu	hg19	16	4949058	4949058	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:4949058C>T	ENST00000345988.2	-	8	921	c.832G>A	c.(832-834)Gac>Aac	p.D278N	PPL_ENST00000590782.2_Missense_Mutation_p.D276N	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	278		keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62					AGCAGCTGGTCGCCCTCGCTG	0.632	0	76.0	83.0	81.0	16	4949058	2197	4300	6497	SO:0001583	missense	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898		9273	protein-coding gene	gene with protein product		602871			9570964, 9521878	Standard	NM_002705	Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.832G>A	16.37:g.4949058C>T	ENSP00000340510:p.Asp278Asn	O60314|O60454|Q14C98	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859704	0.71834	.	.	ENSG00000118898	ENST00000345988	T	0.35048	1.33	5.04	4.09	0.47781	.	0.183662	0.47093	D	0.000242	T	0.34048	0.0884	M	0.64170	1.965	0.46954	D	0.999262	B	0.26041	0.14	B	0.15484	0.013	T	0.19095	-1.0316	10	0.59425	D	0.04	.	10.6588	0.45690	0.0:0.8456:0.0:0.1544	.	278	O60437	PEPL_HUMAN	N	278	ENSP00000340510:D278N	ENSP00000340510:D278N	D	-	1	0	PPL	4889059	0.998000	0.40836	0.811000	0.32455	0.441000	0.31987	3.919000	0.56439	1.126000	0.42016	0.561000	0.74099	GAC	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1		59.787848	0	-30	91	0	0	1	0	NM_002705	21	60.964744	39	0.350000
WDR96	80217	broad.mit.edu	hg19	10	105971913	105971913	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr10:105971913G>A	ENST00000357060.3	-	5	702	c.587C>T	c.(586-588)tCg>tTg	p.S196L	WDR96_ENST00000369719.1_Missense_Mutation_p.S126L|WDR96_ENST00000278064.2_Missense_Mutation_p.S126L|WDR96_ENST00000369720.1_Missense_Mutation_p.S126L|WDR96_ENST00000428666.1_Missense_Mutation_p.S196L	NM_025145.5	NP_079421.5	Q8NDM7	WDR96_HUMAN	WD repeat domain 96	196					NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72					TAATTTCACCGACCTGTAGAC	0.428	0	55.0	53.0	54.0	10	105971913	2203	4300	6503	SO:0001583	missense																									ENST00000278064.2:c.377C>T	10.37:g.105971913G>A	ENSP00000278064:p.Ser126Leu		ENST00000278064.2	37		.	.	.	.	.	.	.	.	.	.	G	12.18	1.860622	0.32884	0.0	2.33E-4	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064;ENST00000369720;ENST00000369719	T;T;T;T;T	0.71579	1.5;1.5;1.5;1.5;-0.58	5.51	1.27	0.21489	WD40 repeat-like-containing domain (1);	0.564958	0.13400	N	0.390738	T	0.57504	0.2058	L	0.43152	1.355	0.09310	N	0.999997	B;B;B	0.14805	0.011;0.004;0.005	B;B;B	0.13407	0.009;0.002;0.003	T	0.42632	-0.9440	10	0.27785	T	0.31	.	6.7757	0.23619	0.1399:0.0:0.6121:0.2479	.	196;196;196	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	L	196;196;126;126;126	ENSP00000349568:S196L;ENSP00000400289:S196L;ENSP00000278064:S126L;ENSP00000358734:S126L;ENSP00000358733:S126L	ENSP00000278064:S126L	S	-	2	0	WDR96	105961903	0.005000	0.15991	0.010000	0.14722	0.043000	0.13939	0.367000	0.20382	0.255000	0.21593	-0.137000	0.14449	TCG	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		22.120429	0	0	49	0	0	1	0		10	26.105593	39	0.204082
CACNA2D1	781	broad.mit.edu	hg19	7	81635088	81635088	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr7:81635088C>T	ENST00000356860.3	-	17	1846	c.1508G>A	c.(1507-1509)cGt>cAt	p.R503H	CACNA2D1_ENST00000464354.1_5'UTR|CACNA2D1_ENST00000356253.5_Missense_Mutation_p.R503H	NM_000722.2	NP_000713.2	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	503	Cache.		voltage-gated calcium channel complex	metal ion binding	breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					TACTGTAAAACGTGGTGTCAG	0.358	1	126.0	119.0	121.0	7	81635088	2203	4299	6502	SO:0001583	missense	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956	"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112	8188232	Standard	XM_005250570	Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356860.3:c.1508G>A	7.37:g.81635088C>T	ENSP00000349320:p.Arg503His	Q17R45|Q9UD80|Q9UD81|Q9UD82	ENST00000356860.3	37	CCDS5598.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.959816|3.959816	0.74016|0.74016	.|.	.|.	ENSG00000153956|ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253|ENST00000443883	T;T|.	0.07327|.	3.22;3.2|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69940|0.69940	0.3167|0.3167	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	B|.	0.19817|.	0.039|.	B|.	0.17979|.	0.02|.	T|T	0.66337|0.66337	-0.5949|-0.5949	10|5	0.54805|.	T|.	0.06|.	-11.1241|-11.1241	18.7374|18.7374	0.91761|0.91761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	503|.	P54289-2|.	.|.	H|I	503|7	ENSP00000349320:R503H;ENSP00000348589:R503H|.	ENSP00000284088:R503H|.	R|V	-|-	2|1	0|0	CACNA2D1|CACNA2D1	81473024|81473024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	7.461000|7.461000	0.80834|0.80834	2.523000|2.523000	0.85059|0.85059	0.591000|0.591000	0.81541|0.81541	CGT|GTT	CACNA2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253340.4		65.974007	0	4	75	0	0	1	0		21	65.974007	21	0.500000
DAPK1	1612	broad.mit.edu	hg19	9	90219978	90219978	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:90219978C>T	ENST00000469640.2	+	3	547	c.172C>T	c.(172-174)Cgc>Tgc	p.R58C	DAPK1_ENST00000472284.1_Missense_Mutation_p.R58C|DAPK1_ENST00000408954.3_Missense_Mutation_p.R58C|DAPK1_ENST00000358077.5_Missense_Mutation_p.R58C|DAPK1_ENST00000491893.1_Missense_Mutation_p.R58C			P53355	DAPK1_HUMAN	death-associated protein kinase 1	58	Protein kinase.	apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity	breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72					GGGTGTGAGCCGCGAGGACAT	0.562	2	62.0	64.0	63.0	9	90219978	2193	4298	6491	SO:0001583	missense	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730	"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831			8530096	Standard	XM_005251757	Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000491893.1:c.172C>T	9.37:g.90219978C>T	ENSP00000419026:p.Arg58Cys	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	ENST00000491893.1	37		.	.	.	.	.	.	.	.	.	.	C	21.6	4.179700	0.78564	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.04	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46145	D	0.000308	D	0.83839	0.5341	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.85130	0.997;0.969;0.853	D	0.86445	0.1769	10	0.87932	D	0	.	17.55	0.87873	0.0:1.0:0.0:0.0	.	58;58;58	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	C	58	ENSP00000350785:R58C;ENSP00000417076:R58C;ENSP00000418885:R58C;ENSP00000386135:R58C;ENSP00000419026:R58C	ENSP00000350785:R58C	R	+	1	0	DAPK1	89409798	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.127000	0.42035	2.628000	0.89032	0.511000	0.50034	CGC	DAPK1-011	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000356844.1		22.595497	0	0	44	0	0	1	0	NM_004938	8	22.770501	12	0.400000
METTL25	84190	broad.mit.edu	hg19	12	82752382	82752382	+	Missense_Mutation	SNP	T	T	C			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:82752382T>C	ENST00000248306.3	+	1	107	c.38T>C	c.(37-39)cTg>cCg	p.L13P	CCDC59_ENST00000548126.1_Intron|CCDC59_ENST00000256151.7_5'UTR|METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2			methyltransferase like 25												ACCCCGGACCTGCCCACGCTG	0.622	0	55.0	47.0	50.0	12	82752382	2203	4300	6503	SO:0001583	missense	BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720		26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26		Standard	NM_032230	Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.38T>C	12.37:g.82752382T>C	ENSP00000248306:p.Leu13Pro	Q9H5Y3	ENST00000248306.3	37	CCDS9024.1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.651132	0.67472	.	.	ENSG00000127720	ENST00000248306;ENST00000548200	T	0.38401	1.14	5.22	4.0	0.46444	.	0.631611	0.15637	N	0.252084	T	0.49949	0.1587	M	0.76574	2.34	0.28316	N	0.922456	D	0.63880	0.993	P	0.59288	0.855	T	0.50127	-0.8864	10	0.72032	D	0.01	-6.825	4.8582	0.13570	0.0:0.0951:0.1911:0.7138	.	13	Q8N6Q8	CL026_HUMAN	P	13	ENSP00000248306:L13P	ENSP00000248306:L13P	L	+	2	0	C12orf26	81276513	0.843000	0.29541	0.926000	0.36857	0.918000	0.54935	2.224000	0.42945	1.972000	0.57404	0.528000	0.53228	CTG	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408192.1		0.498013	0	0	40	0	0	1	0	NM_032230	3	6.848948	33	0.083333
ARHGEF10L	55160	broad.mit.edu	hg19	1	17958885	17958885	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:17958885G>A	ENST00000361221.3	+	16	1813	c.1654G>A	c.(1654-1656)Ggg>Agg	p.G552R	ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.G310R|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.G552R|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.G513R|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.G330R|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.G513R|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.G260R	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	552		regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)	CGGTGACCGCGGGCAGCTAAT	0.592	0	125.0	124.0	124.0	1	17958885	2203	4300	6503	SO:0001583	missense	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964	"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494			10997877, 16112081	Standard	XM_005245923	Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000375415.1:c.1537G>A	1.37:g.17958885G>A	ENSP00000364564:p.Gly513Arg	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	ENST00000375415.1	37	CCDS30617.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951786	0.73787	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.44	5.44	0.79542	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.45756	0.1358	M	0.78456	2.415	0.58432	D	0.999991	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.97110	0.999;0.998;1.0;1.0;0.999;1.0;0.956;0.927	T	0.45600	-0.9250	10	0.87932	D	0	-27.9363	17.8089	0.88609	0.0:0.0:1.0:0.0	.	330;310;552;260;318;513;513;552	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	R	552;513;552;513;310;330;330;260	ENSP00000355060:G552R;ENSP00000399401:G513R;ENSP00000394621:G552R;ENSP00000364564:G513R;ENSP00000364569:G310R;ENSP00000364557:G330R;ENSP00000167825:G260R	ENSP00000167825:G260R	G	+	1	0	ARHGEF10L	17831472	1.000000	0.71417	0.954000	0.39281	0.243000	0.25628	9.357000	0.97099	2.545000	0.85829	0.561000	0.74099	GGG	ARHGEF10L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007149.1		6.377963	0	-8	132	0	0	1	0	NM_018125	10	23.380663	94	0.096154
JPH3	57338	broad.mit.edu	hg19	16	87723889	87723889	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr16:87723889C>T	ENST00000284262.2	+	4	2165	c.1923C>T	c.(1921-1923)gaC>gaT	p.D641D	JPH3_ENST00000563609.1_3'UTR	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	641		calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)	GCTTGGGGGACGACCACCGCC	0.667	0	10.0	11.0	11.0	16	87723889	2167	4279	6446	SO:0001819	synonymous_variant	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118		14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22	10949023, 10891348	Standard	NM_020655	Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.1923C>T	16.37:g.87723889C>T		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	ENST00000284262.2	37	CCDS10962.1																																																																																			JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		11.499359	0	8	17	0	0	1	0		4	11.499359	4	0.500000
DGKQ	1609	broad.mit.edu	hg19	4	955350	955350	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr4:955350C>T	ENST00000273814.3	-	21	2552	c.2479G>A	c.(2479-2481)Gac>Aac	p.D827N		NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	827		activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding	breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)		CCCCACAGGTCGGCCCCCGAG	0.692	0	12.0	13.0	13.0	4	955350	2178	4285	6463	SO:0001583	missense	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214		2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4	8617502, 9099683	Standard	NM_001347	Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2479G>A	4.37:g.955350C>T	ENSP00000273814:p.Asp827Asn	Q6P3W4	ENST00000273814.3	37	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	C	8.004	0.756020	0.15846	.	.	ENSG00000145214	ENST00000273814;ENST00000515182	T;T	0.29917	1.55;1.55	5.32	4.48	0.54585	Diacylglycerol kinase, accessory domain (2);	0.044570	0.85682	N	0.000000	T	0.22513	0.0543	N	0.01809	-0.71	0.58432	D	0.999998	D;D	0.89917	0.974;1.0	P;D	0.91635	0.763;0.999	T	0.20840	-1.0263	10	0.02654	T	1	.	11.3869	0.49791	0.0:0.9115:0.0:0.0884	.	827;827	E9KL49;P52824	.;DGKQ_HUMAN	N	827;42	ENSP00000273814:D827N;ENSP00000421756:D42N	ENSP00000273814:D827N	D	-	1	0	DGKQ	945350	1.000000	0.71417	0.898000	0.35279	0.162000	0.22319	5.204000	0.65180	1.251000	0.43983	0.556000	0.70494	GAC	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		22.629577	0	-7	10	0	0	1	0		7	23.268906	2	0.777778
ARMCX1	51309	broad.mit.edu	hg19	X	100808010	100808010	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chrX:100808010G>A	ENST00000372829.3	+	4	468	c.97G>A	c.(97-99)Gag>Aag	p.E33K		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	33			integral to membrane	binding	NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19					GGGAAGAGACGAGAACGAGAA	0.572	0	78.0	68.0	72.0	X	100808010	2203	4300	6503	SO:0001583	missense	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947	"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362			11162520, 16221301, 22569362	Standard	NM_016608	Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.97G>A	X.37:g.100808010G>A	ENSP00000361917:p.Glu33Lys	Q53HK2|Q9H2Q0	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	g	17.02	3.282336	0.59867	.	.	ENSG00000126947	ENST00000372829	T	0.23348	1.91	3.6	3.6	0.41247	.	0.809987	0.10763	N	0.636898	T	0.28400	0.0702	N	0.12182	0.205	0.29300	N	0.868781	D	0.76494	0.999	D	0.68621	0.959	T	0.09751	-1.0660	10	0.23891	T	0.37	-10.2104	9.701	0.40187	0.0:0.0:1.0:0.0	.	33	Q9P291	ARMX1_HUMAN	K	33	ENSP00000361917:E33K	ENSP00000361917:E33K	E	+	1	0	ARMCX1	100694666	0.991000	0.36638	0.848000	0.33437	0.580000	0.36256	2.394000	0.44450	2.036000	0.60181	0.544000	0.68410	GAG	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1		0.601473	0	-8	44	0	0	1	0	NM_016608	3	6.428303	31	0.088235
DAK	26007	broad.mit.edu	hg19	11	61106798	61106798	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr11:61106798G>A	ENST00000394900.3	+	5	606	c.377G>A	c.(376-378)cGg>cAg	p.R126Q		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	126	DhaK.	glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding	NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23					GAGCAGGCCCGGGCTGAAGGC	0.662	0	54.0	59.0	57.0	11	61106798	2203	4299	6502	SO:0001583	missense		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476		24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""			Standard	XM_005273898	Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.377G>A	11.37:g.61106798G>A	ENSP00000378360:p.Arg126Gln	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338840	0.60963	.	.	ENSG00000149476	ENST00000394900;ENST00000532173;ENST00000529479	T;T;T	0.31769	1.48;1.48;1.48	5.25	-0.792	0.10925	Dak kinase (2);	0.250144	0.40640	N	0.001042	T	0.25531	0.0621	L	0.55017	1.72	0.32060	N	0.595796	B;B	0.20988	0.05;0.031	B;B	0.29942	0.07;0.109	T	0.13656	-1.0501	10	0.41790	T	0.15	-4.3986	6.2213	0.20683	0.3734:0.0:0.5147:0.1119	.	126;126	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	Q	126;126;125	ENSP00000378360:R126Q;ENSP00000431844:R126Q;ENSP00000432539:R125Q	ENSP00000378360:R126Q	R	+	2	0	DAK	60863374	1.000000	0.71417	0.952000	0.39060	0.962000	0.63368	1.860000	0.39428	-0.457000	0.07033	-0.263000	0.10527	CGG	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4		76.505820	0	5	94	0	0	1	0	NM_015533	28	80.211995	68	0.291667
SIPA1L3	23094	broad.mit.edu	hg19	19	38573659	38573659	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:38573659C>T	ENST00000222345.6	+	3	1963	c.1454C>T	c.(1453-1455)aCg>aTg	p.T485M		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	485		regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		CAGCAGCGGACGCAGAGTCGG	0.662	0	29.0	34.0	32.0	19	38573659	2203	4300	6503	SO:0001583	missense	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738		23801	protein-coding gene	gene with protein product						Standard	XM_005258671	Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.1454C>T	19.37:g.38573659C>T	ENSP00000222345:p.Thr485Met	Q2TV87	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.161874	0.38217	.	.	ENSG00000105738	ENST00000222345	T	0.75704	-0.96	5.15	4.08	0.47627	.	0.178179	0.49916	D	0.000138	T	0.47135	0.1429	N	0.08118	0	0.09310	N	0.999999	P	0.35348	0.496	B	0.26202	0.067	T	0.38607	-0.9653	10	0.34782	T	0.22	-18.1799	7.689	0.28557	0.1427:0.5259:0.3313:0.0	.	485	O60292	SI1L3_HUMAN	M	485	ENSP00000222345:T485M	ENSP00000222345:T485M	T	+	2	0	SIPA1L3	43265499	0.006000	0.16342	0.990000	0.47175	0.815000	0.46073	1.828000	0.39111	2.411000	0.81874	0.563000	0.77884	ACG	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2		13.230275	0	-11	29	0	0	1	0	XM_032278	6	16.368576	27	0.181818
ATP1A2	477	broad.mit.edu	hg19	1	160105664	160105664	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr1:160105664G>A	ENST00000361216.3	+	17	2409	c.2320G>A	c.(2320-2322)Gcc>Acc	p.A774T	ATP1A2_ENST00000392233.3_Missense_Mutation_p.A774T	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	774		ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		GAAATCCATCGCCTACACCCT	0.567	0	168.0	144.0	152.0	1	160105664	2203	4300	6503	SO:0001583	missense	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2	9403481	Standard	NM_000702	Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2320G>A	1.37:g.160105664G>A	ENSP00000354490:p.Ala774Thr	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324867	0.81580	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.88664	-2.41;-2.41	4.35	4.35	0.52113	ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.77405	0.4125	L	0.31752	0.955	0.80722	D	1	P;B	0.40032	0.699;0.346	B;B	0.36244	0.22;0.07	T	0.82566	-0.0393	10	0.56958	D	0.05	.	16.155	0.81657	0.0:0.0:1.0:0.0	.	674;774	F5GXJ7;P50993	.;AT1A2_HUMAN	T	774;774;477	ENSP00000354490:A774T;ENSP00000376066:A774T	ENSP00000354490:A774T	A	+	1	0	ATP1A2	158372288	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.601000	0.98297	2.401000	0.81631	0.555000	0.69702	GCC	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2		52.442010	0	-36	151	0	0	1	0	NM_000702	21	55.706856	54	0.280000
ZNF367	195828	broad.mit.edu	hg19	9	99157146	99157146	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr9:99157146C>T	ENST00000375256.4	-	3	946	c.650G>A	c.(649-651)cGt>cAt	p.R217H		NM_153695.3	NP_710162.1	Q7RTV3	ZN367_HUMAN	zinc finger protein 367	217		regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	cervix(1)|endometrium(4)|large_intestine(3)|lung(3)|prostate(1)	12		Acute lymphoblastic leukemia(62;0.0167)			GGTGTGAAGACGCTGATGTGT	0.388	0	96.0	88.0	91.0	9	99157146	2203	4300	6503	SO:0001583	missense	AK091289	CCDS6718.1	9q22	2008-05-02			ENSG00000165244	ENSG00000165244	"""Zinc fingers, C2H2-type"""	18320	protein-coding gene	gene with protein product		610160				Standard	NM_153695	Approved	FLJ33970	uc004awf.3	Q7RTV3	OTTHUMG00000020295	ENST00000375256.4:c.650G>A	9.37:g.99157146C>T	ENSP00000364405:p.Arg217His	Q6Q7C8	ENST00000375256.4	37	CCDS6718.1	.	.	.	.	.	.	.	.	.	.	C	34	5.334771	0.95758	.	.	ENSG00000165244	ENST00000375256	T	0.25749	1.78	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.53613	-0.8414	10	0.87932	D	0	-10.4563	18.7044	0.91632	0.0:1.0:0.0:0.0	.	217;217	Q7RTV3-2;Q7RTV3	.;ZN367_HUMAN	H	217	ENSP00000364405:R217H	ENSP00000364405:R217H	R	-	2	0	ZNF367	98196967	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.289000	0.78701	2.653000	0.90120	0.650000	0.86243	CGT	ZNF367-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053266.1		65.065571	0	12	86	0	0	1	0		21	65.485682	31	0.403846
LY6G6C	80740	broad.mit.edu	hg19	6	31687914	31687914	+	Missense_Mutation	SNP	C	C	T	rs150046471		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:31687914C>T	ENST00000375819.2	-	2	284	c.119G>A	c.(118-120)cGc>cAc	p.R40H	LY6G6C_ENST00000495859.1_5'UTR	NM_025261.2	NP_079537.1	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex, locus G6C	40	UPAR/Ly6.		anchored to membrane|plasma membrane		NS(1)|large_intestine(1)|lung(1)|skin(1)	4					TGGCTCCAGGCGGCAGGACTG	0.587	0	162.0	116.0	132.0	6	31687914	1510	2709	4219	SO:0001583	missense		CCDS4714.1	6p21	2008-08-29	2002-07-29	2002-08-01	ENSG00000204421	ENSG00000204421		13936	protein-coding gene	gene with protein product		610435	"""chromosome 6 open reading frame 24"""	C6orf24	10384126, 12079290	Standard	NM_025261	Approved	G6c, NG24	uc003nwh.3	O95867	OTTHUMG00000031251	ENST00000375819.2:c.119G>A	6.37:g.31687914C>T	ENSP00000364978:p.Arg40His	Q5SRS8|Q8IY94	ENST00000375819.2	37	CCDS4714.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300568	0.60195	.	.	ENSG00000204421	ENST00000375819	D	0.90324	-2.65	5.34	-2.74	0.05932	.	0.199909	0.25456	N	0.030553	T	0.65196	0.2668	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.60239	-0.7302	10	0.72032	D	0.01	-30.6231	4.8661	0.13609	0.536:0.2078:0.0:0.2562	.	40	O95867	LY66C_HUMAN	H	40	ENSP00000364978:R40H	ENSP00000364978:R40H	R	-	2	0	LY6G6C	31795893	0.001000	0.12720	0.747000	0.31113	0.987000	0.75469	-1.321000	0.02697	-0.412000	0.07519	0.591000	0.81541	CGC	LY6G6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076530.2		37.231391	0	-14	77	0	0	1	0		14	38.948249	33	0.297872
SLC25A12	8604	broad.mit.edu	hg19	2	172641886	172641886	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:172641886C>T	ENST00000422440.2	-	18	1972	c.1935G>A	c.(1933-1935)acG>acA	p.T645T	SLC25A12_ENST00000392592.4_Silent_p.T538T	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	645		gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding	endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		TGCCTGCAAACGTGGCTGTGG	0.517	0	177.0	163.0	168.0	2	172641886	2203	4300	6503	SO:0001819	synonymous_variant	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840	"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""		9722566, 10702666, 11566871	Standard	NM_003705	Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1935G>A	2.37:g.172641886C>T		B3KR64|Q96AM8	ENST00000422440.2	37	CCDS33327.1																																																																																			SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2		38.459041	0	18	99	0	0	1	0	NM_003705	16	44.152518	59	0.213333
XAB2	56949	ucsc.edu	hg19	19	7685536	7685536	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe																										CATCTCACGCGCGTGCTCGTC	0.662	0	33.0	34.0	34.0	19	7685536	2203	4300	6503	SO:0001583	missense	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924		14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850			10944529	Standard	NM_020196	Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1991C>T	19.37:g.7685536G>A	ENSP00000351137:p.Ala664Val	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	ENST00000358368.4	37	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	G	8.058	0.767491	0.15983	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.42900	0.96;0.96	4.31	3.26	0.37387	Tetratricopeptide-like helical (1);	0.142130	0.46145	N	0.000312	T	0.32941	0.0846	L	0.49571	1.57	0.50632	D	0.999885	B	0.28584	0.216	B	0.19666	0.026	T	0.09378	-1.0677	10	0.24483	T	0.36	-25.3541	11.0621	0.47953	0.0929:0.0:0.9071:0.0	.	664	Q9HCS7	SYF1_HUMAN	V	664;661	ENSP00000351137:A664V;ENSP00000438225:A661V	ENSP00000351137:A664V	A	-	2	0	XAB2	7591536	0.832000	0.29368	0.839000	0.33178	0.046000	0.14306	3.857000	0.55972	1.018000	0.39521	0.460000	0.39030	GCG	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1				-3	57					NM_020196	5		35	
ALMS1	7840	broad.mit.edu	hg19	2	73828485	73828485	+	Silent	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr2:73828485C>T	ENST00000264448.6	+	19	12144	c.12033C>T	c.(12031-12033)gaC>gaT	p.D4011D	ALMS1_ENST00000409009.1_Silent_p.D3969D|ALMS1_ENST00000464408.2_3'UTR	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	4011		G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147					AGCACCTGGACGGTCGGGGCT	0.592	0	51.0	59.0	57.0	2	73828485	2198	4298	6496	SO:0001819	synonymous_variant	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127		428	protein-coding gene	gene with protein product		606844			9063741	Standard	NM_015120	Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.12033C>T	2.37:g.73828485C>T		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	ENST00000264448.6	37	CCDS42697.1																																																																																			ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1		6.346896	0	-2	60	0	0	1	0	NM_015120	5	12.575331	38	0.116279
SLC6A12	6539	broad.mit.edu	hg19	12	319146	319146	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:319146C>T	ENST00000428720.1	-	3	750	c.7G>A	c.(7-9)Ggg>Agg	p.G3R	SLC6A12_ENST00000359674.4_Missense_Mutation_p.G3R|SLC6A12_ENST00000536824.1_Missense_Mutation_p.G3R|SLC6A12_ENST00000424061.2_Missense_Mutation_p.G3R|SLC6A12_ENST00000397296.2_Missense_Mutation_p.G3R	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	3		cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)		GCCACCTTCCCGTCCATGGCT	0.607	0	63.0	54.0	57.0	12	319146	2203	4300	6503	SO:0001583	missense	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181	"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""		7589472	Standard	NM_003044	Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.7G>A	12.37:g.319146C>T	ENSP00000388184:p.Gly3Arg	A0AV52|B2R992|D3DUN8	ENST00000428720.1	37	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	C	8.125	0.781842	0.16120	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824;ENST00000537793;ENST00000535347	T;T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.33;1.0	5.63	0.973	0.19710	.	1.223420	0.06279	N	0.697043	T	0.47637	0.1456	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.28299	-1.0048	10	0.29301	T	0.29	.	4.8536	0.13549	0.1418:0.2934:0.0:0.5648	.	3	P48065	S6A12_HUMAN	R	3	ENSP00000352702:G3R;ENSP00000380464:G3R;ENSP00000388184:G3R;ENSP00000399136:G3R;ENSP00000444268:G3R;ENSP00000439351:G3R;ENSP00000446082:G3R	ENSP00000352702:G3R	G	-	1	0	SLC6A12	189407	0.000000	0.05858	0.006000	0.13384	0.020000	0.10135	-0.018000	0.12568	0.081000	0.16988	0.563000	0.77884	GGG	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2		20.219424	0	-2	24	0	0	1	0	NM_003044	7	20.616251	13	0.350000
PDZD2	23037	broad.mit.edu	hg19	5	32090677	32090677	+	Missense_Mutation	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:32090677G>A	ENST00000438447.1	+	20	7511	c.7123G>A	c.(7123-7125)Ggc>Agc	p.G2375S	PDZD2_ENST00000282493.3_Missense_Mutation_p.G2375S			O15018	PDZD2_HUMAN	PDZ domain containing 2	2375		cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148					GCGGTCTTCCGGCAGCATTGT	0.597	0	33.0	36.0	35.0	5	32090677	2203	4300	6503	SO:0001583	missense	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401		18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3	9205841	Standard	XM_005248271	Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7123G>A	5.37:g.32090677G>A	ENSP00000402033:p.Gly2375Ser	Q9BXD4	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.363700	0.61513	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.54675	0.56;0.56	5.15	4.28	0.50868	.	0.120727	0.37955	N	0.001864	T	0.67785	0.2930	M	0.71581	2.175	0.39987	D	0.974999	D	0.89917	1.0	D	0.91635	0.999	T	0.67063	-0.5765	10	0.27785	T	0.31	.	11.3637	0.49660	0.0887:0.0:0.9113:0.0	.	2375	O15018	PDZD2_HUMAN	S	2375;2176;2375	ENSP00000402033:G2375S;ENSP00000282493:G2375S	ENSP00000282493:G2375S	G	+	1	0	PDZD2	32126434	1.000000	0.71417	0.633000	0.29310	0.233000	0.25261	3.440000	0.52886	1.159000	0.42565	0.561000	0.74099	GGC	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		10.825999	0	7	47	0	0	1	0		6	15.521943	34	0.150000
PCDHA6	0	broad.mit.edu	hg19	5	140209242	140209242	+	Silent	SNP	G	G	A			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:140209242G>A	ENST00000529310.1	+	1	1680	c.1566G>A	c.(1564-1566)ccG>ccA	p.P522P	PCDHA6_ENST00000527624.1_Silent_p.P522P|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1									NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		CGCTGCAGCCGCTGGACCACG	0.682	0	68.0	79.0	75.0	5	140209242	2202	4291	6493	SO:0001819	synonymous_variant	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842	"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2	10380929, 10662547	Standard	NM_018909	Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1566G>A	5.37:g.140209242G>A		O75283|Q9NRT8	ENST00000529310.1	37	CCDS47281.1																																																																																			PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3		-25.217087	0	-40	164	0	0	1	0	NM_018909	4	7.306372	130	0.029851
NSD1	64324	broad.mit.edu	hg19	5	176637574	176637574	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr5:176637574C>T	ENST00000439151.2	+	5	2219	c.2174C>T	c.(2173-2175)aCg>aTg	p.T725M	NSD1_ENST00000354179.4_Missense_Mutation_p.T456M|NSD1_ENST00000347982.4_Missense_Mutation_p.T456M|NSD1_ENST00000361032.4_Missense_Mutation_p.T622M	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	725		negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	GGAACCGAGACGTCTCAGGTT	0.423	0	73.0	74.0	74.0	5	176637574	2203	4300	6503	SO:0001583	missense	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO	9628876, 11896389	Standard	NM_022455	Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2174C>T	5.37:g.176637574C>T	ENSP00000395929:p.Thr725Met	Q96PD8|Q96RN7	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.761860	0.00651	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93019	-3.04;-3.05;-3.04;-3.15	5.1	-1.69	0.08186	.	0.639611	0.14885	N	0.292703	T	0.80444	0.4624	N	0.14661	0.345	0.09310	N	1	B;B;B	0.19445	0.013;0.036;0.007	B;B;B	0.14578	0.01;0.011;0.004	T	0.66614	-0.5879	9	.	.	.	.	0.8064	0.01084	0.2065:0.2947:0.1203:0.3786	.	456;622;725	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	M	456;456;725;456;622	ENSP00000346111:T456M;ENSP00000395929:T725M;ENSP00000343209:T456M;ENSP00000354310:T622M	.	T	+	2	0	NSD1	176570180	0.580000	0.26733	0.045000	0.18777	0.008000	0.06430	0.891000	0.28309	-0.134000	0.11516	-0.794000	0.03295	ACG	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2		66.475643	0	-10	57	0	0	1	0	NM_172349	21	66.480953	20	0.512195
AGAP2	116986	broad.mit.edu	hg19	12	58125237	58125237	+	Missense_Mutation	SNP	C	C	T			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr12:58125237C>T	ENST00000257897.3	-	10	1134	c.1049G>A	c.(1048-1050)cGa>cAa	p.R350Q	AGAP2_ENST00000547588.1_Missense_Mutation_p.R686Q	NM_014770.3	NP_055585.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	686	Interaction with PLCG1 (By similarity).	axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding	breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48					ATTGCCACTTCGTTTTAGTAG	0.473	0	116.0	117.0	116.0	12	58125237	2203	4300	6503	SO:0001583	missense	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439	"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1		Standard	NM_001122772	Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2057G>A	12.37:g.58125237C>T	ENSP00000449241:p.Arg686Gln	A8K9F7|O00578|Q548E0|Q8IWU3	ENST00000547588.1	37	CCDS44932.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970111	0.92855	.	.	ENSG00000135439	ENST00000257897;ENST00000547588;ENST00000549129	T;T;T	0.79141	-1.24;-1.24;-1.24	5.07	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000002	D	0.83348	0.5235	L	0.37800	1.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	D	0.83433	0.0039	10	0.51188	T	0.08	.	17.7595	0.88460	0.0:1.0:0.0:0.0	.	350;686;686	Q99490-2;F8VVT9;Q99490	.;.;AGAP2_HUMAN	Q	350;686;42	ENSP00000257897:R350Q;ENSP00000449241:R686Q;ENSP00000446683:R42Q	ENSP00000257897:R350Q	R	-	2	0	AGAP2	56411504	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.304000	0.78882	2.818000	0.97014	0.655000	0.94253	CGA	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1		81.041729	0	-55	79	0	0	1	0	NM_014770	26	81.393054	36	0.419355
UBR2	23304	broad.mit.edu	hg19	6	42626026	42626026	+	Missense_Mutation	SNP	G	G	A	rs147976047		TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr6:42626026G>A	ENST00000372899.1	+	28	3289	c.3031G>A	c.(3031-3033)Gtg>Atg	p.V1011M	UBR2_ENST00000372883.3_Missense_Mutation_p.V515M|UBR2_ENST00000372901.1_Missense_Mutation_p.V1011M	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1011		cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding	breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		TACCAGTCCCGTGGCAGAGAC	0.323	0	56.0	64.0	61.0	6	42626026	2203	4300	6503	SO:0001583	missense	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048	"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133		Standard	NM_015255	Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.3031G>A	6.37:g.42626026G>A	ENSP00000361990:p.Val1011Met	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	ENST00000372899.1	37	CCDS4870.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	15.46	2.840548	0.51057	2.27E-4	0.0	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.49720	0.77;0.77;0.77	5.8	4.04	0.47022	.	0.201836	0.46442	D	0.000292	T	0.39036	0.1063	L	0.54323	1.7	0.43890	D	0.996513	D;P	0.61697	0.99;0.934	P;B	0.51974	0.686;0.34	T	0.17992	-1.0351	10	0.33940	T	0.23	-4.5776	12.5366	0.56145	0.1349:0.0:0.8651:0.0	.	1011;1011	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	M	1011;1011;515	ENSP00000361990:V1011M;ENSP00000361992:V1011M;ENSP00000361974:V515M	ENSP00000361974:V515M	V	+	1	0	UBR2	42734004	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	4.684000	0.61686	0.798000	0.33994	-0.244000	0.11960	GTG	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2		53.767981	0	0	59	0	0	1	0	NM_015255	17	54.100687	25	0.404762
SF3A2	8175	broad.mit.edu	hg19	19	2243426	2243426	+	Frame_Shift_Del	DEL	C	C	-			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:2243426delC	ENST00000221494.5	+	2	427	c.9delC	c.(7-9)ttcfs	p.F3fs		NM_007165.4	NP_009096.2	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2, 66kDa			nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex	nucleic acid binding|zinc ion binding	NS(1)|large_intestine(1)|lung(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	CCATGGACTTCCAGCATCGCC	0.662	0	37.0	45.0	42.0	19	2243426	2202	4299	6501	SO:0001589	frameshift_variant	L21990	CCDS12084.1	19p13.3	2012-10-02	2002-08-29		ENSG00000104897	ENSG00000104897		10766	protein-coding gene	gene with protein product		600796	"""splicing factor 3a, subunit 2, 66kD"""		8211113, 8541848	Standard	NM_007165	Approved	SF3a66, SAP62, PRPF11, Prp11	uc002lvg.3	Q15428	OTTHUMG00000180414	ENST00000221494.5:c.9delC	19.37:g.2243426delC	ENSP00000221494:p.Phe3fs	B2RBU1|D6W605|O75245	ENST00000221494.5	37	CCDS12084.1																																																																																			SF3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451268.3	.	.		-11	35						9		16	0.36
SCAF1	58506	broad.mit.edu	hg19	19	50155567	50155569	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr19:50155567_50155569delAAG	ENST00000360565.3	+	7	2045_2047	c.1921_1923delAAG	c.(1921-1923)aagdel	p.K645del		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	645	Arg-rich.|Ser-rich.	mRNA processing|RNA splicing	nucleus	RNA binding	breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)	TGGCGGCAGCAAGAAGAAGAAGA	0.744	0									SO:0001651	inframe_deletion	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461		30403	protein-coding gene	gene with protein product					11461075	Standard	NM_021228	Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.1921_1923delAAG	19.37:g.50155576_50155578delAAG	ENSP00000353769:p.Lys645del	Q7Z5V7|Q8WVA1|Q9NR59	ENST00000360565.3	37	CCDS33074.1																																																																																			SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	.	.		-3	4					NM_021228	3		3	0.50
BAP1	8314	broad.mit.edu	hg19	3	52437188	52437217	+	In_Frame_Del	DEL	CCAGGCCTCACCATCCCCGTCTTCTCTCTG	CCAGGCCTCACCATCCCCGTCTTCTCTCTG	-	rs35353781	byFrequency	TCGA-YZ-A985-01A-11D-A39W-08	TCGA-YZ-A985-10A-01D-A39Z-08							Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7a3d6a96-9d0b-469d-9768-afd80542777e	5b1bd7f5-b12a-4803-a6ed-fa4016ed06fe	g.chr3:52437188_52437217delCCAGGCCTCACCATCCCCGTCTTCTCTCTG	ENST00000460680.1	-	14	2298_2327	c.1827_1856delCAGAGAGAAGACGGGGATGGTGAGGCCTGG	c.(1825-1857)agcagagagaagacggggatggtgaggcctggc>agc	p.REKTGMVRPG610del	BAP1_ENST00000296288.5_In_Frame_Del_p.REKTGMVRPG592del	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0		anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	CAAGGGCTCGCCAGGCCTCACCATCCCCGTCTTCTCTCTGCTGTCCGTGG	0.609	1									SO:0001651	inframe_deletion	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930		950	protein-coding gene	gene with protein product		603089			9528852	Standard	NM_004656	Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1827_1856delCAGAGAGAAGACGGGGATGGTGAGGCCTGG	3:g.52437188_52437217delCCAGGCCTCACCATCCCCGTCTTCTCTCTG	ENSP00000417132:p.Arg610_Gly619del	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	ENST00000460680.1		CCDS2853.1																																																																																			BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1	2.004000e+01	1.641000e+01		-1	59						4		2	7.140000e-01
