#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AEBP2	121536	genome.wustl.edu	37	12	19615485	19615485	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr12:19615485G>A	ENST00000398864.3	+	2	739	c.713G>A	c.(712-714)aGt>aAt	p.S238N	AEBP2_ENST00000360995.4_Missense_Mutation_p.S22N|AEBP2_ENST00000541908.1_Missense_Mutation_p.S9N|AEBP2_ENST00000266508.9_Missense_Mutation_p.S238N	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	238	Interaction with RBBP4.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					ACAATTTCCAGTGGGCGTTCA	0.393																																						dbGAP											0													72.0	64.0	67.0					12																	19615485		1901	4134	6035	-	-	-	SO:0001583	missense	0				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.713G>A	12.37:g.19615485G>A	ENSP00000381840:p.Ser238Asn		Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S238N	ENST00000398864.3	37	c.713	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628205	0.87560	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;T;D;D;T	0.91351	-2.47;-0.51;-2.83;-2.83;-0.35	5.55	5.55	0.83447	.	.	.	.	.	D	0.92143	0.7509	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	D	0.91177	0.4973	9	0.38643	T	0.18	-0.0584	19.6941	0.96016	0.0:0.0:1.0:0.0	.	238	Q6ZN18	AEBP2_HUMAN	N	9;9;238;172;238;22	ENSP00000444255:S9N;ENSP00000437983:S9N;ENSP00000381840:S238N;ENSP00000266508:S238N;ENSP00000354267:S22N	ENSP00000266508:S238N	S	+	2	0	AEBP2	19506752	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.885000	0.99019	0.655000	0.94253	AGT	AEBP2	-	NULL	ENSG00000139154		0.393	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	HGNC	protein_coding	OTTHUMT00000401575.1	197	0.00	0	G	NM_153207		19615485	19615485	+1	no_errors	ENST00000398864	ensembl	human	known	69_37n	missense	237	48.14	220	SNP	1.000	A
ALDH3A1	218	genome.wustl.edu	37	17	19643676	19643676	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr17:19643676T>G	ENST00000457500.2	-	6	1251	c.922A>C	c.(922-924)Acc>Ccc	p.T308P	RP11-311F12.2_ENST00000580884.1_RNA|ALDH3A1_ENST00000485231.1_5'Flank|ALDH3A1_ENST00000395555.3_Intron|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.T235P|ALDH3A1_ENST00000444455.1_Missense_Mutation_p.T308P|ALDH3A1_ENST00000225740.6_Missense_Mutation_p.T308P	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	308					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		GCATCCCCGGTGCCCCCATAA	0.602																																						dbGAP											0													60.0	58.0	59.0					17																	19643676		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.922A>C	17.37:g.19643676T>G	ENSP00000411821:p.Thr308Pro		A8K828|Q9BT37	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	p.T308P	ENST00000457500.2	37	c.922	CCDS11212.1	17	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666772	0.47677	.	.	ENSG00000108602	ENST00000225740;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844;ENST00000439102	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	5.04	5.04	0.67666	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.622493	0.18118	N	0.151125	T	0.80560	0.4646	L	0.41492	1.28	0.22156	N	0.999329	B;P;B	0.37573	0.171;0.6;0.171	B;B;B	0.40702	0.139;0.338;0.139	T	0.74469	-0.3655	10	0.62326	D	0.03	-11.6052	8.5429	0.33404	0.0:0.0967:0.0:0.9033	.	308;425;308	A8K828;Q8N9T9;P30838	.;.;AL3A1_HUMAN	P	308;366;308;308;235;308	ENSP00000225740:T308P;ENSP00000388469:T308P;ENSP00000411821:T308P;ENSP00000389766:T308P	ENSP00000225740:T308P	T	-	1	0	ALDH3A1	19584268	0.001000	0.12720	0.943000	0.38184	0.367000	0.29736	0.024000	0.13555	1.898000	0.54952	0.533000	0.62120	ACC	ALDH3A1	-	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	ENSG00000108602		0.602	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ALDH3A1	HGNC	protein_coding	OTTHUMT00000132265.4	23	0.00	0	T	NM_000691		19643676	19643676	-1	no_errors	ENST00000225740	ensembl	human	known	69_37n	missense	13	41.67	10	SNP	0.426	G
ALPK1	80216	genome.wustl.edu	37	4	113352476	113352476	+	Silent	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr4:113352476C>G	ENST00000458497.1	+	11	2052	c.1773C>G	c.(1771-1773)tcC>tcG	p.S591S	ALPK1_ENST00000177648.9_Silent_p.S591S|ALPK1_ENST00000504176.2_Silent_p.S513S	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	591							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGTTTAGTTCCTCTGCAAGCT	0.507																																						dbGAP											0													91.0	92.0	91.0					4																	113352476		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.1773C>G	4.37:g.113352476C>G			B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.S591	ENST00000458497.1	37	c.1773	CCDS3697.1	4																																																																																			ALPK1	-	NULL	ENSG00000073331		0.507	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	119	0.00	0	C	NM_025144		113352476	113352476	+1	no_errors	ENST00000177648	ensembl	human	known	69_37n	silent	158	43.17	120	SNP	0.042	G
AP5Z1	9907	genome.wustl.edu	37	7	4822959	4822961	+	In_Frame_Del	DEL	GAG	GAG	-	rs115454162	byFrequency	TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:4822959_4822961delGAG	ENST00000348624.4	+	4	473_475	c.379_381delGAG	c.(379-381)gagdel	p.E128del	AP5Z1_ENST00000401897.1_In_Frame_Del_p.E128del	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	128					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											TGACAGAAACGAGGAGGTCAGAG	0.626																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.379_381delGAG	7.37:g.4822962_4822964delGAG	ENSP00000297562:p.Glu128del		Q8N3X2|Q96H80	In_Frame_Del	DEL	NULL	p.E128in_frame_del	ENST00000348624.4	37	c.379_381	CCDS47528.1	7																																																																																			AP5Z1	-	NULL	ENSG00000242802		0.626	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1	12	0.00	0	GAG			4822959	4822961	+1	no_errors	ENST00000348624	ensembl	human	known	69_37n	in_frame_del	12	40.00	8	DEL	0.000:0.007:0.016	-
ARL9	132946	genome.wustl.edu	37	4	57389906	57389906	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr4:57389906T>C	ENST00000360096.2	+	4	550	c.236T>C	c.(235-237)tTg>tCg	p.L79S		NM_206919.1	NP_996802.1	Q6T311	ARL9_HUMAN	ADP-ribosylation factor-like 9	143					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(2)	2	Glioma(25;0.08)|all_neural(26;0.101)					CATGAAGCTTTGGCATTATCT	0.418																																						dbGAP											0													118.0	110.0	113.0					4																	57389906		1914	4133	6047	-	-	-	SO:0001583	missense	0			AY439003	CCDS59474.1	4q12	2014-05-09				ENSG00000196503		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23592	protein-coding gene	gene with protein product		612405					Standard	NM_206919		Approved		uc003hby.1	Q6T311		ENST00000360096.2:c.236T>C	4.37:g.57389906T>C	ENSP00000353210:p.Leu79Ser			Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L143S	ENST00000360096.2	37	c.428	CCDS59474.1	4	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920025	0.73098	.	.	ENSG00000196503	ENST00000360096	.	.	.	5.32	5.32	0.75619	.	0.131418	0.51477	D	0.000099	D	0.88119	0.6351	H	0.98111	4.15	.	.	.	D	0.89917	1.0	D	0.97110	1.0	D	0.92930	0.6363	8	0.87932	D	0	-12.3639	13.5348	0.61641	0.0:0.0:0.0:1.0	.	143	Q6T311	ARL9_HUMAN	S	143	.	ENSP00000353210:L143S	L	+	2	0	ARL9	57084663	1.000000	0.71417	0.923000	0.36655	0.879000	0.50718	4.632000	0.61311	2.133000	0.65898	0.455000	0.32223	TTG	ARL9	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF	ENSG00000196503		0.418	ARL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL9	HGNC	protein_coding	OTTHUMT00000467724.1	171	0.00	0	T	NM_206919		57389906	57389906	+1	no_errors	ENST00000360096	ensembl	human	known	69_37n	missense	421	23.87	132	SNP	0.995	C
C16orf70	80262	genome.wustl.edu	37	16	67183399	67183399	+	IGR	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr16:67183399G>A	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Silent_p.P330P	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GGTGAGGCTCGGGCGTGAGCC	0.657																																						dbGAP											0													19.0	29.0	26.0					16																	67183399		2124	4241	6365	-	-	-	SO:0001628	intergenic_variant	0			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67183399G>A			Q9HA86	Silent	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.P330	ENST00000219139.3	37	c.990	CCDS10828.1	16																																																																																			B3GNT9	-	pfam_Glyco_trans_31	ENSG00000237172		0.657	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT9	HGNC	protein_coding	OTTHUMT00000268829.2	47	0.00	0	G	NM_025187		67183399	67183399	-1	no_errors	ENST00000449549	ensembl	human	known	69_37n	silent	38	13.33	6	SNP	0.000	A
BICC1	80114	genome.wustl.edu	37	10	60556134	60556134	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr10:60556134T>C	ENST00000373886.3	+	10	1218	c.1214T>C	c.(1213-1215)tTa>tCa	p.L405S	BICC1_ENST00000263103.1_Missense_Mutation_p.L31S	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	405					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CGAAATGCCTTAAATATGTAT	0.478																																						dbGAP											0													129.0	111.0	117.0					10																	60556134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.1214T>C	10.37:g.60556134T>C	ENSP00000362993:p.Leu405Ser			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.L405S	ENST00000373886.3	37	c.1214	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948650	0.34377	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.39787	1.85;1.06	5.37	5.37	0.77165	.	0.132323	0.52532	D	0.000068	T	0.36552	0.0971	L	0.27053	0.805	0.44006	D	0.99671	B;D	0.53151	0.05;0.958	B;P	0.47827	0.013;0.558	T	0.07028	-1.0794	10	0.15952	T	0.53	-9.0888	15.6812	0.77371	0.0:0.0:0.0:1.0	.	325;405	E7EU62;Q9H694	.;BICC1_HUMAN	S	405;31	ENSP00000362993:L405S;ENSP00000263103:L31S	ENSP00000263103:L31S	L	+	2	0	BICC1	60226140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.068000	0.57534	2.159000	0.67721	0.533000	0.62120	TTA	BICC1	-	NULL	ENSG00000122870		0.478	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	190	0.00	0	T	NM_025044		60556134	60556134	+1	no_errors	ENST00000373886	ensembl	human	known	69_37n	missense	263	26.74	96	SNP	1.000	C
BYSL	705	genome.wustl.edu	37	6	41899224	41899224	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr6:41899224C>A	ENST00000230340.4	+	5	1170	c.795C>A	c.(793-795)taC>taA	p.Y265*		NM_004053.3	NP_004044.3	Q13895	BYST_HUMAN	bystin-like	265					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|female pregnancy (GO:0007565)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|trophectodermal cell differentiation (GO:0001829)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(5)|skin(1)	8	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGCTGAATACAAACGACTCA	0.517																																						dbGAP											0													118.0	112.0	114.0					6																	41899224		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L36720	CCDS34450.1	6p21.1	2008-08-29			ENSG00000112578	ENSG00000112578			1157	protein-coding gene	gene with protein product		603871				9925933, 17381424	Standard	NM_004053		Approved		uc003orl.3	Q13895	OTTHUMG00000014687	ENST00000230340.4:c.795C>A	6.37:g.41899224C>A	ENSP00000230340:p.Tyr265*		Q6P5W4|Q86W44|Q96IP8	Nonsense_Mutation	SNP	pfam_Bystin	p.Y265*	ENST00000230340.4	37	c.795	CCDS34450.1	6	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783864	0.90282	.	.	ENSG00000112578	ENST00000230340	.	.	.	5.91	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.7554	10.0563	0.42248	0.0:0.8074:0.0:0.1926	.	.	.	.	X	265	.	ENSP00000230340:Y265X	Y	+	3	2	BYSL	42007202	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.026000	0.41069	1.519000	0.48950	0.643000	0.83706	TAC	BYSL	-	pfam_Bystin	ENSG00000112578		0.517	BYSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BYSL	HGNC	protein_coding	OTTHUMT00000040535.2	31	0.00	0	C			41899224	41899224	+1	no_errors	ENST00000230340	ensembl	human	known	69_37n	nonsense	53	39.77	35	SNP	1.000	A
URB1	9875	genome.wustl.edu	37	21	33765564	33765564	+	5'Flank	DEL	G	G	-			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr21:33765564delG	ENST00000382751.3	-	0	0				C21orf119_ENST00000534991.2_Frame_Shift_Del_p.P13fs	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)							nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						GACACCCCCCGCCCCCGGCTG	0.637											OREG0003538	type=REGULATORY REGION|Gene=C21orf108|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													19.0	23.0	22.0					21																	33765564		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919		21.37:g.33765564delG	Exception_encountered	842	D3DSE5|Q96NX1|Q9NYQ1	Frame_Shift_Del	DEL	NULL	p.P13fs	ENST00000382751.3	37	c.33	CCDS46645.1	21																																																																																			C21orf119	-	NULL	ENSG00000256073		0.637	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf119	HGNC	protein_coding	OTTHUMT00000139400.2	41	0.00	0	G			33765564	33765564	+1	no_errors	ENST00000534991	ensembl	human	known	69_37n	frame_shift_del	11	12.50	4	DEL	0.000	-
CCDC142	84865	genome.wustl.edu	37	2	74708349	74708349	+	Splice_Site	DEL	C	C	-			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:74708349delC	ENST00000393965.3	-	3	1655		c.e3+1		TTC31_ENST00000233623.5_5'Flank|TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000290418.4_Splice_Site|TTC31_ENST00000410003.1_5'Flank|CCDC142_ENST00000471713.1_Splice_Site	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142											central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						CCTCGTCTCACCTGCAGGCTG	0.532																																						dbGAP											0													54.0	59.0	57.0					2																	74708349		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1258+1G>-	2.37:g.74708349delC			B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Splice_Site	DEL	-	e3+1	ENST00000393965.3	37	c.1258+1		2																																																																																			CCDC142	-	-	ENSG00000135637		0.532	CCDC142-003	KNOWN	basic	protein_coding	CCDC142	HGNC	protein_coding	OTTHUMT00000328391.1	189	0.00	0	C	NM_032779	Intron	74708349	74708349	-1	no_errors	ENST00000393965	ensembl	human	known	69_37n	splice_site_del	107	15.75	20	DEL	0.987	-
CD248	57124	genome.wustl.edu	37	11	66082644	66082644	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr11:66082644T>G	ENST00000311330.3	-	1	1871	c.1855A>C	c.(1855-1857)Acc>Ccc	p.T619P	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	619	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGCAGGAGGGTGGGGAGGGCT	0.637																																						dbGAP											0													55.0	67.0	63.0					11																	66082644		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1855A>C	11.37:g.66082644T>G	ENSP00000308117:p.Thr619Pro		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_C-type_lectin	p.T619P	ENST00000311330.3	37	c.1855	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	T	8.198	0.797418	0.16327	.	.	ENSG00000174807	ENST00000311330	D	0.88896	-2.44	3.57	-0.947	0.10382	.	2.138040	0.03579	N	0.229903	T	0.80929	0.4718	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.66881	-0.5811	10	0.59425	D	0.04	-1.6173	5.0845	0.14675	0.1741:0.0:0.3321:0.4937	.	619	Q9HCU0	CD248_HUMAN	P	619	ENSP00000308117:T619P	ENSP00000308117:T619P	T	-	1	0	CD248	65839220	0.250000	0.23951	0.001000	0.08648	0.387000	0.30353	0.512000	0.22755	-0.002000	0.14469	-0.661000	0.03856	ACC	CD248	-	NULL	ENSG00000174807		0.637	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2	72	0.00	0	T	NM_020404		66082644	66082644	-1	no_errors	ENST00000311330	ensembl	human	known	69_37n	missense	141	11.45	19	SNP	0.007	G
CDC27	996	genome.wustl.edu	37	17	45234484	45234484	+	Missense_Mutation	SNP	T	T	C	rs202100614		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr17:45234484T>C	ENST00000066544.3	-	7	730	c.637A>G	c.(637-639)Aac>Gac	p.N213D	CDC27_ENST00000527547.1_Missense_Mutation_p.N213D|CDC27_ENST00000531206.1_Missense_Mutation_p.N213D|CDC27_ENST00000446365.2_Missense_Mutation_p.N152D|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	213					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTCAATCTGTTTAATTCCTGA	0.294																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.637A>G	17.37:g.45234484T>C	ENSP00000066544:p.Asn213Asp		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N213D	ENST00000066544.3	37	c.637	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424821	0.62733	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67698	-0.24;-0.28;-0.04;-0.24;0.82	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	N	0.24115	0.695	0.58432	D	0.999999	B;B;B;B	0.33379	0.41;0.011;0.006;0.167	B;B;B;B	0.23275	0.045;0.004;0.006;0.045	T	0.50021	-0.8876	10	0.30078	T	0.28	-15.7847	14.1506	0.65381	0.0:0.0:0.0:1.0	.	152;213;213;213	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	213;213;152;213;213	ENSP00000066544:N213D;ENSP00000434614:N213D;ENSP00000392802:N152D;ENSP00000437339:N213D;ENSP00000432105:N213D	ENSP00000066544:N213D	N	-	1	0	CDC27	42589483	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.522000	0.81844	2.227000	0.72691	0.455000	0.32223	AAC	CDC27	-	NULL	ENSG00000004897		0.294	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	130	0.76	1	T			45234484	45234484	-1	no_errors	ENST00000531206	ensembl	human	known	69_37n	missense	85	11.46	11	SNP	1.000	C
CDCA5	113130	genome.wustl.edu	37	11	64846795	64846795	+	Intron	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr11:64846795G>A	ENST00000275517.3	-	5	851				CDCA5_ENST00000404147.3_Silent_p.A236A	NM_080668.3	NP_542399.1	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5						double-strand break repair (GO:0006302)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|regulation of cohesin localization to chromatin (GO:0071922)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CAGAGCACACGGCAGAGAAAA	0.567																																						dbGAP											0													63.0	71.0	69.0					11																	64846795		2201	4297	6498	-	-	-	SO:0001627	intron_variant	0			BG354578	CCDS8091.1	11q13.1	2011-01-31			ENSG00000146670	ENSG00000146670			14626	protein-coding gene	gene with protein product	"""sororin"""	609374				12188893, 15837422	Standard	NM_080668		Approved		uc001ocp.2	Q96FF9	OTTHUMG00000150420	ENST00000275517.3:c.678+29C>T	11.37:g.64846795G>A			A8K625	Silent	SNP	pfam_Sororin	p.A236	ENST00000275517.3	37	c.708	CCDS8091.1	11																																																																																			CDCA5	-	NULL	ENSG00000146670		0.567	CDCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA5	HGNC	protein_coding	OTTHUMT00000385186.1	246	0.40	1	G	NM_080668		64846795	64846795	-1	no_errors	ENST00000404147	ensembl	human	novel	69_37n	silent	145	30.14	63	SNP	0.000	A
CDCP1	64866	genome.wustl.edu	37	3	45132898	45132898	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr3:45132898C>A	ENST00000296129.1	-	7	1894	c.1760G>T	c.(1759-1761)tGc>tTc	p.C587F		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	587						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GAAAGTCAGGCAGGCCACCTG	0.617																																						dbGAP											0													29.0	29.0	29.0					3																	45132898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1760G>T	3.37:g.45132898C>A	ENSP00000296129:p.Cys587Phe		Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	superfamily_CUB	p.C587F	ENST00000296129.1	37	c.1760	CCDS2727.1	3	.	.	.	.	.	.	.	.	.	.	C	6.285	0.420710	0.11928	.	.	ENSG00000163814	ENST00000296129	T	0.22336	1.96	5.84	3.09	0.35607	.	0.610946	0.19552	N	0.111554	T	0.18299	0.0439	L	0.57536	1.79	0.80722	D	1	B	0.33583	0.418	B	0.26094	0.066	T	0.03259	-1.1055	10	0.40728	T	0.16	.	9.0178	0.36182	0.0:0.658:0.0:0.3419	.	587	Q9H5V8	CDCP1_HUMAN	F	587	ENSP00000296129:C587F	ENSP00000296129:C587F	C	-	2	0	CDCP1	45107902	0.955000	0.32602	1.000000	0.80357	0.933000	0.57130	-0.052000	0.11865	0.820000	0.34516	0.555000	0.69702	TGC	CDCP1	-	NULL	ENSG00000163814		0.617	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	HGNC	protein_coding	OTTHUMT00000256748.3	70	0.00	0	C	NM_022842		45132898	45132898	-1	no_errors	ENST00000296129	ensembl	human	known	69_37n	missense	17	66.00	33	SNP	0.998	A
CFH	3075	genome.wustl.edu	37	1	196715013	196715013	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:196715013C>T	ENST00000367429.4	+	21	3617	c.3377C>T	c.(3376-3378)tCa>tTa	p.S1126L		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1126	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TTCCCGTTGTCAGTATATGCT	0.403																																						dbGAP											0													115.0	111.0	112.0					1																	196715013		2203	4297	6500	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3377C>T	1.37:g.196715013C>T	ENSP00000356399:p.Ser1126Leu		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S1126L	ENST00000367429.4	37	c.3377	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	15.62	2.886903	0.52014	.	.	ENSG00000000971	ENST00000367429	T	0.65178	-0.14	4.97	-1.03	0.10102	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.48696	0.1514	L	0.45422	1.42	0.09310	N	1	B	0.30686	0.29	B	0.29862	0.108	T	0.34354	-0.9832	9	0.30854	T	0.27	.	8.1307	0.31024	0.4047:0.3316:0.2637:0.0	.	1126	P08603	CFAH_HUMAN	L	1126	ENSP00000356399:S1126L	ENSP00000356399:S1126L	S	+	2	0	CFH	194981636	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.624000	0.05540	-0.043000	0.13513	-0.330000	0.08379	TCA	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.403	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	195	0.00	0	C	NM_000186		196715013	196715013	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	435	28.94	178	SNP	0.000	T
CHD2	1106	genome.wustl.edu	37	15	93527730	93527730	+	Splice_Site	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:93527730G>A	ENST00000394196.4	+	25	4305	c.3237G>A	c.(3235-3237)aaG>aaA	p.K1079K	CHD2_ENST00000557381.1_Splice_Site_p.K1079K	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1079					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CCACTAAAAAGGTGATCAAGT	0.393																																						dbGAP											0													51.0	55.0	54.0					15																	93527730		2197	4298	6495	-	-	-	SO:0001630	splice_region_variant	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3237+1G>A	15.37:g.93527730G>A			C6G482|Q96IP5	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K1079	ENST00000394196.4	37	c.3237	CCDS10374.2	15																																																																																			CHD2	-	NULL	ENSG00000173575		0.393	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	407	0.00	0	G	NM_001271	Silent	93527730	93527730	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	silent	378	41.60	270	SNP	1.000	A
CLCN1	1180	genome.wustl.edu	37	7	143028368	143028368	+	Silent	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:143028368C>T	ENST00000343257.2	+	9	1110	c.1023C>T	c.(1021-1023)ttC>ttT	p.F341F		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	341					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GAATGGATTTCCCCTTTGACC	0.507																																						dbGAP											0													163.0	148.0	153.0					7																	143028368		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1023C>T	7.37:g.143028368C>T			A4D2H5|Q2M202	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.F341	ENST00000343257.2	37	c.1023	CCDS5881.1	7																																																																																			CLCN1	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000188037		0.507	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	HGNC	protein_coding	OTTHUMT00000327420.1	303	0.00	0	C	NM_000083		143028368	143028368	+1	no_errors	ENST00000343257	ensembl	human	known	69_37n	silent	395	22.16	113	SNP	1.000	T
CRISPLD1	83690	genome.wustl.edu	37	8	75898239	75898239	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:75898239G>T	ENST00000262207.4	+	2	485	c.17G>T	c.(16-18)cGg>cTg	p.R6L	CRISPLD1_ENST00000519798.1_3'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	6					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R6Q(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TGTACCGCGCGGGAGTGGCTC	0.463																																						dbGAP											1	Substitution - Missense(1)	lung(1)											141.0	152.0	148.0					8																	75898239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.17G>T	8.37:g.75898239G>T	ENSP00000262207:p.Arg6Leu		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.R6L	ENST00000262207.4	37	c.17	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489190	0.26686	.	.	ENSG00000121005	ENST00000262207;ENST00000520277	T;T	0.58060	0.36;2.01	5.37	-0.829	0.10796	.	1.173110	0.05930	N	0.634973	T	0.31918	0.0812	N	0.14661	0.345	0.09310	N	0.999996	B	0.06786	0.001	B	0.06405	0.002	T	0.17198	-1.0377	10	0.19147	T	0.46	.	7.0549	0.25093	0.6801:0.1573:0.1626:0.0	.	6	Q9H336	CRLD1_HUMAN	L	6	ENSP00000262207:R6L;ENSP00000430504:R6L	ENSP00000262207:R6L	R	+	2	0	CRISPLD1	76060794	0.972000	0.33761	0.453000	0.27007	0.992000	0.81027	0.991000	0.29654	-0.173000	0.10761	0.563000	0.77884	CGG	CRISPLD1	-	NULL	ENSG00000121005		0.463	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	141	0.00	0	G	NM_031461		75898239	75898239	+1	no_errors	ENST00000262207	ensembl	human	known	69_37n	missense	178	17.21	37	SNP	0.099	T
CSE1L	1434	genome.wustl.edu	37	20	47712832	47712832	+	Intron	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr20:47712832G>C	ENST00000262982.2	+	25	2949				CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000396192.3_Intron|CSE1L_ENST00000542325.1_Intron	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GATGGGGTTTGTATTGGCGCA	0.493																																						dbGAP											0													84.0	75.0	78.0					20																	47712832		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2827-54G>C	20.37:g.47712832G>C			A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	RNA	SNP	-	NULL	ENST00000262982.2	37	NULL	CCDS13412.1	20																																																																																			CSE1L	-	-	ENSG00000124207		0.493	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	89	0.00	0	G	NM_001316		47712832	47712832	+1	no_errors	ENST00000469700	ensembl	human	known	69_37n	rna	105	33.96	54	SNP	0.003	C
CT83	203413	genome.wustl.edu	37	X	115593150	115593150	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chrX:115593150T>G	ENST00000371894.4	-	2	246	c.100A>C	c.(100-102)Aat>Cat	p.N34H		NM_001017978.2	NP_001017978.1	Q5H943	KKLC1_HUMAN		34						integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(3)|lung(8)	12						GCAGTTGAATTTGATGACATT	0.373																																						dbGAP											0													96.0	83.0	88.0					X																	115593150		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000371894.4:c.100A>C	X.37:g.115593150T>G	ENSP00000360961:p.Asn34His			Missense_Mutation	SNP	NULL	p.N34H	ENST00000371894.4	37	c.100	CCDS35372.1	X	.	.	.	.	.	.	.	.	.	.	T	13.10	2.137717	0.37728	.	.	ENSG00000204019	ENST00000371894	.	.	.	5.12	1.17	0.20885	.	1.223960	0.06035	N	0.653818	T	0.36166	0.0957	N	0.24115	0.695	0.09310	N	1	D	0.54207	0.965	P	0.56474	0.799	T	0.21449	-1.0245	9	0.66056	D	0.02	0.7348	3.0694	0.06225	0.1818:0.2055:0.0:0.6127	.	34	Q5H943	KKLC1_HUMAN	H	34	.	ENSP00000360961:N34H	N	-	1	0	CXorf61	115507178	0.064000	0.20934	0.001000	0.08648	0.295000	0.27426	0.301000	0.19174	0.241000	0.21283	0.434000	0.28630	AAT	CXorf61	-	NULL	ENSG00000204019		0.373	CXorf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf61	HGNC	protein_coding	OTTHUMT00000057985.1	150	0.00	0	T			115593150	115593150	-1	no_errors	ENST00000371894	ensembl	human	known	69_37n	missense	264	34.33	138	SNP	0.000	G
DCC	1630	genome.wustl.edu	37	18	50976897	50976897	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr18:50976897C>T	ENST00000442544.2	+	23	3873	c.3257C>T	c.(3256-3258)cCg>cTg	p.P1086L	DCC_ENST00000581580.1_Missense_Mutation_p.P721L	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1086					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATGCACCCCCCGCATGGCAGT	0.507																																						dbGAP											0													101.0	86.0	91.0					18																	50976897		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3257C>T	18.37:g.50976897C>T	ENSP00000389140:p.Pro1086Leu			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P1086L	ENST00000442544.2	37	c.3257	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	10.27	1.302848	0.23736	.	.	ENSG00000187323	ENST00000442544	T	0.51071	0.72	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	L	0.50333	1.59	0.80722	D	1	D	0.57571	0.98	P	0.48488	0.579	T	0.55270	-0.8167	10	0.59425	D	0.04	-7.0093	18.5478	0.91053	0.0:1.0:0.0:0.0	.	1086	P43146	DCC_HUMAN	L	1086	ENSP00000389140:P1086L	ENSP00000389140:P1086L	P	+	2	0	DCC	49230895	1.000000	0.71417	0.810000	0.32431	0.011000	0.07611	7.283000	0.78640	2.684000	0.91462	0.650000	0.86243	CCG	DCC	-	pfam_Neogenin_C	ENSG00000187323		0.507	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	222	0.00	0	C	NM_005215		50976897	50976897	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	missense	65	77.24	224	SNP	0.995	T
DHDDS	79947	genome.wustl.edu	37	1	26795453	26795453	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:26795453C>T	ENST00000236342.7	+	9	926	c.833C>T	c.(832-834)aCa>aTa	p.T278I	DHDDS_ENST00000525682.2_Missense_Mutation_p.T244I|DHDDS_ENST00000360009.2_Missense_Mutation_p.T279I|RP3-476K8.3_ENST00000423060.1_RNA|DHDDS_ENST00000526219.1_Missense_Mutation_p.T239I			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	278					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		GCTACAGTGACAGAGCAGCTG	0.617																																						dbGAP											0													43.0	44.0	44.0					1																	26795453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.833C>T	1.37:g.26795453C>T	ENSP00000236342:p.Thr278Ile		B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Missense_Mutation	SNP	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	p.T279I	ENST00000236342.7	37	c.836	CCDS282.1	1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867650	0.51588	.	.	ENSG00000117682	ENST00000374187;ENST00000525682;ENST00000236342;ENST00000526219;ENST00000360009;ENST00000431933	T;T;T;T	0.41758	0.99;1.01;1.0;1.01	5.46	5.46	0.80206	.	0.208574	0.50627	D	0.000102	T	0.35480	0.0933	L	0.44542	1.39	0.37879	D	0.930334	B;B;B;B	0.34399	0.012;0.452;0.012;0.021	B;B;B;B	0.29598	0.008;0.104;0.008;0.017	T	0.28870	-1.0030	10	0.31617	T	0.26	0.2232	16.4484	0.83959	0.0:1.0:0.0:0.0	.	244;239;278;279	B7Z4B9;Q86SQ9-3;Q86SQ9;Q86SQ9-2	.;.;DHDDS_HUMAN;.	I	116;244;278;239;279;114	ENSP00000434984:T244I;ENSP00000236342:T278I;ENSP00000434219:T239I;ENSP00000353104:T279I	ENSP00000236342:T278I	T	+	2	0	DHDDS	26668040	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.317000	0.43770	2.562000	0.86427	0.462000	0.41574	ACA	DHDDS	-	NULL	ENSG00000117682		0.617	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHDDS	HGNC	protein_coding	OTTHUMT00000392504.1	46	0.00	0	C	NM_024887		26795453	26795453	+1	no_errors	ENST00000360009	ensembl	human	known	69_37n	missense	21	21.43	6	SNP	1.000	T
DMXL2	23312	genome.wustl.edu	37	15	51828921	51828921	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:51828921C>G	ENST00000251076.5	-	12	2043	c.1756G>C	c.(1756-1758)Gta>Cta	p.V586L	DMXL2_ENST00000449909.3_Missense_Mutation_p.V586L|DMXL2_ENST00000543779.2_Missense_Mutation_p.V586L	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	586						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GGACTGCCTACAGACATCCCC	0.438																																						dbGAP											0													144.0	118.0	127.0					15																	51828921		2195	4293	6488	-	-	-	SO:0001583	missense	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1756G>C	15.37:g.51828921C>G	ENSP00000251076:p.Val586Leu		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V586L	ENST00000251076.5	37	c.1756	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.612202	0.00835	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.22134	2.11;2.11;1.97	5.42	0.156	0.14910	.	1.091900	0.06894	N	0.804769	T	0.08313	0.0207	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.36962	-0.9726	10	0.16896	T	0.51	.	0.8034	0.01079	0.3655:0.2489:0.1021:0.2835	.	586;586;586	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	L	586	ENSP00000251076:V586L;ENSP00000441858:V586L;ENSP00000400855:V586L	ENSP00000251076:V586L	V	-	1	0	DMXL2	49616213	0.000000	0.05858	0.007000	0.13788	0.128000	0.20619	-0.788000	0.04614	-0.003000	0.14444	-0.123000	0.14984	GTA	DMXL2	-	NULL	ENSG00000104093		0.438	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	98	0.00	0	C	NM_015263		51828921	51828921	-1	no_errors	ENST00000543779	ensembl	human	known	69_37n	missense	81	63.01	138	SNP	0.000	G
DSCR3	10311	genome.wustl.edu	37	21	38599972	38599972	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr21:38599972G>T	ENST00000309117.6	-	7	1031	c.794C>A	c.(793-795)aCc>aAc	p.T265N	AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000288304.5_Missense_Mutation_p.T221N|DSCR3_ENST00000476950.1_Missense_Mutation_p.T238N|DSCR3_ENST00000399001.1_Missense_Mutation_p.T140N|DSCR3_ENST00000539844.1_Missense_Mutation_p.T188N|DSCR3_ENST00000399000.3_5'UTR|DSCR3_ENST00000398998.1_Missense_Mutation_p.T217N	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	265						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						GAAGTTGGTGGTCTCCAGTGT	0.607																																						dbGAP											0													120.0	105.0	110.0					21																	38599972		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.794C>A	21.37:g.38599972G>T	ENSP00000311399:p.Thr265Asn		B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Missense_Mutation	SNP	pfam_VPS26,pfam_Arrestin-like_N,superfamily_Ig_E-set	p.T265N	ENST00000309117.6	37	c.794	CCDS33553.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.274294|4.274294	0.80580|0.80580	.|.	.|.	ENSG00000157538|ENSG00000157538	ENST00000471543|ENST00000309117;ENST00000288304;ENST00000539844;ENST00000399001;ENST00000476950;ENST00000398998	.|.	.|.	.|.	5.16|5.16	4.28|4.28	0.50868|0.50868	.|.	.|0.050502	.|0.85682	.|D	.|0.000000	T|T	0.80607|0.80607	0.4655|0.4655	M|M	0.90252|0.90252	3.1|3.1	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.71674	.|0.998;0.998;0.997;0.952	.|D;D;D;P	.|0.76071	.|0.978;0.976;0.987;0.826	T|T	0.81072|0.81072	-0.1098|-0.1098	5|9	.|0.22706	.|T	.|0.39	-10.0253|-10.0253	13.8154|13.8154	0.63287|0.63287	0.0744:0.0:0.9256:0.0|0.0744:0.0:0.9256:0.0	.|.	.|140;188;238;265	.|A8MY26;B7Z606;B7Z6B1;O14972	.|.;.;.;DSCR3_HUMAN	E|N	70|265;221;188;140;238;217	.|.	.|ENSP00000288304:T221N	D|T	-|-	3|2	2|0	DSCR3|DSCR3	37521842|37521842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	9.835000|9.835000	0.99442|0.99442	1.314000|1.314000	0.45095|0.45095	0.650000|0.650000	0.86243|0.86243	GAC|ACC	DSCR3	-	pfam_VPS26	ENSG00000157538		0.607	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	HGNC	protein_coding	OTTHUMT00000194807.1	84	0.00	0	G			38599972	38599972	-1	no_errors	ENST00000309117	ensembl	human	known	69_37n	missense	34	58.54	48	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56418240	56418241	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr6:56418240_56418241insT	ENST00000361203.3	-	57	14723_14724	c.14716_14717insA	c.(14716-14718)accfs	p.T4906fs	DST_ENST00000421834.2_Frame_Shift_Ins_p.T2820fs|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Frame_Shift_Ins_p.T4908fs|DST_ENST00000370754.5_Frame_Shift_Ins_p.T5086fs|DST_ENST00000446842.2_Frame_Shift_Ins_p.T4582fs|DST_ENST00000370788.2_Frame_Shift_Ins_p.T2820fs|DST_ENST00000244364.6_Frame_Shift_Ins_p.T2494fs			Q03001	DYST_HUMAN	dystonin	4906					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCTGCAATGGTTTTTTCATAC	0.342																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.14717dupA	6.37:g.56418246_56418246dupT	ENSP00000354508:p.Thr4906fs		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Ins	INS	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.T5086fs	ENST00000361203.3	37	c.15257_15256		6																																																																																			DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.342	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	86	0.00	0	-	NM_001723		56418240	56418241	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	frame_shift_ins	264	14.29	44	INS	0.997:1.000	T
EGFR	1956	genome.wustl.edu	37	7	55249078	55249078	+	Silent	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:55249078C>G	ENST00000275493.2	+	20	2553	c.2376C>G	c.(2374-2376)ctC>ctG	p.L792L	EGFR_ENST00000454757.2_Silent_p.L739L|EGFR_ENST00000442591.1_Intron|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Silent_p.L747L	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	792	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TCACGCAGCTCATGCCCTTCG	0.592		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												dbGAP	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													101.0	87.0	92.0					7																	55249078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2376C>G	7.37:g.55249078C>G			O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L792	ENST00000275493.2	37	c.2376	CCDS5514.1	7																																																																																			EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000146648		0.592	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	43	0.00	0	C	NM_005228		55249078	55249078	+1	no_errors	ENST00000275493	ensembl	human	known	69_37n	silent	30	30.23	13	SNP	1.000	G
EPAS1	2034	genome.wustl.edu	37	2	46588144	46588144	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:46588144C>A	ENST00000263734.3	+	6	1204	c.694C>A	c.(694-696)Cca>Aca	p.P232T		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	232	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AATCCAGCACCCATCCCACAT	0.547																																						dbGAP											0													120.0	98.0	105.0					2																	46588144		2203	4300	6503	-	-	-	SO:0001583	missense	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.694C>A	2.37:g.46588144C>A	ENSP00000263734:p.Pro232Thr		Q86VA2|Q99630	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.P232T	ENST00000263734.3	37	c.694	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783197	0.90282	.	.	ENSG00000116016	ENST00000449347;ENST00000263734	T;T	0.21543	2.0;2.05	4.77	4.77	0.60923	PAS (1);	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.59156	-0.7507	10	0.87932	D	0	.	17.9939	0.89177	0.0:1.0:0.0:0.0	.	232	Q99814	EPAS1_HUMAN	T	232	ENSP00000406137:P232T;ENSP00000263734:P232T	ENSP00000263734:P232T	P	+	1	0	EPAS1	46441648	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.643000	0.83403	2.488000	0.83962	0.561000	0.74099	CCA	EPAS1	-	smart_PAS	ENSG00000116016		0.547	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	102	0.00	0	C	NM_001430		46588144	46588144	+1	no_errors	ENST00000263734	ensembl	human	known	69_37n	missense	61	41.90	44	SNP	1.000	A
ETHE1	23474	genome.wustl.edu	37	19	44030361	44030361	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:44030361C>A	ENST00000292147.2	-	3	433	c.367G>T	c.(367-369)Ggg>Tgg	p.G123W	ZNF575_ENST00000458714.2_5'UTR|ETHE1_ENST00000600651.1_Missense_Mutation_p.G123W	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	123					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				ACGAAGCGCCCGAAGCGGATG	0.612																																						dbGAP											0													63.0	63.0	63.0					19																	44030361		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.367G>T	19.37:g.44030361C>A	ENSP00000292147:p.Gly123Trp		Q96HR0|Q9H001	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.G123W	ENST00000292147.2	37	c.367	CCDS12622.1	19	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135718	0.77662	.	.	ENSG00000105755	ENST00000292147	D	0.97688	-4.49	4.33	3.26	0.37387	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	D	0.99205	0.9724	H	0.99058	4.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98543	1.0633	10	0.87932	D	0	-11.3653	12.1309	0.53942	0.0:0.8249:0.1751:0.0	.	96;123	B2RCZ7;O95571	.;ETHE1_HUMAN	W	123	ENSP00000292147:G123W	ENSP00000292147:G123W	G	-	1	0	ETHE1	48722201	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.483000	0.60264	1.144000	0.42321	0.555000	0.69702	GGG	ETHE1	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000105755		0.612	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETHE1	HGNC	protein_coding	OTTHUMT00000463184.1	100	0.00	0	C	NM_014297		44030361	44030361	-1	no_errors	ENST00000292147	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	1.000	A
FDXR	2232	genome.wustl.edu	37	17	72868246	72868246	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr17:72868246T>C	ENST00000293195.5	-	2	170	c.92A>G	c.(91-93)cAt>cGt	p.H31R	FDXR_ENST00000420580.2_Missense_Mutation_p.H31R|FDXR_ENST00000442102.2_Missense_Mutation_p.H31R|FDXR_ENST00000455107.2_5'UTR|FDXR_ENST00000413947.2_Intron|FDXR_ENST00000581530.1_Missense_Mutation_p.H31R|FDXR_ENST00000582944.1_Missense_Mutation_p.H31R|FDXR_ENST00000583917.1_Missense_Mutation_p.H31R	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	31					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	TGTGGAGAAATGGTGGCAGAA	0.542																																						dbGAP											0													41.0	42.0	42.0					17																	72868246		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.92A>G	17.37:g.72868246T>C	ENSP00000293195:p.His31Arg		B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.H31R	ENST00000293195.5	37	c.92	CCDS58593.1	17	.	.	.	.	.	.	.	.	.	.	T	7.458	0.644153	0.14451	.	.	ENSG00000161513	ENST00000420580;ENST00000293195;ENST00000442102	T;T;D	0.81499	3.16;-0.34;-1.5	4.4	-4.6	0.03390	.	1.236910	0.05451	N	0.549438	T	0.54631	0.1870	N	0.08118	0	0.19575	N	0.999963	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0;0.001;0.001	T	0.34004	-0.9846	10	0.23891	T	0.37	-0.0806	1.0555	0.01589	0.1616:0.259:0.2897:0.2897	.	31;31;28;31;31;31;31	B4DQQ4;B4DHX5;B4DDI9;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;ADRO_HUMAN;.	R	31	ENSP00000414172:H31R;ENSP00000293195:H31R;ENSP00000416515:H31R	ENSP00000293195:H31R	H	-	2	0	FDXR	70379841	0.001000	0.12720	0.014000	0.15608	0.044000	0.14063	-1.022000	0.03611	-0.609000	0.05724	0.260000	0.18958	CAT	FDXR	-	NULL	ENSG00000161513		0.542	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FDXR	HGNC	protein_coding	OTTHUMT00000444449.1	128	0.00	0	T	NM_004110		72868246	72868246	-1	no_errors	ENST00000581530	ensembl	human	known	69_37n	missense	49	35.90	28	SNP	0.000	C
FRG1	2483	genome.wustl.edu	37	4	190876278	190876278	+	Missense_Mutation	SNP	G	G	A	rs199978807		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr4:190876278G>A	ENST00000226798.4	+	5	626	c.404G>A	c.(403-405)aGa>aAa	p.R135K	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	135					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATTGGACCAAGAGAACAATGG	0.353																																						dbGAP											0													89.0	89.0	89.0					4																	190876278		2203	4300	6503	-	-	-	SO:0001583	missense	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.404G>A	4.37:g.190876278G>A	ENSP00000226798:p.Arg135Lys		A8K775	Missense_Mutation	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.R135K	ENST00000226798.4	37	c.404	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	17.48	3.399095	0.62177	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.45276	1.97;0.9	4.04	4.04	0.47022	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.39627	0.1085	L	0.59436	1.845	0.58432	D	0.999999	B	0.06786	0.001	B	0.15052	0.012	T	0.27434	-1.0074	10	0.29301	T	0.29	-5.2304	14.145	0.65344	0.0:0.0:1.0:0.0	.	135	Q14331	FRG1_HUMAN	K	135;72	ENSP00000226798:R135K;ENSP00000435943:R72K	ENSP00000226798:R135K	R	+	2	0	FRG1	191113272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.411000	0.80078	1.964000	0.57103	0.567000	0.79289	AGA	FRG1	-	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000109536		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4	43	0.00	0	G	NM_004477		190876278	190876278	+1	no_errors	ENST00000226798	ensembl	human	known	69_37n	missense	164	11.83	22	SNP	1.000	A
GALNT1	2589	genome.wustl.edu	37	18	33289620	33289620	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr18:33289620G>T	ENST00000269195.5	+	11	1669	c.1566G>T	c.(1564-1566)caG>caT	p.Q522H	GALNT1_ENST00000537549.1_Missense_Mutation_p.Q462H	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	522	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						ACAGTAATCAGTGCCTGGATA	0.453																																						dbGAP											0													82.0	79.0	80.0					18																	33289620		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.1566G>T	18.37:g.33289620G>T	ENSP00000269195:p.Gln522His		Q86TJ7|Q9UM86	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Q522H	ENST00000269195.5	37	c.1566	CCDS11915.1	18	.	.	.	.	.	.	.	.	.	.	G	14.38	2.516966	0.44763	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.27104	1.69;1.69	5.73	4.85	0.62838	Ricin B-related lectin (1);Ricin B lectin (3);	0.048751	0.85682	D	0.000000	T	0.21718	0.0523	L	0.48935	1.535	0.80722	D	1	B	0.21309	0.054	B	0.22753	0.041	T	0.03463	-1.1034	10	0.15066	T	0.55	.	11.758	0.51886	0.0843:0.0:0.9157:0.0	.	522	Q10472	GALT1_HUMAN	H	522;522;462	ENSP00000269195:Q522H;ENSP00000440910:Q462H	ENSP00000269195:Q522H	Q	+	3	2	GALNT1	31543618	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.688000	0.74557	2.712000	0.92718	0.585000	0.79938	CAG	GALNT1	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000141429		0.453	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT1	HGNC	protein_coding	OTTHUMT00000255771.2	72	0.00	0	G	NM_020474		33289620	33289620	+1	no_errors	ENST00000269195	ensembl	human	known	69_37n	missense	215	20.66	56	SNP	1.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685232	23685232	+	Missense_Mutation	SNP	A	A	G	rs371798993		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:23685232A>G	ENST00000567107.1	-	8	2442	c.2390T>C	c.(2389-2391)gTg>gCg	p.V797A	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tcctgctcccacatcttctcc	0.582																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2390T>C	15.37:g.23685232A>G	ENSP00000454407:p.Val797Ala		A1L301	Missense_Mutation	SNP	NULL	p.V797A	ENST00000567107.1	37	c.2390		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.582	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	8	0.00	0	A	NM_182561		23685232	23685232	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	missense	30	38.78	19	SNP	0.005	G
GPR135	64582	genome.wustl.edu	37	14	59931648	59931648	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr14:59931648delG	ENST00000395116.1	-	1	412	c.297delC	c.(295-297)cacfs	p.H99fs		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		CTGCAGCTCCGTGCGACAGCA	0.746																																						dbGAP											0													6.0	10.0	8.0					14																	59931648		2065	4087	6152	-	-	-	SO:0001589	frameshift_variant	0			AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.297delC	14.37:g.59931648delG	ENSP00000378548:p.His99fs		Q7Z604|Q86SM3|Q8NH39	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.H99fs	ENST00000395116.1	37	c.297	CCDS9738.1	14																																																																																			GPR135	-	NULL	ENSG00000181619		0.746	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR135	HGNC	protein_coding	OTTHUMT00000276941.1	21	0.00	0	G	NM_022571		59931648	59931648	-1	no_errors	ENST00000395116	ensembl	human	known	69_37n	frame_shift_del	6	25.00	2	DEL	1.000	-
GPR20	2843	genome.wustl.edu	37	8	142367953	142367953	+	Missense_Mutation	SNP	C	C	A	rs370443305		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:142367953C>A	ENST00000377741.3	-	2	161	c.71G>T	c.(70-72)cGg>cTg	p.R24L	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	24					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			GGCATTGGTCCGCACTGTTGT	0.682																																						dbGAP											0													41.0	40.0	40.0					8																	142367953		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.71G>T	8.37:g.142367953C>A	ENSP00000366970:p.Arg24Leu		Q17R96	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R24L	ENST00000377741.3	37	c.71	CCDS34949.1	8	.	.	.	.	.	.	.	.	.	.	C	2.915	-0.224411	0.06061	.	.	ENSG00000204882	ENST00000377741	T	0.59364	0.27	3.44	2.54	0.30619	.	1.530910	0.03985	N	0.293979	T	0.37265	0.0997	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.01281	0.0	T	0.22173	-1.0224	10	0.28530	T	0.3	-1.0887	5.9304	0.19136	0.2214:0.5633:0.2154:0.0	.	24	Q99678	GPR20_HUMAN	L	24	ENSP00000366970:R24L	ENSP00000366970:R24L	R	-	2	0	GPR20	142437135	0.143000	0.22626	0.139000	0.22197	0.011000	0.07611	0.987000	0.29603	0.630000	0.30394	0.555000	0.69702	CGG	GPR20	-	NULL	ENSG00000204882		0.682	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR20	HGNC	protein_coding	OTTHUMT00000378968.1	16	0.00	0	C	NM_005293		142367953	142367953	-1	no_errors	ENST00000377741	ensembl	human	known	69_37n	missense	16	51.52	17	SNP	0.420	A
HTATSF1	27336	genome.wustl.edu	37	X	135584979	135584979	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chrX:135584979G>A	ENST00000218364.4	+	5	787	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E205K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	205	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GGATGAAGATGAAATTAGAGG	0.328																																						dbGAP											0													83.0	84.0	84.0					X																	135584979		2203	4299	6502	-	-	-	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.613G>A	X.37:g.135584979G>A	ENSP00000218364:p.Glu205Lys		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E205K	ENST00000218364.4	37	c.613	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599279	0.87055	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000425695;ENST00000218364;ENST00000415377	T;T;T;T	0.15718	2.4;2.4;2.4;2.4	5.4	4.51	0.55191	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.141237	0.64402	D	0.000006	T	0.39963	0.1098	M	0.71581	2.175	0.80722	D	1	D	0.60160	0.987	D	0.65573	0.936	T	0.28202	-1.0051	10	0.59425	D	0.04	-11.4146	15.1489	0.72681	0.0:0.1382:0.8618:0.0	.	205	O43719	HTSF1_HUMAN	K	205	ENSP00000442699:E205K;ENSP00000411381:E205K;ENSP00000412420:E205K;ENSP00000218364:E205K	ENSP00000218364:E205K	E	+	1	0	HTATSF1	135412645	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.215000	0.72206	1.022000	0.39626	0.468000	0.43344	GAA	HTATSF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000102241		0.328	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	124	0.00	0	G	NM_014500		135584979	135584979	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	missense	157	10.80	19	SNP	1.000	A
KDM7A	80853	genome.wustl.edu	37	7	139801836	139801836	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:139801836T>C	ENST00000397560.2	-	12	1650	c.1553A>G	c.(1552-1554)aAt>aGt	p.N518S	JHDM1D_ENST00000006967.5_Missense_Mutation_p.N518S	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		518					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					AGTTCGGACATTATGATCTCG	0.438																																						dbGAP											0													226.0	202.0	210.0					7																	139801836		1875	4103	5978	-	-	-	SO:0001583	missense	0																														ENST00000397560.2:c.1553A>G	7.37:g.139801836T>C	ENSP00000380692:p.Asn518Ser		A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.N518S	ENST00000397560.2	37	c.1553	CCDS43658.1	7	.	.	.	.	.	.	.	.	.	.	T	4.107	0.017908	0.07959	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.43688	0.94;0.94	5.68	0.308	0.15815	.	0.229615	0.27896	U	0.017406	T	0.18635	0.0447	N	0.12569	0.235	0.24118	N	0.995813	B	0.02656	0.0	B	0.04013	0.001	T	0.30621	-0.9972	10	0.02654	T	1	-5.4482	11.0887	0.48102	0.0:0.0783:0.6573:0.2644	.	518	Q6ZMT4	KDM7_HUMAN	S	518	ENSP00000380692:N518S;ENSP00000006967:N518S	ENSP00000006967:N518S	N	-	2	0	JHDM1D	139448305	0.087000	0.21565	0.974000	0.42286	0.998000	0.95712	0.769000	0.26604	0.093000	0.17368	0.533000	0.62120	AAT	JHDM1D	-	NULL	ENSG00000006459		0.438	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JHDM1D	HGNC	protein_coding	OTTHUMT00000348460.1	160	0.00	0	T			139801836	139801836	-1	no_errors	ENST00000397560	ensembl	human	known	69_37n	missense	89	70.92	217	SNP	0.971	C
KANK2	25959	genome.wustl.edu	37	19	11287322	11287322	+	Silent	SNP	C	C	A	rs191625212	byFrequency	TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:11287322C>A	ENST00000586659.1	-	7	2006	c.1692G>T	c.(1690-1692)ctG>ctT	p.L564L	KANK2_ENST00000355150.5_Silent_p.L564L|KANK2_ENST00000589894.1_Silent_p.L564L|KANK2_ENST00000432929.2_Silent_p.L572L|KANK2_ENST00000589359.1_Silent_p.L572L			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	564					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATTCTCGAGACAGCTGACACT	0.627																																						dbGAP											0													110.0	106.0	107.0					19																	11287322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1692G>T	19.37:g.11287322C>A			B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L572	ENST00000586659.1	37	c.1716	CCDS12255.1	19																																																																																			KANK2	-	NULL	ENSG00000197256		0.627	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	53	0.00	0	C	NM_015493		11287322	11287322	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	silent	27	63.64	49	SNP	0.000	A
KCTD18	130535	genome.wustl.edu	37	2	201354837	201354837	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:201354837T>A	ENST00000359878.3	-	7	1777	c.1267A>T	c.(1267-1269)Aac>Tac	p.N423Y	KCTD18_ENST00000409157.1_Missense_Mutation_p.N423Y	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	423					protein homooligomerization (GO:0051260)					endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						TTTCCCTTGTTCTTCCCGTTC	0.552																																						dbGAP											0													55.0	59.0	57.0					2																	201354837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.1267A>T	2.37:g.201354837T>A	ENSP00000352941:p.Asn423Tyr		Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.N423Y	ENST00000359878.3	37	c.1267	CCDS2330.1	2	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650437	0.29336	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.35973	1.28;1.28	4.86	1.81	0.25067	.	1.097970	0.07010	N	0.825004	T	0.21062	0.0507	N	0.14661	0.345	0.09310	N	1	B	0.22683	0.073	B	0.18871	0.023	T	0.27365	-1.0076	10	0.72032	D	0.01	0.1607	3.6631	0.08246	0.0:0.5371:0.203:0.2598	.	423	Q6PI47	KCD18_HUMAN	Y	423	ENSP00000352941:N423Y;ENSP00000386751:N423Y	ENSP00000352941:N423Y	N	-	1	0	KCTD18	201063082	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.193000	0.17116	0.633000	0.30452	-0.152000	0.13540	AAC	KCTD18	-	NULL	ENSG00000155729		0.552	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD18	HGNC	protein_coding	OTTHUMT00000256188.1	97	0.00	0	T	NM_152387		201354837	201354837	-1	no_errors	ENST00000359878	ensembl	human	known	69_37n	missense	70	34.58	37	SNP	0.000	A
KIAA0020	9933	genome.wustl.edu	37	9	2812326	2812326	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr9:2812326T>G	ENST00000397885.2	-	14	1512	c.1306A>C	c.(1306-1308)Aaa>Caa	p.K436Q		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	436	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTTCCATATTTGTCATTTACT	0.343																																						dbGAP											0													146.0	127.0	134.0					9																	2812326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1306A>C	9.37:g.2812326T>G	ENSP00000380982:p.Lys436Gln		A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.K436Q	ENST00000397885.2	37	c.1306	CCDS6448.2	9	.	.	.	.	.	.	.	.	.	.	T	22.0	4.237004	0.79800	.	.	ENSG00000080608	ENST00000397885	T	0.50001	0.76	5.5	5.5	0.81552	CPL (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53433	0.1796	M	0.79805	2.47	0.80722	D	1	B;B	0.28258	0.1;0.205	B;B	0.32928	0.098;0.155	T	0.52193	-0.8608	10	0.22706	T	0.39	-4.0799	15.8958	0.79333	0.0:0.0:0.0:1.0	.	296;436	B2RDG4;Q15397	.;K0020_HUMAN	Q	436	ENSP00000380982:K436Q	ENSP00000380982:K436Q	K	-	1	0	KIAA0020	2802326	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.484000	0.81180	2.209000	0.71365	0.482000	0.46254	AAA	KIAA0020	-	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	ENSG00000080608		0.343	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	268	0.00	0	T	NM_014878		2812326	2812326	-1	no_errors	ENST00000397885	ensembl	human	known	69_37n	missense	159	75.91	501	SNP	1.000	G
KIAA0368	23392	genome.wustl.edu	37	9	114184460	114184460	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr9:114184460G>C	ENST00000338205.5	-	13	1505	c.1286C>G	c.(1285-1287)aCt>aGt	p.T429S	KIAA0368_ENST00000259335.4_Missense_Mutation_p.T607S			Q5VYK3	ECM29_HUMAN	KIAA0368	435					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TATATCCTTAGTGAATAAATG	0.373																																						dbGAP											0													73.0	71.0	72.0					9																	114184460		1848	4097	5945	-	-	-	SO:0001583	missense	0			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1286C>G	9.37:g.114184460G>C	ENSP00000339889:p.Thr429Ser		O15074|Q8WU82	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T607S	ENST00000338205.5	37	c.1820		9	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590428	0.46214	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.40756	1.02	4.96	4.96	0.65561	Armadillo-like helical (1);Armadillo-type fold (1);	0.113624	0.64402	D	0.000015	T	0.22044	0.0531	N	0.05383	-0.06	0.80722	D	1	B	0.33000	0.393	B	0.29176	0.099	T	0.12116	-1.0560	10	0.05833	T	0.94	.	18.5773	0.91159	0.0:0.0:1.0:0.0	.	435	Q5VYK3	ECM29_HUMAN	S	429;607	ENSP00000259335:T607S	ENSP00000259335:T607S	T	-	2	0	KIAA0368	113224281	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.384000	0.97219	2.467000	0.83353	0.557000	0.71058	ACT	KIAA0368	-	superfamily_ARM-type_fold	ENSG00000136813		0.373	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	KIAA0368	HGNC	protein_coding	OTTHUMT00000053637.2	222	0.00	0	G	NM_014686		114184460	114184460	-1	no_errors	ENST00000259335	ensembl	human	known	69_37n	missense	202	28.87	82	SNP	1.000	C
KIAA1377	57562	genome.wustl.edu	37	11	101833406	101833406	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr11:101833406C>G	ENST00000263468.8	+	6	1910	c.1640C>G	c.(1639-1641)tCt>tGt	p.S547C	KIAA1377_ENST00000537689.1_Missense_Mutation_p.S348C	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	547								p.S547Y(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TCATCCTTGTCTAATGTAACT	0.313																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											37.0	40.0	39.0					11																	101833406		2201	4286	6487	-	-	-	SO:0001583	missense	0			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1640C>G	11.37:g.101833406C>G	ENSP00000263468:p.Ser547Cys		Q4G0U6	Missense_Mutation	SNP	NULL	p.S547C	ENST00000263468.8	37	c.1640	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	C	0.852	-0.738300	0.03111	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.09538	2.97;2.97	5.29	3.37	0.38596	.	0.297631	0.29444	N	0.012127	T	0.06325	0.0163	N	0.20685	0.6	0.09310	N	1	B	0.15930	0.015	B	0.15484	0.013	T	0.33292	-0.9874	10	0.35671	T	0.21	-4.0253	5.625	0.17477	0.127:0.6194:0.1777:0.0758	.	547	Q9P2H0	K1377_HUMAN	C	547;348	ENSP00000263468:S547C;ENSP00000443184:S348C	ENSP00000263468:S547C	S	+	2	0	KIAA1377	101338616	0.015000	0.18098	0.020000	0.16555	0.039000	0.13416	0.932000	0.28884	0.661000	0.30985	0.655000	0.94253	TCT	KIAA1377	-	NULL	ENSG00000110318		0.313	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	63	0.00	0	C	NM_020802		101833406	101833406	+1	no_errors	ENST00000263468	ensembl	human	known	69_37n	missense	64	48.80	61	SNP	0.017	G
KRTAP10-7	386675	genome.wustl.edu	37	21	46020875	46020875	+	Silent	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr21:46020875C>G	ENST00000380102.2	+	1	379	c.354C>G	c.(352-354)gtC>gtG	p.V118V	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	118	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCATGCCCGTCTGCTGCAAGA	0.627																																						dbGAP											0													83.0	82.0	83.0					21																	46020875		2185	4299	6484	-	-	-	SO:0001819	synonymous_variant	0			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.354C>G	21.37:g.46020875C>G			Q0VDJ8|Q70LJ2	Silent	SNP	NULL	p.V118	ENST00000380102.2	37	c.354		21																																																																																			KRTAP10-7	-	NULL	ENSG00000205441		0.627	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	KRTAP10-7	HGNC	protein_coding	OTTHUMT00000128038.1	120	0.00	0	C	NM_198689		46020875	46020875	+1	no_errors	ENST00000380102	ensembl	human	known	69_37n	silent	284	22.62	83	SNP	0.137	G
LINC00303	284573	genome.wustl.edu	37	1	204006652	204006652	+	lincRNA	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:204006652C>A	ENST00000367207.3	-	0	368							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		CCACAGCATGCAGGAGGCCAG	0.577																																						dbGAP											0													81.0	97.0	91.0					1																	204006652		2153	4275	6428	-	-	-			0			AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204006652C>A			Q3SY06|Q8N7U1	RNA	SNP	-	NULL	ENST00000367207.3	37	NULL		1																																																																																			LINC00303	-	-	ENSG00000176754		0.577	LINC00303-001	KNOWN	basic	lincRNA	LINC00303	HGNC	lincRNA	OTTHUMT00000087885.3	271	0.00	0	C	NR_027902		204006652	204006652	-1	no_errors	ENST00000367207	ensembl	human	known	69_37n	rna	337	50.44	343	SNP	0.000	A
LRRC32	2615	genome.wustl.edu	37	11	76371666	76371666	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr11:76371666T>C	ENST00000407242.2	-	3	1213	c.971A>G	c.(970-972)tAc>tGc	p.Y324C	LRRC32_ENST00000260061.5_Missense_Mutation_p.Y324C|LRRC32_ENST00000404995.1_Missense_Mutation_p.Y324C|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	324					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AATCTCATTGTAGCTCAAATC	0.607																																						dbGAP											0													26.0	30.0	29.0					11																	76371666		2200	4292	6492	-	-	-	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.971A>G	11.37:g.76371666T>C	ENSP00000384126:p.Tyr324Cys		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.Y324C	ENST00000407242.2	37	c.971	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	T	14.29	2.490731	0.44249	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.04603	3.59;3.59;3.59	4.35	4.35	0.52113	.	0.203226	0.44285	D	0.000477	T	0.12603	0.0306	L	0.39147	1.195	0.58432	D	0.999996	D	0.76494	0.999	D	0.66847	0.947	T	0.05920	-1.0856	10	0.38643	T	0.18	.	13.7077	0.62651	0.0:0.0:0.0:1.0	.	324	Q14392	LRC32_HUMAN	C	324	ENSP00000260061:Y324C;ENSP00000384126:Y324C;ENSP00000385766:Y324C	ENSP00000260061:Y324C	Y	-	2	0	LRRC32	76049314	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.627000	0.54252	1.837000	0.53436	0.454000	0.30748	TAC	LRRC32	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000137507		0.607	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	56	0.00	0	T	NM_005512		76371666	76371666	-1	no_errors	ENST00000260061	ensembl	human	known	69_37n	missense	69	15.48	13	SNP	1.000	C
LYST	1130	genome.wustl.edu	37	1	235872479	235872479	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:235872479T>G	ENST00000389794.3	-	44	10229	c.10055A>C	c.(10054-10056)cAg>cCg	p.Q3352P	LYST_ENST00000389793.2_Missense_Mutation_p.Q3352P|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3352	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ACAGATGTTCTGCGACACGTA	0.478																																						dbGAP											0													118.0	113.0	115.0					1																	235872479		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10055A>C	1.37:g.235872479T>G	ENSP00000374444:p.Gln3352Pro		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q3352P	ENST00000389794.3	37	c.10055	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735867	0.89482	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.81163	-1.46;-1.46	5.35	5.35	0.76521	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.88123	0.6352	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87201	0.2241	10	0.36615	T	0.2	.	15.6775	0.77338	0.0:0.0:0.0:1.0	.	3352	Q99698	LYST_HUMAN	P	3352	ENSP00000374444:Q3352P;ENSP00000374443:Q3352P	ENSP00000374443:Q3352P	Q	-	2	0	LYST	233939102	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.639000	0.83342	2.159000	0.67721	0.529000	0.55759	CAG	LYST	-	pfam_BEACH_dom,superfamily_BEACH_dom,superfamily_ARM-type_fold,pfscan_BEACH_dom	ENSG00000143669		0.478	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	105	0.00	0	T			235872479	235872479	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	missense	239	21.05	64	SNP	1.000	G
MAGEA12	4111	genome.wustl.edu	37	X	151900720	151900720	+	Silent	SNP	A	A	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chrX:151900720A>C	ENST00000357916.4	-	2	236	c.81T>G	c.(79-81)ggT>ggG	p.G27G	CSAG1_ENST00000370287.3_5'Flank|CSAG1_ENST00000452779.2_5'Flank|CSAG1_ENST00000370291.2_5'Flank|MAGEA12_ENST00000393869.3_Silent_p.G27G|CSAG4_ENST00000361201.4_RNA|MAGEA12_ENST00000393900.3_Silent_p.G27G	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	27										breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCTGCGCACCCACCAAGC	0.622																																						dbGAP											0													42.0	44.0	43.0					X																	151900720		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.81T>G	X.37:g.151900720A>C			Q9NSD3	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.G27	ENST00000357916.4	37	c.81	CCDS14710.1	X																																																																																			MAGEA12	-	pfam_Melanoma_ass_antigen_N	ENSG00000213401		0.622	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA12	HGNC	protein_coding	OTTHUMT00000058764.1	47	0.00	0	A	NM_005367		151900720	151900720	-1	no_errors	ENST00000357916	ensembl	human	known	69_37n	silent	97	14.91	17	SNP	0.002	C
MAML1	9794	genome.wustl.edu	37	5	179193106	179193106	+	Silent	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr5:179193106G>A	ENST00000292599.3	+	2	1358	c.1095G>A	c.(1093-1095)ccG>ccA	p.P365P	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCTGATGCCGGCATCAGCCC	0.632																																						dbGAP											0													42.0	43.0	43.0					5																	179193106		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1095G>A	5.37:g.179193106G>A				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.P365	ENST00000292599.3	37	c.1095	CCDS34315.1	5																																																																																			MAML1	-	NULL	ENSG00000161021		0.632	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	74	0.00	0	G	NM_014757		179193106	179193106	+1	no_errors	ENST00000292599	ensembl	human	known	69_37n	silent	62	38.61	39	SNP	0.402	A
MAP4K2	5871	genome.wustl.edu	37	11	64557417	64557417	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr11:64557417T>A	ENST00000294066.2	-	30	2354	c.2263A>T	c.(2263-2265)Agt>Tgt	p.S755C	MAP4K2_ENST00000377350.3_Missense_Mutation_p.S747C	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	755	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						GCCAGCACACTGTCCTGCAGG	0.657																																						dbGAP											0													47.0	42.0	43.0					11																	64557417		2201	4297	6498	-	-	-	SO:0001583	missense	0			BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.2263A>T	11.37:g.64557417T>A	ENSP00000294066:p.Ser755Cys		Q86VU3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.S755C	ENST00000294066.2	37	c.2263	CCDS8082.1	11	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019241	0.75275	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.05447	3.44;3.44	4.78	4.78	0.61160	Citron-like (3);	0.098783	0.64402	D	0.000002	T	0.22859	0.0552	M	0.74467	2.265	0.54753	D	0.999983	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.00501	-1.1702	10	0.87932	D	0	.	10.7617	0.46268	0.0:0.0:0.0:1.0	.	747;755	Q86VU3;Q12851	.;M4K2_HUMAN	C	755;747	ENSP00000294066:S755C;ENSP00000366567:S747C	ENSP00000294066:S755C	S	-	1	0	MAP4K2	64313993	1.000000	0.71417	0.999000	0.59377	0.761000	0.43186	6.703000	0.74633	1.813000	0.52934	0.397000	0.26171	AGT	MAP4K2	-	pfam_Citron,smart_Citron	ENSG00000168067		0.657	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K2	HGNC	protein_coding	OTTHUMT00000105239.1	51	0.00	0	T	NM_004579		64557417	64557417	-1	no_errors	ENST00000294066	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90497640	90497640	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr6:90497640G>A	ENST00000369393.3	-	8	1382	c.1267C>T	c.(1267-1269)Ctc>Ttc	p.L423F	MDN1_ENST00000428876.1_Missense_Mutation_p.L423F			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	423					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGAATCAAGAGCTCTCCATTC	0.413																																						dbGAP											0													93.0	87.0	89.0					6																	90497640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.1267C>T	6.37:g.90497640G>A	ENSP00000358400:p.Leu423Phe		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L423F	ENST00000369393.3	37	c.1267	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	13.40	2.224810	0.39300	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.43688	0.94;0.94	5.65	5.65	0.86999	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.56819	0.2011	M	0.85777	2.775	0.49798	D	0.999829	D;D	0.89917	1.0;0.974	D;D	0.81914	0.995;0.981	T	0.63686	-0.6581	10	0.62326	D	0.03	.	7.7178	0.28715	0.1936:0.0:0.8064:0.0	.	423;423	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	F	423	ENSP00000358400:L423F;ENSP00000413970:L423F	ENSP00000358400:L423F	L	-	1	0	MDN1	90554361	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	2.692000	0.47018	2.826000	0.97356	0.563000	0.77884	CTC	MDN1	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	127	0.00	0	G			90497640	90497640	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	206	55.31	255	SNP	0.998	A
MIR1207	100302175	genome.wustl.edu	37	8	129061432	129061432	+	RNA	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:129061432G>C	ENST00000408249.1	+	0	35					NR_031612.1				microRNA 1207																		GGGGCTGGCTGGGTCTGGTAG	0.562																																						dbGAP											0													48.0	53.0	52.0					8																	129061432		1568	3582	5150	-	-	-			0					8	2011-09-12		2008-12-18	ENSG00000221176	ENSG00000221176		"""ncRNAs / Micro RNAs"""	35273	non-coding RNA	RNA, micro				MIRN1207			Standard	NR_031612		Approved	hsa-mir-1207	uc022bbj.1				8.37:g.129061432G>C				RNA	SNP	-	NULL	ENST00000408249.1	37	NULL		8																																																																																			MIR1207	-	-	ENSG00000221176		0.562	MIR1207-201	KNOWN	basic	miRNA	MIR1207	HGNC	miRNA		105	0.00	0	G	NR_031612		129061432	129061432	+1	no_errors	ENST00000408249	ensembl	human	known	69_37n	rna	291	11.01	36	SNP	0.000	C
MMADHC	27249	genome.wustl.edu	37	2	150443603	150443603	+	Splice_Site	SNP	A	A	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:150443603A>G	ENST00000428879.1	-	1	513	c.9T>C	c.(7-9)aaT>aaC	p.N3N	AC144449.1_ENST00000449714.1_RNA|MMADHC_ENST00000460311.1_5'UTR|MMADHC_ENST00000303319.5_Splice_Site_p.N3N|MMADHC_ENST00000422782.2_Splice_Site_p.N3N			Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria	3					cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(2)	11						ATTTACTCACATTGGCCATCT	0.378																																						dbGAP											0													106.0	108.0	107.0					2																	150443603		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC023995	CCDS2189.1	2q23	2011-05-12	2009-01-08	2009-01-08	ENSG00000168288	ENSG00000168288			25221	protein-coding gene	gene with protein product		611935	"""chromosome 2 open reading frame 25"""	C2orf25		18385497	Standard	NM_015702		Approved	CL25022, cblD	uc002txc.3	Q9H3L0	OTTHUMG00000155558	ENST00000428879.1:c.9+1T>C	2.37:g.150443603A>G			B2R895|D3DP91|O95891	Silent	SNP	pfam_MMADHC	p.N3	ENST00000428879.1	37	c.9	CCDS2189.1	2																																																																																			MMADHC	-	NULL	ENSG00000168288		0.378	MMADHC-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MMADHC	HGNC	protein_coding	OTTHUMT00000332312.1	154	0.00	0	A	NM_015702	Silent	150443603	150443603	-1	no_errors	ENST00000303319	ensembl	human	known	69_37n	silent	251	16.89	51	SNP	1.000	G
MTHFD1	4522	genome.wustl.edu	37	14	64891602	64891602	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr14:64891602C>G	ENST00000545908.1	+	9	1205	c.976C>G	c.(976-978)Cct>Gct	p.P326A	MTHFD1_ENST00000216605.8_Missense_Mutation_p.P270A|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	270	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	CTTCATCACTCCTGTTCCTGG	0.463																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													114.0	91.0	99.0					14																	64891602		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.976C>G	14.37:g.64891602C>G	ENSP00000438588:p.Pro326Ala		B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.P326A	ENST00000545908.1	37	c.976		14	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796687	0.70567	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.89	5.89	0.94794	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94948	0.8366	H	0.98178	4.165	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.985;0.993;0.999	D	0.96297	0.9218	10	0.87932	D	0	-14.4038	18.5149	0.90933	0.0:1.0:0.0:0.0	.	326;270;270	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	A	326;270;326;250	ENSP00000438588:P326A;ENSP00000450560:P270A;ENSP00000216605:P326A;ENSP00000451309:P250A	ENSP00000216605:P270A	P	+	1	0	MTHFD1	63961355	1.000000	0.71417	0.944000	0.38274	0.157000	0.22087	7.760000	0.85248	2.822000	0.97130	0.650000	0.86243	CCT	MTHFD1	-	pfam_THF_DH/CycHdrlase_NAD-bd_dom,prints_THF_DH/CycHdrlase	ENSG00000100714		0.463	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	226	0.00	0	C			64891602	64891602	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	134	33.00	66	SNP	1.000	G
MUSK	4593	genome.wustl.edu	37	9	113550132	113550132	+	Intron	SNP	A	A	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr9:113550132A>C	ENST00000374448.4	+	14	2061				MUSK_ENST00000374438.1_Missense_Mutation_p.Q163H|MUSK_ENST00000189978.5_Intron|MUSK_ENST00000416899.2_Intron	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase						cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						TGAAAATACAAGTGAGGATAT	0.428																																						dbGAP											0													29.0	27.0	28.0					9																	113550132		1848	4093	5941	-	-	-	SO:0001627	intron_variant	0			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1927+14A>C	9.37:g.113550132A>C			Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	p.Q163H	ENST00000374448.4	37	c.489	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	A	12.06	1.824215	0.32237	.	.	ENSG00000030304	ENST00000374441;ENST00000374438	D	0.83075	-1.68	5.43	3.01	0.34805	.	.	.	.	.	T	0.74658	0.3745	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.61461	-0.7058	5	.	.	.	.	4.9967	0.14243	0.7519:0.0:0.0875:0.1605	.	.	.	.	H	163	ENSP00000363561:Q163H	.	Q	+	3	2	MUSK	112589953	0.054000	0.20591	0.000000	0.03702	0.253000	0.25986	2.583000	0.46094	0.411000	0.25702	0.533000	0.62120	CAA	MUSK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000030304		0.428	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	HGNC	protein_coding		80	0.00	0	A			113550132	113550132	+1	no_errors	ENST00000374438	ensembl	human	known	69_37n	missense	97	14.16	16	SNP	0.000	C
MYBPC2	4606	genome.wustl.edu	37	19	50945455	50945455	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:50945455G>C	ENST00000357701.5	+	9	838	c.787G>C	c.(787-789)Gat>Cat	p.D263H		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	263	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AAAGAAGCTGGATCCAGCCTA	0.542																																						dbGAP											0													54.0	57.0	56.0					19																	50945455		2027	4187	6214	-	-	-	SO:0001583	missense	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.787G>C	19.37:g.50945455G>C	ENSP00000350332:p.Asp263His		A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D263H	ENST00000357701.5	37	c.787	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	g	18.54	3.646127	0.67358	.	.	ENSG00000086967	ENST00000357701	T	0.42131	0.98	4.29	4.29	0.51040	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.35805	U	0.002969	T	0.63640	0.2528	M	0.72894	2.215	0.49389	D	0.999788	D	0.89917	1.0	D	0.79108	0.992	T	0.68465	-0.5401	10	0.66056	D	0.02	.	16.3731	0.83371	0.0:0.0:1.0:0.0	.	263	Q14324	MYPC2_HUMAN	H	263	ENSP00000350332:D263H	ENSP00000350332:D263H	D	+	1	0	MYBPC2	55637267	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	9.019000	0.93662	2.321000	0.78463	0.462000	0.41574	GAT	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.542	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	96	0.00	0	G	NM_004533		50945455	50945455	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	missense	138	19.54	34	SNP	1.000	C
MYO7B	4648	genome.wustl.edu	37	2	128370129	128370129	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:128370129G>T	ENST00000409816.2	+	24	3303	c.3271G>T	c.(3271-3273)Gag>Tag	p.E1091*	MYO7B_ENST00000428314.1_Nonsense_Mutation_p.E1091*|MYO7B_ENST00000389524.4_Nonsense_Mutation_p.E1091*			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1091	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GTCCAACCTGGAGAAGGTGCA	0.607																																						dbGAP											0													63.0	71.0	68.0					2																	128370129		2126	4242	6368	-	-	-	SO:0001587	stop_gained	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3271G>T	2.37:g.128370129G>T	ENSP00000386461:p.Glu1091*		Q14786|Q8TEE1	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.E1091*	ENST00000409816.2	37	c.3271	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	G	41	8.796791	0.98958	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	17.427	0.87529	0.0:0.0:1.0:0.0	.	.	.	.	X	1091	.	ENSP00000374175:E1091X	E	+	1	0	MYO7B	128086599	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.262000	0.95591	2.109000	0.64355	0.462000	0.41574	GAG	MYO7B	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000169994		0.607	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	45	0.00	0	G	XM_291001		128370129	128370129	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	nonsense	37	33.93	19	SNP	1.000	T
NAV3	89795	genome.wustl.edu	37	12	78592404	78592404	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr12:78592404A>G	ENST00000397909.2	+	36	6639	c.6466A>G	c.(6466-6468)Atg>Gtg	p.M2156V	NAV3_ENST00000228327.6_Missense_Mutation_p.M2134V|NAV3_ENST00000266692.7_Missense_Mutation_p.M1957V|NAV3_ENST00000541270.1_5'Flank|NAV3_ENST00000536525.2_Missense_Mutation_p.M2134V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2156						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TATTGGAACAATGAATCAGGG	0.264										HNSCC(70;0.22)																												dbGAP											0													80.0	76.0	77.0					12																	78592404		1793	4065	5858	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6466A>G	12.37:g.78592404A>G	ENSP00000381007:p.Met2156Val		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.M2156V	ENST00000397909.2	37	c.6466		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.3|21.3	4.122766|4.122766	0.77436|0.77436	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.88124|.	-2.34;-2.34;-2.34;-2.34;-2.34|.	6.16|6.16	6.16|6.16	0.99307|0.99307	ATPase, AAA+ type, core (1);|.	0.176450|.	0.27640|.	U|.	0.018462|.	T|T	0.79137|0.79137	0.4395|0.4395	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	D;P;D;D|.	0.71674|.	0.998;0.811;0.995;0.982|.	D;P;D;D|.	0.77004|.	0.989;0.879;0.989;0.961|.	T|T	0.80614|0.80614	-0.1304|-0.1304	10|5	0.25106|.	T|.	0.35|.	-21.7055|-21.7055	16.4795|16.4795	0.84153|0.84153	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2134;1957;2156;2134|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|S	2134;2156;2134;1957;748;756|1028	ENSP00000446132:M2134V;ENSP00000381007:M2156V;ENSP00000228327:M2134V;ENSP00000266692:M1957V;ENSP00000448303:M756V|.	ENSP00000228327:M2134V|.	M|N	+|+	1|2	0|0	NAV3|NAV3	77116535|77116535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.108000|9.108000	0.94275|0.94275	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	ATG|AAT	NAV3	-	smart_AAA+_ATPase	ENSG00000067798		0.264	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	66	0.00	0	A	NM_001024383		78592404	78592404	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	111	13.28	17	SNP	1.000	G
NBN	4683	genome.wustl.edu	37	8	90983465	90983465	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:90983465G>A	ENST00000265433.3	-	6	792	c.638C>T	c.(637-639)tCa>tTa	p.S213L	NBN_ENST00000409330.1_Missense_Mutation_p.S131L	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	213	Mediates interaction with SP100. {ECO:0000250}.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			CTGCCGTCCTGACAGATCAAC	0.279								Homologous recombination																														dbGAP											0													68.0	67.0	68.0					8																	90983465		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.638C>T	8.37:g.90983465G>A	ENSP00000265433:p.Ser213Leu		B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	pfam_DNA-repair_Nbs1_C,pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_BRCT_dom,smart_FHA_dom,pirsf_Nibrin_met,pfscan_FHA_dom	p.S213L	ENST00000265433.3	37	c.638	CCDS6249.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271493	0.80469	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387;ENST00000519426;ENST00000517772	T;T;T;T	0.74842	0.29;0.28;-0.88;-0.49	5.84	5.84	0.93424	.	0.270733	0.36815	N	0.002397	D	0.85057	0.5610	M	0.65320	2	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;D	0.66979	0.948;0.948	D	0.85458	0.1165	10	0.87932	D	0	-16.8183	20.1346	0.98019	0.0:0.0:1.0:0.0	.	213;213	A6H8Y5;O60934	.;NBN_HUMAN	L	213;131;213;125;131	ENSP00000265433:S213L;ENSP00000386924:S131L;ENSP00000430983:S125L;ENSP00000428717:S131L	ENSP00000265433:S213L	S	-	2	0	NBN	91052641	0.998000	0.40836	0.980000	0.43619	0.953000	0.61014	5.145000	0.64839	2.765000	0.95021	0.655000	0.94253	TCA	NBN	-	pirsf_Nibrin_met	ENSG00000104320		0.279	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBN	HGNC	protein_coding	OTTHUMT00000331583.3	106	0.93	1	G	NM_001024688		90983465	90983465	-1	no_errors	ENST00000265433	ensembl	human	known	69_37n	missense	319	16.67	64	SNP	0.805	A
NIN	51199	genome.wustl.edu	37	14	51206034	51206034	+	Silent	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr14:51206034G>T	ENST00000382041.3	-	26	5810	c.5620C>A	c.(5620-5622)Cgg>Agg	p.R1874R	NIN_ENST00000530997.2_Silent_p.R1874R|NIN_ENST00000389868.3_Silent_p.R1161R|NIN_ENST00000382043.4_Silent_p.R1161R|NIN_ENST00000453196.1_Silent_p.R1874R|NIN_ENST00000245441.5_Silent_p.R1874R|NIN_ENST00000324330.9_Silent_p.R1874R	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1874					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					ACCTTCTCCCGGGAGTGCGTG	0.443			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													271.0	232.0	245.0					14																	51206034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.5620C>A	14.37:g.51206034G>T			A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	NULL	p.P1364Q	ENST00000382041.3	37	c.4091	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	8.216	0.801420	0.16397	.	.	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.85	4.94	0.65067	.	.	.	.	.	T	0.64193	0.2576	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63143	-0.6703	4	.	.	.	-15.7456	12.6263	0.56632	0.0:0.0:0.5973:0.4027	.	.	.	.	Q	1364	.	.	P	-	2	0	NIN	50275784	0.994000	0.37717	1.000000	0.80357	0.809000	0.45718	0.542000	0.23222	1.584000	0.49913	0.655000	0.94253	CCG	NIN	-	NULL	ENSG00000100503		0.443	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	194	0.00	0	G	NM_182946		51206034	51206034	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530997	ensembl	human	putative	69_37n	missense	300	34.64	159	SNP	1.000	T
OOEP	441161	genome.wustl.edu	37	6	74079480	74079480	+	Silent	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr6:74079480C>A	ENST00000370359.5	-	1	35	c.36G>T	c.(34-36)cgG>cgT	p.R12R	OOEP-AS1_ENST00000445350.2_RNA|OOEP_ENST00000370363.1_Intron	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	12					cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)	p.R12R(1)		large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						TCTGTTTGCCCCGCTGGGACT	0.657																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											49.0	60.0	57.0					6																	74079480		2141	4265	6406	-	-	-	SO:0001819	synonymous_variant	0			BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.36G>T	6.37:g.74079480C>A			A6NIN5|A9UIB7	Silent	SNP	NULL	p.R12	ENST00000370359.5	37	c.36	CCDS47451.1	6																																																																																			OOEP	-	NULL	ENSG00000203907		0.657	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OOEP	HGNC	protein_coding	OTTHUMT00000108414.2	42	0.00	0	C	NM_001080507		74079480	74079480	-1	no_errors	ENST00000370359	ensembl	human	known	69_37n	silent	27	47.37	27	SNP	0.000	A
P2RY10	27334	genome.wustl.edu	37	X	78216327	78216327	+	Missense_Mutation	SNP	G	G	T	rs372511452		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chrX:78216327G>T	ENST00000171757.2	+	4	590	c.310G>T	c.(310-312)Gcc>Tcc	p.A104S	P2RY10_ENST00000544091.1_Missense_Mutation_p.A104S|P2RY10_ENST00000475374.1_3'UTR	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.A104S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TTTCCAGAGAGCCCTTTGCCT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	107.0	110.0					X																	78216327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.310G>T	X.37:g.78216327G>T	ENSP00000171757:p.Ala104Ser		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.A104S	ENST00000171757.2	37	c.310	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.729932	0.00687	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.73897	-0.79;-0.79	4.63	0.499	0.16914	GPCR, rhodopsin-like superfamily (1);	1.306370	0.04877	N	0.446972	T	0.57548	0.2061	N	0.26092	0.79	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.31110	-0.9955	10	0.22109	T	0.4	.	2.0273	0.03522	0.1869:0.1199:0.4697:0.2235	.	104	O00398	P2Y10_HUMAN	S	104	ENSP00000443138:A104S;ENSP00000171757:A104S	ENSP00000171757:A104S	A	+	1	0	P2RY10	78102983	0.000000	0.05858	0.093000	0.20910	0.000000	0.00434	0.173000	0.16724	0.098000	0.17522	-0.418000	0.06021	GCC	P2RY10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000078589		0.453	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	313	0.00	0	G			78216327	78216327	+1	no_errors	ENST00000171757	ensembl	human	known	69_37n	missense	576	27.69	221	SNP	0.000	T
PAN3	255967	genome.wustl.edu	37	13	28794503	28794503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr13:28794503G>T	ENST00000380958.3	+	6	1140	c.988G>T	c.(988-990)Gga>Tga	p.G330*	PAN3_ENST00000399613.1_Nonsense_Mutation_p.G130*	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TGCTACTGCTGGATTAGCGCC	0.433																																						dbGAP											0													171.0	172.0	172.0					13																	28794503		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.988G>T	13.37:g.28794503G>T	ENSP00000370345:p.Gly330*			Nonsense_Mutation	SNP	superfamily_Kinase-like_dom,smart_Znf_CCCH,pfscan_Prot_kinase_cat_dom	p.G330*	ENST00000380958.3	37	c.988	CCDS9329.2	13	.	.	.	.	.	.	.	.	.	.	G	37	6.069586	0.97256	.	.	ENSG00000152520	ENST00000380958;ENST00000399613	.	.	.	5.6	5.6	0.85130	.	0.282686	0.39083	N	0.001480	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-6.3054	19.6153	0.95632	0.0:0.0:1.0:0.0	.	.	.	.	X	330;130	.	ENSP00000370345:G330X	G	+	1	0	PAN3	27692503	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.113000	0.77095	2.630000	0.89119	0.555000	0.69702	GGA	PAN3	-	NULL	ENSG00000152520		0.433	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN3	HGNC	protein_coding	OTTHUMT00000044318.4	81	0.00	0	G	NM_175854		28794503	28794503	+1	no_errors	ENST00000380958	ensembl	human	known	69_37n	nonsense	148	34.07	77	SNP	1.000	T
PAPOLA	10914	genome.wustl.edu	37	14	96968831	96968832	+	5'UTR	INS	-	-	GG			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr14:96968831_96968832insGG	ENST00000216277.8	+	0	122_123				PAPOLA_ENST00000557320.1_5'UTR|PAPOLA_ENST00000557471.1_5'UTR|RP11-872J21.3_ENST00000569214.1_RNA|PAPOLA_ENST00000392990.2_5'Flank|PAPOLA_ENST00000554130.1_3'UTR	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		GGGCTGAGGCAGGCCCCCCCCT	0.718																																					NSCLC(19;254 734 11908 35501 39234)	dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.-98->GG	14.37:g.96968832_96968833dupGG			Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Frame_Shift_Ins	INS	NULL	p.A39fs	ENST00000216277.8	37	c.113_114	CCDS9946.1	14																																																																																			PAPOLA	-	NULL	ENSG00000090060		0.718	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLA	HGNC	protein_coding	OTTHUMT00000413411.2	65	0.00	0	-			96968831	96968832	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553357	ensembl	human	known	69_37n	frame_shift_ins	13	13.33	2	INS	0.996:0.994	GG
PIK3CA	5290	genome.wustl.edu	37	3	178952084	178952084	+	Missense_Mutation	SNP	C	C	T	rs121913281		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr3:178952084C>T	ENST00000263967.3	+	21	3296	c.3139C>T	c.(3139-3141)Cat>Tat	p.H1047Y	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047Y(37)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAATGATGCACATCATGGTGG	0.373	H1047Y(MFE280_ENDOMETRIUM)|H1047Y(TOV21G_OVARY)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	37	Substitution - Missense(37)	large_intestine(15)|endometrium(13)|breast(5)|ovary(3)|central_nervous_system(1)											100.0	89.0	92.0					3																	178952084		1912	4132	6044	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3139C>T	3.37:g.178952084C>T	ENSP00000263967:p.His1047Tyr		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047Y	ENST00000263967.3	37	c.3139	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173289	0.38413	.	.	ENSG00000121879	ENST00000263967	T	0.80480	-1.38	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.54208	0.1844	N	0.00265	-1.74	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.56908	-0.7901	10	0.36615	T	0.2	-21.2893	20.6721	0.99693	0.0:1.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	Y	1047	ENSP00000263967:H1047Y	ENSP00000263967:H1047Y	H	+	1	0	PIK3CA	180434778	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.894000	0.99253	0.591000	0.81541	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.373	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	77	0.00	0	C			178952084	178952084	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	69	81.20	298	SNP	1.000	T
PLCE1	51196	genome.wustl.edu	37	10	96058145	96058146	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr10:96058145_96058146insAC	ENST00000371380.3	+	23	5412_5413	c.5177_5178insAC	c.(5176-5181)gaaggcfs	p.G1727fs	PLCE1_ENST00000260766.3_Frame_Shift_Ins_p.G1727fs|PLCE1_ENST00000371375.1_Frame_Shift_Ins_p.G1419fs|PLCE1_ENST00000371385.3_Frame_Shift_Ins_p.G1419fs			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1727	Required for activation by RHOA, RHOB, GNA12, GNA13 and G-beta gamma. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GGTTCCTGTGAAGGCATTCGAC	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	Exception_encountered	10.37:g.96058145_96058146insAC	ENSP00000360431:p.Gly1727fs		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Frame_Shift_Ins	INS	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.G1727fs	ENST00000371380.3	37	c.5177_5178	CCDS41552.1	10																																																																																			PLCE1	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000138193		0.431	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	114	0.00	0	-	NM_016341		96058145	96058146	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	frame_shift_ins	84	13.40	13	INS	1.000:0.997	AC
POP1	10940	genome.wustl.edu	37	8	99170475	99170475	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:99170475T>G	ENST00000401707.2	+	16	3132	c.3051T>G	c.(3049-3051)ttT>ttG	p.F1017L	POP1_ENST00000349693.3_Missense_Mutation_p.F1017L	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	1017					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AGTATCGATTTGCGAGGATTG	0.507																																						dbGAP											0													114.0	106.0	109.0					8																	99170475		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.3051T>G	8.37:g.99170475T>G	ENSP00000385787:p.Phe1017Leu		A8K5W9|Q15037	Missense_Mutation	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.F1017L	ENST00000401707.2	37	c.3051	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067524	0.36470	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.13538	2.58;2.58	5.67	2.06	0.26882	.	0.053782	0.85682	N	0.000000	T	0.11452	0.0279	M	0.64997	1.995	0.44825	D	0.997836	B	0.26577	0.153	B	0.24269	0.052	T	0.14309	-1.0477	10	0.07030	T	0.85	-0.3855	8.1384	0.31069	0.0:0.2217:0.0:0.7783	.	1017	Q99575	POP1_HUMAN	L	1017	ENSP00000385787:F1017L;ENSP00000339529:F1017L	ENSP00000339529:F1017L	F	+	3	2	POP1	99239651	0.998000	0.40836	0.539000	0.28077	0.607000	0.37147	0.362000	0.20284	0.115000	0.18071	0.455000	0.32223	TTT	POP1	-	NULL	ENSG00000104356		0.507	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	151	0.00	0	T	NM_015029		99170475	99170475	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	missense	81	19.00	19	SNP	1.000	G
PPOX	5498	genome.wustl.edu	37	1	161140234	161140234	+	Silent	SNP	A	A	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:161140234A>T	ENST00000367999.4	+	10	1289	c.1023A>T	c.(1021-1023)ccA>ccT	p.P341P	PPOX_ENST00000432542.2_Silent_p.P86P|PPOX_ENST00000535223.1_Intron|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000352210.5_Silent_p.P341P|PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000544598.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	341					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CAGAAGATCCAGGAGTCCTGG	0.542																																						dbGAP											0													99.0	92.0	94.0					1																	161140234		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1023A>T	1.37:g.161140234A>T			D3DVG0|Q5VTW8	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase	p.R107W	ENST00000367999.4	37	c.319	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	A	9.252	1.041005	0.19669	.	.	ENSG00000143224	ENST00000537523;ENST00000537829	.	.	.	5.53	-3.59	0.04583	.	.	.	.	.	T	0.19446	0.0467	.	.	.	0.47183	D	0.999349	.	.	.	.	.	.	T	0.39881	-0.9592	4	.	.	.	-24.2708	0.3579	0.00359	0.3049:0.1374:0.2635:0.2943	.	.	.	.	L	94;64	.	.	Q	+	2	0	PPOX	159406858	0.000000	0.05858	0.167000	0.22817	0.873000	0.50193	-1.675000	0.01947	-0.363000	0.08101	0.528000	0.53228	CAG	PPOX	-	NULL	ENSG00000143224		0.542	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	68	0.00	0	A	NM_000309		161140234	161140234	+1	no_errors	ENST00000539753	ensembl	human	known	69_37n	missense	247	13.33	38	SNP	0.202	T
PRB2	653247	genome.wustl.edu	37	12	11546698	11546698	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr12:11546698C>T	ENST00000389362.4	-	3	349	c.314G>A	c.(313-315)gGa>gAa	p.G105E	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	105	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGACTTGTCTCCTTGTGGGGG	0.607																																						dbGAP											0													295.0	321.0	312.0					12																	11546698		2203	4300	6503	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.314G>A	12.37:g.11546698C>T	ENSP00000374013:p.Gly105Glu		O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.G105E	ENST00000389362.4	37	c.314	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	6.832	0.522690	0.13066	.	.	ENSG00000121335	ENST00000389362	T	0.08984	3.03	1.0	-0.174	0.13319	.	.	.	.	.	T	0.06416	0.0165	M	0.73430	2.235	0.09310	N	1	P	0.34977	0.478	B	0.25987	0.065	T	0.35822	-0.9773	9	0.06365	T	0.9	.	2.2991	0.04158	0.0:0.3954:0.3405:0.264	.	105	P02812	PRB2_HUMAN	E	105	ENSP00000374013:G105E	ENSP00000374013:G105E	G	-	2	0	PRB2	11437965	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	-1.529000	0.02223	0.542000	0.28846	0.000000	0.15137	GGA	PRB2	-	NULL	ENSG00000121335		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	301	0.00	0	C	NM_006248		11546698	11546698	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	1584	11.80	212	SNP	0.000	T
RUFY3	22902	genome.wustl.edu	37	4	71588300	71588300	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr4:71588300C>G	ENST00000226328.4	+	1	573	c.10C>G	c.(10-12)Ctg>Gtg	p.L4V	RUFY3_ENST00000381006.3_Missense_Mutation_p.L4V|RUFY3_ENST00000417478.2_Intron|RUFY3_ENST00000536664.1_5'Flank	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	4					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			CATGTCTGCTCTGACGCCTCC	0.498																																						dbGAP											0													154.0	130.0	138.0					4																	71588300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.10C>G	4.37:g.71588300C>G	ENSP00000226328:p.Leu4Val		B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	pfam_Run,superfamily_Prefoldin,smart_Run,pfscan_Run	p.L4V	ENST00000226328.4	37	c.10	CCDS3547.1	4	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107878	0.77096	.	.	ENSG00000018189	ENST00000381006;ENST00000226328	T;T	0.15139	2.85;2.45	5.34	4.5	0.54988	.	0.345909	0.26590	N	0.023525	T	0.28134	0.0694	N	0.22421	0.69	0.80722	D	1	D;P	0.67145	0.996;0.956	D;P	0.75484	0.986;0.899	T	0.07809	-1.0753	10	0.87932	D	0	-1.5936	14.3238	0.66505	0.0:0.9282:0.0:0.0718	.	4;4	Q7L099-3;Q7L099	.;RUFY3_HUMAN	V	4	ENSP00000370394:L4V;ENSP00000226328:L4V	ENSP00000226328:L4V	L	+	1	2	RUFY3	71807164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.722000	0.54948	1.386000	0.46466	0.650000	0.86243	CTG	RUFY3	-	NULL	ENSG00000018189		0.498	RUFY3-001	KNOWN	basic|CCDS	protein_coding	RUFY3	HGNC	protein_coding	OTTHUMT00000252161.2	248	0.00	0	C	NM_014961		71588300	71588300	+1	no_errors	ENST00000226328	ensembl	human	known	69_37n	missense	483	14.18	80	SNP	1.000	G
SCG5	6447	genome.wustl.edu	37	15	32988745	32988745	+	Silent	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:32988745C>T	ENST00000300175.4	+	6	684	c.574C>T	c.(574-576)Ctg>Ttg	p.L192L	SCG5_ENST00000494364.1_Silent_p.L173L|SCG5_ENST00000498069.1_3'UTR|SCG5_ENST00000497208.1_Silent_p.L174L|SCG5_ENST00000413748.2_Silent_p.L191L	NM_001144757.1	NP_001138229.1	P05408	7B2_HUMAN	secretogranin V (7B2 protein)	192					intracellular protein transport (GO:0006886)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|regulation of hormone secretion (GO:0046883)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	enzyme inhibitor activity (GO:0004857)|GTP binding (GO:0005525)|unfolded protein binding (GO:0051082)			lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	6		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		AGGACAGAGACTGGATAATGT	0.388																																						dbGAP											0													90.0	84.0	86.0					15																	32988745		1897	4122	6019	-	-	-	SO:0001819	synonymous_variant	0			Y00757	CCDS45207.1, CCDS45208.1	15q13-q14	2006-03-20	2006-03-20	2006-03-20	ENSG00000166922	ENSG00000166922			10816	protein-coding gene	gene with protein product	"""prohormone convertase chaperone"""	173120	"""secretory granule, neuroendocrine protein 1 (7B2 protein)"""	SGNE1		8162254, 12646671	Standard	NM_003020		Approved	7B2, SgV	uc001zha.2	P05408	OTTHUMG00000159447	ENST00000300175.4:c.574C>T	15.37:g.32988745C>T			P01164|Q6FHD0|Q9BS38	Silent	SNP	pfam_Secretogranin_V	p.L192	ENST00000300175.4	37	c.574	CCDS45207.1	15																																																																																			SCG5	-	pfam_Secretogranin_V	ENSG00000166922		0.388	SCG5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCG5	HGNC	protein_coding	OTTHUMT00000355438.1	100	0.00	0	C	NM_003020		32988745	32988745	+1	no_errors	ENST00000300175	ensembl	human	known	69_37n	silent	89	37.32	53	SNP	1.000	T
SFXN5	94097	genome.wustl.edu	37	2	73172038	73172038	+	3'UTR	SNP	C	C	A	rs189263463	byFrequency	TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:73172038C>A	ENST00000272433.2	-	0	1266				SFXN5_ENST00000474528.1_5'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CCCAGGGGGCCCAGGACTGCT	0.582																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.*113G>T	2.37:g.73172038C>A			A8K116|Q494Y3|Q53T29	RNA	SNP	-	NULL	ENST00000272433.2	37	NULL	CCDS1922.1	2																																																																																			SFXN5	-	-	ENSG00000144040		0.582	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	35	0.00	0	C	NM_144579		73172038	73172038	-1	no_errors	ENST00000461352	ensembl	human	known	69_37n	rna	23	43.90	18	SNP	0.003	A
SLC17A7	57030	genome.wustl.edu	37	19	49935871	49935871	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:49935871G>A	ENST00000221485.3	-	9	1226	c.1055C>T	c.(1054-1056)aCc>aTc	p.T352I	SLC17A7_ENST00000543531.1_Missense_Mutation_p.T340I|SLC17A7_ENST00000600601.1_Missense_Mutation_p.T285I	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	352					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CACGATGATGGTCATGACCAG	0.667																																						dbGAP											0													32.0	32.0	32.0					19																	49935871		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1055C>T	19.37:g.49935871G>A	ENSP00000221485:p.Thr352Ile		B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T352I	ENST00000221485.3	37	c.1055	CCDS12764.1	19	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544419	0.86022	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.55588	0.51;0.51	3.87	3.87	0.44632	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.53938	D	0.000055	T	0.61677	0.2366	L	0.43152	1.355	0.80722	D	1	D;P	0.53151	0.958;0.956	P;D	0.63283	0.908;0.913	T	0.64537	-0.6384	10	0.59425	D	0.04	.	13.7066	0.62644	0.0:0.0:1.0:0.0	.	352;194	Q9P2U7;A8K0Q7	VGLU1_HUMAN;.	I	352;340	ENSP00000221485:T352I;ENSP00000441767:T340I	ENSP00000221485:T352I	T	-	2	0	SLC17A7	54627683	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	9.444000	0.97578	2.187000	0.69744	0.491000	0.48974	ACC	SLC17A7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000104888		0.667	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A7	HGNC	protein_coding	OTTHUMT00000465367.2	72	0.00	0	G			49935871	49935871	-1	no_errors	ENST00000221485	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	A
SLC30A1	7779	genome.wustl.edu	37	1	211749391	211749391	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:211749391G>C	ENST00000367001.4	-	2	992	c.863C>G	c.(862-864)cCt>cGt	p.P288R		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	288					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		GCAGGGGTCAGGGAAACATGG	0.393																																						dbGAP											0													105.0	109.0	108.0					1																	211749391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.863C>G	1.37:g.211749391G>C	ENSP00000355968:p.Pro288Arg		Q0VAK9|Q9BZF6	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.P288R	ENST00000367001.4	37	c.863	CCDS1499.1	1	.	.	.	.	.	.	.	.	.	.	G	4.663	0.123195	0.08931	.	.	ENSG00000170385	ENST00000367001	T	0.62364	0.03	5.29	1.85	0.25348	.	0.653744	0.16374	N	0.217220	T	0.44767	0.1309	N	0.25647	0.755	0.09310	N	0.99999	B	0.32010	0.351	B	0.39617	0.305	T	0.23976	-1.0173	10	0.17832	T	0.49	-0.5891	3.3408	0.07118	0.0966:0.1109:0.449:0.3435	.	288	Q9Y6M5	ZNT1_HUMAN	R	288	ENSP00000355968:P288R	ENSP00000355968:P288R	P	-	2	0	SLC30A1	209816014	0.880000	0.30214	0.818000	0.32626	0.943000	0.58893	1.385000	0.34408	1.144000	0.42321	0.563000	0.77884	CCT	SLC30A1	-	pfam_Cation_efflux	ENSG00000170385		0.393	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	HGNC	protein_coding	OTTHUMT00000104738.2	31	0.00	0	G			211749391	211749391	-1	no_errors	ENST00000367001	ensembl	human	known	69_37n	missense	62	41.12	44	SNP	0.242	C
SLC6A3	6531	genome.wustl.edu	37	5	1441547	1441547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr5:1441547G>T	ENST00000270349.9	-	3	472	c.345C>A	c.(343-345)taC>taA	p.Y115*	SLC6A3_ENST00000453492.2_Nonsense_Mutation_p.Y115*	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	115					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CCAGCTCCATGTAGAAAAGTG	0.577																																						dbGAP											0													56.0	50.0	52.0					5																	1441547		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.345C>A	5.37:g.1441547G>T	ENSP00000270349:p.Tyr115*		A2RUN4|Q14996	Nonsense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.Y115*	ENST00000270349.9	37	c.345	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	G	38	6.653149	0.97734	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	.	.	.	3.64	2.75	0.32379	.	0.138608	0.49916	D	0.000121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.681	0.34209	0.1189:0.0:0.8811:0.0	.	.	.	.	X	115;115;41	.	ENSP00000270349:Y115X	Y	-	3	2	SLC6A3	1494547	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.267000	0.43329	0.632000	0.30432	0.561000	0.74099	TAC	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000142319		0.577	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	72	0.00	0	G	NM_001044		1441547	1441547	-1	no_errors	ENST00000270349	ensembl	human	known	69_37n	nonsense	68	32.00	32	SNP	1.000	T
SPATA5L1	79029	genome.wustl.edu	37	15	45706785	45706785	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:45706785T>G	ENST00000305560.6	+	4	1550	c.1451T>G	c.(1450-1452)cTg>cGg	p.L484R	SPATA5L1_ENST00000559860.1_Missense_Mutation_p.L484R	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	484						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GAGTGGCCTCTGAAATTCCCT	0.408																																						dbGAP											0													58.0	58.0	58.0					15																	45706785		2198	4298	6496	-	-	-	SO:0001583	missense	0			AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.1451T>G	15.37:g.45706785T>G	ENSP00000305494:p.Leu484Arg		C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.L484R	ENST00000305560.6	37	c.1451	CCDS10123.1	15	.	.	.	.	.	.	.	.	.	.	T	20.5	3.999832	0.74818	.	.	ENSG00000171763	ENST00000305560	D	0.95518	-3.73	5.33	5.33	0.75918	.	0.059438	0.64402	D	0.000005	D	0.97841	0.9291	M	0.92738	3.34	0.37386	D	0.912259	D	0.58620	0.983	P	0.59948	0.866	D	0.99956	1.1634	10	0.87932	D	0	-17.293	14.4156	0.67148	0.0:0.0:0.0:1.0	.	484	Q9BVQ7	SPA5L_HUMAN	R	484	ENSP00000305494:L484R	ENSP00000305494:L484R	L	+	2	0	SPATA5L1	43494077	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.439000	0.80444	2.132000	0.65825	0.482000	0.46254	CTG	SPATA5L1	-	NULL	ENSG00000171763		0.408	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA5L1	HGNC	protein_coding	OTTHUMT00000254218.1	117	0.00	0	T	NM_024063		45706785	45706785	+1	no_errors	ENST00000305560	ensembl	human	known	69_37n	missense	84	30.58	37	SNP	1.000	G
SYBU	55638	genome.wustl.edu	37	8	110592199	110592199	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr8:110592199G>C	ENST00000422135.1	-	6	1078	c.563C>G	c.(562-564)tCg>tGg	p.S188W	SYBU_ENST00000399066.3_Missense_Mutation_p.S185W|SYBU_ENST00000533171.1_Missense_Mutation_p.S188W|SYBU_ENST00000529175.1_5'UTR|SYBU_ENST00000528647.1_Missense_Mutation_p.S187W|SYBU_ENST00000533895.1_Missense_Mutation_p.S187W|SYBU_ENST00000532779.1_Missense_Mutation_p.S120W|SYBU_ENST00000408908.2_Missense_Mutation_p.S188W|SYBU_ENST00000527707.1_5'UTR|SYBU_ENST00000528331.1_Missense_Mutation_p.S69W|SYBU_ENST00000433638.1_Missense_Mutation_p.S188W|SYBU_ENST00000276646.9_Missense_Mutation_p.S188W|SYBU_ENST00000440310.1_Missense_Mutation_p.S188W|SYBU_ENST00000533065.1_Missense_Mutation_p.S69W|SYBU_ENST00000446070.2_Missense_Mutation_p.S187W|SYBU_ENST00000424158.2_Missense_Mutation_p.S193W|SYBU_ENST00000408889.3_Missense_Mutation_p.S69W|SYBU_ENST00000529690.1_Missense_Mutation_p.S58W|SYBU_ENST00000419099.1_Missense_Mutation_p.S187W	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	188	Ser-rich.|Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CTTGTGTGACGAAGCTCCATT	0.512																																						dbGAP											0													149.0	138.0	142.0					8																	110592199		1990	4171	6161	-	-	-	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.563C>G	8.37:g.110592199G>C	ENSP00000407118:p.Ser188Trp		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.S188W	ENST00000422135.1	37	c.563	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878939	0.51801	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171;ENST00000533394;ENST00000528045;ENST00000529190;ENST00000528569;ENST00000532189	.	.	.	5.82	5.82	0.92795	.	0.378782	0.30093	N	0.010421	T	0.77631	0.4159	M	0.70275	2.135	0.41880	D	0.990311	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.999;0.999	D;D;D;D;D	0.78314	0.991;0.911;0.932;0.985;0.991	T	0.79080	-0.1950	9	0.66056	D	0.02	-3.3673	14.2833	0.66228	0.0729:0.0:0.9271:0.0	.	58;120;187;188;185	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	W	187;193;120;185;187;69;188;187;188;187;188;188;188;69;69;58;188;25;69;187;69;69	.	ENSP00000276646:S188W	S	-	2	0	SYBU	110661375	0.555000	0.26530	0.022000	0.16811	0.480000	0.33159	3.142000	0.50601	2.756000	0.94617	0.561000	0.74099	TCG	SYBU	-	NULL	ENSG00000147642		0.512	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	155	0.00	0	G	NM_017786		110592199	110592199	-1	no_errors	ENST00000276646	ensembl	human	known	69_37n	missense	185	31.73	86	SNP	0.453	C
TACR1	6869	genome.wustl.edu	37	2	75280768	75280768	+	Silent	SNP	A	A	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:75280768A>G	ENST00000305249.5	-	3	1464	c.699T>C	c.(697-699)tcT>tcC	p.S233S	TACR1_ENST00000409848.3_Silent_p.S233S	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	233					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	GGTAGCGGTCAGAGGAGTCCC	0.577											OREG0014726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(64;62 1268 3653 14826 43765)	dbGAP											0													107.0	87.0	93.0					2																	75280768		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.699T>C	2.37:g.75280768A>G		1159	A8K150	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_NK1_rcpt,prints_Neurokn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK3_rcpt	p.S233	ENST00000305249.5	37	c.699	CCDS1958.1	2																																																																																			TACR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_NK3_rcpt	ENSG00000115353		0.577	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR1	HGNC	protein_coding	OTTHUMT00000252239.3	197	0.51	1	A	NM_001058		75280768	75280768	-1	no_errors	ENST00000305249	ensembl	human	known	69_37n	silent	154	38.40	96	SNP	0.215	G
TGM4	7047	genome.wustl.edu	37	3	44943399	44943399	+	Missense_Mutation	SNP	C	C	T	rs142655195	byFrequency	TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr3:44943399C>T	ENST00000296125.4	+	8	1015	c.947C>T	c.(946-948)aCc>aTc	p.T316I	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	316					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GAGAAAATCACCAGTATGACC	0.498																																						dbGAP											0													130.0	127.0	128.0					3																	44943399		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.947C>T	3.37:g.44943399C>T	ENSP00000296125:p.Thr316Ile		Q16707|Q96QN4	Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.T316I	ENST00000296125.4	37	c.947	CCDS2723.1	3	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432315	0.25813	.	.	ENSG00000163810	ENST00000296125	T	0.80393	-1.37	2.55	0.281	0.15687	Transglutaminase-like (2);	0.918490	0.08708	U	0.905433	T	0.67534	0.2903	N	0.11154	0.105	0.09310	N	1	P	0.41524	0.753	P	0.48063	0.565	T	0.58645	-0.7600	10	0.41790	T	0.15	.	3.8543	0.08968	0.4929:0.3554:0.0:0.1516	.	316	P49221	TGM4_HUMAN	I	316	ENSP00000296125:T316I	ENSP00000296125:T316I	T	+	2	0	TGM4	44918403	0.017000	0.18338	0.000000	0.03702	0.003000	0.03518	1.755000	0.38379	0.342000	0.23796	0.563000	0.77884	ACC	TGM4	-	pfam_Transglutaminase-like,smart_Transglutaminase-like	ENSG00000163810		0.498	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	HGNC	protein_coding	OTTHUMT00000256755.2	109	0.00	0	C	NM_003241		44943399	44943399	+1	no_errors	ENST00000296125	ensembl	human	known	69_37n	missense	32	60.98	50	SNP	0.000	T
THBS3	7059	genome.wustl.edu	37	1	155175935	155175935	+	Intron	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:155175935G>T	ENST00000368378.3	-	2	307				RP11-263K19.4_ENST00000422665.1_RNA|MTX1_ENST00000368376.3_5'Flank|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541990.1_Intron|MTX1_ENST00000316721.4_5'Flank|THBS3_ENST00000457183.2_Intron|THBS3_ENST00000486260.1_Intron|RP11-263K19.4_ENST00000430312.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AAGTAGGGATGAGGGAGAGTG	0.547																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.286+55C>A	1.37:g.155175935G>T			B1AVR8|B4DQ20|Q8WV34	RNA	SNP	-	NULL	ENST00000368378.3	37	NULL	CCDS1099.1	1																																																																																			THBS3	-	-	ENSG00000169231		0.547	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS3	HGNC	protein_coding	OTTHUMT00000086856.1	45	0.00	0	G	NM_007112		155175935	155175935	-1	no_errors	ENST00000487250	ensembl	human	known	69_37n	rna	64	12.33	9	SNP	0.000	T
TMEM160	54958	genome.wustl.edu	37	19	47549915	47549915	+	Silent	SNP	G	G	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:47549915G>A	ENST00000253047.6	-	2	252	c.237C>T	c.(235-237)ctC>ctT	p.L79L		NM_017854.1	NP_060324.1	Q9NX00	TM160_HUMAN	transmembrane protein 160	79						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				lung(1)	1		all_cancers(25;8.13e-05)|all_lung(116;0.000901)|all_epithelial(76;0.00185)|Lung NSC(112;0.00215)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;5.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;6.95e-05)|Epithelial(262;0.00363)|GBM - Glioblastoma multiforme(486;0.0242)		CCGATGCCAGGAGGCCATTGC	0.612																																						dbGAP											0													100.0	90.0	94.0					19																	47549915		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000519	CCDS12695.1	19q13.32	2008-02-05				ENSG00000130748			26042	protein-coding gene	gene with protein product						12477932	Standard	XM_005259027		Approved	FLJ20512	uc002pfz.3	Q9NX00		ENST00000253047.6:c.237C>T	19.37:g.47549915G>A			Q9BU41	Silent	SNP	NULL	p.L79	ENST00000253047.6	37	c.237	CCDS12695.1	19																																																																																			TMEM160	-	NULL	ENSG00000130748		0.612	TMEM160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM160	HGNC	protein_coding	OTTHUMT00000466666.1	40	0.00	0	G	NM_017854		47549915	47549915	-1	no_errors	ENST00000253047	ensembl	human	known	69_37n	silent	30	53.85	35	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	262	0.00	0	C	NM_000546		7577120	7577120	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	112	62.29	185	SNP	0.864	T
TP53	7157	genome.wustl.edu	37	17	7578226	7578226	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr17:7578226T>C	ENST00000269305.4	-	6	812	c.623A>G	c.(622-624)gAc>gGc	p.D208G	TP53_ENST00000413465.2_Missense_Mutation_p.D208G|TP53_ENST00000420246.2_Missense_Mutation_p.D208G|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.D208G|TP53_ENST00000445888.2_Missense_Mutation_p.D208G|TP53_ENST00000359597.4_Missense_Mutation_p.D208G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	208	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in a sporadic cancer; somatic mutation).|D -> I (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in a sporadic cancer; somatic mutation).|DD -> EY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D208V(14)|p.0?(8)|p.?(5)|p.D208G(3)|p.D207fs*6(2)|p.D208fs*1(1)|p.D207_R213delDDRNTFR(1)|p.D208fs*39(1)|p.D208fs*38(1)|p.D207_V216del10(1)|p.D208I(1)|p.E204_N210delEYLDDRN(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTGTTTCTGTCATCCAAATA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	40	Substitution - Missense(18)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Deletion - In frame(4)	lung(6)|biliary_tract(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|ovary(3)|stomach(2)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|thyroid(1)|soft_tissue(1)|skin(1)|eye(1)											145.0	128.0	134.0					17																	7578226		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.623A>G	17.37:g.7578226T>C	ENSP00000269305:p.Asp208Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D208G	ENST00000269305.4	37	c.623	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	29.7	5.026039	0.93518	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99871	-7.35;-7.35;-7.35;-7.35;-7.35;-7.35;-7.35;-7.35	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99829	0.9923	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.998;0.996;0.997	D;D;D;D;D;D;D	0.97110	1.0;0.991;0.993;0.998;0.99;0.991;0.986	D	0.96501	0.9371	10	0.87932	D	0	-22.6982	13.709	0.62656	0.0:0.0:0.0:1.0	.	169;208;208;115;208;208;208	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	208;208;208;208;208;208;197;115;76;115;76	ENSP00000410739:D208G;ENSP00000352610:D208G;ENSP00000269305:D208G;ENSP00000398846:D208G;ENSP00000391127:D208G;ENSP00000391478:D208G;ENSP00000425104:D76G;ENSP00000423862:D115G	ENSP00000269305:D208G	D	-	2	0	TP53	7518951	1.000000	0.71417	0.326000	0.25389	0.403000	0.30841	7.996000	0.88334	2.183000	0.69458	0.533000	0.62120	GAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	414	0.00	0	T	NM_000546		7578226	7578226	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	209	61.86	339	SNP	0.996	C
TP53BP1	7158	genome.wustl.edu	37	15	43701229	43701229	+	Silent	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr15:43701229C>A	ENST00000263801.3	-	26	5703	c.5451G>T	c.(5449-5451)ctG>ctT	p.L1817L	TP53BP1_ENST00000382044.4_Silent_p.L1822L|TP53BP1_ENST00000450115.2_Silent_p.L1820L|TP53BP1_ENST00000382039.3_Silent_p.L1772L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1817	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGGCAAGGCACAGGAAGTACT	0.493								Other conserved DNA damage response genes																														dbGAP											0													165.0	127.0	139.0					15																	43701229		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5451G>T	15.37:g.43701229C>A			F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	superfamily_BRCT_dom	p.C142F	ENST00000263801.3	37	c.425	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	C	8.987	0.976704	0.18812	.	.	ENSG00000067369	ENST00000434595	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	T	0.75317	0.3833	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73430	-0.3985	4	.	.	.	-6.013	19.425	0.94737	0.0:1.0:0.0:0.0	.	.	.	.	F	142	.	.	C	-	2	0	TP53BP1	41488521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.208000	0.77907	2.664000	0.90586	0.655000	0.94253	TGT	TP53BP1	-	superfamily_BRCT_dom	ENSG00000067369		0.493	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	316	0.00	0	C			43701229	43701229	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434595	ensembl	human	novel	69_37n	missense	112	66.57	223	SNP	1.000	A
UBN2	254048	genome.wustl.edu	37	7	138954156	138954156	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:138954156C>A	ENST00000473989.3	+	8	1483	c.1483C>A	c.(1483-1485)Caa>Aaa	p.Q495K	UBN2_ENST00000288561.8_Missense_Mutation_p.Q412K	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	495						extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GTTACAGCTACAAGAACTAGG	0.398																																						dbGAP											0													139.0	124.0	128.0					7																	138954156		1884	4129	6013	-	-	-	SO:0001583	missense	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1483C>A	7.37:g.138954156C>A	ENSP00000418648:p.Gln495Lys		A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Nonsense_Mutation	SNP	NULL	p.Y263*	ENST00000473989.3	37	c.789	CCDS43655.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.103901|4.103901	0.76983|0.76983	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000473989;ENST00000288561|ENST00000483726	T;T|.	0.39406|.	1.08;1.08|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.72195|.	0.3430|.	L|L	0.53249|0.53249	1.67|1.67	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.42941|.	0.794|.	P|.	0.48952|.	0.596|.	T|.	0.67581|.	-0.5634|.	10|.	0.23891|.	T|.	0.37|.	-9.0108|-9.0108	19.9357|19.9357	0.97140|0.97140	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	495|.	Q6ZU65|.	UBN2_HUMAN|.	K|X	495;412|263	ENSP00000418648:Q495K;ENSP00000288561:Q412K|.	ENSP00000288561:Q412K|.	Q|Y	+|+	1|3	0|2	UBN2|UBN2	138604696|138604696	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.999000|0.999000	0.98932|0.98932	5.895000|5.895000	0.69814|0.69814	2.715000|2.715000	0.92844|0.92844	0.655000|0.655000	0.94253|0.94253	CAA|TAC	UBN2	-	NULL	ENSG00000157741		0.398	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	101	0.00	0	C	NM_173569		138954156	138954156	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000483726	ensembl	human	putative	69_37n	nonsense	173	19.91	43	SNP	1.000	A
UGT1A3	54659	genome.wustl.edu	37	2	234638355	234638355	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:234638355C>T	ENST00000482026.1	+	1	602	c.583C>T	c.(583-585)Cct>Tct	p.P195S	UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.P195S|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A9_ENST00000354728.4_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	195					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	CTCCTATATTCCTAGATTACT	0.428																																						dbGAP											0													196.0	192.0	193.0					2																	234638355		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.583C>T	2.37:g.234638355C>T	ENSP00000418532:p.Pro195Ser		B8K287	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.P195S	ENST00000482026.1	37	c.583	CCDS2509.1	2	.	.	.	.	.	.	.	.	.	.	c	13.32	2.203350	0.38905	.	.	ENSG00000243135	ENST00000482026	T	0.62941	-0.01	4.35	3.45	0.39498	.	.	.	.	.	D	0.86100	0.5852	H	0.98276	4.19	0.48632	D	0.999683	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89625	0.3851	9	0.87932	D	0	.	12.5659	0.56310	0.0:0.9157:0.0:0.0842	.	195;195	Q5DT01;P35503	.;UD13_HUMAN	S	195	ENSP00000418532:P195S	ENSP00000418532:P195S	P	+	1	0	UGT1A3	234303094	0.993000	0.37304	0.028000	0.17463	0.006000	0.05464	3.331000	0.52075	0.765000	0.33221	0.585000	0.79938	CCT	UGT1A3	-	pfam_UDP_glucos_trans	ENSG00000243135		0.428	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A3	HGNC	protein_coding	OTTHUMT00000130983.1	270	0.00	0	C	NM_019093		234638355	234638355	+1	no_errors	ENST00000482026	ensembl	human	known	69_37n	missense	355	27.49	135	SNP	1.000	T
UHRF2	115426	genome.wustl.edu	37	9	6421074	6421074	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr9:6421074G>C	ENST00000276893.5	+	2	484	c.316G>C	c.(316-318)Gga>Cga	p.G106R	UHRF2_ENST00000381373.3_Missense_Mutation_p.G106R|RP11-307L3.4_ENST00000411561.1_RNA	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	106					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TCCGAGGGTAGGACCTTCCAA	0.448																																						dbGAP											0													123.0	107.0	112.0					9																	6421074		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.316G>C	9.37:g.6421074G>C	ENSP00000276893:p.Gly106Arg		Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	pfam_SRA_YDG,pfam_DUF3590,pfam_Ubiquitin,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Ubiquitin,smart_Znf_PHD,smart_Znf_RING,smart_SRA_YDG,pfscan_SRA_YDG,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Ubiquitin_supergroup	p.G106R	ENST00000276893.5	37	c.316	CCDS6469.1	9	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974312	0.53720	.	.	ENSG00000147854	ENST00000276893;ENST00000381373	T;T	0.21932	1.98;2.77	5.44	5.44	0.79542	.	0.505809	0.22144	N	0.064002	T	0.28732	0.0712	M	0.65975	2.015	0.38859	D	0.956446	B	0.18166	0.026	B	0.20767	0.031	T	0.08310	-1.0728	10	0.59425	D	0.04	-10.6477	17.4303	0.87537	0.0:0.0:1.0:0.0	.	106	Q96PU4	UHRF2_HUMAN	R	106	ENSP00000276893:G106R;ENSP00000370778:G106R	ENSP00000276893:G106R	G	+	1	0	UHRF2	6411074	1.000000	0.71417	0.770000	0.31555	0.927000	0.56198	3.260000	0.51523	2.540000	0.85666	0.467000	0.42956	GGA	UHRF2	-	NULL	ENSG00000147854		0.448	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF2	HGNC	protein_coding	OTTHUMT00000051665.3	174	0.00	0	G	NM_152306		6421074	6421074	+1	no_errors	ENST00000276893	ensembl	human	known	69_37n	missense	622	11.38	80	SNP	0.994	C
VCX3B	425054	genome.wustl.edu	37	X	8433540	8433540	+	Missense_Mutation	SNP	G	G	A	rs199909395		TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chrX:8433540G>A	ENST00000381032.1	+	2	356	c.49G>A	c.(49-51)Gca>Aca	p.A17T	VCX3B_ENST00000453306.1_Missense_Mutation_p.A17T|VCX3B_ENST00000381029.4_Missense_Mutation_p.A17T|VCX3B_ENST00000444481.1_Missense_Mutation_p.A17T|VCX3B_ENST00000440654.2_Missense_Mutation_p.A17T	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	17						nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						GGCCAAGGAGGCAGGAAAGAG	0.627																																						dbGAP											0													87.0	51.0	64.0					X																	8433540		1380	2334	3714	-	-	-	SO:0001583	missense	0				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.49G>A	X.37:g.8433540G>A	ENSP00000370420:p.Ala17Thr		C9JS46|Q4KN12	Missense_Mutation	SNP	NULL	p.A17T	ENST00000381032.1	37	c.49	CCDS48077.2	X	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.509156	0.00153	.	.	ENSG00000205642	ENST00000381032;ENST00000453306;ENST00000444481;ENST00000440654;ENST00000381029	T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65	0.421	-0.841	0.10752	.	.	.	.	.	T	0.02688	0.0081	N	0.01352	-0.895	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.01281	0.0;0.0	T	0.31752	-0.9932	8	0.02654	T	1	.	.	.	.	.	17;17	Q9H321;E7ERZ8	VCX3B_HUMAN;.	T	17	ENSP00000370420:A17T;ENSP00000411785:A17T;ENSP00000414780:A17T;ENSP00000410372:A17T;ENSP00000370417:A17T	ENSP00000370417:A17T	A	+	1	0	VCX3B	8393540	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.887000	0.01617	-1.618000	0.01568	-1.647000	0.00761	GCA	VCX3B	-	NULL	ENSG00000205642		0.627	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	VCX3B	HGNC	protein_coding	OTTHUMT00000055691.1	264	0.75	2	G			8433540	8433540	+1	no_errors	ENST00000444481	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.000	A
WIPF1	7456	genome.wustl.edu	37	2	175432743	175432743	+	Silent	SNP	A	A	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr2:175432743A>G	ENST00000392547.2	-	6	1287	c.1188T>C	c.(1186-1188)ccT>ccC	p.P396P	WIPF1_ENST00000272746.5_Silent_p.P396P|WIPF1_ENST00000392546.2_Silent_p.P396P|WIPF1_ENST00000467149.1_5'UTR|WIPF1_ENST00000409891.1_Silent_p.P396P|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000359761.3_Silent_p.P396P|AC018890.6_ENST00000412835.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	396	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GAGGGGTAGCAGGCAGGGCCC	0.607																																						dbGAP											0													52.0	48.0	49.0					2																	175432743		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1188T>C	2.37:g.175432743A>G			B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Silent	SNP	smart_WH2_dom,pfscan_WH2_dom	p.P396	ENST00000392547.2	37	c.1188	CCDS2260.1	2																																																																																			WIPF1	-	NULL	ENSG00000115935		0.607	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	HGNC	protein_coding	OTTHUMT00000255453.1	106	0.93	1	A	NM_003387		175432743	175432743	-1	no_errors	ENST00000272746	ensembl	human	known	69_37n	silent	101	33.11	50	SNP	0.873	G
WNT1	7471	genome.wustl.edu	37	12	49374313	49374313	+	Silent	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr12:49374313C>T	ENST00000293549.3	+	3	501	c.465C>T	c.(463-465)taC>taT	p.Y155Y		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	155					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		CGTGTGACTAccggcggcgcg	0.672																																						dbGAP											0													21.0	22.0	22.0					12																	49374313		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.465C>T	12.37:g.49374313C>T			Q5U0N2	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt1	p.Y155	ENST00000293549.3	37	c.465	CCDS8776.1	12																																																																																			WNT1	-	pfam_Wnt,smart_Wnt	ENSG00000125084		0.672	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT1	HGNC	protein_coding	OTTHUMT00000408937.1	26	0.00	0	C			49374313	49374313	+1	no_errors	ENST00000293549	ensembl	human	known	69_37n	silent	10	58.33	14	SNP	0.996	T
ZKSCAN1	7586	genome.wustl.edu	37	7	99621358	99621358	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr7:99621358C>G	ENST00000324306.6	+	2	463	c.229C>G	c.(229-231)Ctg>Gtg	p.L77V	ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.L41V|ZKSCAN1_ENST00000535170.1_Intron	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	77	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TCTCAGTCGGCTGAAGGAACT	0.542																																						dbGAP											0													64.0	71.0	69.0					7																	99621358		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.229C>G	7.37:g.99621358C>G	ENSP00000323148:p.Leu77Val		A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L77V	ENST00000324306.6	37	c.229	CCDS34698.1	7	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086385	0.76642	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000432317	T;T;T	0.14640	2.49;2.49;2.49	4.63	4.63	0.57726	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.41194	D	0.000926	T	0.55673	0.1935	H	0.98883	4.36	0.80722	D	1	D;D	0.63046	0.98;0.992	P;D	0.76071	0.744;0.987	T	0.74948	-0.3490	10	0.87932	D	0	.	15.021	0.71630	0.0:1.0:0.0:0.0	.	77;41	P17029;E9PC66	ZKSC1_HUMAN;.	V	77;41;77	ENSP00000323148:L77V;ENSP00000409172:L41V;ENSP00000394445:L77V	ENSP00000323148:L77V	L	+	1	2	ZKSCAN1	99459294	0.939000	0.31865	1.000000	0.80357	0.948000	0.59901	1.913000	0.39956	2.398000	0.81561	0.484000	0.47621	CTG	ZKSCAN1	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000106261		0.542	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN1	HGNC	protein_coding	OTTHUMT00000344550.2	231	0.00	0	C	NM_003439		99621358	99621358	+1	no_errors	ENST00000324306	ensembl	human	known	69_37n	missense	82	40.15	55	SNP	0.992	G
ZNF20	7568	genome.wustl.edu	37	19	12246615	12246615	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:12246615C>T	ENST00000334213.5	-	2	332	c.108G>A	c.(106-108)atG>atA	p.M36I	ZNF20_ENST00000600335.1_Missense_Mutation_p.M33I|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'UTR	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	36	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						AGGTTTCCTGCATCACATCCC	0.458																																						dbGAP											0													114.0	114.0	114.0					19																	12246615		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.108G>A	19.37:g.12246615C>T	ENSP00000335437:p.Met36Ile		Q8N457|Q9UG41	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M36I	ENST00000334213.5	37	c.108	CCDS45986.1	19	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361408	0.24684	.	.	ENSG00000132010	ENST00000334213;ENST00000292241;ENST00000418866	T;T	0.03035	4.07;4.07	0.94	0.94	0.19513	Krueppel-associated box (4);	.	.	.	.	T	0.17492	0.0420	M	0.90019	3.08	0.20489	N	0.999899	D	0.60575	0.988	D	0.74348	0.983	T	0.03608	-1.1020	9	0.72032	D	0.01	.	5.2006	0.15262	0.0:1.0:0.0:0.0	.	36	P17024	ZNF20_HUMAN	I	36;36;33	ENSP00000335437:M36I;ENSP00000390115:M33I	ENSP00000292241:M36I	M	-	3	0	ZNF20	12107615	0.988000	0.35896	0.207000	0.23584	0.314000	0.28054	3.021000	0.49651	0.783000	0.33636	0.313000	0.20887	ATG	ZNF20	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000132010		0.458	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF20	HGNC	protein_coding	OTTHUMT00000344101.1	110	0.00	0	C	NM_021143		12246615	12246615	-1	no_errors	ENST00000334213	ensembl	human	known	69_37n	missense	160	51.07	167	SNP	0.411	T
ZNF230	7773	genome.wustl.edu	37	19	44514454	44514454	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr19:44514454A>G	ENST00000429154.2	+	5	491	c.263A>G	c.(262-264)gAa>gGa	p.E88G		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	88	KRNB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				GGACCACATGAAGACTGCCCT	0.423																																					GBM(175;914 2069 22996 47111 52600)	dbGAP											0													78.0	71.0	73.0					19																	44514454		2203	4300	6503	-	-	-	SO:0001583	missense	0			U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.263A>G	19.37:g.44514454A>G	ENSP00000409318:p.Glu88Gly		O15322|Q504X7|Q86W84|Q9P1U6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E88G	ENST00000429154.2	37	c.263	CCDS33044.1	19	.	.	.	.	.	.	.	.	.	.	A	15.14	2.745028	0.49151	.	.	ENSG00000159882	ENST00000429154	T	0.05580	3.42	2.54	2.54	0.30619	.	.	.	.	.	T	0.07908	0.0198	N	0.20986	0.625	0.09310	N	0.999999	D	0.56287	0.975	P	0.51742	0.678	T	0.31475	-0.9942	9	0.49607	T	0.09	.	8.5345	0.33355	1.0:0.0:0.0:0.0	.	88	Q9UIE0	ZN230_HUMAN	G	88	ENSP00000409318:E88G	ENSP00000409318:E88G	E	+	2	0	ZNF230	49206294	0.001000	0.12720	0.002000	0.10522	0.465000	0.32709	1.158000	0.31737	1.145000	0.42336	0.164000	0.16699	GAA	ZNF230	-	NULL	ENSG00000159882		0.423	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF230	HGNC	protein_coding	OTTHUMT00000460456.1	105	0.00	0	A			44514454	44514454	+1	no_errors	ENST00000429154	ensembl	human	known	69_37n	missense	104	17.46	22	SNP	0.001	G
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29984337	29984338	+	RNA	INS	-	-	G			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr6:29984337_29984338insG	ENST00000376797.3	-	0	625				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CCATGTTCTTTGGTGTCACTTC	0.431																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29984339_29984339dupG				RNA	INS	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.431	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253083.1	23	0.00	0	-	NR_026751		29984337	29984338	-1	no_errors	ENST00000444051	ensembl	human	known	69_37n	rna	3	40.00	2	INS	0.129:0.122	G
ZP4	57829	genome.wustl.edu	37	1	238053232	238053232	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04T-01A-21W-A050-09	TCGA-A2-A04T-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d9ddc397-9cb7-4095-a7d2-1c1396891587	9482fe83-a4b1-424a-baf1-8b0f8e40c9b7	g.chr1:238053232G>T	ENST00000366570.4	-	3	493	c.335C>A	c.(334-336)gCa>gAa	p.A112E	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	112					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGCCGCGCCTGCTCCTTCAAC	0.562																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													193.0	200.0	197.0					1																	238053232		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.335C>A	1.37:g.238053232G>T	ENSP00000355529:p.Ala112Glu		B2RAE1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.A112E	ENST00000366570.4	37	c.335	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307902	0.23821	.	.	ENSG00000116996	ENST00000366570	T	0.75154	-0.91	4.88	-4.95	0.03048	.	1.131750	0.06642	N	0.761289	T	0.64649	0.2617	L	0.60455	1.87	0.09310	N	1	B	0.28552	0.215	B	0.31751	0.135	T	0.54576	-0.8273	10	0.41790	T	0.15	-0.0087	2.7604	0.05305	0.4424:0.1137:0.3289:0.115	.	112	Q12836	ZP4_HUMAN	E	112	ENSP00000355529:A112E	ENSP00000355529:A112E	A	-	2	0	ZP4	236119855	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.004000	0.03678	-0.883000	0.03982	-2.106000	0.00359	GCA	ZP4	-	NULL	ENSG00000116996		0.562	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	129	0.77	1	G			238053232	238053232	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	missense	468	10.17	53	SNP	0.000	T
