#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABL2	27	genome.wustl.edu	37	1	179095520	179095520	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:179095520C>A	ENST00000502732.1	-	4	882	c.679G>T	c.(679-681)Gat>Tat	p.D227Y	ABL2_ENST00000511413.1_Missense_Mutation_p.D227Y|ABL2_ENST00000367623.4_Missense_Mutation_p.D206Y|ABL2_ENST00000344730.3_Missense_Mutation_p.D212Y|ABL2_ENST00000512653.1_Missense_Mutation_p.D212Y|ABL2_ENST00000392043.3_Missense_Mutation_p.D206Y|ABL2_ENST00000507173.1_Missense_Mutation_p.D206Y|ABL2_ENST00000504405.1_Missense_Mutation_p.D191Y|ABL2_ENST00000408940.3_Missense_Mutation_p.D191Y	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	227	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ACCTTGCCATCTGCAGTGGTA	0.468			T	ETV6	AML																																	dbGAP		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													90.0	79.0	83.0					1																	179095520		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.679G>T	1.37:g.179095520C>A	ENSP00000427562:p.Asp227Tyr		A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.D227Y	ENST00000502732.1	37	c.679	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488516	0.84854	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	T;T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.51	5.51	0.81932	SH2 motif (4);	0.000000	0.53938	D	0.000051	T	0.62319	0.2418	M	0.84773	2.715	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.994;0.994;0.994;0.994;0.965;0.994;0.998;0.998;0.995;0.994	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.959;0.959;0.959;0.972;0.915;0.972;0.984;0.991;0.984;0.959	T	0.67987	-0.5528	10	0.87932	D	0	.	18.3861	0.90466	0.0:1.0:0.0:0.0	.	206;206;227;191;191;206;191;227;212;191;212	P42684-6;P42684-7;P42684-5;P42684-4;P42684-9;P42684-8;P42684-2;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;.;.;.;ABL2_HUMAN;.;.;.	Y	227;191;212;212;191;206;206;227;206	ENSP00000427562:D227Y;ENSP00000386152:D191Y;ENSP00000339209:D212Y;ENSP00000423578:D212Y;ENSP00000426831:D191Y;ENSP00000356595:D206Y;ENSP00000423413:D206Y;ENSP00000424697:D227Y;ENSP00000375897:D206Y	ENSP00000339209:D212Y	D	-	1	0	ABL2	177362143	1.000000	0.71417	0.998000	0.56505	0.769000	0.43574	7.743000	0.85020	2.578000	0.87016	0.591000	0.81541	GAT	ABL2	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000143322		0.468	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	78	0.00	0	C	NM_005158		179095520	179095520	-1	no_errors	ENST00000502732	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	A
ACER3	55331	genome.wustl.edu	37	11	76726161	76726161	+	Splice_Site	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr11:76726161G>C	ENST00000532485.1	+	8	703	c.599G>C	c.(598-600)aGg>aCg	p.R200T	ACER3_ENST00000533873.1_Splice_Site_p.R163T|ACER3_ENST00000526597.1_Splice_Site_p.R105T|ACER3_ENST00000544113.1_Splice_Site_p.R67T|ACER3_ENST00000538157.1_Splice_Site_p.R158T	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3	200					ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						GAGTCACTGAGGTAAGATATA	0.279																																						dbGAP											0													51.0	54.0	53.0					11																	76726161		2200	4292	6492	-	-	-	SO:0001630	splice_region_variant	0			AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.599+1G>C	11.37:g.76726161G>C			B2RC99	Missense_Mutation	SNP	pfam_Ceramidase	p.R200T	ENST00000532485.1	37	c.599	CCDS8247.1	11	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311862	0.60414	.	.	ENSG00000078124	ENST00000534206;ENST00000532485;ENST00000526597;ENST00000533873;ENST00000538157;ENST00000530243;ENST00000544113	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	M	0.64567	1.98	0.58432	D	0.999993	P;P	0.43788	0.817;0.817	P;P	0.47744	0.5;0.556	T	0.31696	-0.9934	10	0.08599	T	0.76	-10.3911	15.6744	0.77303	0.0:0.0:1.0:0.0	.	163;200	B7Z2Q2;Q9NUN7	.;ACER3_HUMAN	T	158;200;105;163;158;158;67	ENSP00000435733:R158T;ENSP00000434480:R200T;ENSP00000431149:R105T;ENSP00000436252:R163T;ENSP00000440916:R158T;ENSP00000440663:R67T	ENSP00000431149:R105T	R	+	2	0	ACER3	76403809	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.737000	0.84957	2.630000	0.89119	0.591000	0.81541	AGG	ACER3	-	pfam_Ceramidase	ENSG00000078124		0.279	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACER3	HGNC	protein_coding	OTTHUMT00000382770.2	165	0.00	0	G	NM_018367	Missense_Mutation	76726161	76726161	+1	no_errors	ENST00000532485	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	1.000	C
ARMC4	55130	genome.wustl.edu	37	10	28273951	28273951	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr10:28273951G>A	ENST00000305242.5	-	4	664	c.572C>T	c.(571-573)tCa>tTa	p.S191L	ARMC4_ENST00000537576.1_5'Flank|ARMC4_ENST00000239715.3_Missense_Mutation_p.S48L	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	191					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GACTCACAATGAAATATGTTT	0.393																																						dbGAP											0													55.0	52.0	53.0					10																	28273951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.572C>T	10.37:g.28273951G>A	ENSP00000306410:p.Ser191Leu		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP/TIF31_domain,smart_Armadillo,pfscan_Armadillo	p.S191L	ENST00000305242.5	37	c.572	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723635	0.48728	.	.	ENSG00000169126	ENST00000305242;ENST00000434029;ENST00000239715	T;T;T	0.53206	1.33;0.68;0.63	5.55	3.67	0.42095	.	0.507305	0.20344	N	0.094162	T	0.60599	0.2281	M	0.76574	2.34	0.34403	D	0.695456	D	0.65815	0.995	P	0.57244	0.816	T	0.71784	-0.4488	10	0.87932	D	0	.	9.5136	0.39091	0.0742:0.0:0.7828:0.143	.	191	Q5T2S8	ARMC4_HUMAN	L	191;85;48	ENSP00000306410:S191L;ENSP00000398155:S85L;ENSP00000239715:S48L	ENSP00000239715:S48L	S	-	2	0	ARMC4	28313957	1.000000	0.71417	0.037000	0.18230	0.240000	0.25518	4.272000	0.58908	0.674000	0.31244	0.585000	0.79938	TCA	ARMC4	-	NULL	ENSG00000169126		0.393	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	121	0.00	0	G	NM_018076		28273951	28273951	-1	no_errors	ENST00000305242	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	0.687	A
ASNSD1	54529	genome.wustl.edu	37	2	190535312	190535312	+	Missense_Mutation	SNP	C	C	G	rs139164898		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:190535312C>G	ENST00000260952.4	+	6	2205	c.1792C>G	c.(1792-1794)Ctt>Gtt	p.L598V	ASNSD1_ENST00000607062.1_Missense_Mutation_p.L117V	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	598	Asparagine synthetase.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			AGCCTCTGCTCTTCTGCCCAA	0.428																																						dbGAP											0													80.0	79.0	80.0					2																	190535312		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.1792C>G	2.37:g.190535312C>G	ENSP00000260952:p.Leu598Val		D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	pfam_Asn_synthase	p.L598V	ENST00000260952.4	37	c.1792	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	C	3.706	-0.060537	0.07317	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.46063	0.88;0.88	5.66	2.74	0.32292	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.348573	0.31031	N	0.008393	T	0.28433	0.0703	N	0.25890	0.77	0.33773	D	0.623293	B	0.21688	0.059	B	0.17098	0.017	T	0.30001	-0.9993	10	0.24483	T	0.36	-8.0975	12.6622	0.56820	0.104:0.2581:0.6379:0.0	.	598	Q9NWL6	ASND1_HUMAN	V	598	ENSP00000260952:L598V;ENSP00000406790:L598V	ENSP00000260952:L598V	L	+	1	0	ASNSD1	190243557	0.385000	0.25172	0.638000	0.29380	0.992000	0.81027	0.734000	0.26101	0.716000	0.32124	0.561000	0.74099	CTT	ASNSD1	-	pfam_Asn_synthase	ENSG00000138381		0.428	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	HGNC	protein_coding	OTTHUMT00000255919.3	108	0.00	0	C	NM_019048		190535312	190535312	+1	no_errors	ENST00000260952	ensembl	human	known	69_37n	missense	78	10.34	9	SNP	0.397	G
ATP10B	23120	genome.wustl.edu	37	5	160067594	160067594	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:160067594C>G	ENST00000327245.5	-	10	1720	c.874G>C	c.(874-876)Gag>Cag	p.E292Q	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	292					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTTTCGTCTCATGGCCTTTG	0.463																																						dbGAP											0													160.0	163.0	162.0					5																	160067594		1995	4209	6204	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.874G>C	5.37:g.160067594C>G	ENSP00000313600:p.Glu292Gln		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.E292Q	ENST00000327245.5	37	c.874	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	30	5.053842	0.93793	.	.	ENSG00000118322	ENST00000327245	D	0.88818	-2.43	5.41	5.41	0.78517	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.058530	0.64402	D	0.000003	D	0.95127	0.8421	M	0.86502	2.82	0.80722	D	1	D;P;D;D	0.76494	0.999;0.824;0.999;0.991	D;P;D;P	0.74674	0.984;0.702;0.962;0.864	D	0.95220	0.8333	9	.	.	.	.	18.1924	0.89810	0.0:1.0:0.0:0.0	.	336;292;264;292	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	Q	292	ENSP00000313600:E292Q	.	E	-	1	0	ATP10B	160000172	1.000000	0.71417	0.992000	0.48379	0.957000	0.61999	7.692000	0.84203	2.547000	0.85894	0.650000	0.86243	GAG	ATP10B	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.463	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	182	0.00	0	C	NM_025153		160067594	160067594	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	87	13.00	13	SNP	1.000	G
ATR	545	genome.wustl.edu	37	3	142172007	142172007	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr3:142172007G>A	ENST00000350721.4	-	46	7845	c.7724C>T	c.(7723-7725)gCg>gTg	p.A2575V	ATR_ENST00000383101.3_Missense_Mutation_p.A2511V	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2575					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATTCAGTGGCGCTTTGGAATG	0.368								Other conserved DNA damage response genes																														dbGAP											0													146.0	139.0	141.0					3																	142172007		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.7724C>T	3.37:g.142172007G>A	ENSP00000343741:p.Ala2575Val		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.A2575V	ENST00000350721.4	37	c.7724	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567533	0.28003	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.03607	3.87;3.89	5.0	4.11	0.48088	Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.169991	0.51477	D	0.000099	T	0.03178	0.0093	N	0.24115	0.695	0.49213	D	0.999761	P	0.50443	0.935	B	0.39590	0.304	T	0.60551	-0.7241	10	0.33141	T	0.24	-4.7327	13.775	0.63048	0.0:0.2935:0.7065:0.0	.	2575	Q13535	ATR_HUMAN	V	2575;2511	ENSP00000343741:A2575V;ENSP00000372581:A2511V	ENSP00000343741:A2575V	A	-	2	0	ATR	143654697	1.000000	0.71417	0.820000	0.32676	0.490000	0.33462	6.418000	0.73341	1.062000	0.40625	0.591000	0.81541	GCG	ATR	-	smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000175054		0.368	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	307	0.00	0	G	NM_001184		142172007	142172007	-1	no_errors	ENST00000350721	ensembl	human	known	69_37n	missense	122	15.86	23	SNP	0.977	A
ATXN2	6311	genome.wustl.edu	37	12	111991992	111991992	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:111991992C>T	ENST00000377617.3	-	3	959	c.798G>A	c.(796-798)atG>atA	p.M266I	ATXN2_ENST00000535949.1_Start_Codon_SNP_p.M1I|ATXN2_ENST00000608853.1_Missense_Mutation_p.M106I|ATXN2_ENST00000389153.4_Start_Codon_SNP_p.M1I|ATXN2_ENST00000542287.2_Start_Codon_SNP_p.M1I|ATXN2_ENST00000550104.1_Missense_Mutation_p.M266I|ATXN2_ENST00000549455.1_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	266					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GAACCATCCTCATATTTGCAT	0.289																																						dbGAP											0													44.0	40.0	42.0					12																	111991992		2188	4275	6463	-	-	-	SO:0001583	missense	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.798G>A	12.37:g.111991992C>T	ENSP00000366843:p.Met266Ile		A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.M266I	ENST00000377617.3	37	c.798	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	C	18.07	3.542183	0.65198	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949	T;T	0.38240	1.15;1.15	5.34	5.34	0.76211	.	0.077537	0.85682	D	0.000000	T	0.33962	0.0881	L	0.44542	1.39	0.58432	D	0.999999	B;B;B;B	0.33904	0.006;0.036;0.431;0.003	B;B;B;B	0.29785	0.023;0.034;0.107;0.007	T	0.12344	-1.0551	10	0.46703	T	0.11	-1.4353	19.0095	0.92867	0.0:1.0:0.0:0.0	.	1;266;1;1	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	I	1;266;266;1;1	ENSP00000366843:M266I;ENSP00000446576:M266I	ENSP00000366843:M266I	M	-	3	0	ATXN2	110476375	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.262000	0.65501	2.507000	0.84556	0.313000	0.20887	ATG	ATXN2	-	NULL	ENSG00000204842		0.289	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	81	0.00	0	C	NM_002973		111991992	111991992	-1	no_errors	ENST00000377617	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	T
BAI3	577	genome.wustl.edu	37	6	70070933	70070933	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr6:70070933G>C	ENST00000370598.1	+	29	4589	c.3768G>C	c.(3766-3768)ttG>ttC	p.L1256F	BAI3_ENST00000238918.8_Missense_Mutation_p.L462F|BAI3_ENST00000546190.1_Missense_Mutation_p.L220F	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1256					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCACAGGTTTGCACATGCCCA	0.393																																						dbGAP											0													91.0	82.0	85.0					6																	70070933		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3768G>C	6.37:g.70070933G>C	ENSP00000359630:p.Leu1256Phe		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.L1256F	ENST00000370598.1	37	c.3768	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030932	0.19590	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.49720	1.93;2.53;0.77	5.58	2.8	0.32819	.	0.067886	0.56097	D	0.000033	T	0.15782	0.0380	L	0.53249	1.67	0.46396	D	0.999024	P;B	0.47106	0.89;0.087	B;B	0.38378	0.272;0.033	T	0.15065	-1.0450	10	0.11485	T	0.65	.	3.606	0.08042	0.2029:0.1151:0.5636:0.1185	.	462;1256	B7Z356;O60242	.;BAI3_HUMAN	F	1256;462;220	ENSP00000359630:L1256F;ENSP00000238918:L462F;ENSP00000441821:L220F	ENSP00000238918:L462F	L	+	3	2	BAI3	70127654	1.000000	0.71417	0.993000	0.49108	0.903000	0.53119	0.561000	0.23515	0.822000	0.34565	0.591000	0.81541	TTG	BAI3	-	NULL	ENSG00000135298		0.393	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	154	0.00	0	G			70070933	70070933	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.998	C
NUTM1	256646	genome.wustl.edu	37	15	34640323	34640323	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr15:34640323C>T	ENST00000333756.4	+	2	325	c.170C>T	c.(169-171)cCa>cTa	p.P57L	NUTM1_ENST00000438749.3_Missense_Mutation_p.P75L|NUTM1_ENST00000537011.1_Missense_Mutation_p.P85L	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	57	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTATTCTCTCCAGACAACCCT	0.602																																						dbGAP											0													141.0	133.0	136.0					15																	34640323		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.170C>T	15.37:g.34640323C>T	ENSP00000329448:p.Pro57Leu		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.P57L	ENST00000333756.4	37	c.170	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	C	13.83	2.355190	0.41700	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.45668	0.89;0.89;0.89	5.69	3.79	0.43588	Nuclear Testis  protein, N-terminal (1);	0.502966	0.18466	N	0.140395	T	0.38532	0.1044	L	0.42245	1.32	0.35513	D	0.80082	P;P;P	0.41710	0.76;0.717;0.76	P;B;B	0.45538	0.484;0.243;0.357	T	0.50162	-0.8860	10	0.49607	T	0.09	.	7.2732	0.26268	0.0:0.7394:0.1714:0.0891	.	75;85;57	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	L	85;75;57;57	ENSP00000444896:P85L;ENSP00000407031:P75L;ENSP00000329448:P57L	ENSP00000329448:P57L	P	+	2	0	C15orf55	32427615	0.021000	0.18746	0.864000	0.33941	0.952000	0.60782	1.037000	0.30241	1.383000	0.46405	0.655000	0.94253	CCA	C15orf55	-	NULL	ENSG00000184507		0.602	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	163	0.00	0	C	NM_175741		34640323	34640323	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	0.635	T
CFAP74	85452	genome.wustl.edu	37	1	1900265	1900265	+	IGR	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:1900265C>T								TMEM52 (49553 upstream) : C1orf222 (19297 downstream)																							TGCTCCTCCTCAAAGGCCCTG	0.597																																						dbGAP											0													91.0	94.0	93.0					1																	1900265		2011	4178	6189	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.1900265C>T				Missense_Mutation	SNP	NULL	p.E352K		37	c.1054		1	.	.	.	.	.	.	.	.	.	.	c	12.73	2.024607	0.35701	.	.	ENSG00000142609	ENST00000270720	.	.	.	3.67	1.7	0.24286	.	0.787356	0.11081	N	0.601867	T	0.40979	0.1139	L	0.45137	1.4	0.80722	D	1	P;B	0.35155	0.487;0.319	B;B	0.35470	0.203;0.069	T	0.08932	-1.0698	9	0.23302	T	0.38	-18.4903	7.1595	0.25657	0.0:0.722:0.1739:0.1041	.	352;352	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	K	352	.	ENSP00000270720:E352K	E	-	1	0	C1orf222	1890125	0.746000	0.28272	0.864000	0.33941	0.855000	0.48748	0.450000	0.21762	0.292000	0.22492	0.556000	0.70494	GAG	C1orf222	-	NULL	ENSG00000142609	0	0.597					C1orf222	HGNC			216	0.00	0	C			1900265	1900265	-1	no_errors	ENST00000270720	ensembl	human	known	69_37n	missense	103	23.70	32	SNP	0.995	T
C21orf91	54149	genome.wustl.edu	37	21	19190578	19190578	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr21:19190578C>A	ENST00000400558.3	-	2	148	c.58G>T	c.(58-60)Gtt>Ttt	p.V20F	C21orf91_ENST00000400559.3_Missense_Mutation_p.V20F|C21orf91_ENST00000284881.4_Missense_Mutation_p.V20F|C21orf91_ENST00000493464.1_5'UTR	NM_001100421.1	NP_001093891.1			chromosome 21 open reading frame 91											endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		AGTTTACAAACACTGCAAATG	0.363																																						dbGAP											0													198.0	186.0	190.0					21																	19190578		1879	4111	5990	-	-	-	SO:0001583	missense	0			AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000400558.3:c.58G>T	21.37:g.19190578C>A	ENSP00000383403:p.Val20Phe			Missense_Mutation	SNP	pfam_EURL_prot	p.V20F	ENST00000400558.3	37	c.58	CCDS42909.1	21	.	.	.	.	.	.	.	.	.	.	C	22.7	4.326488	0.81690	.	.	ENSG00000154642	ENST00000284881;ENST00000400559;ENST00000400558;ENST00000405964	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.13	3.99	0.46301	.	0.174325	0.50627	D	0.000118	T	0.30885	0.0779	L	0.53249	1.67	0.80722	D	1	D;D	0.58268	0.977;0.982	P;P	0.60473	0.803;0.875	T	0.02031	-1.1226	9	.	.	.	-7.0252	5.2871	0.15708	0.0:0.7545:0.0:0.2455	.	20;20	Q9NYK6-3;Q9NYK6	.;EURL_HUMAN	F	20	ENSP00000284881:V20F;ENSP00000383404:V20F;ENSP00000383403:V20F;ENSP00000385566:V20F	.	V	-	1	0	C21orf91	18112449	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.154000	0.42291	2.554000	0.86153	0.655000	0.94253	GTT	C21orf91	-	pfam_EURL_prot	ENSG00000154642		0.363	C21orf91-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	C21orf91	HGNC	protein_coding	OTTHUMT00000158214.1	376	0.00	0	C	NM_017447		19190578	19190578	-1	no_errors	ENST00000284881	ensembl	human	known	69_37n	missense	174	10.77	21	SNP	1.000	A
CAD	790	genome.wustl.edu	37	2	27449820	27449820	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:27449820G>A	ENST00000403525.1	+	14	2232	c.2088G>A	c.(2086-2088)atG>atA	p.M696I	CAD_ENST00000264705.4_Missense_Mutation_p.M759I			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGCTGCATGAAGAGCGTTG	0.532																																						dbGAP											0													98.0	98.0	98.0					2																	27449820		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2088G>A	2.37:g.27449820G>A	ENSP00000384510:p.Met696Ile		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE_1,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf_euk,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf_euk	p.M759I	ENST00000403525.1	37	c.2277		2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996866	0.74818	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97906	-4.6;-4.6	4.38	4.38	0.52667	ATP-grasp fold, subdomain 2 (1);	0.037990	0.85682	D	0.000000	D	0.99351	0.9772	H	0.99565	4.63	0.80722	D	1	D;B	0.89917	1.0;0.191	D;B	0.97110	1.0;0.03	D	0.98080	1.0403	10	0.87932	D	0	.	15.7152	0.77663	0.0:0.0:1.0:0.0	.	696;759	F8VPD4;P27708	.;PYR1_HUMAN	I	759;696	ENSP00000264705:M759I;ENSP00000384510:M696I	ENSP00000264705:M759I	M	+	3	0	CAD	27303324	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.129000	0.94430	2.281000	0.76405	0.485000	0.47835	ATG	CAD	-	tigrfam_CarbamoylP_synth_lsu	ENSG00000084774		0.532	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	73	0.00	0	G			27449820	27449820	+1	no_errors	ENST00000264705	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	1.000	A
CASC5	57082	genome.wustl.edu	37	15	40914718	40914718	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr15:40914718G>A	ENST00000346991.5	+	11	2724	c.2334G>A	c.(2332-2334)atG>atA	p.M778I	CASC5_ENST00000399668.2_Missense_Mutation_p.M752I|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	778					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ATGACAAGATGATTATATGTT	0.403																																						dbGAP											0													64.0	59.0	61.0					15																	40914718		1894	4114	6008	-	-	-	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.2334G>A	15.37:g.40914718G>A	ENSP00000335463:p.Met778Ile		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.M778I	ENST00000346991.5	37	c.2334	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	0.065	-1.213961	0.01555	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.04194	3.68;3.68	4.58	0.951	0.19579	.	1.682500	0.03894	N	0.279275	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.41179	-0.9523	10	0.44086	T	0.13	.	3.3229	0.07057	0.3467:0.0:0.1877:0.4656	.	752;778;752	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	I	778;752;752	ENSP00000335463:M778I;ENSP00000382576:M752I	ENSP00000260369:M752I	M	+	3	0	CASC5	38702010	0.000000	0.05858	0.001000	0.08648	0.172000	0.22775	-0.551000	0.06027	0.387000	0.25024	0.460000	0.39030	ATG	CASC5	-	NULL	ENSG00000137812		0.403	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	100	0.00	0	G	NM_144508		40914718	40914718	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	missense	35	31.37	16	SNP	0.000	A
CHD4	1108	genome.wustl.edu	37	12	6688060	6688060	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:6688060C>A	ENST00000357008.2	-	34	5096	c.4933G>T	c.(4933-4935)Gag>Tag	p.E1645*	RP5-940J5.6_ENST00000501075.2_RNA|SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000544040.1_Nonsense_Mutation_p.E1638*|CHD4_ENST00000544484.1_Nonsense_Mutation_p.E1670*|CHD4_ENST00000309577.6_Nonsense_Mutation_p.E1673*	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1645	Required for interaction with PCNT.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GACTTTTCCTCCACCTTCTCT	0.418																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													155.0	132.0	140.0					12																	6688060		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.4933G>T	12.37:g.6688060C>A	ENSP00000349508:p.Glu1645*		Q8IXZ5	Nonsense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1673*	ENST00000357008.2	37	c.5017	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	44	10.941019	0.99492	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	.	.	.	5.7	5.7	0.88788	.	0.115296	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	17.6119	0.88056	0.0:1.0:0.0:0.0	.	.	.	.	X	1670;1638;1673;1645;1619	.	ENSP00000312419:E1673X	E	-	1	0	CHD4	6558321	0.997000	0.39634	1.000000	0.80357	0.571000	0.35966	3.158000	0.50723	2.703000	0.92315	0.655000	0.94253	GAG	CHD4	-	NULL	ENSG00000111642		0.418	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		220	0.00	0	C	NM_001273		6688060	6688060	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	nonsense	123	12.77	18	SNP	1.000	A
CNGA3	1261	genome.wustl.edu	37	2	99013187	99013187	+	Silent	SNP	G	G	A	rs544874644		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:99013187G>A	ENST00000272602.2	+	7	1593	c.1554G>A	c.(1552-1554)gaG>gaA	p.E518E	CNGA3_ENST00000436404.2_Silent_p.E500E|CNGA3_ENST00000393504.1_Silent_p.E518E|CNGA3_ENST00000409937.1_Silent_p.E522E			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	518					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TTGGGAAGGAGATGTACATCA	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20304	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													107.0	98.0	101.0					2																	99013187		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1554G>A	2.37:g.99013187G>A			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E518	ENST00000272602.2	37	c.1554	CCDS2034.1	2																																																																																			CNGA3	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000144191		0.572	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	101	0.00	0	G	NM_001298		99013187	99013187	+1	no_errors	ENST00000272602	ensembl	human	known	69_37n	silent	43	18.87	10	SNP	1.000	A
CR1	1378	genome.wustl.edu	37	1	207793269	207793269	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:207793269G>A	ENST00000367049.4	+	43	7111	c.7111G>A	c.(7111-7113)Gag>Aag	p.E2371K	CR1_ENST00000400960.2_Missense_Mutation_p.E1921K|CR1_ENST00000367052.1_Missense_Mutation_p.E1921K|CR1_ENST00000367053.1_Missense_Mutation_p.E1921K|CR1_ENST00000367051.1_Missense_Mutation_p.E1921K	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1921					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AATCTCGAAGGAGTTAGAAAT	0.368																																						dbGAP											0													50.0	52.0	51.0					1																	207793269		1977	4188	6165	-	-	-	SO:0001583	missense	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.7111G>A	1.37:g.207793269G>A	ENSP00000356016:p.Glu2371Lys		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E2371K	ENST00000367049.4	37	c.7111	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.520931	0.00967	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79	4.6	-0.506	0.11989	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.52025	0.1709	N	0.12182	0.205	0.09310	N	1	B;B	0.27656	0.184;0.039	B;B	0.34489	0.118;0.184	T	0.42599	-0.9442	9	0.07325	T	0.83	.	7.6735	0.28471	0.4573:0.0:0.5427:0.0	.	1921;2371	P17927;E9PDY4	CR1_HUMAN;.	K	1921;1921;1921;1921;2371	ENSP00000356019:E1921K;ENSP00000356018:E1921K;ENSP00000356020:E1921K;ENSP00000383744:E1921K;ENSP00000356016:E2371K	ENSP00000356016:E2371K	E	+	1	0	CR1	205859892	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.159000	0.16442	-0.171000	0.10797	-0.809000	0.03173	GAG	CR1	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.368	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	163	0.00	0	G	NM_000573		207793269	207793269	+1	no_errors	ENST00000367049	ensembl	human	known	69_37n	missense	88	12.00	12	SNP	0.000	A
CRYGC	1420	genome.wustl.edu	37	2	208993007	208993007	+	Nonsense_Mutation	SNP	G	G	A	rs555354568		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:208993007G>A	ENST00000282141.3	-	3	482	c.445C>T	c.(445-447)Caa>Taa	p.Q149*		NM_020989.3	NP_066269.1	P07315	CRGC_HUMAN	crystallin, gamma C	149	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(1)|large_intestine(2)|lung(5)	9				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		CTGTACTCTTGGGGCCTCAGC	0.582																																						dbGAP											0													59.0	63.0	62.0					2																	208993007		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2379.1	2q33.3	2013-02-14			ENSG00000163254	ENSG00000163254			2410	protein-coding gene	gene with protein product		123680		CRYG3			Standard	NM_020989		Approved		uc002vco.4	P07315	OTTHUMG00000132942	ENST00000282141.3:c.445C>T	2.37:g.208993007G>A	ENSP00000282141:p.Gln149*		Q53R50	Nonsense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.Q149*	ENST00000282141.3	37	c.445	CCDS2379.1	2	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546635	0.65198	.	.	ENSG00000163254	ENST00000282141	.	.	.	4.98	0.184	0.15086	.	0.391487	0.26646	N	0.023224	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.5746	0.45219	0.0:0.5888:0.2806:0.1306	.	.	.	.	X	149	.	ENSP00000282141:Q149X	Q	-	1	0	CRYGC	208701252	0.120000	0.22244	0.017000	0.16124	0.986000	0.74619	1.318000	0.33643	0.188000	0.20168	0.557000	0.71058	CAA	CRYGC	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000163254		0.582	CRYGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGC	HGNC	protein_coding	OTTHUMT00000256474.1	100	0.00	0	G	NM_020989		208993007	208993007	-1	no_errors	ENST00000282141	ensembl	human	known	69_37n	nonsense	39	22.00	11	SNP	0.103	A
DCAF8L2	347442	genome.wustl.edu	37	X	27765792	27765792	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:27765792G>A	ENST00000451261.2	+	5	1179	c.780G>A	c.(778-780)caG>caA	p.Q260Q		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	260										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GGGTGCGGCAGAGGCCAGTAC	0.527																																						dbGAP											0													161.0	122.0	134.0					X																	27765792		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.780G>A	X.37:g.27765792G>A			B2RXH9|J3KT06	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q260	ENST00000451261.2	37	c.780	CCDS59162.1	X																																																																																			DCAF8L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000189186		0.527	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	165	0.00	0	G	XM_293354		27765792	27765792	+1	no_errors	ENST00000451261	ensembl	human	known	69_37n	silent	72	12.20	10	SNP	0.002	A
DDX49	54555	genome.wustl.edu	37	19	19035754	19035754	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:19035754C>T	ENST00000247003.4	+	9	1060	c.993C>T	c.(991-993)atC>atT	p.I331I	DDX49_ENST00000438170.2_Missense_Mutation_p.S234F|AC002985.3_ENST00000596918.1_Intron|DDX49_ENST00000599156.1_3'UTR	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	331	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			TCCCCAAGATCTACATCCACC	0.652																																						dbGAP											0													63.0	58.0	60.0					19																	19035754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.993C>T	19.37:g.19035754C>T			E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S234F	ENST00000247003.4	37	c.701	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850220	0.32699	.	.	ENSG00000105671	ENST00000438170	T	0.08984	3.03	4.77	3.74	0.42951	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.29105	N	0.881223	.	.	.	.	.	.	T	0.02417	-1.1162	6	0.87932	D	0	-26.6539	11.8715	0.52523	0.0:0.9151:0.0:0.0849	.	.	.	.	F	234	ENSP00000395377:S234F	ENSP00000395377:S234F	S	+	2	0	DDX49	18896754	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.076000	0.30729	1.019000	0.39547	0.561000	0.74099	TCT	DDX49	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000105671		0.652	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	41	0.00	0	C	NM_019070		19035754	19035754	+1	no_errors	ENST00000438170	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	T
DEFB128	245939	genome.wustl.edu	37	20	168643	168643	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr20:168643C>G	ENST00000334391.4	-	2	223	c.166G>C	c.(166-168)Gat>Cat	p.D56H		NM_001037732.1	NP_001032821.1	Q7Z7B8	DB128_HUMAN	defensin, beta 128	56					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		all_cancers(10;0.00499)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TCTTCTTCATCATTAGCACAA	0.378																																						dbGAP											0													356.0	326.0	336.0					20																	168643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525930	CCDS33430.1	20p13	2011-03-29			ENSG00000185982	ENSG00000185982		"""Defensins, beta"""	18106	protein-coding gene	gene with protein product	"""defensin, beta 28"""					11854508, 16033865	Standard	NM_001037732		Approved	DEFB-28	uc002wcz.1	Q7Z7B8	OTTHUMG00000043057	ENST00000334391.4:c.166G>C	20.37:g.168643C>G	ENSP00000335382:p.Asp56His		B2RU29	Missense_Mutation	SNP	NULL	p.D56H	ENST00000334391.4	37	c.166	CCDS33430.1	20	.	.	.	.	.	.	.	.	.	.	c	7.963	0.747396	0.15710	.	.	ENSG00000185982	ENST00000334391	T	0.18657	2.2	4.39	1.4	0.22301	.	0.751776	0.11840	N	0.524398	T	0.12860	0.0312	.	.	.	0.09310	N	1	B	0.33135	0.399	B	0.30029	0.11	T	0.23297	-1.0192	9	0.52906	T	0.07	-11.5227	3.0962	0.06311	0.1837:0.5429:0.1773:0.096	.	56	Q7Z7B8	DB128_HUMAN	H	56	ENSP00000335382:D56H	ENSP00000335382:D56H	D	-	1	0	DEFB128	116643	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.054000	0.11826	0.367000	0.24454	-0.139000	0.14373	GAT	DEFB128	-	NULL	ENSG00000185982		0.378	DEFB128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB128	HGNC	protein_coding	OTTHUMT00000101361.2	445	0.00	0	C	NM_001037732		168643	168643	-1	no_errors	ENST00000334391	ensembl	human	known	69_37n	missense	237	13.14	36	SNP	0.000	G
DNAH5	1767	genome.wustl.edu	37	5	13708337	13708337	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:13708337G>A	ENST00000265104.4	-	76	13337	c.13233C>T	c.(13231-13233)ctC>ctT	p.L4411L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4411					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCAGCTCAGTGAGGGTGCTGC	0.488									Kartagener syndrome																													dbGAP											0													208.0	182.0	191.0					5																	13708337		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13233C>T	5.37:g.13708337G>A			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L4411	ENST00000265104.4	37	c.13233	CCDS3882.1	5																																																																																			DNAH5	-	pfam_Dynein_heavy	ENSG00000039139		0.488	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	203	0.00	0	G	NM_001369		13708337	13708337	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	silent	92	13.21	14	SNP	1.000	A
GNG10	2790	genome.wustl.edu	37	9	114429136	114429136	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:114429136G>C	ENST00000374293.4	+	2	423	c.123G>C	c.(121-123)caG>caC	p.Q41H	DNAJC25_ENST00000556107.1_Missense_Mutation_p.Q126H|DNAJC25-GNG10_ENST00000374294.3_Missense_Mutation_p.Q126H	NM_001017998.3|NM_001198664.1	NP_001017998.1|NP_001185593.1	P50151	GBG10_HUMAN	guanine nucleotide binding protein (G protein), gamma 10	41					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			kidney(1)	1						ACTGTATGCAGAATGCCTGCA	0.547																																						dbGAP											0													76.0	64.0	68.0					9																	114429136		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS35107.1	9q31.3	2010-08-17			ENSG00000242616	ENSG00000242616			4402	protein-coding gene	gene with protein product		604389				7665596	Standard	NM_001017998		Approved			P50151	OTTHUMG00000157193	ENST00000374293.4:c.123G>C	9.37:g.114429136G>C	ENSP00000363411:p.Gln41His		Q3B7K2|Q4VC27	Missense_Mutation	SNP	pfam_DnaJ_N,pfam_G-protein_gamma-like_dom,superfamily_DnaJ_N,smart_DnaJ_N,smart_G-protein_gamma-like_dom,pfscan_DnaJ_N,pfscan_G-protein_gamma-like_dom,prints_Hsp_DnaJ,prints_Gprotein-gamma	p.Q126H	ENST00000374293.4	37	c.378	CCDS35107.1	9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018513	0.75275	.	.	ENSG00000059769;ENSG00000244115;ENSG00000242616	ENST00000556107;ENST00000374294;ENST00000374293	T	0.35421	1.31	5.5	4.59	0.56863	G-protein gamma domain (5);	.	.	.	.	T	0.58250	0.2109	.	.	.	0.41443	D	0.987934	P;D	0.76494	0.582;0.999	P;D	0.73380	0.588;0.98	T	0.63233	-0.6683	8	0.72032	D	0.01	-12.3403	10.7978	0.46470	0.0728:0.1336:0.7936:0.0	.	41;126	P50151;Q9H1X3-3	GBG10_HUMAN;.	H	126;126;41	ENSP00000363411:Q41H	ENSP00000363412:Q126H	Q	+	3	2	DNAJC25-GNG10;GNG10;DNAJC25	113468957	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.131000	0.50515	1.417000	0.47077	0.655000	0.94253	CAG	DNAJC25-GNG10	-	pfam_G-protein_gamma-like_dom,superfamily_DnaJ_N,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom	ENSG00000244115		0.547	GNG10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC25-GNG10	HGNC	protein_coding	OTTHUMT00000053644.2	145	0.00	0	G			114429136	114429136	+1	no_errors	ENST00000374294	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	1.000	C
DYSF	8291	genome.wustl.edu	37	2	71871094	71871094	+	Splice_Site	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:71871094G>A	ENST00000258104.3	+	41	4687		c.e41-1		DYSF_ENST00000409366.1_Splice_Site|DYSF_ENST00000394120.2_Splice_Site|DYSF_ENST00000409651.1_Splice_Site|DYSF_ENST00000410041.1_Splice_Site|DYSF_ENST00000429174.2_Splice_Site|DYSF_ENST00000413539.2_Splice_Site|DYSF_ENST00000479049.2_Splice_Site|DYSF_ENST00000409744.1_Splice_Site|DYSF_ENST00000409762.1_Splice_Site|DYSF_ENST00000410020.3_Splice_Site|DYSF_ENST00000409582.3_Splice_Site	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin						plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TACCCACTCAGGAGGAAGAGT	0.522																																						dbGAP											0													81.0	74.0	76.0					2																	71871094		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4411-1G>A	2.37:g.71871094G>A			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Splice_Site	SNP	-	e42-1	ENST00000258104.3	37	c.4504-1	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668980	0.67814	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1147	0.89549	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYSF	71724602	1.000000	0.71417	0.999000	0.59377	0.518000	0.34316	8.502000	0.90505	2.882000	0.98803	0.655000	0.94253	.	DYSF	-	-	ENSG00000135636		0.522	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	134	0.00	0	G	NM_003494	Intron	71871094	71871094	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	splice_site	84	15.15	15	SNP	1.000	A
EDC4	23644	genome.wustl.edu	37	16	67913012	67913012	+	Silent	SNP	C	C	A	rs146270915		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr16:67913012C>A	ENST00000358933.5	+	12	1679	c.1440C>A	c.(1438-1440)gcC>gcA	p.A480A	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	480					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TGCTGCCTGCCGAAGAGGAAA	0.592																																						dbGAP											0													39.0	37.0	37.0					16																	67913012		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1440C>A	16.37:g.67913012C>A			A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A480	ENST00000358933.5	37	c.1440	CCDS10849.1	16																																																																																			EDC4	-	NULL	ENSG00000038358		0.592	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2	58	0.00	0	C	NM_014329		67913012	67913012	+1	no_errors	ENST00000358933	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	0.067	A
EGR2	1959	genome.wustl.edu	37	10	64573184	64573184	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr10:64573184C>T	ENST00000242480.3	-	2	1539	c.1214G>A	c.(1213-1215)cGa>cAa	p.R405Q	EGR2_ENST00000439032.1_Missense_Mutation_p.R405Q|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000411732.1_Missense_Mutation_p.R355Q	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	405					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					GGCAAACTTTCGGCCACAGTA	0.602																																						dbGAP											0													148.0	139.0	142.0					10																	64573184		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.1214G>A	10.37:g.64573184C>T	ENSP00000242480:p.Arg405Gln		B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R405Q	ENST00000242480.3	37	c.1214	CCDS7267.1	10	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479501	0.84747	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732	T;T;T	0.18960	2.18;2.18;2.18	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.34978	0.0916	L	0.28054	0.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.14924	-1.0455	10	0.87932	D	0	-19.4985	17.2741	0.87110	0.0:1.0:0.0:0.0	.	355;405	P11161-2;P11161	.;EGR2_HUMAN	Q	405;405;355	ENSP00000242480:R405Q;ENSP00000402040:R405Q;ENSP00000387634:R355Q	ENSP00000242480:R405Q	R	-	2	0	EGR2	64243190	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.609000	0.82925	2.597000	0.87782	0.655000	0.94253	CGA	EGR2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000122877		0.602	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR2	HGNC	protein_coding	OTTHUMT00000048245.2	199	0.00	0	C	NM_000399		64573184	64573184	-1	no_errors	ENST00000242480	ensembl	human	known	69_37n	missense	82	32.79	40	SNP	1.000	T
FAM47A	158724	genome.wustl.edu	37	X	34150228	34150228	+	Silent	SNP	G	G	A	rs200832901		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:34150228G>A	ENST00000346193.3	-	1	219	c.168C>T	c.(166-168)gaC>gaT	p.D56D		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	56										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGCGGAAGTCGTCCATGCCCT	0.557																																						dbGAP											0													75.0	73.0	74.0					X																	34150228		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.168C>T	X.37:g.34150228G>A			A8K8I9|Q8TAA0	Silent	SNP	NULL	p.D56	ENST00000346193.3	37	c.168	CCDS43926.1	X																																																																																			FAM47A	-	NULL	ENSG00000185448		0.557	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	158	0.00	0	G	NM_203408		34150228	34150228	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	silent	79	21.78	22	SNP	0.020	A
FAT4	79633	genome.wustl.edu	37	4	126412418	126412418	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:126412418C>G	ENST00000394329.3	+	17	14454	c.14441C>G	c.(14440-14442)tCt>tGt	p.S4814C	FAT4_ENST00000335110.5_Missense_Mutation_p.S3055C	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4814					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGGAGGTCTTCTTCAGAGGAG	0.507																																						dbGAP											0													57.0	59.0	58.0					4																	126412418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14441C>G	4.37:g.126412418C>G	ENSP00000377862:p.Ser4814Cys		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S4814C	ENST00000394329.3	37	c.14441	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343492	0.61073	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.92299	-2.81;-3.01	4.87	4.87	0.63330	.	0.000000	0.34411	U	0.003992	D	0.95778	0.8626	M	0.75777	2.31	0.49687	D	0.999812	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.994;0.997	D	0.96386	0.9285	10	0.87932	D	0	.	17.0284	0.86454	0.0:1.0:0.0:0.0	.	3055;4814;4813	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	C	4814;3055	ENSP00000377862:S4814C;ENSP00000335169:S3055C	ENSP00000335169:S3055C	S	+	2	0	FAT4	126631868	1.000000	0.71417	0.414000	0.26521	0.972000	0.66771	5.738000	0.68613	2.253000	0.74438	0.491000	0.48974	TCT	FAT4	-	NULL	ENSG00000196159		0.507	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	45	0.00	0	C	NM_024582		126412418	126412418	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.983	G
FREM1	158326	genome.wustl.edu	37	9	14868949	14868949	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:14868949C>T	ENST00000380880.3	-	2	810	c.27G>A	c.(25-27)gcG>gcA	p.A9A	FREM1_ENST00000380881.4_Silent_p.A9A|FREM1_ENST00000422223.2_Silent_p.A9A			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	9					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GCACGGCATTCGCAGCCCCCC	0.602																																						dbGAP											0													23.0	29.0	27.0					9																	14868949		2063	4196	6259	-	-	-	SO:0001819	synonymous_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.27G>A	9.37:g.14868949C>T			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.A9	ENST00000380880.3	37	c.27	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.602	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	73	0.00	0	C	NM_144966		14868949	14868949	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.000	T
GABRQ	55879	genome.wustl.edu	37	X	151815558	151815558	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:151815558C>T	ENST00000370306.2	+	4	476	c.456C>T	c.(454-456)ttC>ttT	p.F152F		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	152					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGGATGCTTTCGTGCATGATG	0.537																																						dbGAP											0													281.0	194.0	223.0					X																	151815558		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.456C>T	X.37:g.151815558C>T			A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABAAb_rcpt,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.F152	ENST00000370306.2	37	c.456	CCDS14707.1	X																																																																																			GABRQ	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000147402		0.537	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	HGNC	protein_coding	OTTHUMT00000058763.2	308	0.00	0	C	NM_018558		151815558	151815558	+1	no_errors	ENST00000370306	ensembl	human	known	69_37n	silent	178	11.88	24	SNP	0.000	T
GINS4	84296	genome.wustl.edu	37	8	41397268	41397268	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr8:41397268G>A	ENST00000276533.3	+	5	579	c.369G>A	c.(367-369)tcG>tcA	p.S123S	RP11-360L9.7_ENST00000524133.1_RNA|RP11-360L9.7_ENST00000578500.1_RNA|RP11-360L9.4_ENST00000523081.1_RNA|GINS4_ENST00000523277.2_Silent_p.S123S|GINS4_ENST00000518671.1_Silent_p.S123S	NM_032336.2	NP_115712.1	Q9BRT9	SLD5_HUMAN	GINS complex subunit 4 (Sld5 homolog)	123					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				breast(1)|lung(2)|skin(1)	4	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			CCAGCCTCTCGCCGGAAGAGT	0.542																																						dbGAP											0													68.0	67.0	67.0					8																	41397268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC005995	CCDS6116.1	8p11.21	2006-05-04			ENSG00000147536	ENSG00000147536			28226	protein-coding gene	gene with protein product		610611				12477932	Standard	NM_032336		Approved	MGC14799, SLD5	uc003xnx.3	Q9BRT9	OTTHUMG00000164079	ENST00000276533.3:c.369G>A	8.37:g.41397268G>A			B2R8H5|D3DSY0|Q8N648	Silent	SNP	pfam_GINS_complex,pirsf_GINS_Sld5	p.S123	ENST00000276533.3	37	c.369	CCDS6116.1	8																																																																																			GINS4	-	pfam_GINS_complex,pirsf_GINS_Sld5	ENSG00000147536		0.542	GINS4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS4	HGNC	protein_coding	OTTHUMT00000377150.1	96	0.00	0	G	NM_032336		41397268	41397268	+1	no_errors	ENST00000276533	ensembl	human	known	69_37n	silent	47	27.69	18	SNP	0.817	A
GNPTAB	79158	genome.wustl.edu	37	12	102158936	102158936	+	Nonsense_Mutation	SNP	G	G	A	rs281864982		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:102158936G>A	ENST00000299314.7	-	13	2021	c.1759C>T	c.(1759-1761)Cga>Tga	p.R587*	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	587					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GAAGCATGTCGAATTATTGGA	0.388																																						dbGAP											0													238.0	217.0	224.0					12																	102158936		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1759C>T	12.37:g.102158936G>A	ENSP00000299314:p.Arg587*		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Nonsense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.R587*	ENST00000299314.7	37	c.1759	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	41	8.905951	0.98998	.	.	ENSG00000111670	ENST00000299314	.	.	.	5.96	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8785	15.4094	0.74905	0.0:0.0:0.747:0.253	.	.	.	.	X	587	.	ENSP00000299314:R587X	R	-	1	2	GNPTAB	100683067	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.079000	0.71291	1.496000	0.48567	0.655000	0.94253	CGA	GNPTAB	-	NULL	ENSG00000111670		0.388	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	408	0.24	1	G			102158936	102158936	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	nonsense	197	13.60	31	SNP	1.000	A
GRID2	2895	genome.wustl.edu	37	4	94031970	94031970	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:94031970G>A	ENST00000282020.4	+	4	859	c.601G>A	c.(601-603)Gaa>Aaa	p.E201K	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.E106K	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	201					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCAGAAGGTAGAAAACAACAT	0.408																																						dbGAP											0													160.0	161.0	160.0					4																	94031970		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.601G>A	4.37:g.94031970G>A	ENSP00000282020:p.Glu201Lys		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E201K	ENST00000282020.4	37	c.601	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016030	0.75161	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.86497	-2.04;-2.13	5.5	5.5	0.81552	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000012	D	0.83792	0.5331	L	0.29908	0.895	0.80722	D	1	P;P;P	0.48089	0.77;0.77;0.905	B;B;B	0.43838	0.396;0.396;0.433	D	0.84250	0.0477	10	0.44086	T	0.13	.	19.7485	0.96259	0.0:0.0:1.0:0.0	.	106;201;142	E9PH24;O43424;B4DYB9	.;GRID2_HUMAN;.	K	201;106	ENSP00000282020:E201K;ENSP00000421257:E106K	ENSP00000282020:E201K	E	+	1	0	GRID2	94250993	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.416000	0.97383	2.742000	0.94016	0.655000	0.94253	GAA	GRID2	-	pfam_ANF_lig-bd_rcpt	ENSG00000152208		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	195	0.00	0	G			94031970	94031970	+1	no_errors	ENST00000282020	ensembl	human	known	69_37n	missense	78	17.02	16	SNP	1.000	A
HIST1H2AK	8330	genome.wustl.edu	37	6	27805901	27805901	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr6:27805901C>T	ENST00000330180.2	-	1	216	c.217G>A	c.(217-219)Gac>Aac	p.D73N	HIST1H2BN_ENST00000396980.3_5'Flank|HIST1H2BN_ENST00000606613.1_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	73						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						TTCTTGTTGTCGCGGGCCGCG	0.647																																						dbGAP											0													90.0	93.0	92.0					6																	27805901		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.217G>A	6.37:g.27805901C>T	ENSP00000330307:p.Asp73Asn		P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.D73N	ENST00000330180.2	37	c.217	CCDS4632.1	6	.	.	.	.	.	.	.	.	.	.	.	17.10	3.304187	0.60305	.	.	ENSG00000184348	ENST00000330180	T	0.67345	-0.26	4.06	4.06	0.47325	.	0.000000	0.32503	U	0.006009	T	0.70727	0.3257	.	.	.	0.33743	D	0.619689	.	.	.	.	.	.	T	0.76088	-0.3087	7	0.72032	D	0.01	.	16.104	0.81205	0.0:1.0:0.0:0.0	.	.	.	.	N	73	ENSP00000330307:D73N	ENSP00000330307:D73N	D	-	1	0	HIST1H2AK	27913880	1.000000	0.71417	0.998000	0.56505	0.529000	0.34654	4.542000	0.60677	2.184000	0.69523	0.555000	0.69702	GAC	HIST1H2AK	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184348		0.647	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AK	HGNC	protein_coding	OTTHUMT00000043814.1	148	0.00	0	C	NM_003510		27805901	27805901	-1	no_errors	ENST00000330180	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	1.000	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29974373	29974373	+	RNA	DEL	C	C	-			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr6:29974373delC	ENST00000376797.3	-	0	1346				ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|HLA-J_ENST00000462773.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CAGACGCCGACGATGGGGTCA	0.687																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29974373delC				RNA	DEL	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.687	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	12	0.00	0	C	NR_026751		29974373	29974373	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.000	-
HTT	3064	genome.wustl.edu	37	4	3224137	3224137	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:3224137G>A	ENST00000355072.5	+	54	7538	c.7393G>A	c.(7393-7395)Gaa>Aaa	p.E2465K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2465					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TACTCAGTTTGAAGAAACTTG	0.542																																						dbGAP											0													77.0	78.0	78.0					4																	3224137		1985	4162	6147	-	-	-	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7393G>A	4.37:g.3224137G>A	ENSP00000347184:p.Glu2465Lys		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.E2465K	ENST00000355072.5	37	c.7393	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.702266	0.96812	.	.	ENSG00000197386	ENST00000355072	T	0.19938	2.11	5.17	5.17	0.71159	.	0.052328	0.85682	N	0.000000	T	0.40015	0.1100	L	0.39898	1.24	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.10636	-1.0621	10	0.52906	T	0.07	.	19.0998	0.93269	0.0:0.0:1.0:0.0	.	2465	P42858	HD_HUMAN	K	2465	ENSP00000347184:E2465K	ENSP00000347184:E2465K	E	+	1	0	HTT	3193935	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.458000	0.97634	2.600000	0.87896	0.650000	0.86243	GAA	HTT	-	NULL	ENSG00000197386		0.542	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	84	0.00	0	G	NM_002111		3224137	3224137	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	A
IGLON5	402665	genome.wustl.edu	37	19	51831946	51831946	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:51831946C>G	ENST00000270642.8	+	8	944	c.944C>G	c.(943-945)tCa>tGa	p.S315*		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	315						extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						CTGGAGAACTCAGCCCCGAGG	0.672																																						dbGAP											0													18.0	22.0	21.0					19																	51831946		1845	4073	5918	-	-	-	SO:0001587	stop_gained	0				CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.944C>G	19.37:g.51831946C>G	ENSP00000270642:p.Ser315*			Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S315*	ENST00000270642.8	37	c.944	CCDS46158.1	19	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940707	0.92526	.	.	ENSG00000142549	ENST00000270642	.	.	.	5.09	5.09	0.68999	.	0.601176	0.14942	N	0.289423	.	.	.	.	.	.	0.46874	D	0.999231	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-3.4524	13.978	0.64285	0.0:1.0:0.0:0.0	.	.	.	.	X	315	.	ENSP00000270642:S315X	S	+	2	0	IGLON5	56523758	0.972000	0.33761	0.965000	0.40720	0.926000	0.56050	2.472000	0.45136	2.381000	0.81170	0.462000	0.41574	TCA	IGLON5	-	NULL	ENSG00000142549		0.672	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGLON5	HGNC	protein_coding	OTTHUMT00000335149.1	68	0.00	0	C	NM_001101372		51831946	51831946	+1	no_errors	ENST00000270642	ensembl	human	known	69_37n	nonsense	36	12.20	5	SNP	0.930	G
IL1RAPL1	11141	genome.wustl.edu	37	X	29301288	29301288	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:29301288C>T	ENST00000378993.1	+	3	989	c.316C>T	c.(316-318)Cgg>Tgg	p.R106W	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.R106W	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	106	Ig-like C2-type 1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CATTTGGTTCCGGCCAACATT	0.448																																						dbGAP											0													108.0	92.0	98.0					X																	29301288		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.316C>T	X.37:g.29301288C>T	ENSP00000368278:p.Arg106Trp		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.R106W	ENST00000378993.1	37	c.316	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329896	0.60743	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.78246	-1.16;-1.16	5.81	4.92	0.64577	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.067596	0.64402	N	0.000016	D	0.83004	0.5160	L	0.47190	1.495	0.42364	D	0.992427	D	0.89917	1.0	D	0.74348	0.983	T	0.82436	-0.0458	10	0.42905	T	0.14	.	12.5036	0.55970	0.4299:0.5701:0.0:0.0	.	106	Q9NZN1	IRPL1_HUMAN	W	106	ENSP00000368278:R106W;ENSP00000305200:R106W	ENSP00000305200:R106W	R	+	1	2	IL1RAPL1	29211209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.676000	0.37565	1.161000	0.42604	0.600000	0.82982	CGG	IL1RAPL1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000169306		0.448	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	137	0.00	0	C	NM_014271		29301288	29301288	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	1.000	T
ISX	91464	genome.wustl.edu	37	22	35480375	35480375	+	Splice_Site	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr22:35480375G>C	ENST00000308700.6	+	3	1333		c.e3-1		ISX_ENST00000404699.2_Splice_Site	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox						regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CCTGATTACAGATCTGGTTCC	0.517																																						dbGAP											0													58.0	57.0	57.0					22																	35480375		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.382-1G>C	22.37:g.35480375G>C			Q68DJ5	Splice_Site	SNP	-	e3-1	ENST00000308700.6	37	c.382-1	CCDS33640.1	22	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945868	0.73672	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2978	0.87173	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ISX	33810375	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	9.294000	0.96088	2.757000	0.94681	0.655000	0.94253	.	ISX	-	-	ENSG00000175329		0.517	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1	100	0.00	0	G	NM_001008494	Intron	35480375	35480375	+1	no_errors	ENST00000308700	ensembl	human	known	69_37n	splice_site	36	12.20	5	SNP	1.000	C
KCTD1	284252	genome.wustl.edu	37	18	24035810	24035810	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr18:24035810C>G	ENST00000408011.3	-	5	1230	c.671G>C	c.(670-672)gGa>gCa	p.G224A	KCTD1_ENST00000317932.7_Missense_Mutation_p.G224A|KCTD1_ENST00000580059.1_Missense_Mutation_p.G224A|KCTD1_ENST00000417602.1_Missense_Mutation_p.G832A|KCTD1_ENST00000579973.1_Missense_Mutation_p.G224A	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	224					negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CGAGTCTACTCCTCCCCCACA	0.577																																						dbGAP											0													77.0	70.0	73.0					18																	24035810		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.671G>C	18.37:g.24035810C>G	ENSP00000384367:p.Gly224Ala		A8K1F5	Missense_Mutation	SNP	pfam_DUF3504,pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.G832A	ENST00000408011.3	37	c.2495	CCDS11888.1	18	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263977	0.80358	.	.	ENSG00000134504	ENST00000317932;ENST00000417602;ENST00000408011	D;D;D	0.87966	-1.67;-2.32;-1.67	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.93220	0.7840	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92398	0.5927	10	0.54805	T	0.06	.	20.4366	0.99092	0.0:1.0:0.0:0.0	.	224	Q719H9	KCTD1_HUMAN	A	224;832;224	ENSP00000314831:G224A;ENSP00000408405:G832A;ENSP00000384367:G224A	ENSP00000314831:G224A	G	-	2	0	KCTD1	22289808	1.000000	0.71417	0.949000	0.38748	0.573000	0.36030	7.471000	0.80985	2.837000	0.97791	0.591000	0.81541	GGA	KCTD1	-	NULL	ENSG00000134504		0.577	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	KCTD1	HGNC	protein_coding	OTTHUMT00000446265.1	91	0.00	0	C	XM_209091		24035810	24035810	-1	no_errors	ENST00000417602	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	G
KIAA1045	23349	genome.wustl.edu	37	9	34977582	34977584	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:34977582_34977584delCAG	ENST00000242315.3	+	7	1132_1134	c.1050_1052delCAG	c.(1048-1053)gccagc>gcc	p.S354del	KIAA1045_ENST00000544237.1_In_Frame_Del_p.S354del|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	354							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			GCAGCCCAGCCAGCAGCAGCAGC	0.596																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.1050_1052delCAG	9.37:g.34977591_34977593delCAG	ENSP00000242315:p.Ser354del		B7Z253|Q58FE9|Q5T662	In_Frame_Del	DEL	superfamily_Znf_FYVE_PHD	p.S354in_frame_del	ENST00000242315.3	37	c.1050_1052	CCDS43796.1	9																																																																																			KIAA1045	-	NULL	ENSG00000122733		0.596	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	48	0.00	0	CAG	XM_048592		34977582	34977584	+1	no_errors	ENST00000242315	ensembl	human	known	69_37n	in_frame_del	26	10.34	3	DEL	1.000:1.000:1.000	-
KIAA2022	340533	genome.wustl.edu	37	X	73963037	73963037	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:73963037G>A	ENST00000055682.6	-	3	1966	c.1355C>T	c.(1354-1356)gCt>gTt	p.A452V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	452					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTCACCCATAGCATCATATGA	0.473																																						dbGAP											0													108.0	83.0	92.0					X																	73963037		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1355C>T	X.37:g.73963037G>A	ENSP00000055682:p.Ala452Val		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.A452V	ENST00000055682.6	37	c.1355	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	9.903	1.207404	0.22205	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29397	1.57;1.57	6.03	6.03	0.97812	.	0.415470	0.28442	N	0.015327	T	0.13072	0.0317	N	0.03115	-0.41	0.22896	N	0.998596	B	0.14805	0.011	B	0.13407	0.009	T	0.12941	-1.0528	10	0.30078	T	0.28	-0.3993	7.0139	0.24877	0.222:0.0:0.778:0.0	.	452	Q5QGS0	K2022_HUMAN	V	452	ENSP00000362567:A452V;ENSP00000055682:A452V	ENSP00000055682:A452V	A	-	2	0	KIAA2022	73879762	1.000000	0.71417	0.998000	0.56505	0.918000	0.54935	5.946000	0.70234	2.554000	0.86153	0.600000	0.82982	GCT	KIAA2022	-	NULL	ENSG00000050030		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	216	0.00	0	G	NM_001008537		73963037	73963037	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	141	16.07	27	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76430698	76430698	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr13:76430698C>T	ENST00000465261.2	+	26	4779	c.4019C>T	c.(4018-4020)tCa>tTa	p.S1340L	LMO7_ENST00000526202.1_Silent_p.I1253I|LMO7_ENST00000321797.8_Silent_p.I1376I|LMO7_ENST00000377534.3_Intron|LMO7_ENST00000341547.4_Silent_p.I1327I|LMO7_ENST00000357063.3_Missense_Mutation_p.S1625L	NM_015842.2	NP_056667.2	Q8WWI1	LMO7_HUMAN	LIM domain 7	0					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAGTCAGGATCAGAAACCACC	0.448																																						dbGAP											0													156.0	152.0	154.0					13																	76430698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000465261.2:c.4019C>T	13.37:g.76430698C>T	ENSP00000433352:p.Ser1340Leu		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.S1625L	ENST00000465261.2	37	c.4874	CCDS53876.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.179706	0.94846	.	.	ENSG00000136153	ENST00000357063;ENST00000465261	T;T	0.46451	1.43;0.87	5.85	5.85	0.93711	.	.	.	.	.	T	0.67373	0.2886	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.69442	-0.5144	8	0.87932	D	0	-16.4014	20.1736	0.98170	0.0:1.0:0.0:0.0	.	1340	E9PLH4	.	L	1625;1340	ENSP00000349571:S1625L;ENSP00000433352:S1340L	ENSP00000349571:S1625L	S	+	2	0	LMO7	75328699	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	4.427000	0.59888	2.767000	0.95098	0.557000	0.71058	TCA	LMO7	-	NULL	ENSG00000136153		0.448	LMO7-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045298.4	175	0.00	0	C	NM_005358		76430698	76430698	+1	no_errors	ENST00000357063	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44104553	44104553	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr18:44104553C>T	ENST00000398722.4	-	24	3917	c.3918G>A	c.(3916-3918)ggG>ggA	p.G1306G	LOXHD1_ENST00000300591.6_Silent_p.G473G|LOXHD1_ENST00000536736.1_Silent_p.G1584G|LOXHD1_ENST00000582408.1_Silent_p.G473G|LOXHD1_ENST00000441893.2_Silent_p.G517G|LOXHD1_ENST00000441551.2_Silent_p.G1378G|LOXHD1_ENST00000579038.1_Silent_p.G377G			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1306					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TGCTGCGGTCCCCAGTGTACT	0.632																																						dbGAP											0													52.0	58.0	56.0					18																	44104553		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3918G>A	18.37:g.44104553C>T			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.G1584	ENST00000398722.4	37	c.4752		18																																																																																			LOXHD1	-	NULL	ENSG00000167210		0.632	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		105	0.00	0	C	NM_144612		44104553	44104553	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	silent	43	16.98	9	SNP	1.000	T
MDN1	23195	genome.wustl.edu	37	6	90371881	90371881	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr6:90371881C>G	ENST00000369393.3	-	87	14605	c.14490G>C	c.(14488-14490)aaG>aaC	p.K4830N	MDN1_ENST00000428876.1_Missense_Mutation_p.K4830N			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4830					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTTCTTCCTTCTTATCTTGCT	0.358																																						dbGAP											0													340.0	304.0	317.0					6																	90371881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.14490G>C	6.37:g.90371881C>G	ENSP00000358400:p.Lys4830Asn		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K4830N	ENST00000369393.3	37	c.14490	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	3.000	-0.206157	0.06180	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03689	3.84;3.84	5.1	1.2	0.21068	.	0.534671	0.19871	N	0.104185	T	0.01029	0.0034	L	0.46157	1.445	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.48055	-0.9068	10	0.20519	T	0.43	.	6.1111	0.20102	0.0:0.5249:0.1275:0.3477	.	4830	Q9NU22	MDN1_HUMAN	N	4830	ENSP00000358400:K4830N;ENSP00000413970:K4830N	ENSP00000358400:K4830N	K	-	3	2	MDN1	90428602	0.368000	0.25031	0.721000	0.30653	0.080000	0.17528	0.208000	0.17415	0.257000	0.21650	0.585000	0.79938	AAG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.358	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	773	0.00	0	C			90371881	90371881	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	351	11.56	46	SNP	0.144	G
MIR412	574433	genome.wustl.edu	37	14	101531971	101531971	+	RNA	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr14:101531971G>A	ENST00000362142.2	+	0	91				MIR369_ENST00000362155.3_RNA|MIR409_ENST00000362237.1_RNA|MIR656_ENST00000385224.1_RNA|MIR410_ENST00000362222.2_RNA|MIR541_ENST00000401360.1_RNA	NR_030155.1				microRNA 412																		TCGCTTTATTGACTTCGAATA	0.537																																						dbGAP											0													156.0	141.0	146.0					14																	101531971		1568	3582	5150	-	-	-			0					14q32.31	2011-09-12		2008-12-18	ENSG00000199012	ENSG00000199012		"""ncRNAs / Micro RNAs"""	32064	non-coding RNA	RNA, micro				MIRN412			Standard	NR_030155		Approved	hsa-mir-412	uc021sds.1				14.37:g.101531971G>A				RNA	SNP	-	NULL	ENST00000362142.2	37	NULL		14																																																																																			MIR369	-	-	ENSG00000199025		0.537	MIR412-201	KNOWN	basic	miRNA	MIR369	HGNC	miRNA		262	0.00	0	G	NR_030155		101531971	101531971	+1	no_errors	ENST00000362155	ensembl	human	known	69_37n	rna	99	18.18	22	SNP	0.948	A
MMS19	64210	genome.wustl.edu	37	10	99222427	99222427	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr10:99222427G>T	ENST00000438925.2	-	20	2260	c.1925C>A	c.(1924-1926)tCa>tAa	p.S642*	MMS19_ENST00000327238.10_Nonsense_Mutation_p.S544*|MMS19_ENST00000355839.6_Nonsense_Mutation_p.S599*|MMS19_ENST00000327277.7_Nonsense_Mutation_p.S278*|MMS19_ENST00000370782.2_Nonsense_Mutation_p.S642*	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	642					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		TCTCAGAACTGAGGGCTCCTT	0.468								Direct reversal of damage																														dbGAP											0													158.0	129.0	139.0					10																	99222427		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.1925C>A	10.37:g.99222427G>T	ENSP00000412698:p.Ser642*		B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Nonsense_Mutation	SNP	pfam_Tscrpt_MMS19_N,superfamily_ARM-type_fold	p.S642*	ENST00000438925.2	37	c.1925	CCDS7464.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	47|47	13.020666|13.020666	0.99713|0.99713	.|.	.|.	ENSG00000155229|ENSG00000155229	ENST00000434538|ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000327277;ENST00000327253;ENST00000355839	.|.	.|.	.|.	5.72|5.72	4.82|4.82	0.62117|0.62117	.|.	.|0.191011	.|0.49305	.|D	.|0.000149	T|.	0.37919|.	0.1021|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39482|.	-0.9612|.	3|.	.|0.06891	.|T	.|0.86	.|.	13.1173|13.1173	0.59307|0.59307	0.0742:0.0:0.9258:0.0|0.0742:0.0:0.9258:0.0	.|.	.|.	.|.	.|.	K|X	217|642;642;544;621;278;227;599	.|.	.|ENSP00000320059:S544X	Q|S	-|-	1|2	0|0	MMS19|MMS19	99212417|99212417	0.995000|0.995000	0.38212|0.38212	0.996000|0.996000	0.52242|0.52242	0.794000|0.794000	0.44872|0.44872	5.910000|5.910000	0.69931|0.69931	1.436000|1.436000	0.47453|0.47453	-0.151000|-0.151000	0.13558|0.13558	CAG|TCA	MMS19	-	superfamily_ARM-type_fold	ENSG00000155229		0.468	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS19	HGNC	protein_coding	OTTHUMT00000049706.2	235	0.00	0	G			99222427	99222427	-1	no_errors	ENST00000370782	ensembl	human	known	69_37n	nonsense	113	14.39	19	SNP	0.333	T
MUC17	140453	genome.wustl.edu	37	7	100685492	100685492	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:100685492C>T	ENST00000306151.4	+	3	10859	c.10795C>T	c.(10795-10797)Cct>Tct	p.P3599S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3599	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P3599S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACCTTCCACTCCTTCTGTTGA	0.468																																						dbGAP											1	Substitution - Missense(1)	skin(1)											162.0	153.0	156.0					7																	100685492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10795C>T	7.37:g.100685492C>T	ENSP00000302716:p.Pro3599Ser		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P3599S	ENST00000306151.4	37	c.10795	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285212	0.05605	.	.	ENSG00000169876	ENST00000306151	T	0.01947	4.54	1.23	-2.46	0.06461	.	.	.	.	.	T	0.02380	0.0073	N	0.14661	0.345	0.09310	N	1	B	0.31931	0.347	P	0.48901	0.594	T	0.38779	-0.9645	9	0.06236	T	0.91	.	8.1467	0.31115	0.4923:0.5077:0.0:0.0	.	3599	Q685J3	MUC17_HUMAN	S	3599	ENSP00000302716:P3599S	ENSP00000302716:P3599S	P	+	1	0	MUC17	100472212	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.933000	0.00168	-1.984000	0.00985	-1.041000	0.02371	CCT	MUC17	-	NULL	ENSG00000169876		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	178	0.00	0	C	NM_001040105		100685492	100685492	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	88	26.67	32	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195490502	195490502	+	Silent	SNP	G	G	A	rs540712980		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr3:195490502G>A	ENST00000346145.4	-	11	1386	c.1347C>T	c.(1345-1347)ttC>ttT	p.F449F	MUC4_ENST00000463781.3_Silent_p.F4685F|MUC4_ENST00000349607.4_Silent_p.F398F|MUC4_ENST00000475231.1_Silent_p.F4633F	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1442					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGGTCCCCGAACATCCAGG	0.572													.|||	1	0.000199681	0.0	0.0	5008	,	,		19812	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													24.0	22.0	23.0					3																	195490502		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.1347C>T	3.37:g.195490502G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.F4685	ENST00000346145.4	37	c.14055	CCDS3310.1	3																																																																																			MUC4	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000145113		0.572	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	31	0.00	0	G	NM_018406		195490502	195490502	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	10	33.33	5	SNP	0.995	A
MYBPC1	4604	genome.wustl.edu	37	12	102040663	102040663	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:102040663G>C	ENST00000550270.1	+	11	1013	c.1013G>C	c.(1012-1014)aGa>aCa	p.R338T	MYBPC1_ENST00000361466.2_Missense_Mutation_p.R363T|MYBPC1_ENST00000553190.1_Missense_Mutation_p.R338T|MYBPC1_ENST00000547405.1_Missense_Mutation_p.R312T|MYBPC1_ENST00000392934.3_Missense_Mutation_p.R325T|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Missense_Mutation_p.R324T|MYBPC1_ENST00000452455.2_Missense_Mutation_p.R338T|MYBPC1_ENST00000549145.1_Missense_Mutation_p.R351T|MYBPC1_ENST00000545503.2_Missense_Mutation_p.R338T|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000536007.1_Missense_Mutation_p.R319T|MYBPC1_ENST00000541119.1_Missense_Mutation_p.R326T|MYBPC1_ENST00000551300.1_Missense_Mutation_p.R239T|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000441232.1_Missense_Mutation_p.R338T|MYBPC1_ENST00000360610.2_Missense_Mutation_p.R338T|MYBPC1_ENST00000361685.2_Missense_Mutation_p.R363T			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	338	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						CTCTTCGTAAGAGGTAAAAAT	0.423																																						dbGAP											0													100.0	96.0	97.0					12																	102040663		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1013G>C	12.37:g.102040663G>C	ENSP00000449702:p.Arg338Thr		B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R363T	ENST00000550270.1	37	c.1088	CCDS9085.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230186	0.79688	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.88	5.88	0.94601	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000077	T	0.43411	0.1246	N	0.10664	0.02	0.48571	D	0.999673	P;P;P;P;P;P;P;P;P;P;D	0.55385	0.902;0.773;0.892;0.907;0.88;0.615;0.855;0.907;0.701;0.944;0.971	P;B;P;B;P;B;P;P;B;P;P	0.56960	0.573;0.445;0.552;0.445;0.808;0.434;0.648;0.515;0.264;0.709;0.81	T	0.53436	-0.8439	10	0.87932	D	0	.	20.2187	0.98312	0.0:0.0:1.0:0.0	.	319;326;338;338;325;312;338;338;363;363;351	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	T	312;338;338;338;325;324;363;351;338;363;338;319;326;363;239;338	ENSP00000448175:R312T;ENSP00000400908:R338T;ENSP00000388989:R338T;ENSP00000353822:R338T;ENSP00000376665:R325T;ENSP00000447362:R324T;ENSP00000354845:R363T;ENSP00000447660:R351T;ENSP00000447900:R338T;ENSP00000440034:R338T;ENSP00000446128:R319T;ENSP00000442847:R326T;ENSP00000354849:R363T;ENSP00000447116:R239T;ENSP00000449702:R338T	ENSP00000353822:R338T	R	+	2	0	MYBPC1	100564794	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.056000	0.71111	2.780000	0.95670	0.655000	0.94253	AGA	MYBPC1	-	smart_Ig_sub	ENSG00000196091		0.423	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	167	0.00	0	G			102040663	102040663	+1	no_errors	ENST00000361466	ensembl	human	known	69_37n	missense	75	20.21	19	SNP	1.000	C
MYBPC2	4606	genome.wustl.edu	37	19	50945512	50945512	+	Missense_Mutation	SNP	G	G	C	rs35951152	byFrequency	TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:50945512G>C	ENST00000357701.5	+	9	895	c.844G>C	c.(844-846)Gac>Cac	p.D282H		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	282	Ig-like C2-type 2.		D -> N (in dbSNP:rs35951152).		cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGAGATCAGCGACCCAGACCT	0.542																																						dbGAP											0													73.0	76.0	75.0					19																	50945512		2046	4180	6226	-	-	-	SO:0001583	missense	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.844G>C	19.37:g.50945512G>C	ENSP00000350332:p.Asp282His		A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D282H	ENST00000357701.5	37	c.844	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	g	19.43	3.825939	0.71143	.	.	ENSG00000086967	ENST00000357701	T	0.68025	-0.3	4.43	4.43	0.53597	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.177991	0.23678	U	0.045657	T	0.79936	0.4532	M	0.79693	2.465	0.46798	D	0.999206	D	0.89917	1.0	D	0.81914	0.995	T	0.79957	-0.1584	10	0.45353	T	0.12	.	10.4223	0.44356	0.0955:0.0:0.9045:0.0	.	282	Q14324	MYPC2_HUMAN	H	282	ENSP00000350332:D282H	ENSP00000350332:D282H	D	+	1	0	MYBPC2	55637324	0.955000	0.32602	0.999000	0.59377	0.936000	0.57629	1.585000	0.36600	2.390000	0.81377	0.563000	0.77884	GAC	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.542	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	100	0.00	0	G	NM_004533		50945512	50945512	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	1.000	C
NACA	4666	genome.wustl.edu	37	12	57115051	57115051	+	Missense_Mutation	SNP	C	C	G	rs372797975		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:57115051C>G	ENST00000454682.1	-	3	544	c.263G>C	c.(262-264)gGa>gCa	p.G88A	NACA_ENST00000546392.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Missense_Mutation_p.G88A	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	88	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TAGGGCTGTTCCAGAGGATGA	0.567			T	BCL6	NHL																																	dbGAP		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													69.0	66.0	67.0					12																	57115051		1568	3582	5150	-	-	-	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.263G>C	12.37:g.57115051C>G	ENSP00000403817:p.Gly88Ala			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx	p.G88A	ENST00000454682.1	37	c.263		12	.	.	.	.	.	.	.	.	.	.	C	6.471	0.455151	0.12283	.	.	ENSG00000196531	ENST00000454682;ENST00000550952	T;T	0.44881	0.91;1.03	3.22	-0.119	0.13543	.	.	.	.	.	T	0.18087	0.0434	N	0.08118	0	0.09310	N	1	P;P	0.46987	0.888;0.728	B;B	0.41374	0.355;0.14	T	0.08086	-1.0739	9	0.31617	T	0.26	.	2.2534	0.04049	0.2451:0.4509:0.0:0.3039	.	88;88	E9PAV3;F8VU71	.;.	A	88	ENSP00000403817:G88A;ENSP00000448035:G88A	ENSP00000403817:G88A	G	-	2	0	NACA	55401318	0.000000	0.05858	0.019000	0.16419	0.273000	0.26683	0.001000	0.13038	0.196000	0.20367	0.306000	0.20318	GGA	NACA	-	NULL	ENSG00000196531		0.567	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		239	0.00	0	C	NM_005594		57115051	57115051	-1	no_errors	ENST00000454682	ensembl	human	known	69_37n	missense	132	17.50	28	SNP	0.004	G
NBAS	51594	genome.wustl.edu	37	2	15374758	15374758	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:15374758C>T	ENST00000281513.5	-	46	6082	c.6057G>A	c.(6055-6057)caG>caA	p.Q2019Q	NBAS_ENST00000441750.1_Silent_p.Q1899Q	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2019					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CTAGCAGCTGCTGAATCATTG	0.428																																						dbGAP											0													97.0	93.0	94.0					2																	15374758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6057G>A	2.37:g.15374758C>T			O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39	p.S1067N	ENST00000281513.5	37	c.3200	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	C	9.255	1.041665	0.19748	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.79	4.91	0.64330	.	.	.	.	.	T	0.71126	0.3303	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70539	-0.4844	4	.	.	.	.	15.2278	0.73364	0.0:0.932:0.0:0.068	.	.	.	.	N	1067	.	.	S	-	2	0	NBAS	15292209	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.966000	0.29331	1.449000	0.47699	0.650000	0.86243	AGC	NBAS	-	NULL	ENSG00000151779		0.428	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	127	0.00	0	C	NM_015909		15374758	15374758	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000442506	ensembl	human	novel	69_37n	missense	55	12.70	8	SNP	1.000	T
NCAPG2	54892	genome.wustl.edu	37	7	158449288	158449288	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:158449288C>T	ENST00000409423.1	-	19	2342	c.2170G>A	c.(2170-2172)Gag>Aag	p.E724K	NCAPG2_ENST00000541468.1_Missense_Mutation_p.E225K|NCAPG2_ENST00000275830.10_Missense_Mutation_p.E516K|NCAPG2_ENST00000409339.3_Missense_Mutation_p.E724K|NCAPG2_ENST00000449727.2_Missense_Mutation_p.E724K|NCAPG2_ENST00000356309.3_Missense_Mutation_p.E724K	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	724					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		TCAACAAGCTCCAGAATGTGC	0.532																																						dbGAP											0													51.0	56.0	54.0					7																	158449288		2007	4183	6190	-	-	-	SO:0001583	missense	0			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.2170G>A	7.37:g.158449288C>T	ENSP00000386569:p.Glu724Lys		A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Nonsense_Mutation	SNP	pfam_Condensin2_G2,superfamily_ARM-type_fold	p.W525*	ENST00000409423.1	37	c.1575	CCDS43686.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.536106|4.536106	0.85812|0.85812	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000541468;ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000545393;ENST00000449727|ENST00000441982	T;T;T;T;T;T|.	0.52983|.	0.64;0.64;0.64;0.64;0.64;0.64|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.147534|.	0.64402|.	D|.	0.000016|.	T|.	0.76513|.	0.3998|.	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.998;1.0;1.0;0.998|.	D;D;D;D|.	0.91635|.	0.956;0.999;0.998;0.974|.	T|.	0.74674|.	-0.3586|.	10|.	0.46703|.	T|.	0.11|.	-18.227|-18.227	19.7096|19.7096	0.96089|0.96089	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	724;167;516;724|.	Q86XI2-2;B4DHE5;E7EUH9;Q86XI2|.	.;.;.;CNDG2_HUMAN|.	K|X	225;724;724;516;724;167;724|525	ENSP00000442337:E225K;ENSP00000348657:E724K;ENSP00000386569:E724K;ENSP00000275830:E516K;ENSP00000387007:E724K;ENSP00000388326:E724K|.	ENSP00000275830:E516K|.	E|W	-|-	1|3	0|0	NCAPG2|NCAPG2	158142049|158142049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.094000|0.094000	0.18550|0.18550	7.327000|7.327000	0.79147|0.79147	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	GAG|TGG	NCAPG2	-	pfam_Condensin2_G2	ENSG00000146918		0.532	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	HGNC	protein_coding	OTTHUMT00000327111.1	95	0.00	0	C	NM_017760		158449288	158449288	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441982	ensembl	human	known	69_37n	nonsense	52	11.86	7	SNP	1.000	T
NLRP13	126204	genome.wustl.edu	37	19	56423843	56423843	+	Nonsense_Mutation	SNP	G	G	C	rs187553647		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:56423843G>C	ENST00000342929.3	-	5	1339	c.1340C>G	c.(1339-1341)tCa>tGa	p.S447*	NLRP13_ENST00000588751.1_Nonsense_Mutation_p.S447*	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	447	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CTGAGTGATTGACTGGAGATC	0.483																																						dbGAP											0													99.0	99.0	99.0					19																	56423843		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1340C>G	19.37:g.56423843G>C	ENSP00000343891:p.Ser447*		Q7RTR5	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S447*	ENST00000342929.3	37	c.1340	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230251	0.58777	.	.	ENSG00000173572	ENST00000342929	.	.	.	2.55	-2.41	0.06562	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	2.6019	0.04868	0.327:0.0:0.4323:0.2407	.	.	.	.	X	447	.	ENSP00000343891:S447X	S	-	2	0	NLRP13	61115655	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.052000	0.11865	-0.223000	0.09943	0.591000	0.81541	TCA	NLRP13	-	NULL	ENSG00000173572		0.483	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	75	0.00	0	G	NM_176810		56423843	56423843	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	nonsense	87	25.64	30	SNP	0.000	C
NLRP13	126204	genome.wustl.edu	37	19	56424232	56424232	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:56424232G>C	ENST00000342929.3	-	5	950	c.951C>G	c.(949-951)atC>atG	p.I317M	NLRP13_ENST00000588751.1_Missense_Mutation_p.I317M	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	317	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ACTCAGATATGATTATTTCCT	0.453																																						dbGAP											0													75.0	76.0	76.0					19																	56424232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.951C>G	19.37:g.56424232G>C	ENSP00000343891:p.Ile317Met		Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.I317M	ENST00000342929.3	37	c.951	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	3.291	-0.144847	0.06627	.	.	ENSG00000173572	ENST00000342929	T	0.78126	-1.15	2.13	-1.76	0.08006	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.55689	0.1936	N	0.08118	0	0.09310	N	1	B	0.26775	0.159	B	0.34138	0.176	T	0.49744	-0.8907	9	0.48119	T	0.1	.	2.8426	0.05534	0.3292:0.2458:0.425:0.0	.	317	Q86W25	NAL13_HUMAN	M	317	ENSP00000343891:I317M	ENSP00000343891:I317M	I	-	3	3	NLRP13	61116044	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.801000	0.00761	-0.284000	0.09102	0.591000	0.81541	ATC	NLRP13	-	pfscan_NACHT_NTPase	ENSG00000173572		0.453	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	103	0.00	0	G	NM_176810		56424232	56424232	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	missense	126	24.55	41	SNP	0.000	C
NPAT	4863	genome.wustl.edu	37	11	108047018	108047018	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr11:108047018C>T	ENST00000278612.8	-	12	1192	c.1087G>A	c.(1087-1089)Gaa>Aaa	p.E363K	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	363					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		AGATTAGTTTCATCTGCTAAG	0.284																																						dbGAP											0													69.0	66.0	67.0					11																	108047018		1791	4055	5846	-	-	-	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1087G>A	11.37:g.108047018C>T	ENSP00000278612:p.Glu363Lys		A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.E363K	ENST00000278612.8	37	c.1087	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579641	0.86645	.	.	ENSG00000149308	ENST00000278612	T	0.05649	3.41	5.69	5.69	0.88448	.	0.139484	0.49916	D	0.000136	T	0.21022	0.0506	M	0.67953	2.075	0.39095	D	0.961179	D;D	0.71674	0.998;0.998	D;D	0.66084	0.941;0.941	T	0.00185	-1.1943	10	0.62326	D	0.03	-15.0071	13.0658	0.59032	0.0:0.9265:0.0:0.0735	.	363;363	B9EG70;Q14207	.;NPAT_HUMAN	K	363	ENSP00000278612:E363K	ENSP00000278612:E363K	E	-	1	0	NPAT	107552228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.383000	0.52471	2.675000	0.91044	0.563000	0.77884	GAA	NPAT	-	NULL	ENSG00000149308		0.284	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	200	0.00	0	C	NM_002519		108047018	108047018	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	missense	85	11.46	11	SNP	1.000	T
NUFIP1	26747	genome.wustl.edu	37	13	45540046	45540046	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr13:45540046C>G	ENST00000379161.4	-	6	806	c.760G>C	c.(760-762)Gaa>Caa	p.E254Q		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	254					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TTCTTCCTTTCAATATTGGCC	0.313																																						dbGAP											0													141.0	126.0	131.0					13																	45540046		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.760G>C	13.37:g.45540046C>G	ENSP00000368459:p.Glu254Gln		Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E254Q	ENST00000379161.4	37	c.760	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610827	0.66558	.	.	ENSG00000083635	ENST00000379161	T	0.53423	0.62	4.89	4.89	0.63831	.	0.119433	0.56097	D	0.000027	T	0.59838	0.2223	L	0.48260	1.515	0.45648	D	0.998573	D	0.89917	1.0	D	0.91635	0.999	T	0.53436	-0.8439	10	0.31617	T	0.26	.	13.7443	0.62865	0.0:1.0:0.0:0.0	.	254	Q9UHK0	NUFP1_HUMAN	Q	254	ENSP00000368459:E254Q	ENSP00000368459:E254Q	E	-	1	0	NUFIP1	44438046	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.661000	0.54503	2.699000	0.92147	0.561000	0.74099	GAA	NUFIP1	-	pfam_NUFIP1_cons_dom	ENSG00000083635		0.313	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	438	0.23	1	C	NM_012345		45540046	45540046	-1	no_errors	ENST00000379161	ensembl	human	known	69_37n	missense	191	13.18	29	SNP	1.000	G
OPRL1	4987	genome.wustl.edu	37	20	62729457	62729457	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr20:62729457C>G	ENST00000349451.3	+	5	948	c.536C>G	c.(535-537)tCt>tGt	p.S179C	OPRL1_ENST00000336866.2_Missense_Mutation_p.S179C|OPRL1_ENST00000355631.4_Missense_Mutation_p.S179C	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	179					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GCCCTGGCCTCTGTTGTCGGT	0.647																																						dbGAP											0													88.0	77.0	81.0					20																	62729457		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.536C>G	20.37:g.62729457C>G	ENSP00000336764:p.Ser179Cys		Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_X_opioid_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_W_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.S179C	ENST00000349451.3	37	c.536	CCDS13556.1	20	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959675	0.74016	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.37584	1.19;1.19;1.19	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.117031	0.64402	D	0.000011	T	0.57431	0.2053	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.60193	-0.7311	10	0.66056	D	0.02	.	18.3439	0.90314	0.0:1.0:0.0:0.0	.	174;179	P41146-2;P41146	.;OPRX_HUMAN	C	179	ENSP00000336843:S179C;ENSP00000347848:S179C;ENSP00000336764:S179C	ENSP00000336843:S179C	S	+	2	0	OPRL1	62199901	1.000000	0.71417	0.932000	0.37286	0.442000	0.32017	7.619000	0.83057	2.347000	0.79759	0.449000	0.29647	TCT	OPRL1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_7TM_GPCR_Rhodpsn,prints_Neuropept_W_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000125510		0.647	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	HGNC	protein_coding	OTTHUMT00000080295.1	117	0.00	0	C	NM_182647		62729457	62729457	+1	no_errors	ENST00000336866	ensembl	human	known	69_37n	missense	76	14.61	13	SNP	1.000	G
OR52N5	390075	genome.wustl.edu	37	11	5799262	5799262	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr11:5799262G>C	ENST00000317093.2	-	1	635	c.603C>G	c.(601-603)atC>atG	p.I201M	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CATTGACCTTGATGCTGGCAC	0.418																																						dbGAP											0													158.0	137.0	144.0					11																	5799262		2123	4086	6209	-	-	-	SO:0001583	missense	0			AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.603C>G	11.37:g.5799262G>C	ENSP00000322866:p.Ile201Met		B9EH12|Q6IFG2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	p.I201M	ENST00000317093.2	37	c.603	CCDS31397.1	11	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096043	0.36952	.	.	ENSG00000181009	ENST00000317093	T	0.00130	8.69	3.7	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31392	U	0.007736	T	0.00440	0.0014	M	0.86651	2.83	0.09310	N	1	P	0.52463	0.953	P	0.62649	0.905	T	0.23762	-1.0179	10	0.87932	D	0	.	10.6551	0.45669	0.1047:0.0:0.8953:0.0	.	201	Q8NH56	O52N5_HUMAN	M	201	ENSP00000322866:I201M	ENSP00000322866:I201M	I	-	3	3	OR52N5	5755838	0.000000	0.05858	0.994000	0.49952	0.739000	0.42172	0.035000	0.13797	2.066000	0.61787	0.494000	0.49563	ATC	OR52N5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181009		0.418	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N5	HGNC	protein_coding	OTTHUMT00000401141.1	85	0.00	0	G	NM_001001922		5799262	5799262	-1	no_errors	ENST00000317093	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	0.261	C
OR10G4	390264	genome.wustl.edu	37	11	123887198	123887198	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr11:123887198C>A	ENST00000320891.4	+	1	917	c.917C>A	c.(916-918)gCa>gAa	p.A306E		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GACAAAGTAGCACATCCTCAG	0.348																																						dbGAP											0													60.0	57.0	58.0					11																	123887198		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.917C>A	11.37:g.123887198C>A	ENSP00000325076:p.Ala306Glu		Q6IEW0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A306E	ENST00000320891.4	37	c.917	CCDS31702.1	11	.	.	.	.	.	.	.	.	.	.	c	5.931	0.355756	0.11239	.	.	ENSG00000254737	ENST00000320891	T	0.09073	3.02	3.05	-0.64	0.11493	.	2.105340	0.02504	N	0.090742	T	0.06325	0.0163	L	0.27053	0.805	0.09310	N	1	B	0.18863	0.031	B	0.21360	0.034	T	0.36768	-0.9734	10	0.11485	T	0.65	.	6.1092	0.20092	0.0:0.4392:0.0:0.5608	.	306	Q8NGN3	O10G4_HUMAN	E	306	ENSP00000325076:A306E	ENSP00000325076:A306E	A	+	2	0	OR10G4	123392408	0.131000	0.22433	0.000000	0.03702	0.074000	0.17049	0.882000	0.28186	-0.011000	0.14247	0.580000	0.79431	GCA	OR10G4	-	NULL	ENSG00000254737		0.348	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G4	HGNC	protein_coding	OTTHUMT00000387268.1	145	0.00	0	C	NM_001004462		123887198	123887198	+1	no_errors	ENST00000320891	ensembl	human	known	69_37n	missense	78	14.29	13	SNP	0.000	A
PCDHA7	56141	genome.wustl.edu	37	5	140214152	140214152	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:140214152C>T	ENST00000525929.1	+	1	184	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.R62C|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGTGCCGCGCCTGTTCCG	0.607																																					NSCLC(160;258 2013 5070 22440 28951)	dbGAP											0													69.0	86.0	80.0					5																	140214152		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.184C>T	5.37:g.140214152C>T	ENSP00000436426:p.Arg62Cys		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R62C	ENST00000525929.1	37	c.184	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709981	0.68730	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.42131	0.98;0.98	4.17	3.23	0.37069	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.68284	0.2984	H	0.99117	4.435	0.42538	D	0.993062	D;D	0.64830	0.994;0.992	P;P	0.49477	0.477;0.612	T	0.82305	-0.0523	9	0.87932	D	0	.	11.8455	0.52381	0.2995:0.7004:0.0:0.0	.	62;62	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	C	62	ENSP00000436426:R62C;ENSP00000367365:R62C	ENSP00000367365:R62C	R	+	1	0	PCDHA7	140194336	0.922000	0.31269	1.000000	0.80357	0.946000	0.59487	1.800000	0.38833	2.028000	0.59812	0.449000	0.29647	CGC	PCDHA7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000204963		0.607	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	83	0.00	0	C	NM_018910		140214152	140214152	+1	no_errors	ENST00000525929	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.996	T
PCDHB7	56129	genome.wustl.edu	37	5	140552525	140552525	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:140552525G>A	ENST00000231137.3	+	1	283	c.109G>A	c.(109-111)Gag>Aag	p.E37K		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	37	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTTGTGGCGGAGGAAACCGA	0.512																																						dbGAP											0													131.0	123.0	126.0					5																	140552525		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.109G>A	5.37:g.140552525G>A	ENSP00000231137:p.Glu37Lys		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E37K	ENST00000231137.3	37	c.109	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035431	0.75617	.	.	ENSG00000113212	ENST00000231137	T	0.60299	0.2	4.79	3.86	0.44501	Cadherin, N-terminal (1);	.	.	.	.	D	0.84696	0.5529	H	0.98446	4.235	0.43771	D	0.996296	D	0.89917	1.0	D	0.97110	1.0	D	0.90763	0.4666	9	0.87932	D	0	.	15.2147	0.73254	0.0:0.141:0.859:0.0	.	37	Q9Y5E2	PCDB7_HUMAN	K	37	ENSP00000231137:E37K	ENSP00000231137:E37K	E	+	1	0	PCDHB7	140532709	1.000000	0.71417	0.946000	0.38457	0.679000	0.39708	7.536000	0.82023	2.357000	0.79964	0.655000	0.94253	GAG	PCDHB7	-	pfam_Cadherin_N,superfamily_Cadherin-like	ENSG00000113212		0.512	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	289	0.00	0	G	NM_018940		140552525	140552525	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	136	16.56	27	SNP	0.997	A
PCDHGB7	56099	genome.wustl.edu	37	5	140798033	140798033	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:140798033G>A	ENST00000398594.2	+	1	607	c.607G>A	c.(607-609)Gaa>Aaa	p.E203K	PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	203	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGGACCGAGAAACGCAGAG	0.478																																						dbGAP											0													64.0	65.0	65.0					5																	140798033		1929	4139	6068	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.607G>A	5.37:g.140798033G>A	ENSP00000381594:p.Glu203Lys		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E203K	ENST00000398594.2	37	c.607	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	32	5.176533	0.94846	.	.	ENSG00000254122	ENST00000398594	T	0.72394	-0.65	5.84	5.84	0.93424	Cadherin (4);Cadherin-like (1);	0.000000	0.33753	U	0.004592	D	0.91456	0.7303	H	0.98901	4.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94317	0.7550	10	0.87932	D	0	.	19.7483	0.96259	0.0:0.0:1.0:0.0	.	203;203	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	K	203	ENSP00000381594:E203K	ENSP00000381594:E203K	E	+	1	0	PCDHGB7	140778217	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.815000	0.99349	2.779000	0.95612	0.655000	0.94253	GAA	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254122		0.478	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	76	0.00	0	G	NM_018927		140798033	140798033	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	141	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	43	41.10	30	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	145001160	145001160	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr8:145001160C>G	ENST00000322810.4	-	29	4510	c.4341G>C	c.(4339-4341)gaG>gaC	p.E1447D	PLEC_ENST00000527096.1_Missense_Mutation_p.E1333D|PLEC_ENST00000398774.2_Missense_Mutation_p.E1278D|PLEC_ENST00000357649.2_Missense_Mutation_p.E1314D|PLEC_ENST00000356346.3_Missense_Mutation_p.E1296D|PLEC_ENST00000354958.2_Missense_Mutation_p.E1288D|PLEC_ENST00000345136.3_Missense_Mutation_p.E1310D|PLEC_ENST00000436759.2_Missense_Mutation_p.E1337D|PLEC_ENST00000354589.3_Missense_Mutation_p.E1310D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1447	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGATGACACTCTCTGATCCCG	0.632																																						dbGAP											0													77.0	82.0	80.0					8																	145001160		2092	4206	6298	-	-	-	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4341G>C	8.37:g.145001160C>G	ENSP00000323856:p.Glu1447Asp		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E1447D	ENST00000322810.4	37	c.4341	CCDS43772.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.393|8.393	0.840118|0.840118	0.16891|0.16891	.|.	.|.	ENSG00000178209|ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096|ENST00000527303	D;D;D;T;T;D;D;D;D|.	0.91351|.	-2.83;-2.83;-2.83;2.12;2.12;-2.83;-2.83;-2.83;-2.83|.	4.97|4.97	1.91|1.91	0.25777|0.25777	.|.	0.080239|.	0.47852|.	U|.	0.000202|.	T|T	0.06050|0.06050	0.0157|0.0157	N|N	0.00246|0.00246	-1.78|-1.78	0.29910|0.29910	N|N	0.823635|0.823635	B;B;B;B;B;B;B;B|.	0.06786|.	0.001;0.0;0.0;0.0;0.0;0.0;0.001;0.001|.	B;B;B;B;B;B;B;B|.	0.06405|.	0.002;0.002;0.002;0.001;0.002;0.002;0.002;0.002|.	T|T	0.36311|0.36311	-0.9753|-0.9753	10|5	0.05525|.	T|.	0.97|.	.|.	3.4335|3.4335	0.07437|0.07437	0.1404:0.3945:0.3649:0.1002|0.1404:0.3945:0.3649:0.1002	.|.	1337;1296;1288;1447;1278;1310;1314;1310|.	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4|.	.;.;.;PLEC_HUMAN;.;.;.;.|.	D|T	1310;1314;1310;1278;1447;1288;1296;1337;1333|7	ENSP00000344848:E1310D;ENSP00000350277:E1314D;ENSP00000346602:E1310D;ENSP00000381756:E1278D;ENSP00000323856:E1447D;ENSP00000347044:E1288D;ENSP00000348702:E1296D;ENSP00000388180:E1337D;ENSP00000434583:E1333D|.	ENSP00000323856:E1447D|.	E|R	-|-	3|2	2|0	PLEC|PLEC	145073148|145073148	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.461000|0.461000	0.32589|0.32589	0.786000|0.786000	0.26844|0.26844	1.091000|1.091000	0.41335|0.41335	-0.404000|-0.404000	0.06349|0.06349	GAG|AGA	PLEC	-	smart_Spectrin/alpha-actinin	ENSG00000178209		0.632	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	88	0.00	0	C	NM_000445		145001160	145001160	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.998	G
PLXDC1	57125	genome.wustl.edu	37	17	37263689	37263689	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr17:37263689C>T	ENST00000315392.4	-	6	893	c.682G>A	c.(682-684)Gac>Aac	p.D228N	PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000444911.2_Missense_Mutation_p.D188N|PLXDC1_ENST00000394316.2_Missense_Mutation_p.D228N|PLXDC1_ENST00000539608.1_Missense_Mutation_p.D155N	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	228					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ATGCGGCCGTCATGGTGCAGA	0.517																																						dbGAP											0													80.0	69.0	73.0					17																	37263689		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.682G>A	17.37:g.37263689C>T	ENSP00000323927:p.Asp228Asn		B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold	p.D228N	ENST00000315392.4	37	c.682	CCDS11333.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.56|13.56	2.272344|2.272344	0.40194|0.40194	.|.	.|.	ENSG00000161381|ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000539608;ENST00000444911;ENST00000394316;ENST00000441877|ENST00000444435	T;T;T;T;T|.	0.77750|.	-1.12;-1.12;-1.12;-1.12;-1.12|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.254100|.	0.37577|.	N|.	0.002038|.	T|T	0.34571|0.34571	0.0902|0.0902	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	P|.	0.52316|.	0.952|.	P|.	0.47075|.	0.536|.	T|T	0.21586|0.21586	-1.0241|-1.0241	10|5	0.13470|.	T|.	0.59|.	-14.851|-14.851	11.9222|11.9222	0.52797|0.52797	0.0:0.9151:0.0:0.0849|0.0:0.9151:0.0:0.0849	.|.	228|.	Q8IUK5|.	PXDC1_HUMAN|.	N|I	228;155;155;188;228;155|11	ENSP00000323927:D228N;ENSP00000441881:D155N;ENSP00000409687:D188N;ENSP00000377851:D228N;ENSP00000393227:D155N|.	ENSP00000323927:D228N|.	D|M	-|-	1|3	0|0	PLXDC1|PLXDC1	34517215|34517215	0.243000|0.243000	0.23878|0.23878	0.038000|0.038000	0.18304|0.18304	0.953000|0.953000	0.61014|0.61014	2.442000|2.442000	0.44873|0.44873	2.456000|2.456000	0.83038|0.83038	0.561000|0.561000	0.74099|0.74099	GAC|ATG	PLXDC1	-	NULL	ENSG00000161381		0.517	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	HGNC	protein_coding	OTTHUMT00000256892.2	90	0.00	0	C	NM_020405		37263689	37263689	-1	no_errors	ENST00000315392	ensembl	human	known	69_37n	missense	46	48.35	44	SNP	0.067	T
POU6F2	11281	genome.wustl.edu	37	7	39503850	39503850	+	Silent	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:39503850G>C	ENST00000403058.1	+	11	1795	c.1641G>C	c.(1639-1641)ctG>ctC	p.L547L	POU6F2_ENST00000559001.1_Silent_p.L492L|POU6F2_ENST00000518318.2_Intron	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	547	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CTAGCAGTCTGACAGCCAAAC	0.498																																						dbGAP											0													145.0	152.0	150.0					7																	39503850		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1641G>C	7.37:g.39503850G>C			A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.L547	ENST00000403058.1	37	c.1641	CCDS34620.2	7																																																																																			POU6F2	-	superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific	ENSG00000106536		0.498	POU6F2-002	KNOWN	basic|CCDS	protein_coding	POU6F2	HGNC	protein_coding	OTTHUMT00000320146.3	153	0.00	0	G	NM_007252		39503850	39503850	+1	no_errors	ENST00000403058	ensembl	human	known	69_37n	silent	77	19.79	19	SNP	1.000	C
PTH2R	5746	genome.wustl.edu	37	2	209302289	209302289	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:209302289G>A	ENST00000272847.2	+	3	419	c.206G>A	c.(205-207)gGa>gAa	p.G69E	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	69					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	GAATGGGATGGACTCATTTGT	0.343																																						dbGAP											0													74.0	77.0	76.0					2																	209302289		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.206G>A	2.37:g.209302289G>A	ENSP00000272847:p.Gly69Glu		Q8N429	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G69E	ENST00000272847.2	37	c.206	CCDS2383.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586011	0.86748	.	.	ENSG00000144407	ENST00000272847	T	0.63580	-0.05	5.6	5.6	0.85130	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.46758	D	0.000262	T	0.80628	0.4659	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79711	-0.1689	10	0.39692	T	0.17	.	17.4647	0.87629	0.0:0.0:1.0:0.0	.	69	P49190	PTH2R_HUMAN	E	69	ENSP00000272847:G69E	ENSP00000272847:G69E	G	+	2	0	PTH2R	209010534	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.910000	0.92685	2.793000	0.96121	0.563000	0.77884	GGA	PTH2R	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000144407		0.343	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256519.2	196	0.00	0	G	NM_005048		209302289	209302289	+1	no_errors	ENST00000272847	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	1.000	A
PTPRQ	374462	genome.wustl.edu	37	12	81013271	81013271	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:81013271A>G	ENST00000266688.5	+	36	5327	c.5327A>G	c.(5326-5328)gAt>gGt	p.D1776G				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1822	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TACTACAGTGATGATCATGGA	0.363																																						dbGAP											0													131.0	100.0	110.0					12																	81013271		692	1590	2282	-	-	-	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5327A>G	12.37:g.81013271A>G	ENSP00000266688:p.Asp1776Gly			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D1776G	ENST00000266688.5	37	c.5327		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.8|20.8	4.043488|4.043488	0.75732|0.75732	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.47177|.	0.85|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|.	.|.	.|.	.|.	T|T	0.71668|0.71668	0.3367|0.3367	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.71182|0.71182	-0.4668|-0.4668	8|4	0.41790|.	T|.	0.15|.	.|.	15.5205|15.5205	0.75862|0.75862	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1822|.	Q9UMZ3|.	PTPRQ_HUMAN|.	G|V	1776|1477	ENSP00000266688:D1776G|.	ENSP00000266688:D1776G|.	D|M	+|+	2|1	0|0	PTPRQ|PTPRQ	79537402|79537402	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.862000|0.862000	0.49288|0.49288	7.751000|7.751000	0.85126|0.85126	2.060000|2.060000	0.61445|0.61445	0.454000|0.454000	0.30748|0.30748	GAT|ATG	PTPRQ	-	NULL	ENSG00000139304		0.363	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		157	0.00	0	A	NM_001145026		81013271	81013271	+1	no_errors	ENST00000266688	ensembl	human	known	69_37n	missense	97	11.01	12	SNP	1.000	G
RGS22	26166	genome.wustl.edu	37	8	101092487	101092487	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr8:101092487G>C	ENST00000360863.6	-	4	408	c.214C>G	c.(214-216)Cta>Gta	p.L72V	RGS22_ENST00000523287.1_5'UTR|RGS22_ENST00000523437.1_Missense_Mutation_p.L72V	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	72					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TGGTTTTGTAGAATTTTTTTC	0.368																																						dbGAP											0													95.0	89.0	91.0					8																	101092487		1819	4069	5888	-	-	-	SO:0001583	missense	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.214C>G	8.37:g.101092487G>C	ENSP00000354109:p.Leu72Val		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.L72V	ENST00000360863.6	37	c.214	CCDS43758.1	8	.	.	.	.	.	.	.	.	.	.	G	4.708	0.131633	0.08981	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523437	T;T	0.62639	0.01;0.01	5.47	3.67	0.42095	.	0.103431	0.38326	N	0.001729	T	0.46092	0.1375	L	0.38838	1.175	0.27303	N	0.95753	B;B	0.30281	0.275;0.275	B;B	0.25884	0.064;0.064	T	0.31110	-0.9955	10	0.30078	T	0.28	.	7.9235	0.29861	0.1397:0.1325:0.7278:0.0	.	72;72	A8K944;Q8NE09	.;RGS22_HUMAN	V	72	ENSP00000354109:L72V;ENSP00000428212:L72V	ENSP00000354109:L72V	L	-	1	2	RGS22	101161663	1.000000	0.71417	0.938000	0.37757	0.597000	0.36814	2.770000	0.47662	0.789000	0.33779	-0.224000	0.12420	CTA	RGS22	-	NULL	ENSG00000132554		0.368	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	226	0.00	0	G	NM_015668		101092487	101092487	-1	no_errors	ENST00000360863	ensembl	human	known	69_37n	missense	134	14.65	23	SNP	0.995	C
RYR2	6262	genome.wustl.edu	37	1	237897015	237897015	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:237897015G>A	ENST00000366574.2	+	79	11367	c.11050G>A	c.(11050-11052)Gaa>Aaa	p.E3684K	RYR2_ENST00000360064.6_Missense_Mutation_p.E3682K|RYR2_ENST00000542537.1_Missense_Mutation_p.E3668K|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3684					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAACTGGAGGAAGATTTTTT	0.353																																						dbGAP											0													103.0	94.0	97.0					1																	237897015		1827	4089	5916	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11050G>A	1.37:g.237897015G>A	ENSP00000355533:p.Glu3684Lys		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E3682K	ENST00000366574.2	37	c.11044	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482989	0.84747	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96913	-4.17;-4.11;-4.17	5.79	5.79	0.91817	.	0.000000	0.64402	U	0.000012	D	0.95265	0.8464	L	0.59436	1.845	0.80722	D	1	B;B	0.33103	0.349;0.397	B;B	0.32928	0.155;0.093	D	0.94202	0.7451	10	0.59425	D	0.04	-18.0479	19.6602	0.95864	0.0:0.0:1.0:0.0	.	639;3684	B4DGV4;Q92736	.;RYR2_HUMAN	K	3684;3682;3668;639	ENSP00000355533:E3684K;ENSP00000353174:E3682K;ENSP00000443798:E3668K	ENSP00000353174:E3682K	E	+	1	0	RYR2	235963638	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.389000	0.79806	2.753000	0.94483	0.557000	0.71058	GAA	RYR2	-	NULL	ENSG00000198626		0.353	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	284	0.00	0	G	NM_001035		237897015	237897015	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	160	11.11	20	SNP	1.000	A
SBNO1	55206	genome.wustl.edu	37	12	123795660	123795660	+	Silent	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:123795660C>G	ENST00000602398.1	-	25	3364	c.3237G>C	c.(3235-3237)ctG>ctC	p.L1079L	SBNO1_ENST00000602750.1_Silent_p.L1078L|SBNO1_ENST00000420886.2_Silent_p.L1079L|SBNO1_ENST00000267176.4_Silent_p.L1078L			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1079					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CAACGCCTATCAGTCCTTGTC	0.383																																						dbGAP											0													115.0	105.0	109.0					12																	123795660		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3237G>C	12.37:g.123795660C>G			Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.L1079	ENST00000602398.1	37	c.3237	CCDS53844.1	12																																																																																			SBNO1	-	NULL	ENSG00000139697		0.383	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	157	0.00	0	C	NM_018183		123795660	123795660	-1	no_errors	ENST00000420886	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.998	G
SEMA3C	10512	genome.wustl.edu	37	7	80418802	80418802	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:80418802C>A	ENST00000265361.3	-	12	1735	c.1174G>T	c.(1174-1176)Gag>Tag	p.E392*	SEMA3C_ENST00000419255.2_Nonsense_Mutation_p.E392*|SEMA3C_ENST00000544525.1_Nonsense_Mutation_p.E410*	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	392	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TCTGGGAACTCCTTGGTGGTT	0.388																																						dbGAP											0													117.0	107.0	110.0					7																	80418802		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1174G>T	7.37:g.80418802C>A	ENSP00000265361:p.Glu392*		B4DRL8	Nonsense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_I-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.E410*	ENST00000265361.3	37	c.1228	CCDS5596.1	7	.	.	.	.	.	.	.	.	.	.	C	44	10.717461	0.99456	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	.	.	.	5.81	5.81	0.92471	.	0.093482	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0755	0.97742	0.0:1.0:0.0:0.0	.	.	.	.	X	392;392;410	.	ENSP00000265361:E392X	E	-	1	0	SEMA3C	80256738	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.042000	0.70996	2.749000	0.94314	0.460000	0.39030	GAG	SEMA3C	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075223		0.388	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	HGNC	protein_coding	OTTHUMT00000253279.1	266	0.00	0	C	NM_006379		80418802	80418802	-1	no_errors	ENST00000544525	ensembl	human	known	69_37n	nonsense	148	12.43	21	SNP	1.000	A
SEMA3E	9723	genome.wustl.edu	37	7	83119463	83119463	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:83119463G>A	ENST00000307792.3	-	2	710	c.243C>T	c.(241-243)ctC>ctT	p.L81L	SEMA3E_ENST00000427262.1_Silent_p.L21L	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	81	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TCTCCAAGCTGAGGGAATATA	0.408																																						dbGAP											0													83.0	77.0	79.0					7																	83119463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.243C>T	7.37:g.83119463G>A			B4E1P1|Q75M94|Q75M97	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.L81	ENST00000307792.3	37	c.243	CCDS34674.1	7																																																																																			SEMA3E	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000170381		0.408	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3E	HGNC	protein_coding	OTTHUMT00000336606.1	186	0.00	0	G	NM_012431		83119463	83119463	-1	no_errors	ENST00000307792	ensembl	human	known	69_37n	silent	105	13.22	16	SNP	1.000	A
SEMA3A	10371	genome.wustl.edu	37	7	83634727	83634727	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:83634727G>C	ENST00000265362.4	-	11	1602	c.1288C>G	c.(1288-1290)Caa>Gaa	p.Q430E	SEMA3A_ENST00000436949.1_Missense_Mutation_p.Q430E	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	430	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TGTGTAAATTGATAATTTACA	0.358																																						dbGAP											0													191.0	172.0	178.0					7																	83634727		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1288C>G	7.37:g.83634727G>C	ENSP00000265362:p.Gln430Glu			Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.Q430E	ENST00000265362.4	37	c.1288	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957432	0.53400	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.10382	2.88;2.88	4.96	4.96	0.65561	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.14917	0.0360	M	0.62088	1.915	0.80722	D	1	P	0.49090	0.919	B	0.39119	0.291	T	0.03945	-1.0990	10	0.46703	T	0.11	.	18.556	0.91085	0.0:0.0:1.0:0.0	.	430	Q14563	SEM3A_HUMAN	E	430	ENSP00000265362:Q430E;ENSP00000415260:Q430E	ENSP00000265362:Q430E	Q	-	1	0	SEMA3A	83472663	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.742000	0.85008	2.446000	0.82766	0.585000	0.79938	CAA	SEMA3A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075213		0.358	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	302	0.00	0	G	NM_006080		83634727	83634727	-1	no_errors	ENST00000265362	ensembl	human	known	69_37n	missense	135	10.00	15	SNP	1.000	C
SLC34A3	142680	genome.wustl.edu	37	9	140126583	140126583	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:140126583C>T	ENST00000538474.1	+	3	369	c.145C>T	c.(145-147)Cag>Tag	p.Q49*	SLC34A3_ENST00000361134.2_Nonsense_Mutation_p.Q49*	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	49					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GACCCTCCCTCAGCTGAAGGA	0.627																																						dbGAP											0													101.0	106.0	104.0					9																	140126583		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.145C>T	9.37:g.140126583C>T	ENSP00000442397:p.Gln49*		A2BFA1	Nonsense_Mutation	SNP	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	p.Q49*	ENST00000538474.1	37	c.145	CCDS7038.1	9	.	.	.	.	.	.	.	.	.	.	c	28.9	4.961662	0.92791	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	.	.	.	3.58	2.64	0.31445	.	0.486060	0.16452	U	0.213823	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-4.7253	9.466	0.38813	0.0:0.5726:0.4274:0.0	.	.	.	.	X	49	.	ENSP00000355353:Q49X	Q	+	1	0	SLC34A3	139246404	0.991000	0.36638	0.993000	0.49108	0.504000	0.33889	1.701000	0.37825	0.658000	0.30925	0.306000	0.20318	CAG	SLC34A3	-	NULL	ENSG00000198569		0.627	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A3	HGNC	protein_coding	OTTHUMT00000254712.1	51	0.00	0	C	NM_080877		140126583	140126583	+1	no_errors	ENST00000361134	ensembl	human	known	69_37n	nonsense	19	20.83	5	SNP	0.999	T
SMO	6608	genome.wustl.edu	37	7	128850818	128850818	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:128850818G>A	ENST00000249373.3	+	10	1945	c.1665G>A	c.(1663-1665)caG>caA	p.Q555Q	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	555	Interaction with BBS5 and BBS7.				adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	TGACTGGGCAGAGTGACGATG	0.552			Mis		skin basal cell						OREG0018305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0													107.0	86.0	93.0					7																	128850818		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1665G>A	7.37:g.128850818G>A		1568	A4D1K5	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,pfam_GPCR_2_secretin-like,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.Q555	ENST00000249373.3	37	c.1665	CCDS5811.1	7																																																																																			SMO	-	NULL	ENSG00000128602		0.552	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	HGNC	protein_coding	OTTHUMT00000350986.1	54	0.00	0	G	NM_005631		128850818	128850818	+1	no_errors	ENST00000249373	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	1.000	A
SOD1	6647	genome.wustl.edu	37	21	33039646	33039646	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr21:33039646C>G	ENST00000270142.6	+	4	463	c.315C>G	c.(313-315)atC>atG	p.I105M	SNORA81_ENST00000458922.1_RNA|SOD1_ENST00000470944.1_3'UTR|SOD1_ENST00000389995.4_Missense_Mutation_p.I86M|AP000254.8_ENST00000609934.1_RNA	NM_000454.4	NP_000445.1	P00441	SODC_HUMAN	superoxide dismutase 1, soluble	105			I -> F (in ALS1). {ECO:0000269|PubMed:7501156}.		activation of MAPK activity (GO:0000187)|anterograde axon cargo transport (GO:0008089)|auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryo implantation (GO:0007566)|glutathione metabolic process (GO:0006749)|heart contraction (GO:0060047)|hydrogen peroxide biosynthetic process (GO:0050665)|locomotory behavior (GO:0007626)|muscle cell cellular homeostasis (GO:0046716)|myeloid cell homeostasis (GO:0002262)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament cytoskeleton organization (GO:0060052)|ovarian follicle development (GO:0001541)|peripheral nervous system myelin maintenance (GO:0032287)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cytokine production (GO:0001819)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of superoxide anion generation (GO:0032930)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of multicellular organism growth (GO:0040014)|regulation of organ growth (GO:0046620)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of T cell differentiation in thymus (GO:0033081)|relaxation of vascular smooth muscle (GO:0060087)|removal of superoxide radicals (GO:0019430)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to hydrogen peroxide (GO:0042542)|response to nutrient levels (GO:0031667)|response to organic substance (GO:0010033)|response to superoxide (GO:0000303)|retina homeostasis (GO:0001895)|retrograde axon cargo transport (GO:0008090)|sensory perception of sound (GO:0007605)|spermatogenesis (GO:0007283)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|thymus development (GO:0048538)|transmission of nerve impulse (GO:0019226)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|peroxisome (GO:0005777)|protein complex (GO:0043234)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein phosphatase 2B binding (GO:0030346)|Rac GTPase binding (GO:0048365)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(1)	4					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	ATTCTGTGATCTCACTCTCAG	0.413																																						dbGAP											0													241.0	199.0	213.0					21																	33039646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY049787, X02317	CCDS33536.1	21q22.11	2014-09-17	2008-07-31		ENSG00000142168	ENSG00000142168	1.15.1.1		11179	protein-coding gene	gene with protein product		147450	"""amyotrophic lateral sclerosis 1 (adult)"""	ALS, ALS1		8446170	Standard	NM_000454		Approved	IPOA	uc002ypa.3	P00441	OTTHUMG00000084878	ENST00000270142.6:c.315C>G	21.37:g.33039646C>G	ENSP00000270142:p.Ile105Met		A6NHJ0|D3DSE4|Q16669|Q16711|Q16838|Q16839|Q16840|Q6NR85	Missense_Mutation	SNP	pfam_SOD_Cu_Zn_dom,superfamily_SOD_Cu_Zn_dom,prints_SOD_Cu_Zn_dom	p.I105M	ENST00000270142.6	37	c.315	CCDS33536.1	21	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500018	0.44455	.	.	ENSG00000142168	ENST00000270142;ENST00000389995	D;D	0.99663	-6.33;-6.33	5.14	-0.137	0.13469	Superoxide dismutase, copper/zinc binding domain (4);	0.170277	0.52532	D	0.000071	D	0.99492	0.9819	M	0.88377	2.95	0.31538	N	0.660303	D	0.53151	0.958	D	0.72075	0.976	D	0.98776	1.0730	10	0.66056	D	0.02	-23.0424	8.8477	0.35181	0.0:0.3276:0.0:0.6724	.	105	P00441	SODC_HUMAN	M	105;86	ENSP00000270142:I105M;ENSP00000374645:I86M	ENSP00000270142:I105M	I	+	3	3	SOD1	31961517	0.001000	0.12720	0.106000	0.21319	0.015000	0.08874	-0.083000	0.11286	0.063000	0.16370	-0.140000	0.14226	ATC	SOD1	-	pfam_SOD_Cu_Zn_dom,superfamily_SOD_Cu_Zn_dom,prints_SOD_Cu_Zn_dom	ENSG00000142168		0.413	SOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOD1	HGNC	protein_coding	OTTHUMT00000192585.2	441	0.00	0	C	NM_000454		33039646	33039646	+1	no_errors	ENST00000270142	ensembl	human	known	69_37n	missense	177	14.49	30	SNP	0.015	G
SPINK2	6691	genome.wustl.edu	37	4	57677909	57677909	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:57677909C>G	ENST00000248701.4	-	3	230	c.151G>C	c.(151-153)Gtg>Ctg	p.V51L	SPINK2_ENST00000504762.1_Missense_Mutation_p.V86L|SPINK2_ENST00000506738.1_Missense_Mutation_p.V101L	NM_021114.2	NP_066937.1	P20155	ISK2_HUMAN	serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)	51	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(2)	4	Glioma(25;0.08)|all_neural(26;0.181)					CTGCCACACACAGGGTTAAAG	0.408																																						dbGAP											0													148.0	145.0	146.0					4																	57677909		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022514	CCDS3508.1, CCDS63971.1, CCDS63972.1, CCDS75128.1	4q12	2011-08-31	2005-08-17		ENSG00000128040	ENSG00000128040		"""Serine peptidase inhibitors, Kazal type"""	11245	protein-coding gene	gene with protein product		605753	"""serine protease inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)"""			8428671	Standard	NM_001271718		Approved	HUSI-II	uc031sep.1	P20155	OTTHUMG00000128769	ENST00000248701.4:c.151G>C	4.37:g.57677909C>G	ENSP00000248701:p.Val51Leu		Q6FGH2	Missense_Mutation	SNP	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	p.V51L	ENST00000248701.4	37	c.151	CCDS3508.1	4	.	.	.	.	.	.	.	.	.	.	C	14.95	2.687855	0.48097	.	.	ENSG00000128040	ENST00000248701;ENST00000506738;ENST00000504762	T;T;T	0.81163	-1.46;-1.46;-1.46	5.26	4.42	0.53409	Proteinase inhibitor I1, Kazal (3);	0.078878	0.49916	D	0.000132	D	0.84133	0.5405	.	.	.	0.38870	D	0.956664	D	0.57257	0.979	P	0.57468	0.821	D	0.84215	0.0458	9	0.39692	T	0.17	-10.4217	9.5781	0.39470	0.0:0.906:0.0:0.094	.	51	P20155	ISK2_HUMAN	L	51;101;86	ENSP00000248701:V51L;ENSP00000425961:V101L;ENSP00000423858:V86L	ENSP00000248701:V51L	V	-	1	0	SPINK2	57372666	0.971000	0.33674	0.905000	0.35620	0.206000	0.24218	2.451000	0.44952	1.468000	0.48064	0.644000	0.83932	GTG	SPINK2	-	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	ENSG00000128040		0.408	SPINK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK2	HGNC	protein_coding	OTTHUMT00000250690.2	106	0.00	0	C	NM_021114		57677909	57677909	-1	no_errors	ENST00000248701	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	0.984	G
SRBD1	55133	genome.wustl.edu	37	2	45789854	45789854	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:45789854C>T	ENST00000263736.4	-	10	1409	c.1347G>A	c.(1345-1347)acG>acA	p.T449T	SRBD1_ENST00000535761.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	449					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TGACCTTAACCGTCAGTACCT	0.358																																						dbGAP											0													121.0	120.0	120.0					2																	45789854		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1347G>A	2.37:g.45789854C>T			Q53T56|Q96TA4|Q9NW11	Silent	SNP	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.T449	ENST00000263736.4	37	c.1347	CCDS1823.1	2																																																																																			SRBD1	-	NULL	ENSG00000068784		0.358	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	263	0.00	0	C	NM_018079		45789854	45789854	-1	no_errors	ENST00000263736	ensembl	human	known	69_37n	silent	87	28.69	35	SNP	0.995	T
STON1	11037	genome.wustl.edu	37	2	48808551	48808551	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr2:48808551C>G	ENST00000406226.1	+	3	974	c.779C>G	c.(778-780)tCt>tGt	p.S260C	STON1_ENST00000309835.3_Missense_Mutation_p.S260C|STON1_ENST00000404752.1_Missense_Mutation_p.S260C|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.S260C|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.S260C|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.S260C|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.S260C|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.S260C	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	260					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAAAATGCCTCTTCCTTTGTC	0.443																																						dbGAP											0													88.0	80.0	83.0					2																	48808551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.779C>G	2.37:g.48808551C>G	ENSP00000384615:p.Ser260Cys		A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.S260C	ENST00000406226.1	37	c.779	CCDS1841.1	2	.	.	.	.	.	.	.	.	.	.	C	2.496	-0.316340	0.05422	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.12147	2.74;2.74;2.74;2.72;2.71;2.72;2.72;2.9	4.85	2.97	0.34412	.	0.350050	0.35677	N	0.003059	T	0.15869	0.0382	L	0.31926	0.97	0.25553	N	0.987065	B;D;B	0.63880	0.29;0.993;0.062	B;P;B	0.53185	0.169;0.72;0.016	T	0.04870	-1.0921	10	0.36615	T	0.2	.	9.6447	0.39861	0.1403:0.7854:0.0:0.0744	.	260;260;260	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	C	260	ENSP00000385273:S260C;ENSP00000384615:S260C;ENSP00000310969:S260C;ENSP00000385499:S260C;ENSP00000385701:S260C;ENSP00000378236:S260C;ENSP00000311493:S260C;ENSP00000378234:S260C	ENSP00000310969:S260C	S	+	2	0	STON1-GTF2A1L;STON1	48662055	0.382000	0.25148	0.707000	0.30419	0.023000	0.10783	0.734000	0.26101	1.276000	0.44395	-0.229000	0.12294	TCT	STON1-GTF2A1L	-	NULL	ENSG00000068781		0.443	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323848.2	104	0.00	0	C	NM_006873		48808551	48808551	+1	no_errors	ENST00000309827	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	0.537	G
TAF1L	138474	genome.wustl.edu	37	9	32634886	32634886	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:32634886A>G	ENST00000242310.4	-	1	781	c.692T>C	c.(691-693)tTg>tCg	p.L231S	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	231					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AATCCCAGCCAATGGAAGGGT	0.463																																						dbGAP											0													139.0	127.0	131.0					9																	32634886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.692T>C	9.37:g.32634886A>G	ENSP00000418379:p.Leu231Ser		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L231S	ENST00000242310.4	37	c.692	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	A	4.598	0.111092	0.08831	.	.	ENSG00000122728	ENST00000242310	T	0.12672	2.66	1.04	1.04	0.20106	.	0.000000	0.85682	D	0.000000	T	0.16727	0.0402	M	0.72353	2.195	0.52501	D	0.99995	P	0.38455	0.632	B	0.42653	0.394	T	0.01988	-1.1234	10	0.48119	T	0.1	.	5.8599	0.18740	1.0:0.0:0.0:0.0	.	231	Q8IZX4	TAF1L_HUMAN	S	231	ENSP00000418379:L231S	ENSP00000418379:L231S	L	-	2	0	TAF1L	32624886	1.000000	0.71417	0.236000	0.24074	0.100000	0.18952	5.824000	0.69279	0.426000	0.26116	0.164000	0.16699	TTG	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	283	0.00	0	A			32634886	32634886	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	135	21.51	37	SNP	0.999	G
TAS2R9	50835	genome.wustl.edu	37	12	10962482	10962482	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr12:10962482C>T	ENST00000240691.2	-	1	285	c.193G>A	c.(193-195)Gat>Aat	p.D65N	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	65					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)	p.D65H(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAGAAGCCATCTAATGATATT	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											104.0	101.0	102.0					12																	10962482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.193G>A	12.37:g.10962482C>T	ENSP00000240691:p.Asp65Asn		Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.D65N	ENST00000240691.2	37	c.193	CCDS8633.1	12	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175587	0.57692	.	.	ENSG00000121381	ENST00000240691	T	0.36520	1.25	4.5	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.828040	0.10398	U	0.679572	T	0.20981	0.0505	N	0.17379	0.485	0.09310	N	0.999998	P	0.44521	0.837	B	0.40782	0.34	T	0.06006	-1.0851	10	0.27082	T	0.32	.	5.9259	0.19112	0.0:0.6837:0.0:0.3163	.	65	Q9NYW1	TA2R9_HUMAN	N	65	ENSP00000240691:D65N	ENSP00000240691:D65N	D	-	1	0	TAS2R9	10853749	0.000000	0.05858	0.236000	0.24074	0.562000	0.35680	-0.394000	0.07296	1.013000	0.39391	0.460000	0.39030	GAT	TAS2R9	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000121381		0.413	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R9	HGNC	protein_coding	OTTHUMT00000399933.1	83	0.00	0	C			10962482	10962482	-1	no_errors	ENST00000240691	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.262	T
TBCD	6904	genome.wustl.edu	37	17	80767627	80767627	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr17:80767627G>A	ENST00000355528.4	+	12	1322	c.1192G>A	c.(1192-1194)Gat>Aat	p.D398N	TBCD_ENST00000397466.2_Missense_Mutation_p.D12N|TBCD_ENST00000539345.2_Missense_Mutation_p.D398N	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	398					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CCTGGCGGATGATGTGGTCGG	0.592																																						dbGAP											0													80.0	88.0	85.0					17																	80767627		2130	4245	6375	-	-	-	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1192G>A	17.37:g.80767627G>A	ENSP00000347719:p.Asp398Asn		O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.D398N	ENST00000355528.4	37	c.1192	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937700	0.73557	.	.	ENSG00000141556	ENST00000355528;ENST00000269368;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.69561	2.33;-0.41	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.082286	0.56097	D	0.000029	T	0.81621	0.4861	M	0.87682	2.9	0.58432	D	0.999999	D;D;P	0.63046	0.974;0.992;0.739	P;P;P	0.61397	0.632;0.888;0.547	D	0.84270	0.0488	9	.	.	.	.	14.2235	0.65843	0.0:0.0:1.0:0.0	.	398;398;398	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	N	398;381;149;12;398	ENSP00000347719:D398N;ENSP00000380608:D12N	.	D	+	1	0	TBCD	78360916	1.000000	0.71417	0.660000	0.29694	0.112000	0.19704	8.325000	0.90007	2.521000	0.84997	0.561000	0.74099	GAT	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.592	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	236	0.00	0	G	NM_005993		80767627	80767627	+1	no_errors	ENST00000355528	ensembl	human	known	69_37n	missense	105	11.76	14	SNP	0.999	A
TG	7038	genome.wustl.edu	37	8	133945871	133945871	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr8:133945871G>T	ENST00000220616.4	+	24	4922	c.4882G>T	c.(4882-4884)Gat>Tat	p.D1628Y	TG_ENST00000377869.1_Missense_Mutation_p.D1571Y|TG_ENST00000542445.1_Missense_Mutation_p.D62Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1628					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GATTTCCTGTGATTTCTATGC	0.557																																						dbGAP											0													311.0	232.0	259.0					8																	133945871		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4882G>T	8.37:g.133945871G>T	ENSP00000220616:p.Asp1628Tyr		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.D1628Y	ENST00000220616.4	37	c.4882	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.80|13.80	2.345126|2.345126	0.41498|0.41498	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445|ENST00000519178	T;T;T|.	0.72942|.	-0.7;-0.7;-0.7|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.269957|.	0.32028|.	N|.	0.006692|.	T|.	0.70544|.	0.3236|.	M|M	0.76574|0.76574	2.34|2.34	0.35584|0.35584	D|D	0.806485|0.806485	D;D|.	0.76494|.	0.999;0.991|.	D;P|.	0.63877|.	0.919;0.861|.	T|.	0.76841|.	-0.2810|.	10|.	0.87932|.	D|.	0|.	.|.	14.3397|14.3397	0.66617|0.66617	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	62;1628|.	F5GWW5;P01266|.	.;THYG_HUMAN|.	Y|L	1571;434;1628;62|147	ENSP00000367100:D1571Y;ENSP00000220616:D1628Y;ENSP00000441693:D62Y|.	ENSP00000220616:D1628Y|.	D|X	+|+	1|2	0|2	TG|TG	134015053|134015053	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.021000|0.021000	0.10359|0.10359	4.474000|4.474000	0.60203|0.60203	2.761000|2.761000	0.94854|0.94854	0.637000|0.637000	0.83480|0.83480	GAT|TGA	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.557	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	238	0.00	0	G	NM_003235		133945871	133945871	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	101	17.89	22	SNP	1.000	T
THBS3	7059	genome.wustl.edu	37	1	155167681	155167681	+	Silent	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:155167681G>C	ENST00000368378.3	-	19	2312	c.2292C>G	c.(2290-2292)ggC>ggG	p.G764G	RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000457183.2_Silent_p.G644G|THBS3_ENST00000541576.1_Silent_p.G161G|MIR92B_ENST00000607575.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA|THBS3_ENST00000541990.1_Silent_p.G293G|RP11-263K19.4_ENST00000447623.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000486260.1_5'Flank|RP11-263K19.4_ENST00000422665.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	764	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAACTGCCAAGCCAGGGTCAC	0.517																																						dbGAP											0													129.0	118.0	121.0					1																	155167681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2292C>G	1.37:g.155167681G>C			B1AVR8|B4DQ20|Q8WV34	Silent	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G764	ENST00000368378.3	37	c.2292	CCDS1099.1	1																																																																																			THBS3	-	pfam_Thrombospondin_C,superfamily_ConA-like_lec_gl	ENSG00000169231		0.517	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS3	HGNC	protein_coding	OTTHUMT00000086856.1	218	0.00	0	G	NM_007112		155167681	155167681	-1	no_errors	ENST00000368378	ensembl	human	known	69_37n	silent	126	14.29	21	SNP	1.000	C
TLN1	7094	genome.wustl.edu	37	9	35722140	35722141	+	Nonsense_Mutation	DNP	GT	GT	TC			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G|T	G|T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:35722140_35722141GT>TC	ENST00000314888.9	-	9	1276_1277	c.923_924AC>GA	c.(922-924)tAC>tGA	p.Y308*	TLN1_ENST00000540444.1_Nonsense_Mutation_p.Y308*	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	308	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with LAYN. {ECO:0000250}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGGAGACACCGTAAGTCTTGAG	0.51																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.923_924delinsTC	9.37:g.35722140_35722141delinsTC	ENSP00000316029:p.Tyr308*		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.Y308*|p.Y308C	ENST00000314888.9	37	c.924|c.923	CCDS35009.1	9																																																																																			TLN1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000137076		0.510	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	142|146	0.00	0	G|T	NM_006289		35722140|35722141	35722140|35722141	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	nonsense|missense	76|74	14.61|14.94	13	SNP	0.383|0.998	T|C
TMC5	79838	genome.wustl.edu	37	16	19501758	19501759	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr16:19501758_19501759delCT	ENST00000396229.2	+	18	3364_3365	c.2615_2616delCT	c.(2614-2616)cctfs	p.P872fs	TMC5_ENST00000541464.1_Frame_Shift_Del_p.P820fs|TMC5_ENST00000564959.1_Frame_Shift_Del_p.P555fs|TMC5_ENST00000381414.4_Intron|TMC5_ENST00000542583.2_Frame_Shift_Del_p.P872fs|TMC5_ENST00000561503.1_Frame_Shift_Del_p.P513fs|TMC5_ENST00000219821.5_Frame_Shift_Del_p.P626fs|CTA-363E6.6_ENST00000561762.1_RNA	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	872					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CGAGGTCTGCCTCTCTTCATTC	0.485																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2615_2616delCT	16.37:g.19501762_19501763delCT	ENSP00000379531:p.Pro872fs		Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Frame_Shift_Del	DEL	pfam_TMC	p.F874fs	ENST00000396229.2	37	c.2615_2616	CCDS45431.1	16																																																																																			TMC5	-	NULL	ENSG00000103534		0.485	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	256	0.00	0	CT	NM_024780		19501758	19501759	+1	no_errors	ENST00000396229	ensembl	human	known	69_37n	frame_shift_del	146	11.98	20	DEL	0.870:0.130	-
TMPRSS11E	28983	genome.wustl.edu	37	4	69334622	69334622	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:69334622C>A	ENST00000305363.4	+	4	348	c.284C>A	c.(283-285)cCa>cAa	p.P95Q		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	95	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P95Q(1)		endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						TATAAATCTCCATTAAGGGAA	0.294																																						dbGAP											1	Substitution - Missense(1)	lung(1)											96.0	111.0	106.0					4																	69334622		2202	4289	6491	-	-	-	SO:0001583	missense	0			AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.284C>A	4.37:g.69334622C>A	ENSP00000307519:p.Pro95Gln		A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_SEA,pfscan_Peptidase_S1_S6	p.P95Q	ENST00000305363.4	37	c.284	CCDS33993.1	4	.	.	.	.	.	.	.	.	.	.	C	9.153	1.016771	0.19355	.	.	ENSG00000087128	ENST00000305363	T	0.32023	1.47	6.02	0.81	0.18732	SEA (2);	1.168750	0.06440	N	0.725834	T	0.17323	0.0416	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.15870	0.014	T	0.29912	-0.9996	10	0.19147	T	0.46	.	3.9354	0.09304	0.2603:0.4096:0.2541:0.076	.	95	Q9UL52	TM11E_HUMAN	Q	95	ENSP00000307519:P95Q	ENSP00000307519:P95Q	P	+	2	0	TMPRSS11E	69017217	0.000000	0.05858	0.011000	0.14972	0.027000	0.11550	0.049000	0.14099	0.352000	0.24053	0.650000	0.86243	CCA	TMPRSS11E	-	pirsf_Pept_S1A_HAT/DESC1,pfam_SEA,pfscan_SEA	ENSG00000087128		0.294	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11E	HGNC	protein_coding	OTTHUMT00000360584.1	125	0.00	0	C	NM_014058		69334622	69334622	+1	no_errors	ENST00000305363	ensembl	human	known	69_37n	missense	181	15.81	34	SNP	0.000	A
TNRC18	84629	genome.wustl.edu	37	7	5399197	5399197	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:5399197C>T	ENST00000430969.1	-	15	5013	c.4665G>A	c.(4663-4665)ctG>ctA	p.L1555L	TNRC18_ENST00000399537.4_Silent_p.L1555L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1555							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		ACTTGCTGCTCAGCCTGAAAC	0.577																																						dbGAP											0													115.0	115.0	115.0					7																	5399197		2113	4235	6348	-	-	-	SO:0001819	synonymous_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4665G>A	7.37:g.5399197C>T			A8MX41|Q96JH1|Q96K91	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.L1555	ENST00000430969.1	37	c.4665	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.577	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		187	0.00	0	C			5399197	5399197	-1	no_errors	ENST00000399537	ensembl	human	known	69_37n	silent	88	14.56	15	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000445888.2_Missense_Mutation_p.V272M|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V272M	ENST00000269305.4	37	c.814	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	168	0.00	0	C	NM_000546		7577124	7577124	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	61	34.41	32	SNP	1.000	T
TRIM42	287015	genome.wustl.edu	37	3	140401809	140401809	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr3:140401809G>A	ENST00000286349.3	+	2	1038	c.847G>A	c.(847-849)Gag>Aag	p.E283K		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	283						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CACCAGCGCCGAGGAACAGGA	0.572																																						dbGAP											0													200.0	168.0	179.0					3																	140401809		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.847G>A	3.37:g.140401809G>A	ENSP00000286349:p.Glu283Lys		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.E283K	ENST00000286349.3	37	c.847	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098043	0.37048	.	.	ENSG00000155890	ENST00000286349	T	0.36878	1.23	5.46	2.46	0.29980	.	0.210402	0.32687	N	0.005767	T	0.20292	0.0488	N	0.19112	0.55	0.26452	N	0.97558	B	0.19935	0.04	B	0.08055	0.003	T	0.13899	-1.0492	10	0.56958	D	0.05	-27.759	6.675	0.23090	0.0984:0.3798:0.5218:0.0	.	283	Q8IWZ5	TRI42_HUMAN	K	283	ENSP00000286349:E283K	ENSP00000286349:E283K	E	+	1	0	TRIM42	141884499	0.985000	0.35326	0.930000	0.37139	0.954000	0.61252	1.954000	0.40362	1.268000	0.44264	0.561000	0.74099	GAG	TRIM42	-	NULL	ENSG00000155890		0.572	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	178	0.00	0	G	NM_152616		140401809	140401809	+1	no_errors	ENST00000286349	ensembl	human	known	69_37n	missense	77	15.05	14	SNP	0.465	A
TRIM8	81603	genome.wustl.edu	37	10	104416924	104416924	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr10:104416924C>G	ENST00000302424.7	+	6	1591	c.1469C>G	c.(1468-1470)tCc>tGc	p.S490C		NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	490					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TACCCCCGCTCCGGCCACTTT	0.652																																						dbGAP											0													45.0	45.0	45.0					10																	104416924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.1469C>G	10.37:g.104416924C>G	ENSP00000302120:p.Ser490Cys		A6NI31|Q9C028	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S490C	ENST00000302424.7	37	c.1469	CCDS31274.1	10	.	.	.	.	.	.	.	.	.	.	C	21.1	4.104328	0.76983	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	D	0.84146	-1.81	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.88355	0.6414	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.89881	0.4030	10	0.87932	D	0	.	19.2308	0.93839	0.0:1.0:0.0:0.0	.	490	Q9BZR9	TRIM8_HUMAN	C	490;489	ENSP00000302120:S490C	ENSP00000302120:S490C	S	+	2	0	TRIM8	104406914	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.410000	0.80065	2.558000	0.86282	0.491000	0.48974	TCC	TRIM8	-	NULL	ENSG00000171206		0.652	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM8	HGNC	protein_coding	OTTHUMT00000050084.3	36	0.00	0	C	NM_030912		104416924	104416924	+1	no_errors	ENST00000302424	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	G
TTC39C	125488	genome.wustl.edu	37	18	21712496	21712496	+	Silent	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr18:21712496C>T	ENST00000317571.3	+	14	1946	c.1710C>T	c.(1708-1710)atC>atT	p.I570I	TTC39C_ENST00000540918.2_Silent_p.I263I|TTC39C_ENST00000304621.6_Silent_p.I509I	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	570										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						ATGTCCGCATCCATGCTGCTC	0.493																																						dbGAP											0													110.0	98.0	102.0					18																	21712496		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.1710C>T	18.37:g.21712496C>T			B7WP63|J3QRR1|Q0VAJ2|Q8N284	Silent	SNP	pfam_OMP_IML2_mit/TPR_39,pfam_Cohesin_loading_factor	p.I570	ENST00000317571.3	37	c.1710	CCDS45839.1	18																																																																																			TTC39C	-	NULL	ENSG00000168234		0.493	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC39C	HGNC	protein_coding	OTTHUMT00000446107.1	156	0.00	0	C	NM_153211		21712496	21712496	+1	no_errors	ENST00000317571	ensembl	human	known	69_37n	silent	74	10.84	9	SNP	1.000	T
UBAC1	10422	genome.wustl.edu	37	9	138845595	138845595	+	Silent	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr9:138845595G>C	ENST00000371756.3	-	3	481	c.264C>G	c.(262-264)gtC>gtG	p.V88V		NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	88	Ubiquitin-like.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		TCAATAATAGGACATCTAGAA	0.408																																					NSCLC(78;973 1398 27381 29552 42415)	dbGAP											0													79.0	74.0	76.0					9																	138845595		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.264C>G	9.37:g.138845595G>C			O75500|Q9UMW7	Silent	SNP	pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,pfscan_UBA/transl_elong_EF1B_N_euk	p.V88	ENST00000371756.3	37	c.264	CCDS35177.1	9																																																																																			UBAC1	-	NULL	ENSG00000130560		0.408	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAC1	HGNC	protein_coding	OTTHUMT00000055034.1	126	0.00	0	G	NM_016172		138845595	138845595	-1	no_errors	ENST00000371756	ensembl	human	known	69_37n	silent	69	13.75	11	SNP	0.988	C
UBN2	254048	genome.wustl.edu	37	7	138944054	138944054	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr7:138944054G>A	ENST00000473989.3	+	5	843	c.843G>A	c.(841-843)cgG>cgA	p.R281R	UBN2_ENST00000288561.8_Silent_p.R198R	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	281	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						TGAAGAAGCGGAAGCGGAAAG	0.383																																						dbGAP											0													126.0	133.0	131.0					7																	138944054		1837	4087	5924	-	-	-	SO:0001819	synonymous_variant	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.843G>A	7.37:g.138944054G>A			A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	NULL	p.G50E	ENST00000473989.3	37	c.149	CCDS43655.2	7	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361008	0.24684	.	.	ENSG00000157741	ENST00000483726	.	.	.	5.34	3.51	0.40186	.	.	.	.	.	T	0.55081	0.1898	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52049	-0.8627	4	.	.	.	-10.4309	6.0484	0.19772	0.1521:0.3993:0.4487:0.0	.	.	.	.	E	50	.	.	G	+	2	0	UBN2	138594594	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.812000	0.27211	1.590000	0.49995	0.650000	0.86243	GGA	UBN2	-	NULL	ENSG00000157741		0.383	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	265	0.00	0	G	NM_173569		138944054	138944054	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000483726	ensembl	human	putative	69_37n	missense	184	12.80	27	SNP	1.000	A
ULBP3	79465	genome.wustl.edu	37	6	150387233	150387233	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr6:150387233C>G	ENST00000367339.2	-	2	182	c.154G>C	c.(154-156)Gag>Cag	p.E52Q	ULBP3_ENST00000438272.2_Missense_Mutation_p.E52Q			Q9BZM4	N2DL3_HUMAN	UL16 binding protein 3	52	MHC class I alpha-1 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)|viral process (GO:0016032)	anchored component of plasma membrane (GO:0046658)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			central_nervous_system(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	9		Ovarian(120;0.12)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.45e-12)		CTCTGGACCTCACACCACTGT	0.458																																						dbGAP											0													114.0	105.0	108.0					6																	150387233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF304379	CCDS5225.1	6q25	2008-04-11			ENSG00000131019	ENSG00000131019			14895	protein-coding gene	gene with protein product		605699				11239445, 11827464	Standard	NM_024518		Approved	RAET1N	uc003qns.3	Q9BZM4	OTTHUMG00000015811	ENST00000367339.2:c.154G>C	6.37:g.150387233C>G	ENSP00000356308:p.Glu52Gln		Q5VY82|Q8IZX5|Q8TE75	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.E52Q	ENST00000367339.2	37	c.154	CCDS5225.1	6	.	.	.	.	.	.	.	.	.	.	C	12.24	1.879988	0.33162	.	.	ENSG00000131019	ENST00000253335;ENST00000367339;ENST00000438272	T;T	0.00686	5.85;5.85	3.17	1.31	0.21738	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00936	0.0031	M	0.64567	1.98	0.09310	N	1	D	0.89917	1.0	D	0.75020	0.985	T	0.53344	-0.8452	9	0.33141	T	0.24	-1.6769	5.5222	0.16939	0.0:0.7269:0.0:0.2731	.	52	Q9BZM4	N2DL3_HUMAN	Q	52	ENSP00000356308:E52Q;ENSP00000403562:E52Q	ENSP00000253335:E52Q	E	-	1	0	ULBP3	150428926	0.000000	0.05858	0.003000	0.11579	0.028000	0.11728	-1.103000	0.03329	0.343000	0.23821	0.478000	0.44815	GAG	ULBP3	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000131019		0.458	ULBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP3	HGNC	protein_coding	OTTHUMT00000042678.2	190	0.00	0	C			150387233	150387233	-1	no_errors	ENST00000367339	ensembl	human	known	69_37n	missense	74	17.78	16	SNP	0.004	G
UNC5C	8633	genome.wustl.edu	37	4	96123917	96123917	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr4:96123917C>T	ENST00000453304.1	-	12	2449	c.2101G>A	c.(2101-2103)Gtc>Atc	p.V701I		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	701	Interaction with DCC. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		AGACAGTAGACTCGGATGCTG	0.607																																						dbGAP											0													91.0	83.0	86.0					4																	96123917		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2101G>A	4.37:g.96123917C>T	ENSP00000406022:p.Val701Ile		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.V701I	ENST00000453304.1	37	c.2101	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628383	0.87560	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796	T;T	0.68331	0.05;-0.32	5.61	5.61	0.85477	.	0.059631	0.64402	D	0.000003	T	0.81187	0.4770	M	0.70275	2.135	0.80722	D	1	P;D	0.58620	0.506;0.983	B;D	0.63957	0.155;0.92	T	0.81678	-0.0824	10	0.66056	D	0.02	.	19.9997	0.97405	0.0:1.0:0.0:0.0	.	701;701	A8K385;O95185	.;UNC5C_HUMAN	I	701;660;720	ENSP00000406022:V701I;ENSP00000426924:V720I	ENSP00000328673:V660I	V	-	1	0	UNC5C	96342940	1.000000	0.71417	0.972000	0.41901	0.978000	0.69477	4.859000	0.62954	2.813000	0.96785	0.655000	0.94253	GTC	UNC5C	-	NULL	ENSG00000182168		0.607	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	136	0.00	0	C	NM_003728		96123917	96123917	-1	no_errors	ENST00000453304	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216246562	216246562	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:216246562T>C	ENST00000307340.3	-	28	6039	c.5653A>G	c.(5653-5655)Aga>Gga	p.R1885G	RP11-22M7.2_ENST00000430890.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.R1885G|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1885	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGATTGACTCTGACAGCACCG	0.468										HNSCC(13;0.011)																												dbGAP											0			GRCh37	CM080603	USH2A	M							90.0	73.0	79.0					1																	216246562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5653A>G	1.37:g.216246562T>C	ENSP00000305941:p.Arg1885Gly		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R1885G	ENST00000307340.3	37	c.5653	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.405220	0.83230	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77489	-1.1;-1.1	5.93	5.93	0.95920	Concanavalin A-like lectin/glucanase (1);Fibronectin, type III (3);Laminin G domain (1);	0.000000	0.49305	D	0.000149	D	0.84642	0.5517	M	0.80616	2.505	0.47476	D	0.999435	D	0.59767	0.986	P	0.53266	0.722	D	0.84283	0.0495	10	0.33141	T	0.24	.	16.3871	0.83514	0.0:0.0:0.0:1.0	.	1885	O75445	USH2A_HUMAN	G	1885	ENSP00000305941:R1885G;ENSP00000355910:R1885G	ENSP00000305941:R1885G	R	-	1	2	USH2A	214313185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.783000	0.68982	2.265000	0.75225	0.533000	0.62120	AGA	USH2A	-	superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Laminin_G	ENSG00000042781		0.468	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	91	0.00	0	T	NM_007123		216246562	216246562	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	C
USH2A	7399	genome.wustl.edu	37	1	216498908	216498908	+	Silent	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr1:216498908G>A	ENST00000307340.3	-	6	1268	c.882C>T	c.(880-882)ctC>ctT	p.L294L	USH2A_ENST00000366943.2_Silent_p.L294L|USH2A_ENST00000366942.3_Silent_p.L294L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	294	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATGCAATCTGAGAAGATCTC	0.512										HNSCC(13;0.011)																												dbGAP											0													46.0	45.0	45.0					1																	216498908		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.882C>T	1.37:g.216498908G>A			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L294	ENST00000307340.3	37	c.882	CCDS31025.1	1																																																																																			USH2A	-	smart_Laminin_N,pfscan_Laminin_N	ENSG00000042781		0.512	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	66	0.00	0	G	NM_007123		216498908	216498908	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	silent	28	17.65	6	SNP	0.000	A
VSTM4	196740	genome.wustl.edu	37	10	50294067	50294067	+	Splice_Site	SNP	G	G	C			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr10:50294067G>C	ENST00000332853.4	-	3	482	c.459C>G	c.(457-459)gtC>gtG	p.V153V		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	153	Ig-like.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						TGAGGGAAATGACTGAAAGAC	0.333																																						dbGAP											0													50.0	53.0	52.0					10																	50294067		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.458-1C>G	10.37:g.50294067G>C			B4DNI6|Q96MX7	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.V153	ENST00000332853.4	37	c.459	CCDS31198.1	10																																																																																			VSTM4	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000165633		0.333	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM4	HGNC	protein_coding	OTTHUMT00000047966.2	124	0.00	0	G	NM_144984	Silent	50294067	50294067	-1	no_errors	ENST00000332853	ensembl	human	known	69_37n	silent	62	31.87	29	SNP	1.000	C
TBC1D31	93594	genome.wustl.edu	37	8	124132400	124132400	+	Silent	SNP	C	C	T	rs561570593	byFrequency	TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr8:124132400C>T	ENST00000287380.1	+	11	1632	c.1542C>T	c.(1540-1542)atC>atT	p.I514I	TBC1D31_ENST00000522420.1_Silent_p.I409I|TBC1D31_ENST00000518805.1_Silent_p.I147I|TBC1D31_ENST00000309336.3_Silent_p.I514I|TBC1D31_ENST00000327098.5_Silent_p.I514I|TBC1D31_ENST00000378080.2_Silent_p.I409I|TBC1D31_ENST00000521676.1_Silent_p.I391I	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	514	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)	p.I514I(1)									ACCAACTCATCTGTTTTGAAG	0.333																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											95.0	83.0	87.0					8																	124132400		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1542C>T	8.37:g.124132400C>T			B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.I514	ENST00000287380.1	37	c.1542	CCDS6338.1	8																																																																																			WDR67	-	pfam_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000156787		0.333	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	264	0.00	0	C	NM_145647		124132400	124132400	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	silent	132	11.41	17	SNP	1.000	T
WWC1	23286	genome.wustl.edu	37	5	167855767	167855767	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr5:167855767G>A	ENST00000265293.4	+	13	2477	c.1975G>A	c.(1975-1977)Gcg>Acg	p.A659T	WWC1_ENST00000521089.1_Missense_Mutation_p.A659T	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	659	C2.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		AGCAGTGGGTGCGACCCGAAT	0.552																																						dbGAP											0													131.0	121.0	124.0					5																	167855767		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.1975G>A	5.37:g.167855767G>A	ENSP00000265293:p.Ala659Thr		B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.A659T	ENST00000265293.4	37	c.1975	CCDS4366.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.293|7.293	0.611441|0.611441	0.14066|0.14066	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895;ENST00000524228	T;T|.	0.17854|.	2.25;2.25|.	5.52|5.52	2.78|2.78	0.32641|0.32641	C2 calcium/lipid-binding domain, CaLB (1);|.	0.428825|.	0.26400|.	N|.	0.024595|.	T|T	0.08268|0.08268	0.0206|0.0206	N|N	0.00879|0.00879	-1.12|-1.12	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.0;0.001;0.0;0.0|.	T|T	0.32534|0.32534	-0.9903|-0.9903	10|5	0.02654|.	T|.	1|.	.|.	5.9515|5.9515	0.19248|0.19248	0.4717:0.0:0.5283:0.0|0.4717:0.0:0.5283:0.0	.|.	659;565;565;659|.	Q8IX03-2;F5H498;B3KX05;Q8IX03|.	.;.;.;KIBRA_HUMAN|.	T|Y	659|620;435	ENSP00000265293:A659T;ENSP00000427772:A659T|.	ENSP00000265293:A659T|.	A|C	+|+	1|2	0|0	WWC1|WWC1	167788345|167788345	0.950000|0.950000	0.32346|0.32346	0.053000|0.053000	0.19242|0.19242	0.589000|0.589000	0.36550|0.36550	2.278000|2.278000	0.43426|0.43426	0.715000|0.715000	0.32103|0.32103	0.556000|0.556000	0.70494|0.70494	GCG|TGC	WWC1	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000113645		0.552	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2	192	0.00	0	G	NM_015238		167855767	167855767	+1	no_errors	ENST00000265293	ensembl	human	known	69_37n	missense	88	12.87	13	SNP	0.071	A
YES1	7525	genome.wustl.edu	37	18	756691	756691	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr18:756691G>A	ENST00000584307.1	-	2	307	c.137C>T	c.(136-138)tCa>tTa	p.S46L	YES1_ENST00000314574.4_Missense_Mutation_p.S46L|YES1_ENST00000577611.1_5'UTR|YES1_ENST00000577961.1_Missense_Mutation_p.S51L			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	46					blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	TCCCTTTGCTGAAGATGACGG	0.463																																						dbGAP											0													247.0	207.0	221.0					18																	756691		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.137C>T	18.37:g.756691G>A	ENSP00000462468:p.Ser46Leu		A6NLB3|D3DUH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.S46L	ENST00000584307.1	37	c.137	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	G	10.75	1.436869	0.25900	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.75050	-0.9	4.72	4.72	0.59763	.	2.268440	0.04272	U	0.342331	T	0.69788	0.3150	L	0.29908	0.895	0.09310	N	0.999997	B	0.18968	0.032	B	0.19946	0.027	T	0.56884	-0.7905	10	0.62326	D	0.03	.	13.7431	0.62860	0.0:0.1543:0.8457:0.0	.	46	P07947	YES_HUMAN	L	46	ENSP00000324740:S46L	ENSP00000324740:S46L	S	-	2	0	YES1	746691	0.992000	0.36948	0.025000	0.17156	0.942000	0.58702	5.523000	0.67099	2.326000	0.78906	0.561000	0.74099	TCA	YES1	-	NULL	ENSG00000176105		0.463	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	264	0.00	0	G	NM_005433		756691	756691	-1	no_errors	ENST00000314574	ensembl	human	known	69_37n	missense	117	15.83	22	SNP	0.109	A
ZIC3	7547	genome.wustl.edu	37	X	136652162	136652162	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chrX:136652162C>G	ENST00000287538.5	+	3	1887	c.1337C>G	c.(1336-1338)tCt>tGt	p.S446C	ZIC3_ENST00000370606.3_Intron	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	446					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					AAAACCCCTTCTGCAGTTCAA	0.463																																						dbGAP											0													156.0	152.0	153.0					X																	136652162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1337C>G	X.37:g.136652162C>G	ENSP00000287538:p.Ser446Cys		B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S446C	ENST00000287538.5	37	c.1337	CCDS14663.1	X	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668992	0.29604	.	.	ENSG00000156925	ENST00000287538	T	0.13538	2.58	5.97	5.97	0.96955	.	0.197547	0.45126	D	0.000389	T	0.15652	0.0377	N	0.22421	0.69	0.80722	D	1	D	0.58620	0.983	P	0.46975	0.533	T	0.00778	-1.1570	10	0.66056	D	0.02	.	18.1822	0.89782	0.0:1.0:0.0:0.0	.	446	O60481	ZIC3_HUMAN	C	446	ENSP00000287538:S446C	ENSP00000287538:S446C	S	+	2	0	ZIC3	136479828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.459000	0.80802	2.517000	0.84864	0.600000	0.82982	TCT	ZIC3	-	NULL	ENSG00000156925		0.463	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC3	HGNC	protein_coding	OTTHUMT00000058526.1	112	0.00	0	C			136652162	136652162	+1	no_errors	ENST00000287538	ensembl	human	known	69_37n	missense	91	13.33	14	SNP	1.000	G
ZNF667	63934	genome.wustl.edu	37	19	56953658	56953658	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:56953658G>A	ENST00000504904.3	-	7	1425	c.706C>T	c.(706-708)Caa>Taa	p.Q236*	ZNF667_ENST00000292069.6_Nonsense_Mutation_p.Q236*|ZNF667_ENST00000342634.3_Nonsense_Mutation_p.Q364*|ZNF667_ENST00000591790.1_3'UTR			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GACTGACATTGACTCAAGGCC	0.388																																						dbGAP											0													134.0	136.0	136.0					19																	56953658		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.706C>T	19.37:g.56953658G>A	ENSP00000439402:p.Gln236*		B2RMS6|B9EK36|Q6B093|Q9H807	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q364*	ENST00000504904.3	37	c.1090	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072014	0.36566	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518	.	.	.	4.79	1.43	0.22495	.	0.895470	0.09259	N	0.826782	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-0.0052	3.7902	0.08716	0.2774:0.0:0.5499:0.1727	.	.	.	.	X	364;236;236;18	.	ENSP00000292069:Q236X	Q	-	1	0	ZNF667	61645470	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	0.224000	0.17738	0.610000	0.30035	0.591000	0.81541	CAA	ZNF667	-	smart_Znf_C2H2-like	ENSG00000198046		0.388	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	223	0.00	0	G	NM_022103		56953658	56953658	-1	no_errors	ENST00000342634	ensembl	human	known	69_37n	nonsense	191	12.39	27	SNP	0.000	A
ZNF808	388558	genome.wustl.edu	37	19	53057385	53057385	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:53057385A>G	ENST00000359798.4	+	5	1396	c.1216A>G	c.(1216-1218)Aag>Gag	p.K406E		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TGAGTGTGGTAAGGCTTTTAA	0.368																																						dbGAP											0													81.0	87.0	85.0					19																	53057385		2194	4290	6484	-	-	-	SO:0001583	missense	0			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1216A>G	19.37:g.53057385A>G	ENSP00000352846:p.Lys406Glu		Q68CN7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K337E	ENST00000359798.4	37	c.1009	CCDS46167.1	19	.	.	.	.	.	.	.	.	.	.	.	13.38	2.218759	0.39201	.	.	ENSG00000198482	ENST00000359798	T	0.27104	1.69	1.5	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43478	0.1249	M	0.80332	2.49	0.09310	N	1	D	0.58268	0.982	P	0.57679	0.825	T	0.19943	-1.0290	9	0.72032	D	0.01	.	7.836	0.29369	1.0:0.0:0.0:0.0	.	406	Q8N4W9	ZN808_HUMAN	E	406	ENSP00000352846:K406E	ENSP00000352846:K406E	K	+	1	0	ZNF808	57749197	0.024000	0.19004	0.005000	0.12908	0.009000	0.06853	1.567000	0.36407	0.666000	0.31087	0.164000	0.16699	AAG	ZNF808	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198482		0.368	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF808	HGNC	protein_coding	OTTHUMT00000350447.3	193	0.00	0	A	NM_001039886		53057385	53057385	+1	no_errors	ENST00000487863	ensembl	human	known	69_37n	missense	116	18.88	27	SNP	0.124	G
ZNF772	400720	genome.wustl.edu	37	19	57984669	57984669	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04W-01A-31D-A10Y-09	TCGA-A2-A04W-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7822a6b1-68c8-4675-993c-c4b54a510c09	62188c38-1f49-4f09-bd46-f60922cd3e4a	g.chr19:57984669C>A	ENST00000343280.4	-	5	1703	c.1443G>T	c.(1441-1443)tgG>tgT	p.W481C	ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000356584.3_Missense_Mutation_p.W440C|ZNF772_ENST00000427512.2_Missense_Mutation_p.W369C|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000425074.3_3'UTR|AC004076.9_ENST00000596831.1_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TGTGAATTTTCCAGTGGCGGA	0.453																																					Melanoma(5;289 436 14293 15924 30817)	dbGAP											0													67.0	58.0	61.0					19																	57984669		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1443G>T	19.37:g.57984669C>A	ENSP00000341165:p.Trp481Cys		A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W481C	ENST00000343280.4	37	c.1443	CCDS33133.1	19	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573659	0.28092	.	.	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000356584;ENST00000291809	T;T;T	0.07327	3.2;3.2;3.2	3.81	1.42	0.22433	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09468	0.0233	N	0.24115	0.695	0.53688	D	0.999973	D;D;D	0.63046	0.976;0.976;0.992	P;P;P	0.53266	0.722;0.604;0.707	T	0.20974	-1.0259	9	0.87932	D	0	.	7.9076	0.29771	0.1804:0.6444:0.1751:0.0	.	369;440;481	Q68DY9-2;A6NJK9;Q68DY9	.;.;ZN772_HUMAN	C	481;369;440;406	ENSP00000341165:W481C;ENSP00000395967:W369C;ENSP00000348992:W440C	ENSP00000291809:W406C	W	-	3	0	ZNF772	62676481	0.000000	0.05858	0.968000	0.41197	0.453000	0.32348	0.018000	0.13422	0.799000	0.34018	0.289000	0.19496	TGG	ZNF772	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197128		0.453	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1	127	0.00	0	C	NM_001024596		57984669	57984669	-1	no_errors	ENST00000343280	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.645	A
