#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC1	4363	genome.wustl.edu	37	16	16200631	16200631	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:16200631C>T	ENST00000399410.3	+	21	2947	c.2772C>T	c.(2770-2772)atC>atT	p.I924I	ABCC1_ENST00000349029.5_Silent_p.I809I|ABCC1_ENST00000346370.5_Silent_p.I868I|ABCC1_ENST00000576557.1_3'UTR|ABCC1_ENST00000345148.5_Silent_p.I924I|ABCC1_ENST00000351154.5_Silent_p.I865I|ABCC1_ENST00000399408.2_Silent_p.I934I	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	924					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.I924I(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GTGGGGACATCAGCAGGCACC	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											75.0	80.0	78.0					16																	16200631		2134	4260	6394	-	-	-	SO:0001819	synonymous_variant	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2772C>T	16.37:g.16200631C>T			A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.Q833*	ENST00000399410.3	37	c.2497	CCDS42122.1	16																																																																																			ABCC1	-	tigrfam_Multidrug-R_assoc	ENSG00000103222		0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	116	0.00	0	C	NM_004996		16200631	16200631	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572882	ensembl	human	novel	69_37n	nonsense	98	12.50	14	SNP	0.000	T
ABCC12	94160	genome.wustl.edu	37	16	48139206	48139206	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:48139206G>A	ENST00000311303.3	-	19	2862	c.2517C>T	c.(2515-2517)gtC>gtT	p.V839V	ABCC12_ENST00000448542.1_Silent_p.V836V|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	839	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.V839V(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GCACCGCGCCGACCTCACACA	0.532																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	76.0	86.0					16																	48139206		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2517C>T	16.37:g.48139206G>A			Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.V839	ENST00000311303.3	37	c.2517	CCDS10730.1	16																																																																																			ABCC12	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000140798		0.532	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	36	0.00	0	G	NM_033226		48139206	48139206	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.000	A
ABLIM3	22885	genome.wustl.edu	37	5	148629383	148629383	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:148629383C>T	ENST00000506113.1	+	18	2187	c.1705C>T	c.(1705-1707)Cgg>Tgg	p.R569W	ABLIM3_ENST00000508983.1_Missense_Mutation_p.R536W|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000504238.1_Missense_Mutation_p.R458W|ABLIM3_ENST00000309868.7_Missense_Mutation_p.R569W|ABLIM3_ENST00000356541.3_Missense_Mutation_p.R458W|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.R474W|ABLIM3_ENST00000517451.1_Missense_Mutation_p.R55W			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	569					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.R569W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGCCCCTCGGTCGCACTA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											181.0	153.0	163.0					5																	148629383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1705C>T	5.37:g.148629383C>T	ENSP00000425394:p.Arg569Trp		A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.R569W	ENST00000506113.1	37	c.1705	CCDS4294.1	5	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092159	0.55968	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983;ENST00000517451;ENST00000536903	T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24	4.97	4.97	0.65823	.	0.247728	0.32093	N	0.006593	T	0.24160	0.0585	N	0.08118	0	0.47276	D	0.999374	P;D;P;D	0.63046	0.956;0.98;0.956;0.992	B;B;P;P	0.46049	0.343;0.443;0.502;0.487	T	0.06499	-1.0823	10	0.48119	T	0.1	.	13.2232	0.59901	0.1592:0.8408:0.0:0.0	.	55;474;458;569	O94929-4;O94929-3;O94929-2;O94929	.;.;.;ABLM3_HUMAN	W	474;458;569;569;458;536;55;54	ENSP00000315841:R474W;ENSP00000348938:R458W;ENSP00000310309:R569W;ENSP00000425394:R569W;ENSP00000421183:R458W;ENSP00000420855:R536W;ENSP00000430150:R55W	ENSP00000310309:R569W	R	+	1	2	ABLIM3	148609576	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.320000	0.43797	2.466000	0.83321	0.561000	0.74099	CGG	ABLIM3	-	NULL	ENSG00000173210		0.517	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABLIM3	HGNC	protein_coding	OTTHUMT00000373435.1	180	0.00	0	C	NM_014945		148629383	148629383	+1	no_errors	ENST00000309868	ensembl	human	known	69_37n	missense	90	21.05	24	SNP	1.000	T
ACAD11	84129	genome.wustl.edu	37	3	132297703	132297703	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:132297703G>A	ENST00000264990.6	-	15	2682	c.1711C>T	c.(1711-1713)Ctt>Ttt	p.L571F	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000545291.1_Missense_Mutation_p.L96F	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	571					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.L571F(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						ATGGGAACAAGAATCATGCTG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	152.0	151.0					3																	132297703		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1711C>T	3.37:g.132297703G>A	ENSP00000264990:p.Leu571Phe		Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_DH_N,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,superfamily_Kinase-like_dom	p.L571F	ENST00000264990.6	37	c.1711	CCDS3074.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616231	0.87359	.	.	ENSG00000240303	ENST00000264990;ENST00000545291	D;D	0.99232	-5.6;-5.6	5.56	5.56	0.83823	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	.	.	.	.	D	0.99492	0.9819	H	0.94306	3.52	0.80722	D	1	D	0.69078	0.997	D	0.65773	0.938	D	0.98383	1.0559	9	0.87932	D	0	.	12.2057	0.54350	0.0:0.0:0.729:0.2709	.	571	Q709F0	ACD11_HUMAN	F	571;96	ENSP00000264990:L571F;ENSP00000446263:L96F	ENSP00000264990:L571F	L	-	1	0	ACAD11	133780393	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.307000	0.59123	2.777000	0.95525	0.591000	0.81541	CTT	ACAD11	-	superfamily_AcylCoA_DH/oxidase	ENSG00000240303		0.338	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	HGNC	protein_coding	OTTHUMT00000357279.2	104	0.00	0	G	NM_032169		132297703	132297703	-1	no_errors	ENST00000264990	ensembl	human	known	69_37n	missense	199	25.47	68	SNP	1.000	A
ACO2	50	genome.wustl.edu	37	22	41865178	41865178	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr22:41865178C>G	ENST00000216254.4	+	1	50	c.28C>G	c.(28-30)Cgg>Ggg	p.R10G	ACO2_ENST00000396512.3_Missense_Mutation_p.R10G|PHF5A_ENST00000491254.1_5'Flank|PHF5A_ENST00000216252.3_5'Flank	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	10					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)	p.R10G(1)		breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						ACTGGTGACTCGGCTGCAGGT	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	80.0	80.0					22																	41865178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.28C>G	22.37:g.41865178C>G	ENSP00000216254:p.Arg10Gly		O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase_mito-like	p.R10G	ENST00000216254.4	37	c.28	CCDS14017.1	22	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084609	0.76642	.	.	ENSG00000100412	ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.45668	0.9;0.89	5.35	5.35	0.76521	.	0.105835	0.64402	D	0.000004	T	0.49795	0.1578	M	0.77486	2.375	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49485	-0.8935	10	0.59425	D	0.04	.	19.6142	0.95626	0.0:1.0:0.0:0.0	.	10;10	A2A274;Q99798	.;ACON_HUMAN	G	10	ENSP00000216254:R10G;ENSP00000379769:R10G	ENSP00000216254:R10G	R	+	1	2	ACO2	40195124	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.949000	0.63596	2.941000	0.99782	0.655000	0.94253	CGG	ACO2	-	NULL	ENSG00000100412		0.642	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO2	HGNC	protein_coding	OTTHUMT00000259151.1	29	0.00	0	C	NM_001098		41865178	41865178	+1	no_errors	ENST00000216254	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	G
AGPS	8540	genome.wustl.edu	37	2	178301510	178301510	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:178301510G>A	ENST00000264167.4	+	4	606	c.460G>A	c.(460-462)Gat>Aat	p.D154N	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	154					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.D154N(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			AAATCCTAGTGATACACCTCC	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	82.0	80.0					2																	178301510		2203	4289	6492	-	-	-	SO:0001583	missense	0			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.460G>A	2.37:g.178301510G>A	ENSP00000264167:p.Asp154Asn		A5D8U9|Q2TU35	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.D154N	ENST00000264167.4	37	c.460	CCDS2275.1	2	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167972	0.57476	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.97279	-4.32	5.62	5.62	0.85841	.	0.101197	0.64402	D	0.000003	D	0.96021	0.8704	M	0.66939	2.045	0.80722	D	1	B	0.15930	0.015	B	0.16289	0.015	D	0.93500	0.6843	10	0.24483	T	0.36	.	19.6456	0.95775	0.0:0.0:1.0:0.0	.	154	O00116	ADAS_HUMAN	N	154;24	ENSP00000264167:D154N	ENSP00000264167:D154N	D	+	1	0	AGPS	178009756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.659000	0.74412	2.630000	0.89119	0.655000	0.94253	GAT	AGPS	-	NULL	ENSG00000018510		0.308	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	133	0.00	0	G			178301510	178301510	+1	no_errors	ENST00000264167	ensembl	human	known	69_37n	missense	161	17.86	35	SNP	1.000	A
ALDH1L2	160428	genome.wustl.edu	37	12	105425679	105425679	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:105425679G>A	ENST00000258494.9	-	20	2418	c.2278C>T	c.(2278-2280)Cca>Tca	p.P760S	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	760	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.P760S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						CTGTCAAGTGGATCACCAATT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	199.0	199.0					12																	105425679		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2278C>T	12.37:g.105425679G>A	ENSP00000258494:p.Pro760Ser		Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.P760S	ENST00000258494.9	37	c.2278	CCDS31891.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.7|28.7	4.942920|4.942920	0.92526|0.92526	.|.	.|.	ENSG00000136010|ENSG00000136010	ENST00000258494|ENST00000548418	T|.	0.80480|.	-1.38|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84995|0.84995	0.5596|0.5596	M|M	0.89287|0.89287	3.02|3.02	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.86704|0.86704	0.1931|0.1931	10|5	0.87932|.	D|.	0|.	.|.	19.6632|19.6632	0.95882|0.95882	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	760|.	Q3SY69|.	AL1L2_HUMAN|.	S|F	760|12	ENSP00000258494:P760S|.	ENSP00000258494:P760S|.	P|S	-|-	1|2	0|0	ALDH1L2|ALDH1L2	103949809|103949809	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	9.776000|9.776000	0.99001|0.99001	2.716000|2.716000	0.92895|0.92895	0.655000|0.655000	0.94253|0.94253	CCA|TCC	ALDH1L2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000136010		0.393	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	206	0.48	1	G	XM_090294		105425679	105425679	-1	no_errors	ENST00000258494	ensembl	human	known	69_37n	missense	201	13.36	31	SNP	1.000	A
AMBN	258	genome.wustl.edu	37	4	71469002	71469002	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:71469002C>G	ENST00000322937.6	+	10	777	c.674C>G	c.(673-675)tCt>tGt	p.S225C	AMBN_ENST00000449493.2_Missense_Mutation_p.S210C	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	225					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.S225C(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			CGTTTGATTTCTCACGGACCA	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	74.0	75.0					4																	71469002		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.674C>G	4.37:g.71469002C>G	ENSP00000313809:p.Ser225Cys		Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.S225C	ENST00000322937.6	37	c.674	CCDS3543.1	4	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857135	0.51376	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.42131	0.98;0.98	6.04	5.2	0.72013	.	0.395337	0.24828	N	0.035277	T	0.57607	0.2065	M	0.61703	1.905	0.34216	D	0.674847	D	0.76494	0.999	D	0.65323	0.934	T	0.69764	-0.5057	10	0.48119	T	0.1	-2.2705	11.4832	0.50337	0.0:0.9177:0.0:0.0823	.	225	Q9NP70	AMBN_HUMAN	C	225;224;210	ENSP00000313809:S225C;ENSP00000391234:S210C	ENSP00000313809:S225C	S	+	2	0	AMBN	71503591	0.116000	0.22171	0.983000	0.44433	0.424000	0.31475	1.459000	0.35234	1.568000	0.49683	0.563000	0.77884	TCT	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.323	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	96	0.00	0	C	NM_016519		71469002	71469002	+1	no_errors	ENST00000322937	ensembl	human	known	69_37n	missense	137	17.37	29	SNP	0.980	G
ANKRD30B	374860	genome.wustl.edu	37	18	14763684	14763684	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr18:14763684G>A	ENST00000358984.4	+	7	1000		c.e7-1		ANKRD30B_ENST00000447268.2_Splice_Site|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B									p.?(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GTGTTTGGCAGAAGGAACATC	0.443																																						dbGAP											2	Unknown(2)	breast(2)											18.0	17.0	18.0					18																	14763684		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.821-1G>A	18.37:g.14763684G>A			B4DGP1|F8WAG3|Q4G175	Splice_Site	SNP	-	e7-1	ENST00000358984.4	37	c.821-1	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	2.985	-0.209387	0.06140	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	.	.	.	0.226	0.226	0.15353	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999921	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	ANKRD30B	14753684	0.242000	0.23868	0.093000	0.20910	0.094000	0.18550	0.308000	0.19314	0.301000	0.22738	0.306000	0.20318	.	ANKRD30B	-	-	ENSG00000180777		0.443	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	32	0.00	0	G	NM_001145029	Intron	14763684	14763684	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	splice_site	42	19.23	10	SNP	0.108	A
ANKRD34B	340120	genome.wustl.edu	37	5	79855559	79855559	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:79855559C>G	ENST00000338682.3	-	5	952	c.280G>C	c.(280-282)Gaa>Caa	p.E94Q		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	94						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E94Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CCAGCTTTTTCTAAGCAAGCA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	145.0	147.0					5																	79855559		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.280G>C	5.37:g.79855559C>G	ENSP00000339802:p.Glu94Gln		B2RPH1|Q68D79	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E94Q	ENST00000338682.3	37	c.280	CCDS34194.1	5	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289597	0.40494	.	.	ENSG00000189127	ENST00000338682	T	0.63913	-0.07	5.9	5.03	0.67393	Ankyrin repeat-containing domain (4);	0.066671	0.56097	U	0.000031	T	0.60444	0.2269	N	0.25144	0.715	0.41240	D	0.98663	D	0.54772	0.968	P	0.54629	0.757	T	0.61613	-0.7027	10	0.38643	T	0.18	-9.8797	13.9112	0.63869	0.0:0.9264:0.0:0.0736	.	94	A5PLL1	AN34B_HUMAN	Q	94	ENSP00000339802:E94Q	ENSP00000339802:E94Q	E	-	1	0	ANKRD34B	79891315	0.980000	0.34600	0.643000	0.29450	0.872000	0.50106	2.424000	0.44714	1.497000	0.48584	0.561000	0.74099	GAA	ANKRD34B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000189127		0.443	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34B	HGNC	protein_coding	OTTHUMT00000369475.1	208	0.00	0	C	NM_001004441		79855559	79855559	-1	no_errors	ENST00000338682	ensembl	human	known	69_37n	missense	128	20.50	33	SNP	0.870	G
APPL1	26060	genome.wustl.edu	37	3	57272085	57272085	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:57272085G>A	ENST00000288266.3	+	4	373	c.226G>A	c.(226-228)Gga>Aga	p.G76R		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	76	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)	p.G76R(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		TTTTCCATTGGGAGGTGATGA	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											153.0	145.0	148.0					3																	57272085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.226G>A	3.37:g.57272085G>A	ENSP00000288266:p.Gly76Arg		Q9P2B9	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.G76R	ENST00000288266.3	37	c.226	CCDS2882.1	3	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206458	0.79127	.	.	ENSG00000157500	ENST00000288266;ENST00000444459	T;T	0.32023	1.47;1.47	6.06	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.41949	0.1181	L	0.55481	1.735	0.58432	D	0.999999	P;B;P	0.48089	0.843;0.015;0.905	P;B;P	0.56398	0.677;0.017;0.797	T	0.25363	-1.0134	10	0.66056	D	0.02	.	8.538	0.33375	0.1314:0.0:0.743:0.1256	.	59;59;76	B4DQX8;C9JAB0;Q9UKG1	.;.;DP13A_HUMAN	R	76;59	ENSP00000288266:G76R;ENSP00000406095:G59R	ENSP00000288266:G76R	G	+	1	0	APPL1	57247125	1.000000	0.71417	0.613000	0.29037	0.962000	0.63368	6.293000	0.72731	0.897000	0.36392	0.650000	0.86243	GGA	APPL1	-	NULL	ENSG00000157500		0.308	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL1	HGNC	protein_coding	OTTHUMT00000258196.2	45	0.00	0	G	NM_012096		57272085	57272085	+1	no_errors	ENST00000288266	ensembl	human	known	69_37n	missense	48	22.58	14	SNP	1.000	A
ARHGAP5	394	genome.wustl.edu	37	14	32623834	32623834	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr14:32623834C>T	ENST00000345122.3	+	7	4504	c.4189C>T	c.(4189-4191)Cag>Tag	p.Q1397*	ARHGAP5_ENST00000433497.1_Nonsense_Mutation_p.Q136*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.Q1396*|ARHGAP5_ENST00000396582.2_Nonsense_Mutation_p.Q132*|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.Q1397*|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.Q1396*	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1397	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.Q1397*(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CAGGGTTAGTCAGCAACATAA	0.343																																					NSCLC(9;77 350 3443 29227 41353)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											81.0	75.0	78.0					14																	32623834		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4189C>T	14.37:g.32623834C>T	ENSP00000371897:p.Gln1397*		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.Q1397*	ENST00000345122.3	37	c.4189	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471648	0.84533	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497;ENST00000554090	.	.	.	4.93	4.93	0.64822	.	0.063906	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.5752	0.91153	0.0:1.0:0.0:0.0	.	.	.	.	X	1396;1397;132;1397;1396;136;136	.	ENSP00000371897:Q1397X	Q	+	1	0	ARHGAP5	31693585	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.834000	0.69361	2.475000	0.83589	0.549000	0.68633	CAG	ARHGAP5	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000100852		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	59	0.00	0	C	NM_001030055		32623834	32623834	+1	no_errors	ENST00000345122	ensembl	human	known	69_37n	nonsense	80	34.43	42	SNP	1.000	T
ASIC3	9311	genome.wustl.edu	37	7	150746160	150746160	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:150746160G>C	ENST00000349064.5	+	1	386	c.188G>C	c.(187-189)aGg>aCg	p.R63T	ASIC3_ENST00000297512.8_Missense_Mutation_p.R63T|ASIC3_ENST00000357922.4_Missense_Mutation_p.R63T	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	63					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)	p.R63T(2)									GTGGCTGAGAGGGTGCGCTAC	0.652																																						dbGAP											2	Substitution - Missense(2)	breast(2)											89.0	72.0	78.0					7																	150746160		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.188G>C	7.37:g.150746160G>C	ENSP00000344838:p.Arg63Thr		B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.R63T	ENST00000349064.5	37	c.188	CCDS5916.1	7	.	.	.	.	.	.	.	.	.	.	G	17.52	3.411255	0.62399	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.64618	-0.11;-0.11;-0.11	4.98	4.98	0.66077	.	0.000000	0.31246	U	0.007993	T	0.80717	0.4676	M	0.88704	2.975	0.35726	D	0.817527	D;D;D	0.69078	0.995;0.995;0.997	D;D;D	0.74674	0.931;0.948;0.984	D	0.83656	0.0158	10	0.22706	T	0.39	-23.1846	16.1122	0.81271	0.0:0.0:1.0:0.0	.	63;63;63	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	T	63	ENSP00000350600:R63T;ENSP00000344838:R63T;ENSP00000297512:R63T	ENSP00000297512:R63T	R	+	2	0	ACCN3	150377093	0.933000	0.31639	0.417000	0.26559	0.484000	0.33280	5.209000	0.65208	2.480000	0.83734	0.462000	0.41574	AGG	ASIC3	-	pfam_Na+channel_ASC	ENSG00000213199		0.652	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC3	HGNC	protein_coding	OTTHUMT00000351725.1	48	0.00	0	G	NM_004769		150746160	150746160	+1	no_errors	ENST00000297512	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	0.891	C
ATP7B	540	genome.wustl.edu	37	13	52544779	52544779	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr13:52544779C>T	ENST00000242839.4	-	3	1548	c.1392G>A	c.(1390-1392)ggG>ggA	p.G464G	ATP7B_ENST00000448424.2_Silent_p.G464G|ATP7B_ENST00000542656.1_Silent_p.G432G|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000344297.5_Silent_p.G464G|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000418097.2_Silent_p.G464G|ATP7B_ENST00000400366.3_Silent_p.G353G	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	464					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)	p.G464G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CAGGGAGCCTCCCAGTGTGGG	0.527									Wilson disease																													dbGAP											1	Substitution - coding silent(1)	breast(1)											144.0	144.0	144.0					13																	52544779		2019	4161	6180	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1392G>A	13.37:g.52544779C>T			Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Silent	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.G464	ENST00000242839.4	37	c.1392	CCDS41892.1	13																																																																																			ATP7B	-	NULL	ENSG00000123191		0.527	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	HGNC	protein_coding	OTTHUMT00000045981.1	284	0.00	0	C	NM_000053		52544779	52544779	-1	no_errors	ENST00000242839	ensembl	human	known	69_37n	silent	168	20.00	42	SNP	0.000	T
B3GNT1	11041	genome.wustl.edu	37	11	66114072	66114072	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:66114072G>A	ENST00000311181.4	-	1	1091	c.945C>T	c.(943-945)ccC>ccT	p.P315P	BRMS1_ENST00000359957.3_5'Flank|BRMS1_ENST00000425825.2_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	315					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)	p.P315P(1)		breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						CCACGTAGGCGGGCCGCAGCA	0.637																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											48.0	54.0	52.0					11																	66114072		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.945C>T	11.37:g.66114072G>A			Q4TTN0	Silent	SNP	NULL	p.P315	ENST00000311181.4	37	c.945	CCDS8136.1	11																																																																																			B3GNT1	-	NULL	ENSG00000174684		0.637	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT1	HGNC	protein_coding	OTTHUMT00000392959.1	68	0.00	0	G	NM_006876		66114072	66114072	-1	no_errors	ENST00000311181	ensembl	human	known	69_37n	silent	30	28.57	12	SNP	0.981	A
BICD1	636	genome.wustl.edu	37	12	32369283	32369283	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:32369283C>G	ENST00000281474.5	+	2	419	c.316C>G	c.(316-318)Ctg>Gtg	p.L106V	BICD1_ENST00000548411.1_Missense_Mutation_p.L106V	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	106					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.L106V(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGCTTACTATCTGGGGAAGAT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	106.0	109.0					12																	32369283		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.316C>G	12.37:g.32369283C>G	ENSP00000281474:p.Leu106Val		A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc,superfamily_SPOC-like	p.L106V	ENST00000281474.5	37	c.316	CCDS8726.1	12	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846616	0.32606	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.42131	0.98;0.98	5.55	5.55	0.83447	.	0.156867	0.42964	D	0.000639	T	0.32102	0.0818	N	0.08118	0	0.80722	D	1	B;P	0.44429	0.356;0.835	B;P	0.45071	0.164;0.468	T	0.11916	-1.0568	10	0.28530	T	0.3	.	19.5182	0.95174	0.0:1.0:0.0:0.0	.	106;106	F8W113;Q96G01	.;BICD1_HUMAN	V	106	ENSP00000446793:L106V;ENSP00000281474:L106V	ENSP00000281474:L106V	L	+	1	2	BICD1	32260550	0.671000	0.27521	0.998000	0.56505	0.989000	0.77384	1.263000	0.33004	2.603000	0.88011	0.655000	0.94253	CTG	BICD1	-	pfam_Bicaudal-D_microtubule-assoc	ENSG00000151746		0.542	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICD1	HGNC	protein_coding	OTTHUMT00000403380.1	68	0.00	0	C	NM_001714		32369283	32369283	+1	no_errors	ENST00000281474	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	1.000	G
BID	637	genome.wustl.edu	37	22	18220787	18220787	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr22:18220787C>T	ENST00000399774.3	-	5	741	c.572G>A	c.(571-573)aGa>aAa	p.R191K	BID_ENST00000399767.1_Missense_Mutation_p.R95K|BID_ENST00000399765.1_Missense_Mutation_p.R95K|BID_ENST00000551952.1_Missense_Mutation_p.R191K|BID_ENST00000473439.1_5'Flank|BID_ENST00000342111.5_3'UTR|BID_ENST00000317361.7_Missense_Mutation_p.R237K	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	191					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)	p.R237K(1)		large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		TCTTACATTTCTGGCTAAGCT	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	107.0	107.0					22																	18220787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.572G>A	22.37:g.18220787C>T	ENSP00000382674:p.Arg191Lys		Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	pfam_BID	p.R237K	ENST00000399774.3	37	c.710	CCDS13748.1	22	.	.	.	.	.	.	.	.	.	.	C	16.65	3.183387	0.57800	.	.	ENSG00000015475	ENST00000317361;ENST00000399767;ENST00000399774;ENST00000399765;ENST00000551952	T;T;T;T;T	0.28895	1.78;1.59;1.78;1.59;1.78	5.48	3.36	0.38483	.	0.148707	0.43110	D	0.000618	T	0.36441	0.0967	M	0.67397	2.05	0.19300	N	0.999974	B;P	0.38597	0.176;0.639	B;B	0.43783	0.322;0.431	T	0.21793	-1.0235	10	0.59425	D	0.04	.	9.5658	0.39398	0.0:0.8348:0.0:0.1652	.	191;237	P55957;P55957-2	BID_HUMAN;.	K	237;95;191;95;191	ENSP00000318822:R237K;ENSP00000382669:R95K;ENSP00000382674:R191K;ENSP00000382667:R95K;ENSP00000449236:R191K	ENSP00000318822:R237K	R	-	2	0	BID	16600787	0.097000	0.21791	0.185000	0.23176	0.596000	0.36781	0.714000	0.25808	0.670000	0.31165	0.655000	0.94253	AGA	BID	-	pfam_BID	ENSG00000015475		0.552	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BID	HGNC	protein_coding	OTTHUMT00000316178.1	39	0.00	0	C	NM_197966		18220787	18220787	-1	no_errors	ENST00000317361	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.220	T
BLOC1S2	282991	genome.wustl.edu	37	10	102046374	102046374	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:102046374C>T	ENST00000370372.2	-	1	95	c.43G>A	c.(43-45)Gag>Aag	p.E15K	BLOC1S2_ENST00000361832.2_5'UTR|BLOC1S2_ENST00000441611.1_5'Flank	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	15					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		CGGGCGGGCTCATCACTCCGG	0.726																																						dbGAP											0													13.0	18.0	17.0					10																	102046374		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.43G>A	10.37:g.102046374C>T	ENSP00000359398:p.Glu15Lys		B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	pfam_BLOC1_su2	p.E15K	ENST00000370372.2	37	c.43	CCDS7490.1	10	.	.	.	.	.	.	.	.	.	.	-	14.83	2.651678	0.47362	.	.	ENSG00000196072	ENST00000358848	.	.	.	4.62	4.62	0.57501	.	0.393291	0.28420	N	0.015401	T	0.25754	0.0627	N	0.14661	0.345	0.23320	N	0.997912	B	0.15473	0.013	B	0.12156	0.007	T	0.08764	-1.0706	9	0.22109	T	0.4	-8.162	13.1811	0.59655	0.0:1.0:0.0:0.0	.	15	Q6QNY1	BL1S2_HUMAN	K	15	.	ENSP00000351716:E15K	E	-	1	0	BLOC1S2	102036364	1.000000	0.71417	0.761000	0.31378	0.022000	0.10575	3.107000	0.50329	2.574000	0.86865	0.550000	0.68814	GAG	BLOC1S2	-	NULL	ENSG00000196072		0.726	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S2	HGNC	protein_coding	OTTHUMT00000049861.2	16	0.00	0	C	NM_173809		102046374	102046374	-1	no_errors	ENST00000370372	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.851	T
BMPR2	659	genome.wustl.edu	37	2	203383637	203383637	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:203383637G>A	ENST00000374580.4	+	6	1253	c.714G>A	c.(712-714)caG>caA	p.Q238Q	BMPR2_ENST00000374574.2_Silent_p.Q238Q	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.Q238Q(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						CAAACCGTCAGAATTTTATCA	0.438																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	119.0	122.0					2																	203383637		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.714G>A	2.37:g.203383637G>A			Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q238	ENST00000374580.4	37	c.714	CCDS33361.1	2																																																																																			BMPR2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000204217		0.438	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	101	0.00	0	G	NM_001204		203383637	203383637	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	silent	107	14.40	18	SNP	0.998	A
BPGM	669	genome.wustl.edu	37	7	134346544	134346544	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:134346544G>A	ENST00000393132.2	+	3	774	c.285G>A	c.(283-285)ttG>ttA	p.L95L	BPGM_ENST00000344924.3_Silent_p.L95L|BPGM_ENST00000418040.1_Silent_p.L95L	NM_199186.2	NP_954655.1	P07738	PMGE_HUMAN	2,3-bisphosphoglycerate mutase	95					carbohydrate metabolic process (GO:0005975)|erythrocyte development (GO:0048821)|glycolytic process (GO:0006096)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)	p.L95L(1)		breast(1)|endometrium(1)|lung(2)|stomach(1)	5						ATGGGGCCTTGATCGGTCTCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											74.0	68.0	70.0					7																	134346544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017050	CCDS5833.1	7q33	2012-10-02			ENSG00000172331	ENSG00000172331	5.4.2.4		1093	protein-coding gene	gene with protein product		613896					Standard	NM_199186		Approved		uc003vrw.3	P07738	OTTHUMG00000155380	ENST00000393132.2:c.285G>A	7.37:g.134346544G>A			A4D1N9	Silent	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.L95	ENST00000393132.2	37	c.285	CCDS5833.1	7																																																																																			BPGM	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	ENSG00000172331		0.537	BPGM-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPGM	HGNC	protein_coding	OTTHUMT00000339763.1	182	0.00	0	G	NM_001724		134346544	134346544	+1	no_errors	ENST00000344924	ensembl	human	known	69_37n	silent	178	18.72	41	SNP	1.000	A
BRIP1	83990	genome.wustl.edu	37	17	59876540	59876540	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:59876540C>G	ENST00000259008.2	-	9	1528	c.1261G>C	c.(1261-1263)Gaa>Caa	p.E421Q	BRIP1_ENST00000577598.1_Missense_Mutation_p.E421Q	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	421	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E421Q(2)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CTATCTAGTTCATCCCGAGCA	0.408			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	2	Substitution - Missense(2)	breast(2)											150.0	139.0	143.0					17																	59876540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1261G>C	17.37:g.59876540C>G	ENSP00000259008:p.Glu421Gln		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.E421Q	ENST00000259008.2	37	c.1261	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969806	0.92855	.	.	ENSG00000136492	ENST00000259008	T	0.74947	-0.89	5.61	5.61	0.85477	DEAD-like helicase (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	T	0.81254	0.4784	L	0.35723	1.085	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78889	-0.2026	9	.	.	.	-22.5749	18.6272	0.91344	0.0:1.0:0.0:0.0	.	421	Q9BX63	FANCJ_HUMAN	Q	421	ENSP00000259008:E421Q	.	E	-	1	0	BRIP1	57231322	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.010000	0.76353	2.652000	0.90054	0.460000	0.39030	GAA	BRIP1	-	smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000136492		0.408	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	146	0.00	0	C	NM_032043		59876540	59876540	-1	no_errors	ENST00000259008	ensembl	human	known	69_37n	missense	262	27.62	100	SNP	1.000	G
BRPF3	27154	genome.wustl.edu	37	6	36168619	36168619	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:36168619G>C	ENST00000357641.6	+	2	773	c.520G>C	c.(520-522)Gat>Cat	p.D174H	BRPF3_ENST00000339717.7_Missense_Mutation_p.D174H|BRPF3_ENST00000543502.1_Missense_Mutation_p.D174H|BRPF3_ENST00000443324.2_Missense_Mutation_p.D174H|BRPF3_ENST00000534694.1_Missense_Mutation_p.D174H|BRPF3_ENST00000534400.1_Missense_Mutation_p.D174H	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	174					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.D174H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ACGGCGAGTAGATGGGCACAG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	105.0	112.0					6																	36168619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.520G>C	6.37:g.36168619G>C	ENSP00000350267:p.Asp174His		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.D174H	ENST00000357641.6	37	c.520	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917683	0.73098	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8	5.57	5.57	0.84162	Enhancer of polycomb-like, N-terminal (1);	0.106541	0.64402	D	0.000005	T	0.63710	0.2534	M	0.66506	2.035	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76071	0.972;0.972;0.987	T	0.65421	-0.6172	10	0.66056	D	0.02	.	19.6097	0.95600	0.0:0.0:1.0:0.0	.	174;174;174	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	H	174	ENSP00000350267:D174H;ENSP00000345419:D174H;ENSP00000434501:D174H;ENSP00000445352:D174H;ENSP00000387368:D174H;ENSP00000436504:D174H	ENSP00000345419:D174H	D	+	1	0	BRPF3	36276597	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	9.414000	0.97362	2.627000	0.88993	0.558000	0.71614	GAT	BRPF3	-	pfam_Enhancer_polycomb-like_N	ENSG00000096070		0.527	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	141	0.00	0	G	NM_015695		36168619	36168619	+1	no_errors	ENST00000357641	ensembl	human	known	69_37n	missense	103	10.34	12	SNP	1.000	C
BTD	686	genome.wustl.edu	37	3	15677106	15677106	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:15677106C>G	ENST00000303498.5	+	2	329	c.220C>G	c.(220-222)Ctg>Gtg	p.L74V	BTD_ENST00000449107.1_Missense_Mutation_p.L76V|BTD_ENST00000383778.4_Missense_Mutation_p.L54V|BTD_ENST00000437172.1_Missense_Mutation_p.L76V|BTD_ENST00000482824.1_3'UTR	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	74	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)	p.L74V(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						TCTGAACCCTCTGGCTCTCAT	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	125.0	128.0					3																	15677106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.220C>G	3.37:g.15677106C>G	ENSP00000306477:p.Leu74Val		A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.L74V	ENST00000303498.5	37	c.220	CCDS2628.1	3	.	.	.	.	.	.	.	.	.	.	C	0.474	-0.882895	0.02530	.	.	ENSG00000169814	ENST00000427382;ENST00000449107;ENST00000303498;ENST00000437172;ENST00000436193;ENST00000383778	D;D;D;D;D;D	0.98120	-4.73;-2.47;-2.46;-2.47;-2.2;-2.46	4.72	0.161	0.14977	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (2);	0.714712	0.13486	N	0.384291	D	0.90638	0.7064	N	0.22421	0.69	0.09310	N	1	P;P;P	0.45283	0.855;0.855;0.855	B;B;B	0.38225	0.268;0.268;0.268	D	0.86202	0.1619	10	0.12430	T	0.62	-11.7289	1.2366	0.01954	0.2672:0.2465:0.3145:0.1717	.	76;76;74	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	V	54;76;74;76;54;54	ENSP00000397113:L54V;ENSP00000388212:L76V;ENSP00000306477:L74V;ENSP00000400995:L76V;ENSP00000394277:L54V;ENSP00000373288:L54V	ENSP00000306477:L74V	L	+	1	2	BTD	15652110	0.000000	0.05858	0.144000	0.22314	0.028000	0.11728	0.074000	0.14662	0.438000	0.26450	-0.260000	0.10688	CTG	BTD	-	superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	ENSG00000169814		0.547	BTD-001	KNOWN	basic|CCDS	protein_coding	BTD	HGNC	protein_coding	OTTHUMT00000252103.2	169	0.59	1	C	NM_000060		15677106	15677106	+1	no_errors	ENST00000303498	ensembl	human	known	69_37n	missense	281	14.33	47	SNP	0.000	G
BTK	695	genome.wustl.edu	37	X	100615648	100615648	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:100615648C>G	ENST00000308731.7	-	8	847	c.684G>C	c.(682-684)atG>atC	p.M228I	BTK_ENST00000372880.1_Missense_Mutation_p.M228I	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	228	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.M228I(1)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CATTTGCATTCATTGGCATGT	0.458									Agammaglobulinemia, X-linked																													dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	140.0	149.0					X																	100615648		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.684G>C	X.37:g.100615648C>G	ENSP00000308176:p.Met228Ile		B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.M228I	ENST00000308731.7	37	c.684	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195729	0.38806	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.47528	0.84;0.84	5.94	5.94	0.96194	Src homology-3 domain (4);	0.154131	0.64402	D	0.000001	T	0.34454	0.0898	N	0.16567	0.415	0.51767	D	0.999934	B;B;B	0.20164	0.017;0.0;0.042	B;B;B	0.29663	0.105;0.007;0.061	T	0.15752	-1.0426	10	0.30854	T	0.27	.	12.3853	0.55328	0.0:0.9209:0.0:0.0791	.	228;228;228	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	I	228	ENSP00000361971:M228I;ENSP00000308176:M228I	ENSP00000308176:M228I	M	-	3	0	BTK	100502304	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.535000	0.67173	2.529000	0.85273	0.590000	0.80494	ATG	BTK	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000010671		0.458	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	221	0.00	0	C	NM_000061		100615648	100615648	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	missense	179	15.96	34	SNP	1.000	G
C10orf107	219621	genome.wustl.edu	37	10	63519907	63519907	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:63519907G>C	ENST00000330194.2	+	5	684	c.379G>C	c.(379-381)Gag>Cag	p.E127Q		NM_173554.2	NP_775825.1	Q8IVU9	CJ107_HUMAN	chromosome 10 open reading frame 107	127								p.E127Q(1)		breast(1)|kidney(1)|lung(4)|prostate(1)|skin(1)	8	Prostate(12;0.016)					AACATTCATAGAGCCCCCCAC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	93.0	95.0					10																	63519907		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041932	CCDS7262.1	10q21.3	2012-06-01			ENSG00000183346	ENSG00000183346			28678	protein-coding gene	gene with protein product						12477932	Standard	NM_173554		Approved	bA63A2.1, Em:AC022398.2, MGC44593	uc010qik.2	Q8IVU9	OTTHUMG00000018295	ENST00000330194.2:c.379G>C	10.37:g.63519907G>C	ENSP00000328698:p.Glu127Gln		Q5T1B8	Missense_Mutation	SNP	NULL	p.E127Q	ENST00000330194.2	37	c.379	CCDS7262.1	10	.	.	.	.	.	.	.	.	.	.	G	11.39	1.623507	0.28889	.	.	ENSG00000183346	ENST00000330194	.	.	.	5.58	3.74	0.42951	.	0.520575	0.18403	N	0.142295	T	0.46560	0.1399	M	0.68317	2.08	0.24989	N	0.991542	B	0.29037	0.231	B	0.33196	0.159	T	0.44667	-0.9313	9	0.52906	T	0.07	-0.976	8.5225	0.33285	0.2402:0.0:0.7598:0.0	.	127	Q8IVU9	CJ107_HUMAN	Q	127	.	ENSP00000328698:E127Q	E	+	1	0	C10orf107	63189913	0.007000	0.16637	0.795000	0.32087	0.193000	0.23685	0.875000	0.28079	0.722000	0.32252	-0.136000	0.14681	GAG	C10orf107	-	NULL	ENSG00000183346		0.413	C10orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf107	HGNC	protein_coding	OTTHUMT00000048228.2	92	0.00	0	G	NM_173554		63519907	63519907	+1	no_errors	ENST00000330194	ensembl	human	known	69_37n	missense	147	15.52	27	SNP	0.931	C
C10orf2	56652	genome.wustl.edu	37	10	102748459	102748459	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:102748459C>T	ENST00000311916.2	+	1	677	c.492C>T	c.(490-492)ctC>ctT	p.L164L	MRPL43_ENST00000370236.1_5'Flank|MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370241.3_5'Flank|C10orf2_ENST00000370228.1_Silent_p.L164L|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|MRPL43_ENST00000493646.1_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	164					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.L164L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAATACCTCTCTGGGAGCTGC	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											145.0	162.0	156.0					10																	102748459		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.492C>T	10.37:g.102748459C>T			B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Silent	SNP	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	p.L164	ENST00000311916.2	37	c.492	CCDS7506.1	10																																																																																			C10orf2	-	NULL	ENSG00000107815		0.552	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1	142	0.00	0	C	NM_021830		102748459	102748459	+1	no_errors	ENST00000311916	ensembl	human	known	69_37n	silent	86	12.12	12	SNP	0.375	T
C11orf87	399947	genome.wustl.edu	37	11	109294466	109294466	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:109294466G>A	ENST00000327419.6	+	2	510	c.107G>A	c.(106-108)cGc>cAc	p.R36H	RP11-708B6.2_ENST00000532929.1_RNA|RP11-708B6.2_ENST00000532992.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	36						integral component of membrane (GO:0016021)		p.R36H(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						ACGGGTGCCCGCGGCCCAGGC	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	51.0	54.0					11																	109294466		2200	4297	6497	-	-	-	SO:0001583	missense	0			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.107G>A	11.37:g.109294466G>A	ENSP00000331581:p.Arg36His		B4E169	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.R36H	ENST00000327419.6	37	c.107	CCDS31672.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425489	0.83667	.	.	ENSG00000185742	ENST00000327419	.	.	.	4.26	4.26	0.50523	.	0.000000	0.48286	U	0.000194	T	0.55210	0.1906	N	0.19112	0.55	0.37386	D	0.912242	D	0.89917	1.0	D	0.68765	0.96	T	0.62364	-0.6870	9	0.49607	T	0.09	.	12.888	0.58055	0.0:0.0:1.0:0.0	.	36	Q6NUJ2	CK087_HUMAN	H	36	.	ENSP00000331581:R36H	R	+	2	0	C11orf87	108799676	0.373000	0.25073	0.192000	0.23308	0.037000	0.13140	0.926000	0.28804	2.307000	0.77673	0.462000	0.41574	CGC	C11orf87	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000185742		0.677	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf87	HGNC	protein_coding	OTTHUMT00000390403.1	46	0.00	0	G	NM_207645		109294466	109294466	+1	no_errors	ENST00000327419	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.991	A
C12orf40	283461	genome.wustl.edu	37	12	40034769	40034769	+	Silent	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:40034769G>C	ENST00000324616.5	+	2	190	c.36G>C	c.(34-36)ctG>ctC	p.L12L	C12orf40_ENST00000398716.1_5'UTR|C12orf40_ENST00000405531.3_Silent_p.L12L	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	12								p.L12L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						CCAGGGTTCTGATCAAGCAGG	0.338																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											79.0	78.0	79.0					12																	40034769		1801	4070	5871	-	-	-	SO:0001819	synonymous_variant	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.36G>C	12.37:g.40034769G>C			B7WNU1|Q8IXY6|Q8N818|V9HW02	Silent	SNP	NULL	p.L12	ENST00000324616.5	37	c.36	CCDS41770.1	12																																																																																			C12orf40	-	NULL	ENSG00000180116		0.338	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	90	0.00	0	G	NM_173599		40034769	40034769	+1	no_errors	ENST00000324616	ensembl	human	known	69_37n	silent	225	13.79	36	SNP	1.000	C
TLDC2	140711	genome.wustl.edu	37	20	35507575	35507576	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:35507575_35507576insC	ENST00000217320.3	+	3	365_366	c.321_322insC	c.(322-324)ctcfs	p.L108fs	TLDC2_ENST00000602922.1_Frame_Shift_Ins_p.L108fs	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	108	TLD.																TGCTGCTGGTGCTCAGGGACCA	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.322dupC	20.37:g.35507576_35507576dupC	ENSP00000217320:p.Leu108fs		B3KVU8	Frame_Shift_Ins	INS	pfam_TLDc,smart_TLDc	p.L107fs	ENST00000217320.3	37	c.321_322	CCDS33465.1	20																																																																																			C20orf118	-	pfam_TLDc,smart_TLDc	ENSG00000101342		0.683	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf118	HGNC	protein_coding	OTTHUMT00000079060.2	62	0.00	0	-	NM_080628		35507575	35507576	+1	no_errors	ENST00000217320	ensembl	human	known	69_37n	frame_shift_ins	67	11.84	9	INS	0.998:0.999	C
C2CD3	26005	genome.wustl.edu	37	11	73789584	73789584	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:73789584C>T	ENST00000334126.7	-	23	4405	c.4179G>A	c.(4177-4179)ctG>ctA	p.L1393L	C2CD3_ENST00000313663.7_Silent_p.L1393L			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1393					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.L1393L(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CAAAATCTTTCAGGCTGTTCT	0.542																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											81.0	75.0	77.0					11																	73789584		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4179G>A	11.37:g.73789584C>T			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.L1393	ENST00000334126.7	37	c.4179		11																																																																																			C2CD3	-	NULL	ENSG00000168014		0.542	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		149	0.00	0	C	NM_015531		73789584	73789584	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	silent	130	19.25	31	SNP	0.004	T
C7orf60	154743	genome.wustl.edu	37	7	112461888	112461888	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:112461888C>T	ENST00000297145.4	-	5	1294	c.1129G>A	c.(1129-1131)Gat>Aat	p.D377N	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	377							rRNA (adenine) methyltransferase activity (GO:0016433)	p.D377N(1)|p.D377H(1)		breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						TATGGCGCATCAGGGAgttct	0.378																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											68.0	65.0	66.0					7																	112461888		1852	4100	5952	-	-	-	SO:0001583	missense	0				CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.1129G>A	7.37:g.112461888C>T	ENSP00000297145:p.Asp377Asn		Q8N3D0|Q96MV7	Missense_Mutation	SNP	pfam_DUF3321	p.D377N	ENST00000297145.4	37	c.1129	CCDS43634.1	7	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363655	0.82353	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.83	5.83	0.93111	.	0.044615	0.85682	D	0.000000	T	0.56514	0.1990	N	0.19112	0.55	0.80722	D	1	P;D	0.56968	0.7;0.978	B;P	0.50825	0.221;0.651	T	0.60924	-0.7166	9	0.66056	D	0.02	-14.2384	20.1197	0.97955	0.0:1.0:0.0:0.0	.	324;377	B4DST1;Q1RMZ1	.;CG060_HUMAN	N	377;359;324	.	ENSP00000297145:D377N	D	-	1	0	C7orf60	112249124	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.747000	0.94245	0.585000	0.79938	GAT	C7orf60	-	NULL	ENSG00000164603		0.378	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf60	HGNC	protein_coding	OTTHUMT00000338923.1	102	0.00	0	C	NM_152556		112461888	112461888	-1	no_errors	ENST00000297145	ensembl	human	known	69_37n	missense	141	10.69	17	SNP	1.000	T
C8orf31	286122	genome.wustl.edu	37	8	144124425	144124425	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr8:144124425G>A	ENST00000395172.1	+	2	359	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	C8orf31_ENST00000517653.1_Intron	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	3								p.E3K(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TCTCATGGCTGAAAAGCCACA	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	75.0	74.0					8																	144124425		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.7G>A	8.37:g.144124425G>A	ENSP00000378601:p.Glu3Lys		Q6GMU7	Missense_Mutation	SNP	NULL	p.E3K	ENST00000395172.1	37	c.7	CCDS6395.1	8	.	.	.	.	.	.	.	.	.	.	g	8.672	0.903119	0.17760	.	.	ENSG00000177335	ENST00000395172	T	0.54866	0.55	1.03	-1.32	0.09201	.	.	.	.	.	T	0.25344	0.0616	N	0.08118	0	0.09310	N	1	B	0.23540	0.087	B	0.13407	0.009	T	0.14952	-1.0454	9	0.87932	D	0	.	1.7934	0.03056	0.2429:0.0:0.4342:0.323	.	3	Q8N9H6	CH031_HUMAN	K	3	ENSP00000378601:E3K	ENSP00000378601:E3K	E	+	1	0	C8orf31	144195800	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	-0.555000	0.05999	-0.462000	0.06984	0.435000	0.28638	GAA	C8orf31	-	NULL	ENSG00000177335		0.587	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf31	HGNC	protein_coding	OTTHUMT00000380167.1	74	0.00	0	G	NM_173687		144124425	144124425	+1	no_errors	ENST00000395172	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	0.001	A
CABS1	85438	genome.wustl.edu	37	4	71201101	71201101	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:71201101C>A	ENST00000273936.5	+	1	419	c.345C>A	c.(343-345)ttC>ttA	p.F115L		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	115					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)	p.F115L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCGAACATTTCATGCCAGTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	49.0	49.0					4																	71201101		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.345C>A	4.37:g.71201101C>A	ENSP00000273936:p.Phe115Leu		B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.F115L	ENST00000273936.5	37	c.345	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	C	0.730	-0.780263	0.02929	.	.	ENSG00000145309	ENST00000273936	T	0.23552	1.9	4.72	1.0	0.19881	.	0.524018	0.16195	N	0.225188	T	0.10208	0.0250	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.35649	-0.9780	10	0.07030	T	0.85	-1.4735	3.9919	0.09541	0.3265:0.4953:0.0:0.1781	.	115	Q96KC9	CABS1_HUMAN	L	115	ENSP00000273936:F115L	ENSP00000273936:F115L	F	+	3	2	CABS1	71235690	0.004000	0.15560	0.029000	0.17559	0.006000	0.05464	0.261000	0.18442	0.040000	0.15660	-0.768000	0.03414	TTC	CABS1	-	NULL	ENSG00000145309		0.368	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	220	0.00	0	C	NM_033122		71201101	71201101	+1	no_errors	ENST00000273936	ensembl	human	known	69_37n	missense	239	31.23	109	SNP	0.010	A
CABYR	26256	genome.wustl.edu	37	18	21736510	21736510	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr18:21736510G>T	ENST00000399481.2	+	2	903	c.751G>T	c.(751-753)Gaa>Taa	p.E251*	CABYR_ENST00000581397.1_Intron|RP11-799B12.4_ENST00000583267.1_lincRNA|CABYR_ENST00000327201.6_Intron|CABYR_ENST00000399496.3_Intron|CABYR_ENST00000399499.1_Intron|CABYR_ENST00000415309.2_Intron			O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	349					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)	p.E349*(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					ATCTGTAGTAGAAAAGACCAC	0.378																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											61.0	65.0	64.0					18																	21736510		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399481.2:c.751G>T	18.37:g.21736510G>T	ENSP00000382404:p.Glu251*		B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Nonsense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.E349*	ENST00000399481.2	37	c.1045		18	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359969	0.24598	.	.	ENSG00000154040	ENST00000399481	.	.	.	4.9	-9.79	0.00494	.	13.242900	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7488	6.552	0.22440	0.0843:0.546:0.1073:0.2623	.	.	.	.	X	251	.	.	E	+	1	0	CABYR	19990508	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-3.341000	0.00505	-1.256000	0.02478	-0.868000	0.02995	GAA	CABYR	-	NULL	ENSG00000154040		0.378	CABYR-201	KNOWN	basic	protein_coding	CABYR	HGNC	protein_coding		190	0.00	0	G	NM_153770		21736510	21736510	+1	no_errors	ENST00000463087	ensembl	human	known	69_37n	nonsense	124	18.42	28	SNP	0.000	T
CACNG6	59285	genome.wustl.edu	37	19	54502978	54502978	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:54502978G>A	ENST00000252729.2	+	3	1087	c.497G>A	c.(496-498)gGt>gAt	p.G166D	CACNG6_ENST00000352529.1_Intron|CACNG6_ENST00000346968.2_Intron	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	166					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CTCAGTAAAGGTGCAGAGTTC	0.587																																						dbGAP											0													224.0	192.0	203.0					19																	54502978		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.497G>A	19.37:g.54502978G>A	ENSP00000252729:p.Gly166Asp			Missense_Mutation	SNP	prints_VDCC_g6su,prints_VDCC_gsu,prints_Claudin	p.G166D	ENST00000252729.2	37	c.497	CCDS12870.1	19	.	.	.	.	.	.	.	.	.	.	.	19.83	3.900045	0.72754	.	.	ENSG00000130433	ENST00000252729	T	0.69306	-0.39	4.92	4.92	0.64577	.	0.235349	0.34156	N	0.004219	T	0.77751	0.4177	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.77814	-0.2448	10	0.48119	T	0.1	-19.4122	14.0252	0.64582	0.0:0.0:1.0:0.0	.	166	Q9BXT2	CCG6_HUMAN	D	166	ENSP00000252729:G166D	ENSP00000252729:G166D	G	+	2	0	CACNG6	59194790	1.000000	0.71417	0.981000	0.43875	0.986000	0.74619	3.422000	0.52749	2.446000	0.82766	0.561000	0.74099	GGT	CACNG6	-	NULL	ENSG00000130433		0.587	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG6	HGNC	protein_coding	OTTHUMT00000139359.1	304	0.33	1	G			54502978	54502978	+1	no_errors	ENST00000252729	ensembl	human	known	69_37n	missense	144	16.28	28	SNP	0.979	A
CALCOCO1	57658	genome.wustl.edu	37	12	54109013	54109013	+	Nonsense_Mutation	SNP	C	C	A	rs374769405		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:54109013C>A	ENST00000550804.1	-	10	1417	c.1357G>T	c.(1357-1359)Gag>Tag	p.E453*	CALCOCO1_ENST00000262059.4_Nonsense_Mutation_p.E453*|CALCOCO1_ENST00000430117.2_Nonsense_Mutation_p.E368*|CALCOCO1_ENST00000548263.1_Nonsense_Mutation_p.E453*			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	453					intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.E453*(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						CGGGCCAGCTCAGTCTTGAAC	0.542																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											167.0	137.0	147.0					12																	54109013		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.1357G>T	12.37:g.54109013C>A	ENSP00000449960:p.Glu453*		B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Nonsense_Mutation	SNP	pfam_CoCoA	p.E453*	ENST00000550804.1	37	c.1357	CCDS8864.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.104294	0.94245	.	.	ENSG00000012822	ENST00000342760;ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935	.	.	.	5.58	5.58	0.84498	.	0.000000	0.46758	D	0.000261	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-14.6325	12.1341	0.53961	0.0:0.9203:0.0:0.0797	.	.	.	.	X	130;368;453;391;453;453;446	.	ENSP00000262059:E453X	E	-	1	0	CALCOCO1	52395280	0.972000	0.33761	0.940000	0.37924	0.413000	0.31143	2.799000	0.47892	2.802000	0.96397	0.655000	0.94253	GAG	CALCOCO1	-	pfam_CoCoA	ENSG00000012822		0.542	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CALCOCO1	HGNC	protein_coding	OTTHUMT00000407233.2	306	0.00	0	C	NM_020898		54109013	54109013	-1	no_errors	ENST00000550804	ensembl	human	known	69_37n	nonsense	247	14.24	41	SNP	0.950	A
CAMTA2	23125	genome.wustl.edu	37	17	4876514	4876514	+	Missense_Mutation	SNP	C	C	G	rs560446249	byFrequency	TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:4876514C>G	ENST00000348066.3	-	14	2359	c.2236G>C	c.(2236-2238)Gag>Cag	p.E746Q	CAMTA2_ENST00000358183.4_Missense_Mutation_p.E746Q|CAMTA2_ENST00000361571.5_Missense_Mutation_p.E745Q|CAMTA2_ENST00000414043.3_Missense_Mutation_p.E769Q|CAMTA2_ENST00000381311.5_Missense_Mutation_p.E748Q|CAMTA2_ENST00000572543.1_Missense_Mutation_p.E751Q|RP5-1050D4.2_ENST00000430920.1_RNA	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	746					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.E746Q(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GGGTCAACCTCCTGCTCTAAG	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		19266	0.0		0.0	False		,,,				2504	0.002					dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	118.0	119.0					17																	4876514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.2236G>C	17.37:g.4876514C>G	ENSP00000321813:p.Glu746Gln		B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.E769Q	ENST00000348066.3	37	c.2305	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986275	0.93044	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61	4.88	4.88	0.63580	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000004	T	0.79227	0.4410	L	0.43646	1.37	0.53005	D	0.999966	D;D;D;D;D	0.89917	0.999;1.0;0.996;0.993;0.989	D;D;D;D;D	0.87578	0.991;0.998;0.986;0.968;0.979	T	0.81141	-0.1068	10	0.87932	D	0	-19.5835	15.5673	0.76303	0.0:1.0:0.0:0.0	.	722;769;748;746;745	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	Q	769;748;745;746;746	ENSP00000412886:E769Q;ENSP00000370712:E748Q;ENSP00000354828:E745Q;ENSP00000350910:E746Q;ENSP00000321813:E746Q	ENSP00000321813:E746Q	E	-	1	0	CAMTA2	4817238	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.596000	0.82721	2.541000	0.85698	0.561000	0.74099	GAG	CAMTA2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000108509		0.552	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	152	0.00	0	C	NM_015099		4876514	4876514	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	missense	82	20.39	21	SNP	1.000	G
CBFA2T2	9139	genome.wustl.edu	37	20	32199100	32199100	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:32199100G>A	ENST00000346541.3	+	4	943	c.406G>A	c.(406-408)Gag>Aag	p.E136K	CBFA2T2_ENST00000342704.6_Missense_Mutation_p.E127K|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.E107K|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.E136K|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.E107K|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.E107K|CBFA2T2_ENST00000397798.2_Missense_Mutation_p.E107K|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.E146K	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	136	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.E127K(1)|p.E136K(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CATCTCCCCTGAGATTGGGGA	0.507																																					Esophageal Squamous(174;142 1955 14837 21276 28041)	dbGAP											2	Substitution - Missense(2)	breast(2)											111.0	106.0	107.0					20																	32199100		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.406G>A	20.37:g.32199100G>A	ENSP00000262653:p.Glu136Lys		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.E136K	ENST00000346541.3	37	c.406	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.712385	0.96830	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000359606	T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.69	5.69	0.88448	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.71005	0.3289	M	0.75264	2.295	0.80722	D	1	D;D	0.64830	0.994;0.993	D;D	0.80764	0.994;0.989	T	0.73033	-0.4110	10	0.87932	D	0	-7.2552	19.812	0.96551	0.0:0.0:1.0:0.0	.	136;127	O43439;F8W6D7	MTG8R_HUMAN;.	K	136;127;127;107;136;107;107;146	ENSP00000364428:E136K;ENSP00000345810:E127K;ENSP00000408352:E127K;ENSP00000341865:E107K;ENSP00000262653:E136K;ENSP00000380902:E107K;ENSP00000380900:E107K;ENSP00000352622:E146K	ENSP00000345810:E127K	E	+	1	0	CBFA2T2	31662761	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.869000	0.99810	2.685000	0.91497	0.655000	0.94253	GAG	CBFA2T2	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1	ENSG00000078699		0.507	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	135	0.00	0	G	NM_001032999		32199100	32199100	+1	no_errors	ENST00000346541	ensembl	human	known	69_37n	missense	199	14.22	33	SNP	1.000	A
CBWD3	445571	genome.wustl.edu	37	9	70912543	70912543	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:70912543A>T	ENST00000360171.6	+	12	1415	c.864A>T	c.(862-864)gaA>gaT	p.E288D	CBWD3_ENST00000377342.5_Missense_Mutation_p.E268D	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	288	CobW C-terminal.						ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CAAAGGAAGAACATCTTAATA	0.274																																						dbGAP											0													2.0	2.0	2.0					9																	70912543		484	914	1398	-	-	-	SO:0001583	missense	0			BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.864A>T	9.37:g.70912543A>T	ENSP00000353295:p.Glu288Asp		B4DNG9|Q6VB91	Missense_Mutation	SNP	pfam_Cbl_biosynth_CobW-like,pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C,smart_Cbl_biosynth_CobW-like_C	p.E288D	ENST00000360171.6	37	c.864	CCDS35038.1	9	.	.	.	.	.	.	.	.	.	.	.	6.436	0.448519	0.12223	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455820;ENST00000377344;ENST00000377342	T;T	0.18174	2.23;2.23	3.68	2.47	0.30058	Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (4);	0.205916	0.45606	D	0.000342	T	0.11623	0.0283	L	0.33710	1.025	0.25192	P	0.99012997	B;B	0.21225	0.053;0.005	B;B	0.21360	0.034;0.02	T	0.17258	-1.0375	9	0.25106	T	0.35	-1.7023	8.3665	0.32389	0.8976:0.0:0.1024:0.0	.	240;288	E7ETY5;Q5JTY5	.;CBWD3_HUMAN	D	288;269;240;252;268	ENSP00000353295:E288D;ENSP00000366559:E268D	ENSP00000353295:E288D	E	+	3	2	CBWD3	70102363	0.972000	0.33761	0.962000	0.40283	0.463000	0.32649	1.301000	0.33447	0.358000	0.24211	0.254000	0.18369	GAA	CBWD3	-	pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C,smart_Cbl_biosynth_CobW-like_C	ENSG00000196873		0.274	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD3	HGNC	protein_coding	OTTHUMT00000052526.1	29	0.00	0	A	NM_201453		70912543	70912543	+1	no_errors	ENST00000360171	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.900	T
CCDC88C	440193	genome.wustl.edu	37	14	91779976	91779976	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr14:91779976C>T	ENST00000389857.6	-	15	2270	c.2184G>A	c.(2182-2184)agG>agA	p.R728R		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	728					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCTGGTTCTCCCTCTCCATCT	0.607																																						dbGAP											0													76.0	78.0	77.0					14																	91779976		2167	4270	6437	-	-	-	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2184G>A	14.37:g.91779976C>T			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.R728	ENST00000389857.6	37	c.2184	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.607	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	106	0.93	1	C	XM_029353		91779976	91779976	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	silent	67	18.29	15	SNP	0.100	T
CD3EAP	10849	genome.wustl.edu	37	19	45912334	45912334	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:45912334G>A	ENST00000309424.3	+	3	1596	c.1108G>A	c.(1108-1110)Gaa>Aaa	p.E370K	ERCC1_ENST00000588738.1_5'Flank|CD3EAP_ENST00000589804.1_Missense_Mutation_p.E372K|PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000423698.2_3'UTR|ERCC1_ENST00000300853.3_3'UTR	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	370					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)	p.E370K(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TCAACAGCCAGAAGGAGCGAA	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	46.0	43.0					19																	45912334		2202	4298	6500	-	-	-	SO:0001583	missense	0			U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1108G>A	19.37:g.45912334G>A	ENSP00000310966:p.Glu370Lys		Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol1_su_RPA34	p.E372K	ENST00000309424.3	37	c.1114	CCDS12661.1	19	.	.	.	.	.	.	.	.	.	.	G	8.411	0.844167	0.16963	.	.	ENSG00000117877	ENST00000309424	T	0.14640	2.49	4.46	-0.834	0.10779	.	4.736990	0.00397	N	0.000040	T	0.07458	0.0188	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34354	-0.9832	10	0.07990	T	0.79	12.0135	10.1412	0.42736	0.1081:0.6513:0.2406:0.0	.	372;370	O15446-2;O15446	.;RPA34_HUMAN	K	370	ENSP00000310966:E370K	ENSP00000310966:E370K	E	+	1	0	CD3EAP	50604174	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.266000	0.08631	-0.337000	0.08426	-0.367000	0.07326	GAA	CD3EAP	-	NULL	ENSG00000117877		0.597	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	HGNC	protein_coding	OTTHUMT00000459538.1	95	0.00	0	G	NM_012099		45912334	45912334	+1	no_errors	ENST00000589804	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	0.000	A
CDC23	8697	genome.wustl.edu	37	5	137542199	137542199	+	Intron	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:137542199C>T	ENST00000394886.2	-	3	403				CDC23_ENST00000505120.1_3'UTR|CDC23_ENST00000394884.3_Missense_Mutation_p.E137K	NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATGGATGTTTCACTAAAGGCA	0.333																																						dbGAP											0													45.0	47.0	46.0					5																	137542199		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.372+36G>A	5.37:g.137542199C>T			A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Missense_Mutation	SNP	pfam_APC8	p.E137K	ENST00000394886.2	37	c.409	CCDS4200.2	5	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243422	0.58995	.	.	ENSG00000094880	ENST00000394884	T	0.32023	1.47	4.75	4.75	0.60458	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.54753	D	0.999982	P	0.45715	0.865	P	0.50708	0.648	T	0.01500	-1.1339	8	0.06365	T	0.9	.	13.4516	0.61174	0.0:1.0:0.0:0.0	.	137	Q9UJX2-2	.	K	137	ENSP00000378348:E137K	ENSP00000378348:E137K	E	-	1	0	CDC23	137570098	0.003000	0.15002	0.573000	0.28510	0.318000	0.28184	0.106000	0.15354	2.629000	0.89072	0.650000	0.86243	GAA	CDC23	-	NULL	ENSG00000094880		0.333	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC23	HGNC	protein_coding	OTTHUMT00000251275.2	119	0.00	0	C			137542199	137542199	-1	no_errors	ENST00000394884	ensembl	human	known	69_37n	missense	82	21.90	23	SNP	0.339	T
CDC42BPB	9578	genome.wustl.edu	37	14	103434954	103434954	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr14:103434954C>G	ENST00000361246.2	-	15	2383	c.2095G>C	c.(2095-2097)Gag>Cag	p.E699Q		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)									p.E699Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ACCAATTCCTCTTCATAAAAT	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	104.0	102.0					14																	103434954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.2095G>C	14.37:g.103434954C>G	ENSP00000355237:p.Glu699Gln			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.E699Q	ENST00000361246.2	37	c.2095	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303657	0.81136	.	.	ENSG00000198752	ENST00000361246	T	0.67345	-0.26	4.61	4.61	0.57282	.	0.047211	0.85682	D	0.000000	T	0.79106	0.4390	M	0.83953	2.67	0.80722	D	1	D	0.56746	0.977	P	0.53593	0.73	D	0.83865	0.0270	10	0.72032	D	0.01	.	17.8167	0.88637	0.0:1.0:0.0:0.0	.	699	Q9Y5S2	MRCKB_HUMAN	Q	699	ENSP00000355237:E699Q	ENSP00000355237:E699Q	E	-	1	0	CDC42BPB	102504707	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.994000	0.70623	2.293000	0.77203	0.655000	0.94253	GAG	CDC42BPB	-	NULL	ENSG00000198752		0.498	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	138	0.00	0	C	NM_006035		103434954	103434954	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	G
CDCA2	157313	genome.wustl.edu	37	8	25319710	25319710	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr8:25319710G>C	ENST00000330560.3	+	4	850	c.373G>C	c.(373-375)Gat>Cat	p.D125H	CDCA2_ENST00000380665.3_Missense_Mutation_p.D110H	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	125					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D125H(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TTTGGCACAAGATTCTCCTTC	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	85.0	84.0					8																	25319710		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.373G>C	8.37:g.25319710G>C	ENSP00000328228:p.Asp125His		Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.D125H	ENST00000330560.3	37	c.373	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	G	11.07	1.529639	0.27387	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.31510	1.49;1.49	5.4	-0.834	0.10779	.	0.851711	0.10268	N	0.695158	T	0.25158	0.0611	L	0.40543	1.245	0.09310	N	1	P;P;P	0.43094	0.799;0.799;0.799	P;P;P	0.44946	0.465;0.465;0.465	T	0.17868	-1.0355	10	0.40728	T	0.16	-3.331	4.5407	0.12056	0.1664:0.0:0.4817:0.3518	.	125;110;125	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	H	125;110	ENSP00000328228:D125H;ENSP00000370040:D110H	ENSP00000328228:D125H	D	+	1	0	CDCA2	25375627	0.000000	0.05858	0.000000	0.03702	0.473000	0.32948	-0.106000	0.10890	0.131000	0.18576	0.313000	0.20887	GAT	CDCA2	-	NULL	ENSG00000184661		0.428	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	159	0.00	0	G	NM_152562		25319710	25319710	+1	no_errors	ENST00000330560	ensembl	human	known	69_37n	missense	129	15.13	23	SNP	0.000	C
CDHR5	53841	genome.wustl.edu	37	11	621446	621446	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:621446C>T	ENST00000358353.3	-	7	839	c.517G>A	c.(517-519)Gac>Aac	p.D173N	CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.D173N|CDHR5_ENST00000349570.7_Missense_Mutation_p.D173N			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	173	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)	p.D173N(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GAGAAGTAGTCACTGGCACCC	0.667																																						dbGAP											1	Substitution - Missense(1)	breast(1)											42.0	45.0	44.0					11																	621446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.517G>A	11.37:g.621446C>T	ENSP00000351118:p.Asp173Asn		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	p.D173N	ENST00000358353.3	37	c.517	CCDS7707.1	11	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918193	0.33815	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000326366;ENST00000349570;ENST00000526077;ENST00000534311;ENST00000531088	T;T;T;T;T	0.45276	1.18;1.18;1.18;0.9;0.91	3.97	-1.88	0.07713	Cadherin (3);Cadherin-like (1);	2.247140	0.02589	N	0.099741	T	0.36717	0.0977	L	0.52573	1.65	0.09310	N	1	B;B;B;B;B	0.27732	0.187;0.007;0.023;0.023;0.007	B;B;B;B;B	0.24701	0.055;0.005;0.003;0.022;0.005	T	0.17653	-1.0362	10	0.28530	T	0.3	-1.3789	8.2871	0.31935	0.0:0.256:0.0:0.744	.	173;173;166;173;173	Q58EZ6;Q9HBB8-4;B4DV98;Q9HBB8-2;Q9HBB8	.;.;.;.;CDHR5_HUMAN	N	173;173;173;173;142;150;7	ENSP00000380676:D173N;ENSP00000351118:D173N;ENSP00000345726:D173N;ENSP00000435082:D142N;ENSP00000436295:D150N	ENSP00000326527:D173N	D	-	1	0	CDHR5	611446	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-1.049000	0.03514	-0.473000	0.06871	0.561000	0.74099	GAC	CDHR5	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000099834		0.667	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR5	HGNC	protein_coding	OTTHUMT00000255023.2	14	0.00	0	C	NM_021924		621446	621446	-1	no_errors	ENST00000358353	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.000	T
CDKL4	344387	genome.wustl.edu	37	2	39453083	39453083	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:39453083G>C	ENST00000395035.3	-	2	186	c.187C>G	c.(187-189)Ctt>Gtt	p.L63V	CDKL4_ENST00000378803.1_Missense_Mutation_p.L63V			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	63	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.L63V(1)		breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				AGGTTCACAAGATTTGGATGT	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	70.0	71.0					2																	39453083		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.187C>G	2.37:g.39453083G>C	ENSP00000378476:p.Leu63Val		Q2NME9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L63V	ENST00000395035.3	37	c.187		2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194560	0.78902	.	.	ENSG00000205111	ENST00000378803;ENST00000395035	T;T	0.37584	1.19;1.19	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49305	D	0.000157	T	0.31765	0.0807	N	0.00778	-1.195	0.80722	D	1	D;P	0.89917	1.0;0.947	D;D	0.91635	0.999;0.935	T	0.61192	-0.7112	10	0.41790	T	0.15	-25.6781	17.7728	0.88497	0.0:0.0:1.0:0.0	.	63;63	Q2NME9;Q5MAI5	.;CDKL4_HUMAN	V	63	ENSP00000368080:L63V;ENSP00000378476:L63V	ENSP00000368080:L63V	L	-	1	0	CDKL4	39306587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.971000	0.70440	2.788000	0.95919	0.650000	0.86243	CTT	CDKL4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000205111		0.338	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	CDKL4	HGNC	protein_coding	OTTHUMT00000331655.1	52	0.00	0	G	XM_293029		39453083	39453083	-1	no_errors	ENST00000378803	ensembl	human	known	69_37n	missense	62	36.08	35	SNP	1.000	C
CEP250	11190	genome.wustl.edu	37	20	34086459	34086459	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:34086459C>A	ENST00000397527.1	+	27	4411	c.3691C>A	c.(3691-3693)Ccc>Acc	p.P1231T	CEP250_ENST00000342580.4_Missense_Mutation_p.P1175T	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1231	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.P1231T(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TAAGAGAGGGCCCCTGCTGAC	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	80.0	78.0					20																	34086459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.3691C>A	20.37:g.34086459C>A	ENSP00000380661:p.Pro1231Thr		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.P1231T	ENST00000397527.1	37	c.3691	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	C	7.012	0.556941	0.13436	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.12774	2.65;2.65	4.51	-1.48	0.08745	.	0.811237	0.10956	N	0.615520	T	0.11623	0.0283	M	0.68317	2.08	0.21527	N	0.999658	B	0.27971	0.196	B	0.26770	0.073	T	0.35919	-0.9769	10	0.20519	T	0.43	.	3.5604	0.07880	0.1849:0.4013:0.0:0.4138	.	1231	Q9BV73	CP250_HUMAN	T	1231;1175	ENSP00000380661:P1231T;ENSP00000341541:P1175T	ENSP00000341541:P1175T	P	+	1	0	CEP250	33549873	0.002000	0.14202	0.969000	0.41365	0.340000	0.28889	-0.474000	0.06607	-0.060000	0.13132	-0.463000	0.05309	CCC	CEP250	-	NULL	ENSG00000126001		0.522	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	232	0.00	0	C	NM_007186		34086459	34086459	+1	no_errors	ENST00000397527	ensembl	human	known	69_37n	missense	195	14.41	33	SNP	0.695	A
CNN1	1264	genome.wustl.edu	37	19	11657670	11657670	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:11657670C>G	ENST00000252456.2	+	4	487	c.276C>G	c.(274-276)atC>atG	p.I92M	CNN1_ENST00000592923.1_Missense_Mutation_p.I42M|CNN1_ENST00000535659.2_Missense_Mutation_p.I42M|CNN1_ENST00000544952.1_Missense_Mutation_p.I72M	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	92	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.I92M(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						GCAACTTCATCAAGGCCATCA	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	108.0	115.0					19																	11657670		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.276C>G	19.37:g.11657670C>G	ENSP00000252456:p.Ile92Met		B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Missense_Mutation	SNP	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.I92M	ENST00000252456.2	37	c.276	CCDS12263.1	19	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724096	0.48728	.	.	ENSG00000130176	ENST00000252456;ENST00000535659;ENST00000544952	T;T;T	0.61040	0.14;0.14;0.14	4.77	3.69	0.42338	Calponin homology domain (5);	0.442010	0.25729	N	0.028696	T	0.68439	0.3001	M	0.74389	2.26	0.40455	D	0.980184	B	0.34161	0.439	P	0.50708	0.648	T	0.70528	-0.4847	10	0.87932	D	0	-36.8003	8.0539	0.30593	0.0:0.7455:0.164:0.0906	.	92	P51911	CNN1_HUMAN	M	92;42;72	ENSP00000252456:I92M;ENSP00000442031:I42M;ENSP00000437470:I72M	ENSP00000252456:I92M	I	+	3	3	CNN1	11518670	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.984000	0.49353	0.949000	0.37715	0.543000	0.68304	ATC	CNN1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,prints_SM22_calponin	ENSG00000130176		0.577	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN1	HGNC	protein_coding	OTTHUMT00000458854.1	415	0.00	0	C	NM_001299		11657670	11657670	+1	no_errors	ENST00000252456	ensembl	human	known	69_37n	missense	266	16.51	53	SNP	1.000	G
CS	1431	genome.wustl.edu	37	12	56668617	56668617	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:56668617C>G	ENST00000351328.3	-	9	1154	c.964G>C	c.(964-966)Gat>Cat	p.D322H	CS_ENST00000548567.1_Missense_Mutation_p.D256H|CS_ENST00000542324.2_Missense_Mutation_p.D309H	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	322					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)	p.D322H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		TCTGACACATCTTTGCCAACT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	125.0	133.0					12																	56668617		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.964G>C	12.37:g.56668617C>G	ENSP00000342056:p.Asp322His		Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Missense_Mutation	SNP	pfam_Citrate_synthase-like,superfamily_Citrate_synthase-like_core,prints_Citrate_synthase-like,tigrfam_Citrate_synthase_euk	p.D322H	ENST00000351328.3	37	c.964	CCDS8913.1	12	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781311	0.70222	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324	.	.	.	5.55	5.55	0.83447	Citrate synthase-like, large alpha subdomain (1);Citrate synthase-like, core (1);	0.101153	0.64402	D	0.000003	T	0.68284	0.2984	M	0.67569	2.06	0.58432	D	0.999998	B;B;B	0.16802	0.008;0.008;0.019	B;B;B	0.19946	0.027;0.027;0.027	T	0.64859	-0.6308	9	0.52906	T	0.07	-14.0725	18.6591	0.91465	0.0:1.0:0.0:0.0	.	309;277;322	B4DJV2;B3KTN4;O75390	.;.;CISY_HUMAN	H	256;322;309	.	ENSP00000342056:D322H	D	-	1	0	CS	54954884	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.537000	0.82033	2.792000	0.96026	0.555000	0.69702	GAT	CS	-	pfam_Citrate_synthase-like,superfamily_Citrate_synthase-like_core,tigrfam_Citrate_synthase_euk	ENSG00000062485		0.438	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CS	HGNC	protein_coding	OTTHUMT00000408588.2	217	0.00	0	C	NM_004077		56668617	56668617	-1	no_errors	ENST00000351328	ensembl	human	known	69_37n	missense	175	10.71	21	SNP	1.000	G
CSF1	1435	genome.wustl.edu	37	1	110466073	110466073	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:110466073C>T	ENST00000329608.6	+	6	1221	c.830C>T	c.(829-831)tCa>tTa	p.S277L	CSF1_ENST00000344188.5_Missense_Mutation_p.S277L|CSF1_ENST00000369801.1_Missense_Mutation_p.S277L|CSF1_ENST00000369802.3_Missense_Mutation_p.S277L|CSF1_ENST00000420111.2_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	277					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)	p.S277L(1)		breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		ATCGGTGGCTCACCACAGCCT	0.612											OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	46.0	44.0					1																	110466073		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.830C>T	1.37:g.110466073C>T	ENSP00000327513:p.Ser277Leu	1427	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	pfam_MCSF-1,superfamily_4_helix_cytokine-like_core,pirsf_MCSF-1	p.S277L	ENST00000329608.6	37	c.830	CCDS816.1	1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618479	0.28801	.	.	ENSG00000184371	ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000369801	T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67	4.05	4.05	0.47172	.	1.246080	0.06159	N	0.675670	T	0.08447	0.0210	L	0.57536	1.79	0.09310	N	1	B;B	0.29162	0.235;0.181	B;B	0.30943	0.103;0.122	T	0.27872	-1.0061	10	0.46703	T	0.11	.	12.0292	0.53388	0.0:1.0:0.0:0.0	.	277;277	P09603;P09603-2	CSF1_HUMAN;.	L	277;277;236;277;277	ENSP00000342718:S277L;ENSP00000327513:S277L;ENSP00000433837:S236L;ENSP00000358817:S277L;ENSP00000358816:S277L	ENSP00000327513:S277L	S	+	2	0	CSF1	110267596	0.000000	0.05858	0.008000	0.14137	0.110000	0.19582	-0.339000	0.07832	1.950000	0.56595	0.313000	0.20887	TCA	CSF1	-	pfam_MCSF-1,pirsf_MCSF-1	ENSG00000184371		0.612	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1	HGNC	protein_coding	OTTHUMT00000032208.1	167	0.59	1	C	NM_000757		110466073	110466073	+1	no_errors	ENST00000329608	ensembl	human	known	69_37n	missense	98	12.50	14	SNP	0.009	T
BRINP1	1620	genome.wustl.edu	37	9	121929782	121929782	+	Silent	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:121929782C>G	ENST00000265922.3	-	8	2327	c.1866G>C	c.(1864-1866)cgG>cgC	p.R622R	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	622					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.R622R(1)									GTAGCCGAGTCCGACTACGTA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											130.0	126.0	127.0					9																	121929782		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1866G>C	9.37:g.121929782C>G			Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	pfam_MACPF,smart_MACPF	p.R622	ENST00000265922.3	37	c.1866	CCDS6822.1	9																																																																																			DBC1	-	NULL	ENSG00000078725		0.537	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	167	0.00	0	C	NM_014618		121929782	121929782	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	silent	118	14.49	20	SNP	1.000	G
DCP1A	55802	genome.wustl.edu	37	3	53346285	53346285	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:53346285C>A	ENST00000607628.1	-	5	605	c.496G>T	c.(496-498)Gat>Tat	p.D166Y	DCP1A_ENST00000606822.1_Missense_Mutation_p.D166Y|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Missense_Mutation_p.D166Y	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	166					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)	p.D166Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TCATACTCATCCTTGGCTCTG	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	80.0	79.0					3																	53346285		2015	4182	6197	-	-	-	SO:0001583	missense	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.496G>T	3.37:g.53346285C>A	ENSP00000475920:p.Asp166Tyr		B4DHN9|U3KQM8	RNA	SNP	-	NULL	ENST00000607628.1	37	NULL		3																																																																																			DCP1A	-	-	ENSG00000162290		0.572	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		49	0.00	0	C	NM_018403		53346285	53346285	-1	no_errors	ENST00000294241	ensembl	human	known	69_37n	rna	42	22.22	12	SNP	1.000	A
DCTN4	51164	genome.wustl.edu	37	5	150112930	150112930	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:150112930C>T	ENST00000447998.2	-	5	652	c.537G>A	c.(535-537)tcG>tcA	p.S179S	DCTN4_ENST00000521093.1_5'Flank|DCTN4_ENST00000446090.2_Splice_Site_p.S179S|DCTN4_ENST00000424236.1_Splice_Site_p.S122S	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	179					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.S179S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAATTCTCACCGAAAAAGCCA	0.413																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											104.0	95.0	98.0					5																	150112930		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.537+1G>A	5.37:g.150112930C>T			B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Silent	SNP	pfam_Dynactin_p62	p.S179	ENST00000447998.2	37	c.537	CCDS4310.1	5																																																																																			DCTN4	-	pfam_Dynactin_p62	ENSG00000132912		0.413	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	HGNC	protein_coding	OTTHUMT00000252372.1	120	0.00	0	C		Silent	150112930	150112930	-1	no_errors	ENST00000446090	ensembl	human	known	69_37n	silent	84	26.96	31	SNP	1.000	T
DDX41	51428	genome.wustl.edu	37	5	176942966	176942966	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:176942966G>A	ENST00000507955.1	-	5	921	c.398C>T	c.(397-399)gCt>gTt	p.A133V	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	133					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A133V(1)				all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			AATGCCCTTAGCCATCTCCTT	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	128.0	133.0					5																	176942966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.398C>T	5.37:g.176942966G>A	ENSP00000422753:p.Ala133Val		B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A133V	ENST00000507955.1	37	c.398	CCDS4427.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.144938	0.94603	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.32023	1.47;1.49	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.59609	0.2206	M	0.93978	3.48	0.80722	D	1	D	0.61080	0.989	P	0.51701	0.677	T	0.71580	-0.4550	10	0.62326	D	0.03	-23.5489	19.7629	0.96329	0.0:0.0:1.0:0.0	.	133	Q9UJV9	DDX41_HUMAN	V	151;133	ENSP00000330349:A151V;ENSP00000422753:A133V	ENSP00000330349:A151V	A	-	2	0	DDX41	176875572	1.000000	0.71417	0.996000	0.52242	0.358000	0.29455	9.310000	0.96267	2.666000	0.90696	0.561000	0.74099	GCT	DDX41	-	NULL	ENSG00000183258		0.517	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2	53	0.00	0	G	NM_016222		176942966	176942966	-1	no_errors	ENST00000507955	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	1.000	A
DDX5	1655	genome.wustl.edu	37	17	62499308	62499308	+	Silent	SNP	T	T	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:62499308T>G	ENST00000225792.5	-	7	1209	c.808A>C	c.(808-810)Aga>Cga	p.R270R	MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000450599.2_Silent_p.R191R|DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000578804.1_Silent_p.R270R|MIR3064_ENST00000581130.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	270	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)	p.R270R(2)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			ACACTTACTCTTATTTGATCC	0.373			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)	dbGAP		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	2	Substitution - coding silent(2)	breast(2)											146.0	149.0	148.0					17																	62499308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.808A>C	17.37:g.62499308T>G			B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Nonstop_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfscan_Helicase_ATP-bd	p.*55Y	ENST00000225792.5	37	c.165	CCDS11659.1	17																																																																																			DDX5	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfscan_Helicase_ATP-bd	ENSG00000108654		0.373	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	325	0.00	0	T	NM_004396		62499308	62499308	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000579996	ensembl	human	putative	69_37n	nonstop	291	13.13	44	SNP	1.000	G
DEGS1	8560	genome.wustl.edu	37	1	224377343	224377343	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:224377343G>A	ENST00000323699.4	+	2	313	c.147G>A	c.(145-147)atG>atA	p.M49I	DEGS1_ENST00000391877.3_Missense_Mutation_p.M49I|DEGS1_ENST00000465848.1_3'UTR	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	49					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.M49I(1)		breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		TTATAATTATGATGGTTCTCA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	86.0	84.0					1																	224377343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.147G>A	1.37:g.224377343G>A	ENSP00000316476:p.Met49Ile			Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.M49I	ENST00000323699.4	37	c.147	CCDS1540.1	1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281504	0.23392	.	.	ENSG00000143753	ENST00000415210;ENST00000323699;ENST00000391877	T;T;T	0.39997	1.05;1.63;1.63	5.72	3.84	0.44239	.	0.814709	0.12090	N	0.500544	T	0.24353	0.0590	N	0.08118	0	0.33040	D	0.5313	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22277	-1.0221	10	0.20046	T	0.44	.	13.0458	0.58925	0.1291:0.0:0.8709:0.0	.	49;28	O15121;E7EMA0	DEGS1_HUMAN;.	I	28;49;49	ENSP00000400545:M28I;ENSP00000316476:M49I;ENSP00000375749:M49I	ENSP00000316476:M49I	M	+	3	0	DEGS1	222443966	1.000000	0.71417	0.819000	0.32651	0.687000	0.40016	4.925000	0.63425	0.870000	0.35726	0.549000	0.68633	ATG	DEGS1	-	pirsf_Sphingolipid_d4-desaturase	ENSG00000143753		0.368	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS1	HGNC	protein_coding	OTTHUMT00000091285.2	201	0.00	0	G			224377343	224377343	+1	no_errors	ENST00000323699	ensembl	human	known	69_37n	missense	364	12.26	51	SNP	0.945	A
DENND4A	10260	genome.wustl.edu	37	15	65962379	65962379	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr15:65962379C>G	ENST00000431932.2	-	25	4688	c.4480G>C	c.(4480-4482)Gaa>Caa	p.E1494Q	DENND4A_ENST00000443035.3_Missense_Mutation_p.E1537Q	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1494					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E1537Q(1)|p.E1496Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TCTCTTATTTCTATATTCAGA	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	59.0	59.0					15																	65962379		1835	4086	5921	-	-	-	SO:0001583	missense	0			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4480G>C	15.37:g.65962379C>G	ENSP00000396830:p.Glu1494Gln		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.E1537Q	ENST00000431932.2	37	c.4609	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656591	0.88154	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.06687	3.29;3.27	5.94	5.94	0.96194	.	0.052231	0.85682	D	0.000000	T	0.24353	0.0590	L	0.46885	1.475	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.99;0.994	T	0.00243	-1.1884	10	0.26408	T	0.33	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	1537;1494	E7EPL3;Q7Z401	.;MYCPP_HUMAN	Q	1537;1494	ENSP00000391167:E1537Q;ENSP00000396830:E1494Q	ENSP00000396830:E1494Q	E	-	1	0	DENND4A	63749433	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	7.675000	0.84002	2.820000	0.97059	0.650000	0.86243	GAA	DENND4A	-	NULL	ENSG00000174485		0.358	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	HGNC	protein_coding	OTTHUMT00000419611.1	42	0.00	0	C	NM_005848		65962379	65962379	-1	no_errors	ENST00000443035	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	G
DEPDC4	120863	genome.wustl.edu	37	12	100657398	100657398	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:100657398T>G	ENST00000416321.1	-	2	433	c.431A>C	c.(430-432)aAa>aCa	p.K144T		NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	144	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)			p.K144T(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TTCCTTTTCTTTTTTGAAAAG	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	69.0	68.0					12																	100657398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.431A>C	12.37:g.100657398T>G	ENSP00000396234:p.Lys144Thr		Q496C8|Q96BW0	Missense_Mutation	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.K144T	ENST00000416321.1	37	c.431	CCDS9075.1	12	.	.	.	.	.	.	.	.	.	.	T	10.53	1.375632	0.24857	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	T;T;T;T	0.33654	1.4;1.41;1.4;1.41	4.86	1.0	0.19881	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.326269	0.30584	U	0.009310	T	0.22166	0.0534	L	0.39898	1.24	0.21386	N	0.999703	B;B;B	0.10296	0.001;0.0;0.003	B;B;B	0.10450	0.005;0.002;0.005	T	0.14144	-1.0483	10	0.21540	T	0.41	.	4.0376	0.09737	0.0:0.2565:0.1841:0.5594	.	144;77;144	E9PGM3;Q3ZCN8;Q8N2C3	.;.;DEPD4_HUMAN	T	144;77;144;144;77;137	ENSP00000396234:K144T;ENSP00000448385:K144T;ENSP00000448338:K77T;ENSP00000449590:K137T	ENSP00000367490:K144T	K	-	2	0	DEPDC4	99181529	0.332000	0.24722	0.994000	0.49952	0.757000	0.42996	0.087000	0.14958	0.204000	0.20548	0.421000	0.28195	AAA	DEPDC4	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000166153		0.343	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC4	HGNC	protein_coding	OTTHUMT00000408482.1	193	0.00	0	T	NM_152317		100657398	100657398	-1	no_errors	ENST00000378244	ensembl	human	known	69_37n	missense	197	16.17	38	SNP	0.986	G
DHTKD1	55526	genome.wustl.edu	37	10	12123578	12123578	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:12123578G>A	ENST00000263035.4	+	2	324	c.262G>A	c.(262-264)Gaa>Aaa	p.E88K	DHTKD1_ENST00000465617.1_3'UTR	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	88					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.E88K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GAATGTGCCTGAAATCCAAGC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	104.0	108.0					10																	12123578		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.262G>A	10.37:g.12123578G>A	ENSP00000263035:p.Glu88Lys		Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.E88K	ENST00000263035.4	37	c.262	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.299498	0.95574	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.20200	3.51;2.09	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.25827	0.0629	L	0.61036	1.89	0.80722	D	1	B	0.14012	0.009	B	0.14023	0.01	T	0.04811	-1.0925	10	0.25106	T	0.35	.	18.3648	0.90386	0.0:0.0:1.0:0.0	.	88	Q96HY7	DHTK1_HUMAN	K	88	ENSP00000263035:E88K;ENSP00000388163:E88K	ENSP00000263035:E88K	E	+	1	0	DHTKD1	12163584	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.075000	0.94004	2.356000	0.79943	0.655000	0.94253	GAA	DHTKD1	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000181192		0.582	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	273	0.36	1	G	NM_018706		12123578	12123578	+1	no_errors	ENST00000263035	ensembl	human	known	69_37n	missense	196	17.65	42	SNP	1.000	A
DLG1	1739	genome.wustl.edu	37	3	196846393	196846393	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:196846393G>A	ENST00000419354.1	-	13	1559	c.1273C>T	c.(1273-1275)Cag>Tag	p.Q425*	DLG1_ENST00000450955.1_Nonsense_Mutation_p.Q392*|DLG1_ENST00000448528.2_Nonsense_Mutation_p.Q425*|DLG1_ENST00000392382.2_Nonsense_Mutation_p.Q392*|DLG1_ENST00000357674.4_Nonsense_Mutation_p.Q392*|DLG1_ENST00000443183.1_Nonsense_Mutation_p.Q309*|DLG1_ENST00000346964.2_Nonsense_Mutation_p.Q425*|DLG1_ENST00000452595.1_Nonsense_Mutation_p.Q309*|DLG1_ENST00000314062.3_Nonsense_Mutation_p.Q374*|DLG1_ENST00000422288.1_Nonsense_Mutation_p.Q374*			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	425					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.Q425*(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TCAACAGGCTGAGAAGAAGCT	0.393																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											60.0	58.0	59.0					3																	196846393		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1273C>T	3.37:g.196846393G>A	ENSP00000407531:p.Gln425*		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Nonsense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q425*	ENST00000419354.1	37	c.1273	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.845421	0.98522	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955;ENST00000447466	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	17.6981	0.88288	0.0:0.0:1.0:0.0	.	.	.	.	X	425;425;392;425;374;425;309;374;425;309;392;392;234	.	ENSP00000321087:Q374X	Q	-	1	0	DLG1	198330790	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.920000	0.92779	2.434000	0.82447	0.563000	0.77884	CAG	DLG1	-	pfam_PDZ_assoc,pirsf_M-assoc_guanylate_kinase	ENSG00000075711		0.393	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	72	0.00	0	G	NM_004087		196846393	196846393	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	nonsense	202	24.34	65	SNP	1.000	A
DNM2	1785	genome.wustl.edu	37	19	10935742	10935742	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:10935742G>A	ENST00000355667.6	+	18	1983	c.1903G>A	c.(1903-1905)Gag>Aag	p.E635K	DNM2_ENST00000585892.1_Missense_Mutation_p.E635K|DNM2_ENST00000359692.6_Missense_Mutation_p.E631K|DNM2_ENST00000408974.4_Missense_Mutation_p.E631K|DNM2_ENST00000389253.4_Missense_Mutation_p.E635K|DNM2_ENST00000314646.5_Missense_Mutation_p.E635K	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	635					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.E631K(1)|p.E635K(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			GGCAGAAAACGAGGATGGGGC	0.592			"""F, N, Splice, Mis, O"""		ETP ALL																																	dbGAP		Rec	yes		19	19p13.2	1785	dynamin 2		L	2	Substitution - Missense(2)	breast(2)											95.0	94.0	94.0					19																	10935742		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1903G>A	19.37:g.10935742G>A	ENSP00000347890:p.Glu635Lys		A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.E635K	ENST00000355667.6	37	c.1903	CCDS45968.1	19	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517284	0.44763	.	.	ENSG00000079805	ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646;ENST00000545324	D;D;D	0.93076	-3.14;-3.16;-3.15	5.03	5.03	0.67393	.	0.238971	0.41500	D	0.000867	D	0.92883	0.7736	M	0.62723	1.935	0.80722	D	1	B;B;B;P;B;B	0.50528	0.022;0.004;0.007;0.936;0.185;0.026	B;B;B;P;B;B	0.45712	0.005;0.002;0.002;0.491;0.016;0.003	D	0.92320	0.5865	10	0.35671	T	0.21	-6.95	17.1341	0.86734	0.0:0.0:1.0:0.0	.	229;364;631;631;635;635	Q8N1K8;B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;.;DYN2_HUMAN;.	K	631;631;635;635;635;242	ENSP00000386192:E631K;ENSP00000373905:E635K;ENSP00000313164:E635K	ENSP00000313164:E635K	E	+	1	0	DNM2	10796742	1.000000	0.71417	0.957000	0.39632	0.034000	0.12701	7.441000	0.80485	2.350000	0.79820	0.563000	0.77884	GAG	DNM2	-	NULL	ENSG00000079805		0.592	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	HGNC	protein_coding	OTTHUMT00000452592.1	68	0.00	0	G	NM_004945		10935742	10935742	+1	no_errors	ENST00000314646	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	A
DOLK	22845	genome.wustl.edu	37	9	131708299	131708299	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:131708299C>A	ENST00000372586.3	-	1	1599	c.1284G>T	c.(1282-1284)caG>caT	p.Q428H	RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	428					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)	p.Q428H(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						GGCTACCCTTCTGTGTGCAGG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	82.0	82.0					9																	131708299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1284G>T	9.37:g.131708299C>A	ENSP00000361667:p.Gln428His		Q5SRE6	Missense_Mutation	SNP	NULL	p.Q428H	ENST00000372586.3	37	c.1284	CCDS6915.1	9	.	.	.	.	.	.	.	.	.	.	C	5.402	0.259332	0.10239	.	.	ENSG00000175283	ENST00000372586	D	0.84223	-1.82	4.44	3.53	0.40419	.	0.150792	0.42053	D	0.000769	T	0.67505	0.2900	N	0.11201	0.11	0.28316	N	0.922445	B	0.09022	0.002	B	0.09377	0.004	T	0.57388	-0.7820	10	0.49607	T	0.09	-11.5734	5.128	0.14896	0.2246:0.67:0.0:0.1054	.	428	Q9UPQ8	DOLK_HUMAN	H	428	ENSP00000361667:Q428H	ENSP00000361667:Q428H	Q	-	3	2	DOLK	130748120	0.825000	0.29262	1.000000	0.80357	0.970000	0.65996	-0.097000	0.11042	2.444000	0.82710	0.407000	0.27541	CAG	DOLK	-	NULL	ENSG00000175283		0.592	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOLK	HGNC	protein_coding	OTTHUMT00000054515.1	60	0.00	0	C	NM_014908		131708299	131708299	-1	no_errors	ENST00000372586	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.998	A
DST	667	genome.wustl.edu	37	6	56480618	56480618	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:56480618C>T	ENST00000370765.6	-	24	7754	c.7647G>A	c.(7645-7647)aaG>aaA	p.K2549K	DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1845					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.K2549K(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCCCATTTCCTTATTTATAA	0.423																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											109.0	109.0	109.0					6																	56480618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7647G>A	6.37:g.56480618C>T			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.K2549	ENST00000370765.6	37	c.7647	CCDS4959.1	6																																																																																			DST	-	smart_Plectin_repeat	ENSG00000151914		0.423	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	228	0.00	0	C	NM_001723		56480618	56480618	-1	no_errors	ENST00000370765	ensembl	human	known	69_37n	silent	270	17.68	58	SNP	0.998	T
EDDM3A	10876	genome.wustl.edu	37	14	21216105	21216105	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr14:21216105C>T	ENST00000326842.2	+	2	493	c.366C>T	c.(364-366)taC>taT	p.Y122Y		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	122					sperm displacement (GO:0007321)	extracellular space (GO:0005615)		p.Y122Y(1)		breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GCTTCAGCTACATTGAATTCC	0.428																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	79.0	84.0					14																	21216105		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.366C>T	14.37:g.21216105C>T			Q4KN33	Silent	SNP	superfamily_RNaseA_domain	p.Y122	ENST00000326842.2	37	c.366	CCDS9556.1	14																																																																																			EDDM3A	-	superfamily_RNaseA_domain	ENSG00000181562		0.428	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3A	HGNC	protein_coding	OTTHUMT00000073742.3	194	0.00	0	C			21216105	21216105	+1	no_errors	ENST00000326842	ensembl	human	known	69_37n	silent	146	13.10	22	SNP	0.002	T
EFCAB7	84455	genome.wustl.edu	37	1	64027432	64027432	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:64027432G>C	ENST00000371088.4	+	11	1647	c.1401G>C	c.(1399-1401)ttG>ttC	p.L467F	EFCAB7_ENST00000461039.1_3'UTR	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	467							calcium ion binding (GO:0005509)	p.L467F(1)		breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						TTATGGATTTGAATCTAATGG	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	74.0	73.0					1																	64027432		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.1401G>C	1.37:g.64027432G>C	ENSP00000360129:p.Leu467Phe		Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.L467F	ENST00000371088.4	37	c.1401	CCDS30737.1	1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218527	0.58560	.	.	ENSG00000203965	ENST00000371088	T	0.44083	0.93	5.62	2.43	0.29744	.	0.000000	0.85682	D	0.000000	T	0.49184	0.1542	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.53711	-0.8400	10	0.72032	D	0.01	-5.9646	8.8215	0.35030	0.1397:0.2517:0.6087:0.0	.	467	A8K855	EFCB7_HUMAN	F	467	ENSP00000360129:L467F	ENSP00000360129:L467F	L	+	3	2	EFCAB7	63800020	1.000000	0.71417	0.986000	0.45419	0.933000	0.57130	2.227000	0.42972	0.694000	0.31654	0.542000	0.68232	TTG	EFCAB7	-	NULL	ENSG00000203965		0.333	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	76	0.00	0	G	NM_032437		64027432	64027432	+1	no_errors	ENST00000371088	ensembl	human	known	69_37n	missense	187	10.95	23	SNP	0.999	C
EFHC2	80258	genome.wustl.edu	37	X	44120503	44120503	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:44120503C>T	ENST00000420999.1	-	4	507	c.424G>A	c.(424-426)Gat>Aat	p.D142N		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	142	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)	p.D142N(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						TGATCCTCATCAGGAGGCGGA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	51.0	53.0					X																	44120503		1847	4085	5932	-	-	-	SO:0001583	missense	0			AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.424G>A	X.37:g.44120503C>T	ENSP00000404232:p.Asp142Asn		Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_HAND_2	p.D142N	ENST00000420999.1	37	c.424	CCDS55405.1	X	.	.	.	.	.	.	.	.	.	.	C	4.758	0.140975	0.09083	.	.	ENSG00000183690	ENST00000333807;ENST00000420999	T;T	0.69306	-0.38;-0.39	5.83	-2.52	0.06346	Uncharacterised domain DM10 (2);	0.476527	0.22232	N	0.062809	T	0.30572	0.0769	N	0.03930	-0.32	0.26048	N	0.981513	B	0.06786	0.001	B	0.01281	0.0	T	0.23833	-1.0177	10	0.11182	T	0.66	-1.583	4.8105	0.13340	0.0993:0.2179:0.0973:0.5855	.	142	Q5JST6	EFHC2_HUMAN	N	142;170	ENSP00000333823:D142N;ENSP00000404232:D170N	ENSP00000333823:D142N	D	-	1	0	EFHC2	44005447	0.015000	0.18098	0.726000	0.30738	0.963000	0.63663	-0.619000	0.05572	-0.580000	0.05944	-0.192000	0.12808	GAT	EFHC2	-	smart_Uncharacterised_DM10	ENSG00000183690		0.408	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	EFHC2	HGNC	protein_coding	OTTHUMT00000056312.2	244	0.00	0	C	NM_025184		44120503	44120503	-1	no_errors	ENST00000333807	ensembl	human	known	69_37n	missense	277	12.58	40	SNP	0.571	T
PDXDC2P	283970	genome.wustl.edu	37	16	70020388	70020388	+	RNA	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:70020388G>A	ENST00000531894.1	-	0	2169				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.R49C(2)|p.R34C(1)									TCACGATGACGATGGTCAGCC	0.363																																						dbGAP											3	Substitution - Missense(3)	breast(3)																																								-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70020388G>A			A8K9Z5	Missense_Mutation	SNP	pfam_NPIP	p.R34C	ENST00000531894.1	37	c.100		16	.	.	.	.	.	.	.	.	.	.	.	11.62	1.693029	0.30052	.	.	ENSG00000226232	ENST00000532298;ENST00000325845	T;T	0.45276	0.9;0.9	0.904	-0.432	0.12291	.	.	.	.	.	T	0.50599	0.1625	.	.	.	.	.	.	D	0.89917	1.0	D	0.63033	0.91	T	0.53315	-0.8456	7	0.59425	D	0.04	.	2.2566	0.04057	0.4535:0.3108:0.2357:0.0	.	30	A8MZ50	NPIL4_HUMAN	C	49;34	ENSP00000448651:R49C;ENSP00000449128:R34C	ENSP00000449128:R34C	R	-	1	0	RP11-419C5.2	68577889	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.895000	0.04118	-1.045000	0.03250	-2.445000	0.00210	CGT	RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.363	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	124	0.00	0	G			70020388	70020388	-1	no_errors	ENST00000325845	ensembl	human	known	69_37n	missense	73	20.43	19	SNP	0.000	A
EPM2AIP1	9852	genome.wustl.edu	37	3	37032949	37032949	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:37032949G>C	ENST00000322716.5	-	1	1846	c.1620C>G	c.(1618-1620)atC>atG	p.I540M	MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000435176.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	540					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)		p.I540M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						CAACCCCTTTGATAATTGGGT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	56.0	58.0					3																	37032949		1856	4106	5962	-	-	-	SO:0001583	missense	0			AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.1620C>G	3.37:g.37032949G>C	ENSP00000406027:p.Ile540Met		O94866|Q9H3L3	Missense_Mutation	SNP	NULL	p.I540M	ENST00000322716.5	37	c.1620	CCDS46790.1	3	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069244	0.55539	.	.	ENSG00000178567	ENST00000322716	T	0.15139	2.45	3.85	2.97	0.34412	.	.	.	.	.	T	0.28200	0.0696	L	0.42245	1.32	0.31143	N	0.706389	D	0.64830	0.994	P	0.62560	0.904	T	0.12734	-1.0536	9	0.62326	D	0.03	-10.894	9.5647	0.39391	0.1064:0.0:0.8936:0.0	.	540	Q7L775	EPMIP_HUMAN	M	540	ENSP00000406027:I540M	ENSP00000406027:I540M	I	-	3	3	EPM2AIP1	37007953	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.280000	0.43443	1.186000	0.42985	0.655000	0.94253	ATC	EPM2AIP1	-	NULL	ENSG00000178567		0.393	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2AIP1	HGNC	protein_coding	OTTHUMT00000470593.1	100	0.00	0	G	NM_014805		37032949	37032949	-1	no_errors	ENST00000322716	ensembl	human	known	69_37n	missense	118	21.19	32	SNP	1.000	C
ETV6	2120	genome.wustl.edu	37	12	11905408	11905408	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:11905408C>T	ENST00000396373.4	+	2	332	c.58C>T	c.(58-60)Cca>Tca	p.P20S	ETV6_ENST00000544715.1_3'UTR	NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	20					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P20S(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				ATATACACCTCCAGAGAGCCC	0.537			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	dbGAP		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	1	Substitution - Missense(1)	breast(1)											90.0	85.0	86.0					12																	11905408		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.58C>T	12.37:g.11905408C>T	ENSP00000379658:p.Pro20Ser		A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.P20S	ENST00000396373.4	37	c.58	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	C	8.730	0.916433	0.17907	.	.	ENSG00000139083	ENST00000396373	T	0.06768	3.26	5.73	5.73	0.89815	Sterile alpha motif/pointed domain (1);	0.125329	0.56097	D	0.000032	T	0.05686	0.0149	N	0.08118	0	0.47374	D	0.999409	B	0.10296	0.003	B	0.06405	0.002	T	0.46596	-0.9180	10	0.13853	T	0.58	.	19.4942	0.95065	0.0:1.0:0.0:0.0	.	20	P41212	ETV6_HUMAN	S	20	ENSP00000379658:P20S	ENSP00000379658:P20S	P	+	1	0	ETV6	11796675	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.335000	0.65929	2.708000	0.92522	0.655000	0.94253	CCA	ETV6	-	superfamily_SAM/pointed	ENSG00000139083		0.537	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	181	0.00	0	C	NM_001987		11905408	11905408	+1	no_errors	ENST00000396373	ensembl	human	known	69_37n	missense	177	13.66	28	SNP	1.000	T
EVC	2121	genome.wustl.edu	37	4	5755608	5755608	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:5755608G>A	ENST00000264956.6	+	10	1596	c.1412G>A	c.(1411-1413)aGa>aAa	p.R471K	EVC_ENST00000382674.2_Missense_Mutation_p.R471K|EVC_ENST00000509451.1_Missense_Mutation_p.R471K	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	471					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R471K(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GAGGAACAGAGAAGCTTCCTG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	81.0	82.0					4																	5755608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1412G>A	4.37:g.5755608G>A	ENSP00000264956:p.Arg471Lys			Missense_Mutation	SNP	NULL	p.R471K	ENST00000264956.6	37	c.1412	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	G	3.914	-0.019572	0.07634	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.51325	0.71;0.71;0.78	5.04	3.1	0.35709	.	0.285554	0.34603	N	0.003824	T	0.33411	0.0862	L	0.54323	1.7	0.19575	N	0.999965	P	0.37500	0.597	B	0.37888	0.26	T	0.22347	-1.0219	10	0.06625	T	0.88	.	5.0904	0.14706	0.1054:0.0:0.5785:0.3161	.	471	P57679	EVC_HUMAN	K	471	ENSP00000264956:R471K;ENSP00000372120:R471K;ENSP00000426774:R471K	ENSP00000264956:R471K	R	+	2	0	EVC	5806509	0.006000	0.16342	0.363000	0.25875	0.086000	0.17979	0.721000	0.25911	2.354000	0.79902	0.561000	0.74099	AGA	EVC	-	NULL	ENSG00000072840		0.597	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	53	0.00	0	G			5755608	5755608	+1	no_errors	ENST00000264956	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.012	A
EWSR1	2130	genome.wustl.edu	37	22	29693828	29693828	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr22:29693828C>T	ENST00000397938.2	+	13	1625	c.1306C>T	c.(1306-1308)Caa>Taa	p.Q436*	EWSR1_ENST00000332035.6_Nonsense_Mutation_p.Q380*|EWSR1_ENST00000331029.7_Nonsense_Mutation_p.Q398*|EWSR1_ENST00000414183.2_Nonsense_Mutation_p.Q441*|EWSR1_ENST00000332050.6_Nonsense_Mutation_p.Q363*|EWSR1_ENST00000406548.1_Nonsense_Mutation_p.Q435*	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	436	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.Q436*(1)	EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAAAGATTTTCAAGGGAGCAA	0.512			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																	dbGAP		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	1	Substitution - Nonsense(1)	breast(1)											91.0	87.0	89.0					22																	29693828		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1306C>T	22.37:g.29693828C>T	ENSP00000381031:p.Gln436*		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Nonsense_Mutation	SNP	pfam_Znf_RanBP2,pfam_RRM_dom,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.Q441*	ENST00000397938.2	37	c.1321	CCDS13851.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.263838|6.263838	0.97426|0.97426	.|.	.|.	ENSG00000182944|ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035|ENST00000360091	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.137625|.	0.49916|.	U|.	0.000135|.	.|T	.|0.66528	.|0.2798	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68667	.|-0.5348	.|3	0.25106|.	T|.	0.35|.	.|.	14.8206|14.8206	0.70070|0.70070	0.1439:0.8561:0.0:0.0|0.1439:0.8561:0.0:0.0	.|.	.|.	.|.	.|.	X|L	363;436;435;398;441;380|91	.|.	ENSP00000330516:Q398X|.	Q|S	+|+	1|2	0|0	EWSR1|EWSR1	28023828|28023828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.891000|0.891000	0.51852|0.51852	4.955000|4.955000	0.63638|0.63638	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CAA|TCA	EWSR1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000182944		0.512	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	HGNC	protein_coding	OTTHUMT00000321345.1	162	0.00	0	C	NM_005243		29693828	29693828	+1	no_errors	ENST00000414183	ensembl	human	known	69_37n	nonsense	97	15.65	18	SNP	1.000	T
FAM171B	165215	genome.wustl.edu	37	2	187627333	187627333	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:187627333C>G	ENST00000304698.5	+	8	2467	c.2264C>G	c.(2263-2265)cCt>cGt	p.P755R		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	755						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.P755R(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GTCTGTTCCCCTGAGGACCCA	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	85.0	84.0					2																	187627333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2264C>G	2.37:g.187627333C>G	ENSP00000304108:p.Pro755Arg		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.P755R	ENST00000304698.5	37	c.2264	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150339	0.78001	.	.	ENSG00000144369	ENST00000304698	T	0.64085	-0.08	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78974	-0.1992	10	0.87932	D	0	-17.8381	20.547	0.99278	0.0:1.0:0.0:0.0	.	755;756	Q6P995;A8K122	F171B_HUMAN;.	R	755	ENSP00000304108:P755R	ENSP00000304108:P755R	P	+	2	0	FAM171B	187335578	1.000000	0.71417	0.991000	0.47740	0.972000	0.66771	7.267000	0.78462	2.850000	0.98022	0.650000	0.86243	CCT	FAM171B	-	pfam_Uncharacterised_FAM171	ENSG00000144369		0.488	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	49	0.00	0	C	NM_177454		187627333	187627333	+1	no_errors	ENST00000304698	ensembl	human	known	69_37n	missense	110	16.67	22	SNP	1.000	G
FAM178A	55719	genome.wustl.edu	37	10	102705188	102705188	+	Silent	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:102705188G>T	ENST00000238961.4	+	13	3401	c.2859G>T	c.(2857-2859)ctG>ctT	p.L953L	FAM178A_ENST00000370269.3_Silent_p.L953L	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	953						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L953L(1)									AAAAACAGCTGAAACAGATTC	0.328																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	55.0	54.0					10																	102705188		2203	4295	6498	-	-	-	SO:0001819	synonymous_variant	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.2859G>T	10.37:g.102705188G>T			A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Silent	SNP	NULL	p.L953	ENST00000238961.4	37	c.2859	CCDS7500.1	10																																																																																			FAM178A	-	NULL	ENSG00000119906		0.328	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	36	0.00	0	G			102705188	102705188	+1	no_errors	ENST00000370269	ensembl	human	known	69_37n	silent	46	23.33	14	SNP	1.000	T
FAM196A	642938	genome.wustl.edu	37	10	128974473	128974473	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:128974473G>A	ENST00000522781.1	-	4	742	c.187C>T	c.(187-189)Cag>Tag	p.Q63*	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Nonsense_Mutation_p.Q63*	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	63								p.Q63*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GAGGACAGCTGTGTGTCCCTC	0.592																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											116.0	111.0	113.0					10																	128974473		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.187C>T	10.37:g.128974473G>A	ENSP00000429763:p.Gln63*		B2RNT4|B7ZME7	Nonsense_Mutation	SNP	NULL	p.Q63*	ENST00000522781.1	37	c.187	CCDS31312.1	10	.	.	.	.	.	.	.	.	.	.	G	41	9.114142	0.99069	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	.	.	.	5.32	5.32	0.75619	.	0.179878	0.49916	D	0.000122	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.3815	0.94540	0.0:0.0:1.0:0.0	.	.	.	.	X	63	.	ENSP00000428730:Q63X	Q	-	1	0	FAM196A	128864463	0.999000	0.42202	0.241000	0.24154	0.689000	0.40095	3.920000	0.56446	2.655000	0.90218	0.462000	0.41574	CAG	FAM196A	-	NULL	ENSG00000188916		0.592	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196A	HGNC	protein_coding	OTTHUMT00000050978.2	44	0.00	0	G	NM_001039762		128974473	128974473	-1	no_errors	ENST00000522781	ensembl	human	known	69_37n	nonsense	43	17.31	9	SNP	0.974	A
SPATA31B1P	404770	genome.wustl.edu	37	9	84676058	84676058	+	IGR	SNP	T	T	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:84676058T>C								SPATA31D1 (65887 upstream) : RP11-15B24.5 (211612 downstream)														p.M123V(1)									GAGGTGGTCATTGGGCCTGGT	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											187.0	191.0	190.0					9																	84676058		2004	4171	6175	-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.84676058T>C				Missense_Mutation	SNP	NULL	p.M123V		37	c.367		9	.	.	.	.	.	.	.	.	.	.	T	0.944	-0.708685	0.03230	.	.	ENSG00000204561	ENST00000376458	.	.	.	1.16	1.16	0.20824	.	.	.	.	.	T	0.23806	0.0576	.	.	.	0.21822	N	0.999521	B	0.18166	0.026	B	0.15052	0.012	T	0.20174	-1.0283	6	0.28530	T	0.3	.	4.6381	0.12534	0.0:0.0:0.0:1.0	.	123	Q5VZV4	FA75B_HUMAN	V	123	.	ENSP00000365641:M123V	M	-	1	0	FAM75B	83865878	0.005000	0.15991	0.001000	0.08648	0.259000	0.26198	0.777000	0.26718	0.819000	0.34492	0.102000	0.15555	ATG	FAM75B	-	NULL	ENSG00000204561	0	0.567					FAM75B	HGNC			559	0.00	0	T			84676058	84676058	-1	no_errors	ENST00000376458	ensembl	human	known	69_37n	missense	518	16.37	102	SNP	0.001	C
FAM83A	84985	genome.wustl.edu	37	8	124195521	124195521	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr8:124195521T>A	ENST00000518448.1	+	2	2439	c.425T>A	c.(424-426)gTc>gAc	p.V142D	FAM83A_ENST00000546351.1_Missense_Mutation_p.V142D|FAM83A_ENST00000276699.6_Missense_Mutation_p.V142D|FAM83A_ENST00000522648.1_Missense_Mutation_p.V142D|U3_ENST00000408534.1_RNA|FAM83A_ENST00000536633.1_Missense_Mutation_p.V142D|RP11-539E17.5_ENST00000522383.1_RNA|FAM83A_ENST00000318462.6_Missense_Mutation_p.V142D			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	142								p.V142D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TTCCAGACCGTCAAGCACAAC	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	66.0	65.0					8																	124195521		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.425T>A	8.37:g.124195521T>A	ENSP00000428876:p.Val142Asp		Q71HL2|Q8N7I1|Q96I47	Missense_Mutation	SNP	pfam_DUF1669	p.V142D	ENST00000518448.1	37	c.425	CCDS6340.1	8	.	.	.	.	.	.	.	.	.	.	A	4.151	0.026366	0.08054	.	.	ENSG00000147689	ENST00000518448;ENST00000546351;ENST00000536633;ENST00000318462;ENST00000522648;ENST00000276699	T;T;T;T;T;T	0.10005	2.92;3.1;2.92;2.92;3.1;2.92	5.46	5.46	0.80206	.	0.296857	0.37761	N	0.001957	T	0.02304	0.0071	N	0.00146	-1.995	0.42006	D	0.990915	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.36915	-0.9728	10	0.08599	T	0.76	-32.6991	11.9302	0.52843	0.8695:0.0:0.0:0.1305	.	142;142;142	Q86UY5-2;Q86UY5-3;Q86UY5	.;.;FA83A_HUMAN	D	142	ENSP00000428876:V142D;ENSP00000440565:V142D;ENSP00000445218:V142D;ENSP00000323034:V142D;ENSP00000427979:V142D;ENSP00000276699:V142D	ENSP00000276699:V142D	V	+	2	0	FAM83A	124264702	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	5.258000	0.65479	0.902000	0.36520	-0.364000	0.07487	GTC	FAM83A	-	pfam_DUF1669	ENSG00000147689		0.612	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A	HGNC	protein_coding	OTTHUMT00000381737.1	81	0.00	0	T	NM_032899		124195521	124195521	+1	no_errors	ENST00000318462	ensembl	human	known	69_37n	missense	156	11.86	21	SNP	1.000	A
FASTKD3	79072	genome.wustl.edu	37	5	7867557	7867557	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:7867557C>A	ENST00000264669.5	-	2	776	c.640G>T	c.(640-642)Gaa>Taa	p.E214*	MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000502509.1_Intron|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	214					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.E214*(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTGCGAACTTCCATGCCACCT	0.428																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											110.0	110.0	110.0					5																	7867557		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.640G>T	5.37:g.7867557C>A	ENSP00000264669:p.Glu214*		Q9BVD3	Nonsense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.E214*	ENST00000264669.5	37	c.640	CCDS3873.1	5	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410501	0.83340	.	.	ENSG00000124279	ENST00000264669;ENST00000504695	.	.	.	4.74	2.87	0.33458	.	0.582602	0.18657	N	0.134825	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-10.4135	2.1354	0.03760	0.2809:0.466:0.0:0.2531	.	.	.	.	X	214	.	ENSP00000264669:E214X	E	-	1	0	FASTKD3	7920557	0.656000	0.27385	0.746000	0.31095	0.840000	0.47671	0.854000	0.27791	2.443000	0.82685	0.650000	0.86243	GAA	FASTKD3	-	NULL	ENSG00000124279		0.428	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	HGNC	protein_coding	OTTHUMT00000253673.1	146	0.68	1	C	NM_024091		7867557	7867557	-1	no_errors	ENST00000264669	ensembl	human	known	69_37n	nonsense	196	25.19	66	SNP	0.949	A
FGD4	121512	genome.wustl.edu	37	12	32751440	32751440	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:32751440G>A	ENST00000427716.2	+	5	1034	c.610G>A	c.(610-612)Gag>Aag	p.E204K	FGD4_ENST00000534526.2_Missense_Mutation_p.E341K|FGD4_ENST00000525053.1_Missense_Mutation_p.E316K|FGD4_ENST00000381025.3_5'Flank|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000531134.1_Missense_Mutation_p.E289K|FGD4_ENST00000546442.1_Missense_Mutation_p.E111K	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	204					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.E204K(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GGAGACTAATGAGCAAAAACT	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	84.0	84.0					12																	32751440		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.610G>A	12.37:g.32751440G>A	ENSP00000394487:p.Glu204Lys		Q6ULS2|Q8TCP6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E204K	ENST00000427716.2	37	c.610	CCDS8727.1	12	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475087	0.84640	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	4.91	3.95	0.45737	Dbl homology (DH) domain (2);	0.000000	0.52532	D	0.000073	T	0.27063	0.0663	L	0.32530	0.975	0.80722	D	1	B;B;P	0.43826	0.409;0.249;0.818	B;B;B	0.41723	0.082;0.118;0.365	T	0.15636	-1.0430	10	0.87932	D	0	-9.1104	14.9675	0.71204	0.0:0.1431:0.8569:0.0	.	316;289;204	E9PJX4;B7Z493;Q96M96	.;.;FGD4_HUMAN	K	341;289;204;111;316	ENSP00000449273:E341K;ENSP00000431323:E289K;ENSP00000394487:E204K;ENSP00000446695:E111K;ENSP00000433666:E316K	ENSP00000379089:E204K	E	+	1	0	FGD4	32642707	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.041000	0.70988	2.426000	0.82243	0.655000	0.94253	GAG	FGD4	-	superfamily_DH-domain	ENSG00000139132		0.323	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	HGNC	protein_coding	OTTHUMT00000268017.1	105	0.00	0	G	NM_139241		32751440	32751440	+1	no_errors	ENST00000427716	ensembl	human	known	69_37n	missense	134	12.99	20	SNP	1.000	A
FNBP4	23360	genome.wustl.edu	37	11	47765568	47765568	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:47765568G>C	ENST00000263773.5	-	8	1405	c.1393C>G	c.(1393-1395)Cca>Gca	p.P465A	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	465						nucleus (GO:0005634)		p.P465A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GTAGATTCTGGACTGGTAGCT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	142.0	148.0					11																	47765568		1903	4120	6023	-	-	-	SO:0001583	missense	0			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1393C>G	11.37:g.47765568G>C	ENSP00000263773:p.Pro465Ala		Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.P465A	ENST00000263773.5	37	c.1393	CCDS41644.1	11	.	.	.	.	.	.	.	.	.	.	G	30	5.052896	0.93793	.	.	ENSG00000109920	ENST00000263773	T	0.67345	-0.26	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.76615	0.4012	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.75348	-0.3349	10	0.48119	T	0.1	-14.7652	20.1338	0.98010	0.0:0.0:1.0:0.0	.	465	Q8N3X1	FNBP4_HUMAN	A	465	ENSP00000263773:P465A	ENSP00000263773:P465A	P	-	1	0	FNBP4	47722144	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.412000	0.80091	2.770000	0.95276	0.655000	0.94253	CCA	FNBP4	-	NULL	ENSG00000109920		0.413	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP4	HGNC	protein_coding	OTTHUMT00000390237.3	115	0.00	0	G			47765568	47765568	-1	no_errors	ENST00000263773	ensembl	human	known	69_37n	missense	86	13.00	13	SNP	1.000	C
FXR1	8087	genome.wustl.edu	37	3	180694051	180694051	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:180694051G>C	ENST00000357559.4	+	17	2221	c.1837G>C	c.(1837-1839)Gaa>Caa	p.E613Q	FXR1_ENST00000480918.1_Missense_Mutation_p.E600Q|FXR1_ENST00000468861.1_3'UTR|FXR1_ENST00000305586.7_Missense_Mutation_p.E528Q|FXR1_ENST00000491062.1_3'UTR|FXR1_ENST00000445140.2_3'UTR	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	613					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E613Q(1)		breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AAACACTCAAGAAGCAGCAGT	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	65.0	66.0					3																	180694051		2203	4299	6502	-	-	-	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1837G>C	3.37:g.180694051G>C	ENSP00000350170:p.Glu613Gln		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,superfamily_NA-bd_OB-fold-like,smart_KH_dom,pfscan_KH_dom_type_1	p.E613Q	ENST00000357559.4	37	c.1837	CCDS3238.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.53|10.53	1.374682|1.374682	0.24857|0.24857	.|.	.|.	ENSG00000114416|ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000480918|ENST00000482125	T;T;T|.	0.28069|.	1.83;1.64;1.63|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.275129|.	0.40144|.	N|.	0.001172|.	T|T	0.33059|0.33059	0.0850|0.0850	N|N	0.02011|0.02011	-0.69|-0.69	0.39625|0.39625	D|D	0.970095|0.970095	B;B;P|.	0.35700|.	0.137;0.001;0.516|.	B;B;B|.	0.23018|.	0.029;0.001;0.043|.	T|T	0.36138|0.36138	-0.9760|-0.9760	10|5	0.30854|.	T|.	0.27|.	-22.4496|-22.4496	18.515|18.515	0.90933|0.90933	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	600;557;613|.	B4DXZ6;E7ERF5;P51114|.	.;.;FXR1_HUMAN|.	Q|N	613;528;600|240	ENSP00000350170:E613Q;ENSP00000307633:E528Q;ENSP00000418097:E600Q|.	ENSP00000307633:E528Q|.	E|K	+|+	1|3	0|2	FXR1|FXR1	182176745|182176745	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.586000|4.586000	0.60984|0.60984	2.375000|2.375000	0.81037|0.81037	0.603000|0.603000	0.83216|0.83216	GAA|AAG	FXR1	-	NULL	ENSG00000114416		0.378	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	86	0.00	0	G			180694051	180694051	+1	no_errors	ENST00000357559	ensembl	human	known	69_37n	missense	149	28.57	60	SNP	1.000	C
GAB3	139716	genome.wustl.edu	37	X	153940741	153940741	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:153940741C>T	ENST00000369575.3	-	4	860	c.829G>A	c.(829-831)Gaa>Aaa	p.E277K	GAB3_ENST00000424127.2_Missense_Mutation_p.E278K|GAB3_ENST00000496390.1_Intron	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	277					macrophage differentiation (GO:0030225)			p.E277K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAGGAACTTTCCAGCAATGGT	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	113.0	114.0					X																	153940741		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.829G>A	X.37:g.153940741C>T	ENSP00000358588:p.Glu277Lys		A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E278K	ENST00000369575.3	37	c.832	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	C	4.197	0.035314	0.08148	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.19105	2.17;2.17;2.17	5.53	4.66	0.58398	.	0.623617	0.16971	N	0.192081	T	0.20129	0.0484	M	0.68317	2.08	0.27185	N	0.960576	B;B;B	0.28713	0.22;0.22;0.22	B;B;B	0.19148	0.024;0.024;0.024	T	0.29088	-1.0023	10	0.06891	T	0.86	-20.8712	13.0295	0.58835	0.0:0.841:0.159:0.0	.	278;278;277	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	K	277;278;278	ENSP00000358588:E277K;ENSP00000358581:E278K;ENSP00000399588:E278K	ENSP00000358581:E278K	E	-	1	0	GAB3	153593935	0.378000	0.25114	0.186000	0.23195	0.615000	0.37417	2.895000	0.48648	1.071000	0.40834	0.506000	0.49869	GAA	GAB3	-	NULL	ENSG00000160219		0.502	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	174	0.00	0	C	NM_001081573		153940741	153940741	-1	no_errors	ENST00000424127	ensembl	human	known	69_37n	missense	189	14.03	31	SNP	0.699	T
GALNT15	117248	genome.wustl.edu	37	3	16216721	16216721	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:16216721G>A	ENST00000339732.5	+	1	566	c.63G>A	c.(61-63)ctG>ctA	p.L21L	GALNT15_ENST00000437509.1_Silent_p.L21L	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	21					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L21L(1)									TGCTGCTCCTGATGCTGGGAT	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											145.0	122.0	130.0					3																	16216721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.63G>A	3.37:g.16216721G>A			A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L21	ENST00000339732.5	37	c.63	CCDS33711.1	3																																																																																			GALNTL2	-	NULL	ENSG00000131386		0.557	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL2	HGNC	protein_coding	OTTHUMT00000346483.2	97	0.00	0	G	NM_054110		16216721	16216721	+1	no_errors	ENST00000339732	ensembl	human	known	69_37n	silent	143	17.82	31	SNP	0.207	A
GCKR	2646	genome.wustl.edu	37	2	27746251	27746251	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:27746251C>T	ENST00000264717.2	+	19	1886	c.1823C>T	c.(1822-1824)cCa>cTa	p.P608L	GCKR_ENST00000424318.2_Missense_Mutation_p.P418L	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	608					carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.P608L(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					CTTGCTGGGCCAGGTCAGAAG	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	66.0	68.0					2																	27746251		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.1823C>T	2.37:g.27746251C>T	ENSP00000264717:p.Pro608Leu		A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	NULL	p.P608L	ENST00000264717.2	37	c.1823	CCDS1757.1	2	.	.	.	.	.	.	.	.	.	.	C	1.331	-0.596849	0.03771	.	.	ENSG00000084734	ENST00000264717;ENST00000424318	T;T	0.21932	2.3;1.98	4.09	1.24	0.21308	.	0.707374	0.11578	N	0.550006	T	0.10594	0.0259	N	0.14661	0.345	0.09310	N	0.999994	B;B;B	0.11235	0.004;0.003;0.003	B;B;B	0.12156	0.007;0.007;0.007	T	0.27839	-1.0062	10	0.49607	T	0.09	-1.1012	3.0216	0.06077	0.2163:0.5536:0.0:0.2301	.	418;606;608	F5H1P6;A8K731;Q14397	.;.;GCKR_HUMAN	L	608;418	ENSP00000264717:P608L;ENSP00000409109:P418L	ENSP00000264717:P608L	P	+	2	0	GCKR	27599755	0.020000	0.18652	0.117000	0.21633	0.043000	0.13939	0.373000	0.20484	0.452000	0.26830	0.563000	0.77884	CCA	GCKR	-	NULL	ENSG00000084734		0.602	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCKR	HGNC	protein_coding	OTTHUMT00000250214.1	75	0.00	0	C	NM_001486		27746251	27746251	+1	no_errors	ENST00000264717	ensembl	human	known	69_37n	missense	92	18.58	21	SNP	0.033	T
GPRIN2	9721	genome.wustl.edu	37	10	46999608	46999608	+	Frame_Shift_Del	DEL	C	C	-	rs374420863		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:46999608delC	ENST00000374317.1	+	3	1001	c.728delC	c.(727-729)gctfs	p.A243fs	GPRIN2_ENST00000374314.4_Frame_Shift_Del_p.A243fs	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	243										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GAGGTGAGGGCTGGTGGCTGC	0.632																																						dbGAP											0													53.0	57.0	56.0					10																	46999608		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.728delC	10.37:g.46999608delC	ENSP00000363436:p.Ala243fs		Q5SVF0	Frame_Shift_Del	DEL	NULL	p.A243fs	ENST00000374317.1	37	c.728	CCDS31192.1	10																																																																																			GPRIN2	-	NULL	ENSG00000204175		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	29	0.00	0	C	NM_014696		46999608	46999608	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	frame_shift_del	24	13.79	4	DEL	0.001	-
HAO1	54363	genome.wustl.edu	37	20	7915161	7915161	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:7915161G>A	ENST00000378789.3	-	2	310	c.259C>T	c.(259-261)Cat>Tat	p.H87Y		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	87	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.H87Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CCGTCCACATGAGCCATGCGC	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	95.0	98.0					20																	7915161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.259C>T	20.37:g.7915161G>A	ENSP00000368066:p.His87Tyr		Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.H87Y	ENST00000378789.3	37	c.259	CCDS13100.1	20	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778258	0.90195	.	.	ENSG00000101323	ENST00000378789	T	0.34472	1.36	5.96	5.96	0.96718	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.69628	0.3132	M	0.91354	3.2	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73708	0.981;0.981	T	0.75074	-0.3446	10	0.66056	D	0.02	-0.9505	19.1831	0.93630	0.0:0.0:1.0:0.0	.	87;87	A8K058;Q9UJM8	.;HAOX1_HUMAN	Y	87	ENSP00000368066:H87Y	ENSP00000368066:H87Y	H	-	1	0	HAO1	7863161	1.000000	0.71417	0.998000	0.56505	0.802000	0.45316	8.282000	0.89907	2.827000	0.97445	0.655000	0.94253	CAT	HAO1	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN	ENSG00000101323		0.537	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	HGNC	protein_coding	OTTHUMT00000077926.2	84	0.00	0	G			7915161	7915161	-1	no_errors	ENST00000378789	ensembl	human	known	69_37n	missense	120	10.45	14	SNP	1.000	A
HEG1	57493	genome.wustl.edu	37	3	124738384	124738384	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:124738384G>A	ENST00000311127.4	-	5	1377	c.1310C>T	c.(1309-1311)tCt>tTt	p.S437F	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	437					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.S437F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						CTCAGTCTGAGACATGGGACT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											179.0	171.0	173.0					3																	124738384		2075	4228	6303	-	-	-	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1310C>T	3.37:g.124738384G>A	ENSP00000311502:p.Ser437Phe		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.S437F	ENST00000311127.4	37	c.1310	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	17.16	3.317767	0.60524	.	.	ENSG00000173706	ENST00000311127	T	0.39592	1.07	5.39	3.57	0.40892	.	.	.	.	.	T	0.48352	0.1495	L	0.51422	1.61	0.09310	N	1	D;P	0.54601	0.967;0.944	P;P	0.55303	0.773;0.598	T	0.32824	-0.9892	9	0.72032	D	0.01	.	7.4893	0.27452	0.0841:0.0:0.7504:0.1655	.	437;437	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	F	437	ENSP00000311502:S437F	ENSP00000311502:S437F	S	-	2	0	HEG1	126221074	0.052000	0.20516	0.002000	0.10522	0.275000	0.26752	1.171000	0.31896	0.809000	0.34255	0.650000	0.86243	TCT	HEG1	-	NULL	ENSG00000173706		0.478	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	854	0.00	0	G	XM_087386		124738384	124738384	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	missense	764	15.36	139	SNP	0.011	A
HEPACAM	220296	genome.wustl.edu	37	11	124793676	124793676	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:124793676C>G	ENST00000298251.4	-	3	1063	c.658G>C	c.(658-660)Gag>Cag	p.E220Q		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule									p.E220Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		ATGGGGTTCTCCACCATGCAG	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	72.0	76.0					11																	124793676		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.658G>C	11.37:g.124793676C>G	ENSP00000298251:p.Glu220Gln			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E220Q	ENST00000298251.4	37	c.658	CCDS8456.1	11	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362845	0.82353	.	.	ENSG00000165478	ENST00000298251;ENST00000374961	T	0.38401	1.14	5.56	5.56	0.83823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.54759	0.1878	L	0.55834	1.745	0.47949	D	0.999554	D;D	0.65815	0.995;0.984	D;P	0.64237	0.923;0.773	T	0.43877	-0.9364	10	0.32370	T	0.25	-22.4654	19.5031	0.95104	0.0:1.0:0.0:0.0	.	220;220	Q14CZ8-2;Q14CZ8	.;HECAM_HUMAN	Q	220	ENSP00000298251:E220Q	ENSP00000298251:E220Q	E	-	1	0	HEPACAM	124298886	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.900000	0.63252	2.605000	0.88082	0.655000	0.94253	GAG	HEPACAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000165478		0.572	HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM	HGNC	protein_coding	OTTHUMT00000387125.1	118	0.00	0	C	NM_152722		124793676	124793676	-1	no_errors	ENST00000298251	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	1.000	G
HIST1H1D	3007	genome.wustl.edu	37	6	26234687	26234687	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:26234687C>T	ENST00000244534.5	-	1	529	c.475G>A	c.(475-477)Gta>Ata	p.V159I		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	159					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.V159I(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GGCTTCTTTACCTTCTTAGGA	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	98.0	96.0					6																	26234687		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.475G>A	6.37:g.26234687C>T	ENSP00000244534:p.Val159Ile		B2R751|Q2M2I2	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.V159I	ENST00000244534.5	37	c.475	CCDS4597.1	6	.	.	.	.	.	.	.	.	.	.	.	10.97	1.500939	0.26861	.	.	ENSG00000124575	ENST00000244534	T	0.14766	2.48	5.22	3.42	0.39159	.	0.381500	0.28349	N	0.015665	T	0.02418	0.0074	N	0.08118	0	0.09310	N	0.999999	B	0.17038	0.02	B	0.16722	0.016	T	0.40664	-0.9551	10	0.59425	D	0.04	-0.0274	10.3773	0.44090	0.0:0.7912:0.1347:0.074	.	159	P16402	H13_HUMAN	I	159	ENSP00000244534:V159I	ENSP00000244534:V159I	V	-	1	0	HIST1H1D	26342666	0.543000	0.26434	0.026000	0.17262	0.002000	0.02628	3.715000	0.54897	0.691000	0.31592	0.650000	0.86243	GTA	HIST1H1D	-	NULL	ENSG00000124575		0.537	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1D	HGNC	protein_coding	OTTHUMT00000040095.1	107	0.93	1	C	NM_005320		26234687	26234687	-1	no_errors	ENST00000244534	ensembl	human	known	69_37n	missense	77	11.24	10	SNP	0.602	T
HSPA9	3313	genome.wustl.edu	37	5	137909537	137909537	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:137909537G>C	ENST00000297185.3	-	3	268	c.143C>G	c.(142-144)tCa>tGa	p.S48*		NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	48				S -> P (in Ref. 9; AA sequence). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.S48*(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GATTGCTTCTGATCTGTAAGA	0.378																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											88.0	82.0	84.0					5																	137909537		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.143C>G	5.37:g.137909537G>C	ENSP00000297185:p.Ser48*		B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Nonsense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,pfam_Carb_kinase_FGGY_C,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	p.S48*	ENST00000297185.3	37	c.143	CCDS4208.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	5.995571|5.995571	0.97184|0.97184	.|.	.|.	ENSG00000113013|ENSG00000113013	ENST00000541333|ENST00000297185;ENST00000540484	.|.	.|.	.|.	5.51|5.51	4.64|4.64	0.57946|0.57946	.|.	.|0.127341	.|0.56097	.|D	.|0.000036	T|.	0.69949|.	0.3168|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.79298|.	-0.1861|.	4|.	0.87932|0.87932	D|D	0|0	-7.4394|-7.4394	14.1526|14.1526	0.65395|0.65395	0.0728:0.0:0.9272:0.0|0.0728:0.0:0.9272:0.0	.|.	.|.	.|.	.|.	E|X	18|48;34	.|.	ENSP00000438817:Q18E|ENSP00000297185:S48X	Q|S	-|-	1|2	0|0	HSPA9|HSPA9	137937436|137937436	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.837000|9.837000	0.99465|0.99465	1.474000|1.474000	0.48178|0.48178	0.655000|0.655000	0.94253|0.94253	CAG|TCA	HSPA9	-	NULL	ENSG00000113013		0.378	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA9	HGNC	protein_coding	OTTHUMT00000251285.1	52	0.00	0	G	NM_004134		137909537	137909537	-1	no_errors	ENST00000297185	ensembl	human	known	69_37n	nonsense	31	20.51	8	SNP	1.000	C
HYDIN	54768	genome.wustl.edu	37	16	70889175	70889175	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:70889175C>T	ENST00000393567.2	-	73	12449	c.12299G>A	c.(12298-12300)aGa>aAa	p.R4100K	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4100					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R4099K(1)|p.R4051K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCTGGCTTCTCTGCCTGAGGA	0.532																																						dbGAP											2	Substitution - Missense(2)	breast(2)											39.0	54.0	50.0					16																	70889175		1497	4064	5561	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12299G>A	16.37:g.70889175C>T	ENSP00000377197:p.Arg4100Lys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.R4099K	ENST00000393567.2	37	c.12296	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	9.365	1.068990	0.20147	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00808	5.67	5.28	2.92	0.33932	.	0.546023	0.12696	U	0.446773	T	0.01156	0.0038	M	0.62723	1.935	0.80722	D	1	B	0.21753	0.06	B	0.26864	0.074	T	0.39663	-0.9603	10	0.06365	T	0.9	.	4.5539	0.12128	0.0:0.5566:0.0:0.4434	.	4099	F8WD23	.	K	4100;4099	ENSP00000377197:R4100K	ENSP00000313052:R4099K	R	-	2	0	HYDIN	69446676	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.144000	0.50616	1.340000	0.45581	0.511000	0.50034	AGA	HYDIN	-	NULL	ENSG00000157423		0.532	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	234	0.00	0	C			70889175	70889175	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	151	24.88	50	SNP	0.998	T
IFNA17	3451	genome.wustl.edu	37	9	21227804	21227804	+	Silent	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:21227804C>A	ENST00000413767.2	-	1	417	c.369G>T	c.(367-369)gtG>gtT	p.V123V		NM_021268.2	NP_067091.1	P01571	IFN17_HUMAN	interferon, alpha 17	123					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.V123V(1)		breast(1)|endometrium(2)|lung(4)|ovary(1)|skin(1)	9				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CCTCCTGTATCACACATGCTT	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											171.0	176.0	174.0					9																	21227804		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6500.1	9p22	2010-12-10			ENSG00000234829	ENSG00000234829		"""Interferons"""	5422	protein-coding gene	gene with protein product		147583				1385305	Standard	NM_021268		Approved	LEIF2C1, IFN-alphaI	uc003zos.1	P01571	OTTHUMG00000019667	ENST00000413767.2:c.369G>T	9.37:g.21227804C>A			Q14639|Q4KMT4|Q5VZ53|Q7M4Q4	Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.V123	ENST00000413767.2	37	c.369	CCDS6500.1	9																																																																																			IFNA17	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000234829		0.453	IFNA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA17	HGNC	protein_coding	OTTHUMT00000051896.1	402	0.00	0	C	NM_021268		21227804	21227804	-1	no_errors	ENST00000413767	ensembl	human	known	69_37n	silent	579	15.23	104	SNP	0.004	A
IL1RAP	3556	genome.wustl.edu	37	3	190338161	190338161	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:190338161G>C	ENST00000412504.2	+	5	887	c.635G>C	c.(634-636)tGt>tCt	p.C212S	IL1RAP_ENST00000447382.1_Missense_Mutation_p.C212S|IL1RAP_ENST00000072516.3_Missense_Mutation_p.C212S|IL1RAP_ENST00000422485.1_Missense_Mutation_p.C212S|IL1RAP_ENST00000422940.1_Missense_Mutation_p.C212S|IL1RAP_ENST00000317757.3_Missense_Mutation_p.C212S|IL1RAP_ENST00000439062.1_Missense_Mutation_p.C212S|IL1RAP_ENST00000443369.2_Missense_Mutation_p.C212S|IL1RAP_ENST00000434491.1_Missense_Mutation_p.C71S			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	212	Ig-like C2-type 2.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)	p.C212S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		AATTACACATGTGTTGTTACA	0.353																																						dbGAP											2	Substitution - Missense(2)	breast(2)											122.0	113.0	116.0					3																	190338161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.635G>C	3.37:g.190338161G>C	ENSP00000412053:p.Cys212Ser		B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.C212S	ENST00000412504.2	37	c.635	CCDS3298.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	3.995347|3.995347	0.74703|0.74703	.|.	.|.	ENSG00000196083|ENSG00000196083	ENST00000072516;ENST00000443369;ENST00000412504;ENST00000439062;ENST00000447382;ENST00000422485;ENST00000434491;ENST00000422940;ENST00000317757|ENST00000412080	T;T;T;T;T;T;T;T;T|.	0.58210|.	0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.050820|.	0.85682|.	D|.	0.000000|.	T|T	0.76543|0.76543	0.4002|0.4002	M|M	0.81341|0.81341	2.54|2.54	0.58432|0.58432	D|D	0.999997|0.999997	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.988;0.994;0.99|.	T|T	0.77760|0.77760	-0.2467|-0.2467	10|5	0.87932|.	D|.	0|.	.|.	14.6515|14.6515	0.68800|0.68800	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	71;212;212;212|.	C9J9W1;Q9NPH3-5;Q9NPH3;Q9NPH3-2|.	.;.;IL1AP_HUMAN;.|.	S|L	212;212;212;212;212;212;71;212;212|49	ENSP00000072516:C212S;ENSP00000408893:C212S;ENSP00000412053:C212S;ENSP00000401132:C212S;ENSP00000390541:C212S;ENSP00000409352:C212S;ENSP00000391899:C71S;ENSP00000387371:C212S;ENSP00000314807:C212S|.	ENSP00000072516:C212S|.	C|V	+|+	2|1	0|0	IL1RAP|IL1RAP	191820855|191820855	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.101000|5.101000	0.64566|0.64566	2.589000|2.589000	0.87451|0.87451	0.650000|0.650000	0.86243|0.86243	TGT|GTG	IL1RAP	-	smart_Ig_sub,pfscan_Ig-like,prints_IL1_rcpt_I/II	ENSG00000196083		0.353	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL1RAP	HGNC	protein_coding	OTTHUMT00000343497.1	76	0.00	0	G			190338161	190338161	+1	no_errors	ENST00000443369	ensembl	human	known	69_37n	missense	131	11.49	17	SNP	1.000	C
IL27RA	9466	genome.wustl.edu	37	19	14150608	14150608	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:14150608C>T	ENST00000263379.2	+	4	545	c.420C>T	c.(418-420)tcC>tcT	p.S140S		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	140	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.S140S(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TGGACTTTTCCGAGGATGACC	0.607																																					Colon(164;1849 1896 4443 37792 47834)	dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	62.0	61.0					19																	14150608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.420C>T	19.37:g.14150608C>T			A0N0L1|O60624	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S140	ENST00000263379.2	37	c.420	CCDS12303.1	19																																																																																			IL27RA	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000104998		0.607	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	HGNC	protein_coding	OTTHUMT00000458539.1	96	0.00	0	C	NM_004843		14150608	14150608	+1	no_errors	ENST00000263379	ensembl	human	known	69_37n	silent	56	12.50	8	SNP	0.072	T
IMPG2	50939	genome.wustl.edu	37	3	100962906	100962906	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:100962906C>T	ENST00000193391.7	-	13	2456	c.2269G>A	c.(2269-2271)Gaa>Aaa	p.E757K		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	757					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.E757K(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TCAAACCATTCATAGTTGGAT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	130.0	130.0					3																	100962906		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2269G>A	3.37:g.100962906C>T	ENSP00000193391:p.Glu757Lys		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.E757K	ENST00000193391.7	37	c.2269	CCDS2940.1	3	.	.	.	.	.	.	.	.	.	.	C	3.064	-0.192696	0.06259	.	.	ENSG00000081148	ENST00000193391	T	0.19669	2.13	5.88	4.08	0.47627	.	0.664548	0.15457	N	0.261316	T	0.10252	0.0251	N	0.11560	0.145	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.11329	0.006;0.006	T	0.35574	-0.9783	10	0.17832	T	0.49	-0.9061	7.6233	0.28197	0.0:0.7385:0.0:0.2615	.	757;757	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	K	757	ENSP00000193391:E757K	ENSP00000193391:E757K	E	-	1	0	IMPG2	102445596	0.062000	0.20869	0.008000	0.14137	0.003000	0.03518	0.372000	0.20467	0.805000	0.34159	0.655000	0.94253	GAA	IMPG2	-	NULL	ENSG00000081148		0.413	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	311	0.00	0	C			100962906	100962906	-1	no_errors	ENST00000193391	ensembl	human	known	69_37n	missense	536	11.70	71	SNP	0.029	T
INSRR	3645	genome.wustl.edu	37	1	156819062	156819062	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:156819062G>A	ENST00000368195.3	-	6	1816	c.1420C>T	c.(1420-1422)Cgc>Tgc	p.R474C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	474					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R474C(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCGTTGGTGCGGGGGTTGATC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											99.0	100.0	100.0					1																	156819062		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1420C>T	1.37:g.156819062G>A	ENSP00000357178:p.Arg474Cys		O60724|Q5VZS3	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R474C	ENST00000368195.3	37	c.1420	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340642	0.81911	.	.	ENSG00000027644	ENST00000368195	D	0.83075	-1.68	4.75	4.75	0.60458	.	0.000000	0.47852	D	0.000213	D	0.90038	0.6889	.	.	.	0.50813	D	0.999896	D	0.89917	1.0	D	0.91635	0.999	D	0.91134	0.4940	9	0.72032	D	0.01	.	16.4887	0.84193	0.0:0.0:1.0:0.0	.	474	P14616	INSRR_HUMAN	C	474	ENSP00000357178:R474C	ENSP00000357178:R474C	R	-	1	0	INSRR	155085686	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.136000	0.50554	2.490000	0.84030	0.561000	0.74099	CGC	INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt	ENSG00000027644		0.647	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	39	0.00	0	G	NM_014215		156819062	156819062	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	missense	18	38.71	12	SNP	0.970	A
ITGA1	3672	genome.wustl.edu	37	5	52214648	52214648	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:52214648G>A	ENST00000282588.6	+	16	2533	c.2075G>A	c.(2074-2076)gGa>gAa	p.G692E		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	692					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)	p.G692E(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CATATGGAGGGAAAGGAAACA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	100.0	105.0					5																	52214648		2203	4299	6502	-	-	-	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2075G>A	5.37:g.52214648G>A	ENSP00000282588:p.Gly692Glu		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.G692E	ENST00000282588.6	37	c.2075	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879494	0.51801	.	.	ENSG00000213949	ENST00000282588	T	0.68624	-0.34	5.51	5.51	0.81932	Integrin alpha-2 (1);	0.401841	0.29106	N	0.013130	T	0.67258	0.2874	L	0.52573	1.65	0.38856	D	0.956376	D	0.56746	0.977	P	0.57846	0.828	T	0.64976	-0.6280	10	0.17832	T	0.49	.	5.8288	0.18568	0.1488:0.0:0.687:0.1643	.	692	P56199	ITA1_HUMAN	E	692	ENSP00000282588:G692E	ENSP00000282588:G692E	G	+	2	0	ITGA1	52250405	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	2.886000	0.48578	2.738000	0.93877	0.655000	0.94253	GGA	ITGA1	-	pfam_Integrin_alpha-2	ENSG00000213949		0.348	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	79	0.00	0	G	NM_181501		52214648	52214648	+1	no_errors	ENST00000282588	ensembl	human	known	69_37n	missense	127	18.06	28	SNP	0.995	A
KCNH8	131096	genome.wustl.edu	37	3	19389427	19389427	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:19389427G>T	ENST00000328405.2	+	5	1047	c.781G>T	c.(781-783)Gac>Tac	p.D261Y	KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	261					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.D261Y(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AACCGTCAGTGACATTGCAGT	0.398																																					NSCLC(124;1625 1765 8018 24930 42026)	dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	122.0	125.0					3																	19389427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.781G>T	3.37:g.19389427G>T	ENSP00000328813:p.Asp261Tyr		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.D261Y	ENST00000328405.2	37	c.781	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631528	0.87660	.	.	ENSG00000183960	ENST00000328405	D	0.98090	-4.71	5.83	5.83	0.93111	Ion transport (1);	0.000000	0.32987	U	0.005420	D	0.99061	0.9678	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99301	1.0901	9	.	.	.	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	261;261	B7Z398;Q96L42	.;KCNH8_HUMAN	Y	261	ENSP00000328813:D261Y	.	D	+	1	0	KCNH8	19364431	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	9.835000	0.99442	2.763000	0.94921	0.563000	0.77884	GAC	KCNH8	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000183960		0.398	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	148	0.00	0	G	NM_144633		19389427	19389427	+1	no_errors	ENST00000328405	ensembl	human	known	69_37n	missense	423	11.69	56	SNP	1.000	T
KDM5C	8242	genome.wustl.edu	37	X	53225908	53225908	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:53225908C>T	ENST00000375401.3	-	19	3473	c.2941G>A	c.(2941-2943)Gaa>Aaa	p.E981K	KDM5C_ENST00000404049.3_Missense_Mutation_p.E980K|KDM5C_ENST00000452825.3_Missense_Mutation_p.E914K|KDM5C_ENST00000375383.3_Missense_Mutation_p.E940K|KDM5C_ENST00000375379.3_Missense_Mutation_p.E981K	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	981					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.E981K(1)|p.E914K(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCCCAGCGTTCAGCAATGGTC	0.597			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Substitution - Missense(2)	breast(2)											70.0	60.0	63.0					X																	53225908		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2941G>A	X.37:g.53225908C>T	ENSP00000364550:p.Glu981Lys		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E981K	ENST00000375401.3	37	c.2941	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	c	25.9	4.685281	0.88639	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	4.92	4.92	0.64577	Lysine-specific demethylase-like domain (1);	0.120589	0.53938	D	0.000047	T	0.66416	0.2787	M	0.84326	2.69	0.41272	D	0.98685	D;D;D	0.55385	0.964;0.971;0.971	P;P;P	0.62435	0.841;0.902;0.902	T	0.71676	-0.4521	10	0.66056	D	0.02	-7.5724	10.7021	0.45933	0.0:0.8109:0.1891:0.0	.	914;980;981	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	K	914;981;980;981;940	ENSP00000445176:E914K;ENSP00000364550:E981K;ENSP00000385394:E980K;ENSP00000364528:E981K;ENSP00000364532:E940K	ENSP00000364528:E981K	E	-	1	0	KDM5C	53242633	0.941000	0.31946	1.000000	0.80357	0.997000	0.91878	2.090000	0.41682	2.053000	0.61076	0.591000	0.81541	GAA	KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.597	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	129	0.00	0	C	NM_004187		53225908	53225908	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	T
MAP10	54627	genome.wustl.edu	37	1	232942483	232942483	+	Missense_Mutation	SNP	G	G	A	rs558263978	byFrequency	TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:232942483G>A	ENST00000418460.1	+	1	1841	c.1714G>A	c.(1714-1716)Gag>Aag	p.E572K		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	430					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)	p.E572K(2)									ATATAGGACTGAGGATAAGAA	0.443													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18264	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											68.0	63.0	65.0					1																	232942483		1911	4151	6062	-	-	-	SO:0001583	missense	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1714G>A	1.37:g.232942483G>A	ENSP00000403208:p.Glu572Lys		A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	NULL	p.E572K	ENST00000418460.1	37	c.1714	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049111	0.36181	.	.	ENSG00000212916	ENST00000418460	.	.	.	6.17	5.25	0.73442	.	0.436137	0.16574	U	0.208488	T	0.45438	0.1342	M	0.69823	2.125	0.09310	N	1	P	0.45715	0.865	B	0.43478	0.421	T	0.48958	-0.8988	9	0.59425	D	0.04	-9.1067	9.2357	0.37464	0.0739:0.2997:0.6264:0.0	.	430	Q9P2G4	K1383_HUMAN	K	572	.	ENSP00000403208:E572K	E	+	1	0	KIAA1383	231009106	0.061000	0.20836	0.125000	0.21846	0.145000	0.21501	2.225000	0.42954	1.587000	0.49959	0.655000	0.94253	GAG	KIAA1383	-	NULL	ENSG00000212916		0.443	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	HGNC	protein_coding	OTTHUMT00000092317.3	60	0.00	0	G	NM_019090		232942483	232942483	+1	no_errors	ENST00000418460	ensembl	human	known	69_37n	missense	37	56.98	49	SNP	0.050	A
KIAA1841	84542	genome.wustl.edu	37	2	61297579	61297579	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:61297579C>G	ENST00000402291.1	+	3	335	c.94C>G	c.(94-96)Cag>Gag	p.Q32E	KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000295031.5_Missense_Mutation_p.Q32E|KIAA1841_ENST00000356719.2_Missense_Mutation_p.Q32E|KIAA1841_ENST00000453873.1_Missense_Mutation_p.Q32E	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	32								p.Q32E(2)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			TGGAATCCCTCAGACTATCAA	0.383																																						dbGAP											2	Substitution - Missense(2)	breast(2)											108.0	111.0	110.0					2																	61297579		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.94C>G	2.37:g.61297579C>G	ENSP00000385579:p.Gln32Glu		Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.Q32E	ENST00000402291.1	37	c.94	CCDS46296.1	2	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079144	0.36662	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.95	4.14	0.48551	.	0.054891	0.85682	N	0.000000	T	0.34571	0.0902	L	0.32530	0.975	0.44547	D	0.997503	B;B;B	0.09022	0.002;0.0;0.002	B;B;B	0.14023	0.01;0.003;0.01	T	0.04467	-1.0949	10	0.29301	T	0.29	-4.6308	16.7542	0.85495	0.0:0.756:0.244:0.0	.	32;32;32	Q6NSI8-2;Q6NSI8;Q6NSI8-4	.;K1841_HUMAN;.	E	32	ENSP00000385579:Q32E;ENSP00000295031:Q32E;ENSP00000349154:Q32E;ENSP00000416795:Q32E	ENSP00000295031:Q32E	Q	+	1	0	KIAA1841	61151083	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.404000	0.66344	0.836000	0.34901	-0.175000	0.13238	CAG	KIAA1841	-	superfamily_Homeodomain-like	ENSG00000162929		0.383	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000325477.1	92	0.00	0	C	NM_032506		61297579	61297579	+1	no_errors	ENST00000356719	ensembl	human	known	69_37n	missense	98	10.09	11	SNP	1.000	G
KL	9365	genome.wustl.edu	37	13	33638166	33638166	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr13:33638166G>C	ENST00000380099.3	+	5	2890	c.2882G>C	c.(2881-2883)aGa>aCa	p.R961T	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	961					acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.R961T(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		ACTCTGGAAAGATTTTGTCCA	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	115.0	114.0					13																	33638166		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2882G>C	13.37:g.33638166G>C	ENSP00000369442:p.Arg961Thr		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.R961T	ENST00000380099.3	37	c.2882	CCDS9347.1	13	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.534150	0.00951	.	.	ENSG00000133116	ENST00000380099	T	0.20598	2.06	5.52	-0.309	0.12769	Glycoside hydrolase, superfamily (1);	0.654083	0.16739	N	0.201518	T	0.14313	0.0346	L	0.60455	1.87	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.35748	-0.9776	10	0.14656	T	0.56	-1.7623	1.6433	0.02756	0.2141:0.1748:0.4328:0.1783	.	961	Q9UEF7	KLOT_HUMAN	T	961	ENSP00000369442:R961T	ENSP00000369442:R961T	R	+	2	0	KL	32536166	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.015000	0.13355	-0.456000	0.07043	-1.868000	0.00555	AGA	KL	-	superfamily_Glycoside_hydrolase_SF	ENSG00000133116		0.403	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	HGNC	protein_coding	OTTHUMT00000045987.1	236	0.00	0	G			33638166	33638166	+1	no_errors	ENST00000380099	ensembl	human	known	69_37n	missense	152	14.12	25	SNP	0.000	C
LRRIQ4	344657	genome.wustl.edu	37	3	169546579	169546579	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:169546579G>A	ENST00000340806.6	+	2	1053	c.1053G>A	c.(1051-1053)ctG>ctA	p.L351L		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	351								p.L351L(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						TTTCAAAACTGAAGATACTTG	0.373																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											92.0	91.0	91.0					3																	169546579		1826	4089	5915	-	-	-	SO:0001819	synonymous_variant	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1053G>A	3.37:g.169546579G>A				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.L351	ENST00000340806.6	37	c.1053	CCDS46951.1	3																																																																																			LRRIQ4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000188306		0.373	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	226	0.00	0	G	NM_001080460		169546579	169546579	+1	no_errors	ENST00000340806	ensembl	human	known	69_37n	silent	255	13.27	39	SNP	1.000	A
MAGED2	10916	genome.wustl.edu	37	X	54841887	54841887	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:54841887C>T	ENST00000375068.1	+	12	1826	c.1593C>T	c.(1591-1593)atC>atT	p.I531I	SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000347546.4_Silent_p.I513I|MAGED2_ENST00000375060.1_Silent_p.I446I|MAGED2_ENST00000375058.1_Silent_p.I531I|MAGED2_ENST00000375062.4_Silent_p.I446I|MAGED2_ENST00000396224.1_Silent_p.I531I|MAGED2_ENST00000218439.4_Silent_p.I531I|MAGED2_ENST00000375053.2_Silent_p.I531I			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	531						membrane (GO:0016020)		p.I531I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						AAGCCCGGATCCAGGCGGGAG	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											23.0	23.0	23.0					X																	54841887		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1593C>T	X.37:g.54841887C>T			A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.I531	ENST00000375068.1	37	c.1593	CCDS14362.1	X																																																																																			MAGED2	-	NULL	ENSG00000102316		0.597	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGED2	HGNC	protein_coding	OTTHUMT00000056821.2	59	0.00	0	C	NM_014599		54841887	54841887	+1	no_errors	ENST00000218439	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	1.000	T
MAP3K10	4294	genome.wustl.edu	37	19	40704438	40704438	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:40704438T>A	ENST00000253055.3	+	2	1127	c.839T>A	c.(838-840)tTc>tAc	p.F280Y	MAP3K10_ENST00000593906.1_Intron	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)	p.F280Y(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CTCTCCCTCTTCTCCAAAAGC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	61.0	64.0					19																	40704438		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.839T>A	19.37:g.40704438T>A	ENSP00000253055:p.Phe280Tyr		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.F280Y	ENST00000253055.3	37	c.839	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	T	28.2	4.902471	0.92035	.	.	ENSG00000130758	ENST00000253055	D	0.83335	-1.71	5.08	5.08	0.68730	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74283	0.3696	N	0.02674	-0.535	0.54753	D	0.999989	P	0.37500	0.597	P	0.51742	0.678	T	0.76410	-0.2969	10	0.30854	T	0.27	.	13.1247	0.59346	0.0:0.0:0.0:1.0	.	280	Q02779	M3K10_HUMAN	Y	280	ENSP00000253055:F280Y	ENSP00000253055:F280Y	F	+	2	0	MAP3K10	45396278	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.008000	0.88588	2.061000	0.61500	0.254000	0.18369	TTC	MAP3K10	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000130758		0.647	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	36	0.00	0	T	NM_002446		40704438	40704438	+1	no_errors	ENST00000253055	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	A
MBTD1	54799	genome.wustl.edu	37	17	49280258	49280258	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:49280258C>G	ENST00000586178.1	-	10	1210	c.867G>C	c.(865-867)atG>atC	p.M289I	MBTD1_ENST00000415868.1_Missense_Mutation_p.M289I|MBTD1_ENST00000376381.2_Missense_Mutation_p.M289I	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	289					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.M125I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			CTTCTACTCTCATGCAAGGTT	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											233.0	222.0	226.0					17																	49280258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.867G>C	17.37:g.49280258C>G	ENSP00000468304:p.Met289Ile		Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.M289I	ENST00000586178.1	37	c.867	CCDS11581.2	17	.	.	.	.	.	.	.	.	.	.	c	20.9	4.067873	0.76301	.	.	ENSG00000011258	ENST00000405860;ENST00000415868;ENST00000376381	T;T	0.52057	0.68;0.68	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.75889	0.3911	M	0.91140	3.18	0.80722	D	1	P;D;P	0.63046	0.91;0.992;0.948	P;D;P	0.79784	0.748;0.993;0.798	T	0.82544	-0.0404	10	0.72032	D	0.01	.	18.0784	0.89435	0.0:1.0:0.0:0.0	.	289;289;125	Q05BQ5;Q05BQ5-2;Q05BQ5-3	MBTD1_HUMAN;.;.	I	289	ENSP00000403946:M289I;ENSP00000365561:M289I	ENSP00000365561:M289I	M	-	3	0	MBTD1	46635257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.815000	0.86186	2.280000	0.76307	0.651000	0.88453	ATG	MBTD1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000011258		0.383	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	105	0.00	0	C			49280258	49280258	-1	no_errors	ENST00000415868	ensembl	human	known	69_37n	missense	189	13.70	30	SNP	1.000	G
MCF2	4168	genome.wustl.edu	37	X	138727745	138727745	+	5'Flank	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:138727745G>A	ENST00000370576.4	-	0	0				MCF2_ENST00000520602.1_Silent_p.I71I|MCF2_ENST00000414978.1_Silent_p.I71I|MCF2_ENST00000519895.1_Silent_p.I71I|MCF2_ENST00000370578.4_Silent_p.I156I|MCF2_ENST00000536274.1_5'Flank	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I71I(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TTTGGAGAGAGATTTTGAGAG	0.323																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											66.0	57.0	60.0					X																	138727745		1804	4057	5861	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537		X.37:g.138727745G>A	Exception_encountered		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I156	ENST00000370576.4	37	c.468	CCDS14667.1	X																																																																																			MCF2	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000101977		0.323	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	44	0.00	0	G	NM_005369		138727745	138727745	-1	no_errors	ENST00000370578	ensembl	human	known	69_37n	silent	91	16.51	18	SNP	0.639	A
MDC1	9656	genome.wustl.edu	37	6	30679725	30679725	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:30679725C>T	ENST00000376406.3	-	5	2641	c.1994G>A	c.(1993-1995)gGa>gAa	p.G665E	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Missense_Mutation_p.G665E	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	665				Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.G665E(1)		breast(2)|kidney(1)|ovary(1)	4						GACCTGGGCTCCCTCTCTCTG	0.557								Other conserved DNA damage response genes																														dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	91.0	98.0					6																	30679725		1511	2708	4219	-	-	-	SO:0001583	missense	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1994G>A	6.37:g.30679725C>T	ENSP00000365588:p.Gly665Glu		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.G665E	ENST00000376406.3	37	c.1994	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470531	0.43942	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.17854	2.4;2.25	4.54	4.54	0.55810	.	0.217094	0.23551	N	0.046964	T	0.26159	0.0638	M	0.62723	1.935	0.30497	N	0.770811	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.995;0.99;0.999;0.984	T	0.01428	-1.1357	10	0.51188	T	0.08	-9.8658	12.6601	0.56809	0.0:1.0:0.0:0.0	.	665;537;665;665	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	E	665;665;665;537	ENSP00000365588:G665E;ENSP00000365587:G665E	ENSP00000365587:G665E	G	-	2	0	MDC1	30787704	0.968000	0.33430	1.000000	0.80357	0.166000	0.22503	1.174000	0.31932	2.362000	0.80069	0.555000	0.69702	GGA	MDC1	-	NULL	ENSG00000137337		0.557	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	385	0.00	0	C	NM_014641		30679725	30679725	-1	no_errors	ENST00000376406	ensembl	human	known	69_37n	missense	136	53.90	159	SNP	1.000	T
MDN1	23195	genome.wustl.edu	37	6	90450019	90450019	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:90450019C>T	ENST00000369393.3	-	32	4642	c.4527G>A	c.(4525-4527)ttG>ttA	p.L1509L	MDN1_ENST00000428876.1_Silent_p.L1509L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1509					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.L1509L(2)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCCCAGCAGTCAACAGCTCTA	0.388																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											121.0	117.0	119.0					6																	90450019		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4527G>A	6.37:g.90450019C>T			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L1509	ENST00000369393.3	37	c.4527	CCDS5024.1	6																																																																																			MDN1	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.388	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	150	0.00	0	C			90450019	90450019	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	silent	171	14.93	30	SNP	0.998	T
MED12	9968	genome.wustl.edu	37	X	70340837	70340837	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:70340837C>T	ENST00000374080.3	+	5	602	c.570C>T	c.(568-570)atC>atT	p.I190I	MED12_ENST00000333646.6_Silent_p.I190I|MED12_ENST00000374102.1_Silent_p.I190I			Q93074	MED12_HUMAN	mediator complex subunit 12	190					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.I190I(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTCAGATCATCACCAAGTACT	0.522			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	2	Substitution - coding silent(2)	breast(2)											79.0	73.0	75.0					X																	70340837		1958	4117	6075	-	-	-	SO:0001819	synonymous_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.570C>T	X.37:g.70340837C>T			O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.I190	ENST00000374080.3	37	c.570	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.522	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	264	0.00	0	C	NM_005120		70340837	70340837	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	silent	163	15.82	31	SNP	1.000	T
MEIS1	4211	genome.wustl.edu	37	2	66739364	66739364	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:66739364C>T	ENST00000272369.9	+	8	1283	c.826C>T	c.(826-828)Cgt>Tgt	p.R276C	MEIS1_ENST00000409517.1_Intron|MEIS1_ENST00000398506.2_Missense_Mutation_p.R274C|MEIS1_ENST00000560281.2_Missense_Mutation_p.R276C|MEIS1_ENST00000495021.2_Missense_Mutation_p.R211C|MEIS1_ENST00000488550.1_Missense_Mutation_p.R276C|MEIS1_ENST00000407092.2_Missense_Mutation_p.R276C|MEIS1_ENST00000444274.2_Intron	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	276					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.R276C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						TCACAAAAAGCGTGGCATCTT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	59.0	57.0					2																	66739364		2078	4255	6333	-	-	-	SO:0001583	missense	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.826C>T	2.37:g.66739364C>T	ENSP00000272369:p.Arg276Cys		A8MV50	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R276C	ENST00000272369.9	37	c.826	CCDS46309.1	2	.	.	.	.	.	.	.	.	.	.	C	18.73	3.687073	0.68157	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000495021;ENST00000402908;ENST00000450027	D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49	5.76	4.87	0.63330	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.94703	0.8291	M	0.82193	2.58	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.999	D	0.95466	0.8547	10	0.87932	D	0	.	16.2806	0.82678	0.1337:0.8663:0.0:0.0	.	211;274;276;276	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	C	276;276;274;211;132;88	ENSP00000272369:R276C;ENSP00000384461:R276C;ENSP00000381518:R274C;ENSP00000440571:R211C;ENSP00000395827:R88C	ENSP00000272369:R276C	R	+	1	0	MEIS1	66592868	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.185000	0.50934	1.530000	0.49136	0.650000	0.86243	CGT	MEIS1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000143995		0.438	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	55	0.00	0	C	NM_002398		66739364	66739364	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	missense	42	35.82	24	SNP	1.000	T
METTL5	29081	genome.wustl.edu	37	2	170672003	170672003	+	Missense_Mutation	SNP	C	C	G	rs143314373		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:170672003C>G	ENST00000260953.5	-	5	841	c.525G>C	c.(523-525)aaG>aaC	p.K175N	METTL5_ENST00000409965.1_Missense_Mutation_p.K175N|METTL5_ENST00000392640.2_Missense_Mutation_p.K175N|METTL5_ENST00000409340.1_Missense_Mutation_p.K76N|METTL5_ENST00000308099.3_Intron|U3_ENST00000517172.1_RNA|METTL5_ENST00000409837.1_Missense_Mutation_p.K175N|METTL5_ENST00000410097.1_Missense_Mutation_p.K175N	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5	175							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.K175N(1)		breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						TAATATCTATCTTGATTTTCC	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	113.0	116.0					2																	170672003		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.525G>C	2.37:g.170672003C>G	ENSP00000260953:p.Lys175Asn		D3DPC9|Q9NVX1	Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_RNA_cap_Gua-N2-MeTrfase,pfam_Methyltransf_11	p.K175N	ENST00000260953.5	37	c.525	CCDS33320.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.82|12.82	2.053793|2.053793	0.36277|0.36277	.|.	.|.	ENSG00000138382|ENSG00000138382	ENST00000409837;ENST00000409340;ENST00000260953;ENST00000409965;ENST00000392640;ENST00000410097|ENST00000442181	T;T;T;T|.	0.45668|.	0.89;0.9;0.9;0.9|.	5.42|5.42	3.23|3.23	0.37069|0.37069	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50429|0.50429	0.1615|0.1615	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999996|0.999996	B;B|.	0.23891|.	0.093;0.037|.	B;B|.	0.24006|.	0.05;0.021|.	T|T	0.42050|0.42050	-0.9474|-0.9474	10|5	0.25106|.	T|.	0.35|.	-34.8119|-34.8119	10.9853|10.9853	0.47518|0.47518	0.0:0.8005:0.0:0.1995|0.0:0.8005:0.0:0.1995	.|.	175;175|.	B8ZZC8;Q9NRN9|.	.;METL5_HUMAN|.	N|T	175;76;175;175;175;175|86	ENSP00000387106:K76N;ENSP00000260953:K175N;ENSP00000386582:K175N;ENSP00000376415:K175N|.	ENSP00000260953:K175N|.	K|R	-|-	3|2	2|0	METTL5|METTL5	170380249|170380249	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	2.050000|2.050000	0.41297|0.41297	1.420000|1.420000	0.47138|0.47138	0.561000|0.561000	0.74099|0.74099	AAG|AGA	METTL5	-	NULL	ENSG00000138382		0.308	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL5	HGNC	protein_coding	OTTHUMT00000333957.1	37	0.00	0	C	NM_014168		170672003	170672003	-1	no_errors	ENST00000260953	ensembl	human	known	69_37n	missense	35	25.00	12	SNP	1.000	G
MIR297	100126354	genome.wustl.edu	37	4	111781793	111781796	+	RNA	DEL	ACAT	ACAT	-			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	ACAT	ACAT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:111781793_111781796delACAT	ENST00000401142.1	-	0	7_10					NR_030643.1				microRNA 297																		gcacatgcacacatacatacataT	0.319																																						dbGAP											0																																										-	-	-			0					4q25	2011-09-12		2008-12-18	ENSG00000215961	ENSG00000215961		"""ncRNAs / Micro RNAs"""	33691	non-coding RNA	RNA, micro		615520		MIRN297			Standard	NR_030643		Approved	hsa-mir-297					4.37:g.111781801_111781804delACAT				RNA	DEL	-	NULL	ENST00000401142.1	37	NULL		4																																																																																			MIR297	-	-	ENSG00000215961		0.319	MIR297-201	KNOWN	basic	miRNA	MIR297	HGNC	miRNA		53	0.00	0	ACAT	NR_030643		111781793	111781796	-1	no_errors	ENST00000401142	ensembl	human	known	69_37n	rna	55	12.70	8	DEL	0.000:0.000:0.000:0.000	-
MKL2	57496	genome.wustl.edu	37	16	14340567	14340567	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:14340567G>C	ENST00000341243.5	+	10	1417	c.1417G>C	c.(1417-1419)Gaa>Caa	p.E473Q	MKL2_ENST00000318282.5_Missense_Mutation_p.E484Q|MKL2_ENST00000571589.1_Missense_Mutation_p.E484Q|MKL2_ENST00000574045.1_Missense_Mutation_p.E484Q			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	473					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.E484Q(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCTCAAGGCAGAATTGCCACC	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											206.0	185.0	192.0					16																	14340567		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1417G>C	16.37:g.14340567G>C	ENSP00000345841:p.Glu473Gln		A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.E473Q	ENST00000341243.5	37	c.1417		16	.	.	.	.	.	.	.	.	.	.	G	5.574	0.290776	0.10567	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.93	4.96	0.65561	.	0.746262	0.13474	N	0.385207	T	0.50548	0.1622	L	0.48362	1.52	0.31136	N	0.707191	B;P	0.46656	0.016;0.882	B;P	0.49226	0.011;0.603	T	0.48692	-0.9013	9	0.13853	T	0.58	-8.3679	16.1382	0.81506	0.0:0.1336:0.8664:0.0	.	484;484	B4DGT8;Q9ULH7-4	.;.	Q	484;473	.	ENSP00000339086:E484Q	E	+	1	0	MKL2	14248068	1.000000	0.71417	0.982000	0.44146	0.345000	0.29048	6.198000	0.72106	1.476000	0.48215	0.655000	0.94253	GAA	MKL2	-	NULL	ENSG00000186260		0.507	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding		268	0.00	0	G	NM_014048		14340567	14340567	+1	no_errors	ENST00000341243	ensembl	human	known	69_37n	missense	264	11.71	35	SNP	1.000	C
MSH6	2956	genome.wustl.edu	37	2	48028268	48028268	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:48028268C>T	ENST00000234420.5	+	4	3298	c.3146C>T	c.(3145-3147)tCt>tTt	p.S1049F	MSH6_ENST00000540021.1_Missense_Mutation_p.S919F|MSH6_ENST00000538136.1_Missense_Mutation_p.S747F|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1049					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.S1049F(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GACTGGCAGTCTGCTGTAGAG	0.413			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	4	Substitution - Missense(2)|Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)|breast(2)											59.0	59.0	59.0					2																	48028268		2200	4292	6492	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3146C>T	2.37:g.48028268C>T	ENSP00000234420:p.Ser1049Phe		B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_PWWP,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP	p.S1049F	ENST00000234420.5	37	c.3146	CCDS1836.1	2	.	.	.	.	.	.	.	.	.	.	C	12.79	2.043148	0.36085	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000543270;ENST00000540021;ENST00000538136	D;D;D	0.90900	-2.75;-2.75;-2.75	5.08	4.19	0.49359	DNA mismatch repair protein MutS, core (3);	0.404899	0.28262	N	0.015995	D	0.89966	0.6868	L	0.29908	0.895	0.80722	D	1	P;B;P	0.39391	0.507;0.1;0.671	B;B;P	0.50490	0.393;0.279;0.642	D	0.90396	0.4399	10	0.56958	D	0.05	-4.8942	15.475	0.75471	0.0:0.8609:0.1391:0.0	.	919;1049;1049	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	F	1049;1047;17;919;747	ENSP00000234420:S1049F;ENSP00000446475:S919F;ENSP00000438580:S747F	ENSP00000234420:S1049F	S	+	2	0	MSH6	47881772	1.000000	0.71417	0.986000	0.45419	0.791000	0.44710	5.951000	0.70273	1.332000	0.45431	0.462000	0.41574	TCT	MSH6	-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_Msh6	ENSG00000116062		0.413	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	229	0.00	0	C	NM_000179		48028268	48028268	+1	no_errors	ENST00000234420	ensembl	human	known	69_37n	missense	222	16.54	44	SNP	0.999	T
MTO1	25821	genome.wustl.edu	37	6	74171591	74171591	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:74171591G>A	ENST00000370300.4	+	1	104	c.14G>A	c.(13-15)cGa>cAa	p.R5Q	MTO1_ENST00000498286.1_Missense_Mutation_p.R5Q|MTO1_ENST00000370305.1_Intron|MTO1_ENST00000415954.2_Missense_Mutation_p.R5Q|RNU6-975P_ENST00000384296.1_RNA	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	5					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)	p.R5Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TTCTACTTCCGAGGCTGTGGC	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	66.0	67.0					6																	74171591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.14G>A	6.37:g.74171591G>A	ENSP00000359323:p.Arg5Gln		B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	pfam_GIDA-rel,pfam_FAD_bind_dom,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_GidA	p.R5Q	ENST00000370300.4	37	c.14	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503527	0.26949	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370300	.	.	.	4.79	2.81	0.32909	.	0.662221	0.12828	N	0.435893	T	0.11452	0.0279	N	0.24115	0.695	0.09310	N	1	B;B;B	0.28636	0.218;0.003;0.016	B;B;B	0.16722	0.016;0.003;0.002	T	0.17107	-1.0380	9	0.66056	D	0.02	-1.1968	8.3122	0.32077	0.2017:0.0:0.7983:0.0	.	5;5;5	Q9Y2Z2-6;Q9Y2Z2-4;Q9Y2Z2	.;.;MTO1_HUMAN	Q	5	.	ENSP00000350506:R5Q	R	+	2	0	MTO1	74228312	0.011000	0.17503	0.195000	0.23364	0.093000	0.18481	0.764000	0.26532	0.511000	0.28236	0.555000	0.69702	CGA	MTO1	-	NULL	ENSG00000135297		0.552	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2	69	0.00	0	G	NM_012123		74171591	74171591	+1	no_errors	ENST00000415954	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.072	A
MYLK	4638	genome.wustl.edu	37	3	123419231	123419231	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:123419231G>A	ENST00000475616.1	-	15	3083	c.3084C>T	c.(3082-3084)aaC>aaT	p.N1028N	MYLK_ENST00000360772.3_Silent_p.N1028N|MYLK_ENST00000359169.1_Silent_p.N1028N|MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000360304.3_Silent_p.N1028N|MYLK_ENST00000346322.5_Silent_p.N959N			Q15746	MYLK_HUMAN	myosin light chain kinase	1028	6 X 12 AA approximate tandem repeats.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.N1028N(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CAGGCTTGGCGTTGCCCACGG	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											122.0	127.0	125.0					3																	123419231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3084C>T	3.37:g.123419231G>A			B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.N1028	ENST00000475616.1	37	c.3084	CCDS46896.1	3																																																																																			MYLK	-	NULL	ENSG00000065534		0.602	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	153	0.00	0	G	NM_053025		123419231	123419231	-1	no_errors	ENST00000360304	ensembl	human	known	69_37n	silent	92	44.91	75	SNP	0.000	A
NAIF1	203245	genome.wustl.edu	37	9	130825724	130825724	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:130825724C>T	ENST00000373078.4	-	2	1186	c.967G>A	c.(967-969)Gac>Aac	p.D323N	NAIF1_ENST00000488519.1_5'UTR	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	323					negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATGATGCTGTCTGGCTGCCCA	0.602																																						dbGAP											0													45.0	51.0	49.0					9																	130825724		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.967G>A	9.37:g.130825724C>T	ENSP00000362170:p.Asp323Asn		B3KV81|Q8WU12	Missense_Mutation	SNP	NULL	p.D323N	ENST00000373078.4	37	c.967	CCDS6889.1	9	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578308	0.86645	.	.	ENSG00000171169	ENST00000373078	.	.	.	5.3	5.3	0.74995	.	0.249491	0.38837	N	0.001546	T	0.46946	0.1419	L	0.27053	0.805	0.47621	D	0.999473	P	0.46987	0.888	B	0.43889	0.435	T	0.53809	-0.8386	9	0.87932	D	0	-2.8845	17.9175	0.88955	0.0:1.0:0.0:0.0	.	323	Q69YI7	NAIF1_HUMAN	N	323	.	ENSP00000362170:D323N	D	-	1	0	NAIF1	129865545	0.998000	0.40836	0.960000	0.40013	0.762000	0.43233	4.204000	0.58460	2.478000	0.83669	0.563000	0.77884	GAC	NAIF1	-	NULL	ENSG00000171169		0.602	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAIF1	HGNC	protein_coding	OTTHUMT00000054330.1	67	0.00	0	C	NM_197956		130825724	130825724	-1	no_errors	ENST00000373078	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.994	T
NCOA6	23054	genome.wustl.edu	37	20	33329945	33329945	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:33329945C>G	ENST00000374796.2	-	12	6685	c.4115G>C	c.(4114-4116)aGa>aCa	p.R1372T	NCOA6_ENST00000359003.2_Missense_Mutation_p.R1372T			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1372					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.R1372T(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CAATACATTTCTCGGCAACTC	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	90.0	90.0					20																	33329945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4115G>C	20.37:g.33329945C>G	ENSP00000363929:p.Arg1372Thr		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.R1372T	ENST00000374796.2	37	c.4115	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685930	0.47991	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.28454	1.61;1.61	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.38585	0.1046	N	0.24115	0.695	0.42219	D	0.991844	D	0.63880	0.993	P	0.57101	0.813	T	0.07139	-1.0788	10	0.41790	T	0.15	-10.1434	19.7069	0.96076	0.0:1.0:0.0:0.0	.	1372	Q14686	NCOA6_HUMAN	T	1372	ENSP00000363929:R1372T;ENSP00000351894:R1372T	ENSP00000351894:R1372T	R	-	2	0	NCOA6	32793606	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.053000	0.57427	2.894000	0.99253	0.591000	0.81541	AGA	NCOA6	-	NULL	ENSG00000198646		0.498	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	168	0.59	1	C	NM_014071		33329945	33329945	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	missense	158	15.96	30	SNP	1.000	G
NEK10	152110	genome.wustl.edu	37	3	27203970	27203970	+	Nonsense_Mutation	SNP	G	G	A	rs560857654		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:27203970G>A	ENST00000429845.2	-	32	3354	c.2992C>T	c.(2992-2994)Cga>Tga	p.R998*	NEK10_ENST00000498182.1_Intron|NEK10_ENST00000357467.2_Nonsense_Mutation_p.R395*|NEK10_ENST00000383770.3_Intron|NEK10_ENST00000295720.6_Nonsense_Mutation_p.R310*|NEK10_ENST00000383771.4_Nonsense_Mutation_p.R310*			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	998					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R998*(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TTGAGATTTCGAAGAATCACA	0.458																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											110.0	105.0	107.0					3																	27203970		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2992C>T	3.37:g.27203970G>A	ENSP00000395849:p.Arg998*		A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	p.R310*	ENST00000429845.2	37	c.928		3	.	.	.	.	.	.	.	.	.	.	G	42	9.678293	0.99237	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000357467	.	.	.	5.62	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7486	0.28883	0.1581:0.0:0.8419:0.0	.	.	.	.	X	310;310;395	.	ENSP00000295720:R310X	R	-	1	2	NEK10	27178974	0.867000	0.29959	0.467000	0.27180	0.936000	0.57629	1.152000	0.31663	2.654000	0.90174	0.655000	0.94253	CGA	NEK10	-	NULL	ENSG00000163491		0.458	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	176	0.00	0	G	NM_152534		27203970	27203970	-1	no_errors	ENST00000383771	ensembl	human	known	69_37n	nonsense	340	10.53	40	SNP	0.926	A
NET1	10276	genome.wustl.edu	37	10	5495482	5495482	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:5495482G>A	ENST00000355029.4	+	8	869	c.727G>A	c.(727-729)Gat>Aat	p.D243N	NET1_ENST00000542715.1_Missense_Mutation_p.D62N|NET1_ENST00000380359.3_Missense_Mutation_p.D189N	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	243	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D243N(1)|p.D189N(1)		breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						AACCAAGCCTGATGGAACAGT	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											197.0	176.0	183.0					10																	5495482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.727G>A	10.37:g.5495482G>A	ENSP00000347134:p.Asp243Asn		Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D243N	ENST00000355029.4	37	c.727	CCDS41483.1	10	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268564	0.40095	.	.	ENSG00000173848	ENST00000355029;ENST00000542715;ENST00000449083;ENST00000380359;ENST00000380337	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.82	4.91	0.64330	Dbl homology (DH) domain (5);	0.160062	0.27917	N	0.017332	T	0.54967	0.1891	L	0.50993	1.605	0.41513	D	0.988354	B;B	0.13145	0.007;0.003	B;B	0.20767	0.031;0.021	T	0.51616	-0.8683	10	0.32370	T	0.25	-0.7112	10.7619	0.46270	0.0:0.1425:0.7095:0.148	.	189;243	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	N	243;62;61;189;61	ENSP00000347134:D243N;ENSP00000446452:D62N;ENSP00000403101:D61N;ENSP00000369717:D189N	ENSP00000347134:D243N	D	+	1	0	NET1	5485482	1.000000	0.71417	0.957000	0.39632	0.924000	0.55760	4.400000	0.59709	1.443000	0.47586	0.650000	0.86243	GAT	NET1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000173848		0.398	NET1-005	KNOWN	basic|CCDS	protein_coding	NET1	HGNC	protein_coding	OTTHUMT00000046553.3	134	0.00	0	G	NM_005863		5495482	5495482	+1	no_errors	ENST00000355029	ensembl	human	known	69_37n	missense	160	20.30	41	SNP	0.941	A
NFKBIZ	64332	genome.wustl.edu	37	3	101572097	101572097	+	Missense_Mutation	SNP	G	G	C	rs150091528		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:101572097G>C	ENST00000326172.5	+	5	842	c.727G>C	c.(727-729)Gtg>Ctg	p.V243L	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.V143L|NFKBIZ_ENST00000326151.5_Intron	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	243					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V243L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						GCTGAACCCCGTGGTGGTCCC	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	99.0	97.0					3																	101572097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.727G>C	3.37:g.101572097G>C	ENSP00000325663:p.Val243Leu		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V243L	ENST00000326172.5	37	c.727	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	7.557	0.663991	0.14710	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326172	T;T;T	0.58797	0.34;0.31;0.36	5.33	2.52	0.30459	.	1.520670	0.04009	N	0.297770	T	0.58652	0.2137	L	0.59436	1.845	0.09310	N	1	B	0.15930	0.015	B	0.16722	0.016	T	0.50311	-0.8843	10	0.72032	D	0.01	-11.8484	10.6487	0.45636	0.2121:0.0:0.7879:0.0	.	243	Q9BYH8	IKBZ_HUMAN	L	143;143;243	ENSP00000419800:V143L;ENSP00000377618:V143L;ENSP00000325663:V243L	ENSP00000325663:V243L	V	+	1	0	NFKBIZ	103054787	0.001000	0.12720	0.067000	0.19924	0.108000	0.19459	1.024000	0.30077	0.226000	0.20979	-0.253000	0.11424	GTG	NFKBIZ	-	NULL	ENSG00000144802		0.527	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	214	0.00	0	G	NM_031419		101572097	101572097	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	missense	164	16.24	32	SNP	0.003	C
NLRP11	204801	genome.wustl.edu	37	19	56321506	56321506	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:56321506G>C	ENST00000589093.1	-	3	563	c.470C>G	c.(469-471)tCt>tGt	p.S157C	NLRP11_ENST00000589824.2_Missense_Mutation_p.S157C|NLRP11_ENST00000360133.3_Missense_Mutation_p.S157C|NLRP11_ENST00000592953.1_Missense_Mutation_p.S58C|NLRP11_ENST00000443188.1_Missense_Mutation_p.S157C			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	157	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.S157C(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AGTTTTTCCAGATGCTCTCTC	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	84.0	86.0					19																	56321506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.470C>G	19.37:g.56321506G>C	ENSP00000466285:p.Ser157Cys		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S157C	ENST00000589093.1	37	c.470	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	G	7.032	0.560784	0.13498	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.80033	-1.33;-1.33	2.25	-2.09	0.07232	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.66636	0.2809	N	0.22421	0.69	0.09310	N	1	B;B	0.33318	0.408;0.228	B;B	0.41135	0.348;0.236	T	0.59773	-0.7391	9	0.66056	D	0.02	.	0.4948	0.00570	0.1923:0.2389:0.3275:0.2413	.	157;157	P59045;P59045-2	NAL11_HUMAN;.	C	157	ENSP00000409898:S157C;ENSP00000353251:S157C	ENSP00000353251:S157C	S	-	2	0	NLRP11	61013318	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.916000	0.04029	-0.383000	0.07858	-0.182000	0.12963	TCT	NLRP11	-	pfscan_NACHT_NTPase	ENSG00000179873		0.423	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	119	0.00	0	G	NM_145007		56321506	56321506	-1	no_errors	ENST00000443188	ensembl	human	known	69_37n	missense	82	34.40	43	SNP	0.004	C
NLRP4	147945	genome.wustl.edu	37	19	56363563	56363563	+	Silent	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:56363563C>G	ENST00000301295.6	+	2	539	c.117C>G	c.(115-117)ctC>ctG	p.L39L	NLRP4_ENST00000346986.5_Silent_p.L39L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	39	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.L39L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGCTTGAACTCAAGCAGATTC	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	88.0	87.0					19																	56363563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.117C>G	19.37:g.56363563C>G			Q86W87|Q96AY6	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L39	ENST00000301295.6	37	c.117	CCDS12936.1	19																																																																																			NLRP4	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000160505		0.418	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	348	0.00	0	C	NM_134444		56363563	56363563	+1	no_errors	ENST00000301295	ensembl	human	known	69_37n	silent	268	20.00	67	SNP	0.003	G
NLRP4	147945	genome.wustl.edu	37	19	56363675	56363675	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:56363675C>G	ENST00000301295.6	+	2	651	c.229C>G	c.(229-231)Caa>Gaa	p.Q77E	NLRP4_ENST00000346986.5_Missense_Mutation_p.Q77E	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	77	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.Q77E(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AAGAATCTTTCAAAAGATGGA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	80.0	79.0					19																	56363675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.229C>G	19.37:g.56363675C>G	ENSP00000301295:p.Gln77Glu		Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q77E	ENST00000301295.6	37	c.229	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827589	0.32329	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.43294	0.95;0.95	4.46	0.741	0.18336	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.31918	0.0812	L	0.31371	0.925	0.09310	N	1	D	0.56968	0.978	P	0.52481	0.7	T	0.14755	-1.0461	9	0.02654	T	1	.	6.5921	0.22651	0.3678:0.4533:0.1789:0.0	.	77	Q96MN2	NALP4_HUMAN	E	77	ENSP00000301295:Q77E;ENSP00000344787:Q77E	ENSP00000301295:Q77E	Q	+	1	0	NLRP4	61055487	0.003000	0.15002	0.004000	0.12327	0.005000	0.04900	1.107000	0.31110	0.551000	0.29008	-0.175000	0.13238	CAA	NLRP4	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000160505		0.443	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	252	0.00	0	C	NM_134444		56363675	56363675	+1	no_errors	ENST00000301295	ensembl	human	known	69_37n	missense	204	19.29	49	SNP	0.002	G
NLRP8	126205	genome.wustl.edu	37	19	56459312	56459312	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:56459312C>T	ENST00000291971.3	+	1	115	c.44C>T	c.(43-45)tCa>tTa	p.S15L	NLRP8_ENST00000590542.1_Missense_Mutation_p.S15L	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	15					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.S15L(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		ATTCCCTTTTCATCCTCCTCC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											249.0	197.0	215.0					19																	56459312		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.44C>T	19.37:g.56459312C>T	ENSP00000291971:p.Ser15Leu		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S15L	ENST00000291971.3	37	c.44	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495683	0.26774	.	.	ENSG00000179709	ENST00000291971	T	0.75477	-0.94	1.7	1.7	0.24286	.	.	.	.	.	T	0.52661	0.1748	N	0.08118	0	0.09310	N	1	B;D	0.59357	0.017;0.985	B;B	0.42422	0.005;0.387	T	0.47983	-0.9074	9	0.87932	D	0	.	6.8739	0.24135	0.0:1.0:0.0:0.0	.	15;15	Q86W28-2;Q86W28	.;NALP8_HUMAN	L	15	ENSP00000291971:S15L	ENSP00000291971:S15L	S	+	2	0	NLRP8	61151124	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.355000	0.07671	1.268000	0.44264	0.407000	0.27541	TCA	NLRP8	-	NULL	ENSG00000179709		0.502	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	226	0.00	0	C	NM_176811		56459312	56459312	+1	no_errors	ENST00000291971	ensembl	human	known	69_37n	missense	221	18.75	51	SNP	0.004	T
NOMO1	23420	genome.wustl.edu	37	16	14978247	14978247	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:14978247G>A	ENST00000287667.7	+	27	3301	c.3130G>A	c.(3130-3132)Gat>Aat	p.D1044N		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1044						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						TAATGACATCGATGATGTAAA	0.418																																						dbGAP											0													34.0	18.0	23.0					16																	14978247		2030	3927	5957	-	-	-	SO:0001583	missense	0			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3130G>A	16.37:g.14978247G>A	ENSP00000287667:p.Asp1044Asn		P78421|Q8IW21|Q96DG0	Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.D1044N	ENST00000287667.7	37	c.3130	CCDS10556.1	16	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569140	0.45798	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	T	0.36699	1.24	3.21	3.21	0.36854	Carbohydrate-binding-like fold (1);	0.054701	0.64402	D	0.000001	T	0.22551	0.0544	L	0.36672	1.1	0.51482	D	0.99992	P	0.48640	0.913	B	0.36378	0.223	T	0.04991	-1.0913	10	0.16896	T	0.51	-19.328	11.969	0.53053	0.0:0.0:1.0:0.0	.	1044	Q15155	NOMO1_HUMAN	N	1044;1044;877	ENSP00000287667:D1044N	ENSP00000287667:D1044N	D	+	1	0	NOMO1	14885748	1.000000	0.71417	0.999000	0.59377	0.659000	0.38960	7.393000	0.79851	1.628000	0.50416	0.184000	0.17185	GAT	NOMO1	-	superfamily_Carb-bd-like_fold	ENSG00000103512		0.418	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO1	HGNC	protein_coding	OTTHUMT00000207065.1	220	0.45	1	G			14978247	14978247	+1	no_errors	ENST00000287667	ensembl	human	known	69_37n	missense	186	22.08	53	SNP	1.000	A
NOB1	28987	genome.wustl.edu	37	16	69788555	69788555	+	Silent	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:69788555G>C	ENST00000268802.5	-	2	167	c.138C>G	c.(136-138)ctC>ctG	p.L46L		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	46	PINc.				visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L46L(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCAGGACAGCGAGCCGCCTGC	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											71.0	63.0	66.0					16																	69788555		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.138C>G	16.37:g.69788555G>C			Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	pfam_NOB1_Zn-bd,smart_PINc_nuc-bd,pirsf_D-site_20S_pre-rRNA_nuclease	p.L46	ENST00000268802.5	37	c.138	CCDS10884.1	16																																																																																			NOB1	-	smart_PINc_nuc-bd,pirsf_D-site_20S_pre-rRNA_nuclease	ENSG00000141101		0.622	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	HGNC	protein_coding	OTTHUMT00000268958.2	69	0.00	0	G	NM_014062		69788555	69788555	-1	no_errors	ENST00000268802	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	1.000	C
NSUN3	63899	genome.wustl.edu	37	3	93803063	93803063	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:93803063C>T	ENST00000314622.4	+	3	446	c.235C>T	c.(235-237)Cag>Tag	p.Q79*		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	79							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.Q79*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						CACACTCTCTCAGGGATCTTT	0.418																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											80.0	78.0	79.0					3																	93803063		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.235C>T	3.37:g.93803063C>T	ENSP00000318986:p.Gln79*		Q6PG41|Q8IXG9|Q9H6M2	Nonsense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.Q79*	ENST00000314622.4	37	c.235	CCDS2927.1	3	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597740	0.28445	.	.	ENSG00000178694	ENST00000314622	.	.	.	5.81	3.96	0.45880	.	0.424990	0.26474	N	0.024173	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-2.3826	12.469	0.55775	0.1233:0.6389:0.2377:0.0	.	.	.	.	X	79	.	ENSP00000318986:Q79X	Q	+	1	0	NSUN3	95285753	0.983000	0.35010	0.003000	0.11579	0.009000	0.06853	1.445000	0.35079	0.738000	0.32606	0.655000	0.94253	CAG	NSUN3	-	NULL	ENSG00000178694		0.418	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN3	HGNC	protein_coding	OTTHUMT00000352934.1	102	0.00	0	C	NM_022072		93803063	93803063	+1	no_errors	ENST00000314622	ensembl	human	known	69_37n	nonsense	112	11.81	15	SNP	0.036	T
NUP188	23511	genome.wustl.edu	37	9	131768007	131768007	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:131768007C>T	ENST00000372577.2	+	41	4842	c.4821C>T	c.(4819-4821)ttC>ttT	p.F1607F	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1607					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.F1607F(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCCCCTCCTTCGGGACCCTTC	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											211.0	204.0	206.0					9																	131768007		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4821C>T	9.37:g.131768007C>T			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.F1607	ENST00000372577.2	37	c.4821	CCDS35156.1	9																																																																																			NUP188	-	NULL	ENSG00000095319		0.572	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	408	0.24	1	C			131768007	131768007	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	silent	356	12.96	53	SNP	0.097	T
NVL	4931	genome.wustl.edu	37	1	224477395	224477395	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:224477395C>T	ENST00000281701.6	-	13	1625	c.1366G>A	c.(1366-1368)Gct>Act	p.A456T	NVL_ENST00000361463.3_Missense_Mutation_p.A350T|NVL_ENST00000391875.2_Missense_Mutation_p.A350T|NVL_ENST00000469075.1_Missense_Mutation_p.A365T|NVL_ENST00000340871.4_Missense_Mutation_p.A267T|NVL_ENST00000482491.1_Missense_Mutation_p.A180T	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	456						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.A456T(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		AAATCAAAAGCTTGAGGAAGC	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	45.0	46.0					1																	224477395		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.1366G>A	1.37:g.224477395C>T	ENSP00000281701:p.Ala456Thr		B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_Zeta_toxin_domain,smart_AAA+_ATPase	p.A456T	ENST00000281701.6	37	c.1366	CCDS1541.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.992328|1.992328	0.35131|0.35131	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871;ENST00000361463|ENST00000469968	T;T;T;D;T;T|.	0.94862|.	-1.17;-1.17;-1.17;-3.54;-1.17;-1.17|.	5.91|5.91	-3.21|-3.21	0.05140|0.05140	.|.	0.611782|.	0.17946|.	N|.	0.156690|.	T|T	0.07954|0.07954	0.0199|0.0199	N|N	0.01686|0.01686	-0.76|-0.76	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.001|.	T|T	0.30851|0.30851	-0.9964|-0.9964	10|5	0.38643|.	T|.	0.18|.	-0.2638|-0.2638	1.7278|1.7278	0.02925|0.02925	0.3169:0.3542:0.1004:0.2285|0.3169:0.3542:0.1004:0.2285	.|.	267;365;456|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	T|N	456;350;365;180;267;350|338	ENSP00000281701:A456T;ENSP00000375747:A350T;ENSP00000417826:A365T;ENSP00000417213:A180T;ENSP00000341362:A267T;ENSP00000354779:A350T|.	ENSP00000281701:A456T|.	A|S	-|-	1|2	0|0	NVL|NVL	222544018|222544018	0.004000|0.004000	0.15560|0.15560	0.000000|0.000000	0.03702|0.03702	0.458000|0.458000	0.32498|0.32498	0.198000|0.198000	0.17217|0.17217	-0.437000|-0.437000	0.07243|0.07243	0.655000|0.655000	0.94253|0.94253	GCT|AGC	NVL	-	NULL	ENSG00000143748		0.418	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NVL	HGNC	protein_coding	OTTHUMT00000091453.2	82	0.00	0	C	NM_002533		224477395	224477395	-1	no_errors	ENST00000281701	ensembl	human	known	69_37n	missense	182	13.33	28	SNP	0.009	T
OCIAD1	54940	genome.wustl.edu	37	4	48859365	48859365	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:48859365G>C	ENST00000381473.3	+	8	1101	c.683G>C	c.(682-684)aGa>aCa	p.R228T	OCIAD1_ENST00000506801.1_Intron|OCIAD1_ENST00000396448.2_Intron|OCIAD1_ENST00000509122.1_Missense_Mutation_p.R201T|OCIAD1_ENST00000264312.7_Missense_Mutation_p.R228T|OCIAD1_ENST00000508293.1_Missense_Mutation_p.R228T|OCIAD1_ENST00000444354.2_Intron|OCIAD1_ENST00000425583.2_Intron|OCIAD1-AS1_ENST00000513576.1_RNA|OCIAD1_ENST00000513391.2_Missense_Mutation_p.R228T	NM_001079839.2	NP_001073308.1	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1	228						endosome (GO:0005768)|membrane (GO:0016020)|mitochondrion (GO:0005739)		p.R228T(1)		breast(2)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	9						ATGCATGAAAGAGTGCCAAAA	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	60.0	59.0					4																	48859365		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF324350	CCDS3484.1, CCDS43228.1, CCDS47052.1	4p11	2010-03-19			ENSG00000109180	ENSG00000109180			16074	protein-coding gene	gene with protein product						11162530, 18328549	Standard	NM_017830		Approved	FLJ20455, TPA018, OCIA, Asrij	uc010igk.3	Q9NX40	OTTHUMG00000102095	ENST00000381473.3:c.683G>C	4.37:g.48859365G>C	ENSP00000370882:p.Arg228Thr		C9K030|G8JLN7|Q9BZE8	Missense_Mutation	SNP	pfam_OCIA	p.R228T	ENST00000381473.3	37	c.683	CCDS3484.1	4	.	.	.	.	.	.	.	.	.	.	G	12.37	1.919086	0.33908	.	.	ENSG00000109180	ENST00000509122;ENST00000264312;ENST00000381473;ENST00000503016;ENST00000508293;ENST00000513391	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.81	4.06	0.47325	.	0.185246	0.56097	N	0.000021	T	0.37183	0.0994	L	0.55481	1.735	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.001;0.002	T	0.17349	-1.0372	9	.	.	.	-8.9841	4.9584	0.14054	0.0793:0.1471:0.6213:0.1523	.	201;228	D6RBN5;Q9NX40	.;OCAD1_HUMAN	T	201;228;228;174;228;228	ENSP00000264312:R228T;ENSP00000370882:R228T;ENSP00000423002:R228T;ENSP00000423909:R228T	.	R	+	2	0	OCIAD1	48554122	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.054000	0.30455	0.780000	0.33566	-0.150000	0.13652	AGA	OCIAD1	-	NULL	ENSG00000109180		0.303	OCIAD1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OCIAD1	HGNC	protein_coding	OTTHUMT00000361812.3	126	0.00	0	G	NM_017830		48859365	48859365	+1	no_errors	ENST00000264312	ensembl	human	known	69_37n	missense	190	16.59	38	SNP	1.000	C
PAK1	5058	genome.wustl.edu	37	11	77103382	77103382	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:77103382C>T	ENST00000356341.3	-	2	715	c.184G>A	c.(184-186)Gat>Aat	p.D62N	PAK1_ENST00000528203.1_Intron|PAK1_ENST00000278568.4_Missense_Mutation_p.D62N|PAK1_ENST00000530617.1_Missense_Mutation_p.D62N	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	62					actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D62N(2)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					ATACTTTTATCTCCAGGTAAA	0.343																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	57.0	58.0					11																	77103382		2200	4292	6492	-	-	-	SO:0001583	missense	0			U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.184G>A	11.37:g.77103382C>T	ENSP00000348696:p.Asp62Asn		O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.D62N	ENST00000356341.3	37	c.184	CCDS8250.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175091	0.78564	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000529248;ENST00000524847;ENST00000528592;ENST00000528633	T;T;T	0.70869	-0.49;-0.52;-0.52	6.17	6.17	0.99709	.	0.043720	0.85682	D	0.000000	T	0.71970	0.3403	L	0.53249	1.67	0.80722	D	1	B;P;B	0.41524	0.008;0.753;0.003	B;B;B	0.43867	0.022;0.434;0.033	T	0.65162	-0.6235	10	0.18710	T	0.47	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	62;62;62	B3KNX7;Q13153;Q13153-2	.;PAK1_HUMAN;.	N	62	ENSP00000348696:D62N;ENSP00000433423:D62N;ENSP00000278568:D62N	ENSP00000278568:D62N	D	-	1	0	PAK1	76781030	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.430000	0.80321	2.941000	0.99782	0.655000	0.94253	GAT	PAK1	-	NULL	ENSG00000149269		0.343	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1	HGNC	protein_coding	OTTHUMT00000382083.2	225	0.00	0	C	NM_002576		77103382	77103382	-1	no_errors	ENST00000278568	ensembl	human	known	69_37n	missense	125	25.15	42	SNP	1.000	T
PANK2	80025	genome.wustl.edu	37	20	3888593	3888593	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:3888593G>C	ENST00000316562.4	+	2	655	c.649G>C	c.(649-651)Gat>Cat	p.D217H	PANK2_ENST00000497424.1_5'UTR|PANK2_ENST00000610179.1_Missense_Mutation_p.D94H	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	217					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.D217H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GTTTGGACTGGATATCGGTGG	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)	GRCh37	CM060411	PANK2	M							59.0	63.0	61.0					20																	3888593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.649G>C	20.37:g.3888593G>C	ENSP00000313377:p.Asp217His		B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.D217H	ENST00000316562.4	37	c.649	CCDS13071.2	20	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208982	0.79240	.	.	ENSG00000125779	ENST00000316562;ENST00000399552	D	0.99909	-7.86	4.67	4.67	0.58626	.	0.042681	0.85682	D	0.000000	D	0.99924	0.9965	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96085	0.9057	10	0.87932	D	0	-14.5919	15.8947	0.79325	0.0:0.0:1.0:0.0	.	217	Q9BZ23	PANK2_HUMAN	H	217;33	ENSP00000313377:D217H	ENSP00000313377:D217H	D	+	1	0	PANK2	3836593	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.535000	0.98064	2.882000	0.98803	0.655000	0.94253	GAT	PANK2	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000125779		0.373	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANK2	HGNC	protein_coding	OTTHUMT00000077793.2	116	0.00	0	G	NM_024960		3888593	3888593	+1	no_errors	ENST00000316562	ensembl	human	known	69_37n	missense	100	13.04	15	SNP	1.000	C
PAQR3	152559	genome.wustl.edu	37	4	79845078	79845078	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:79845078C>T	ENST00000512733.1	-	5	939	c.726G>A	c.(724-726)gtG>gtA	p.V242V	PAQR3_ENST00000515541.1_Intron|PAQR3_ENST00000380645.4_Silent_p.V242V|PAQR3_ENST00000295462.3_3'UTR	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	242					negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V242V(1)		breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						TCATATACATCACAATTACAC	0.358																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	82.0	85.0					4																	79845078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.726G>A	4.37:g.79845078C>T			A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	Silent	SNP	pfam_HlyIII-related	p.V242	ENST00000512733.1	37	c.726	CCDS34020.1	4																																																																																			PAQR3	-	pfam_HlyIII-related	ENSG00000163291		0.358	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR3	HGNC	protein_coding	OTTHUMT00000363442.1	63	0.00	0	C	NM_177453		79845078	79845078	-1	no_errors	ENST00000511594	ensembl	human	known	69_37n	silent	99	14.66	17	SNP	1.000	T
PARD3	56288	genome.wustl.edu	37	10	34400415	34400415	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:34400415C>T	ENST00000374789.3	-	25	4078	c.3753G>A	c.(3751-3753)caG>caA	p.Q1251Q	PARD3_ENST00000374790.3_Silent_p.Q1191Q|PARD3_ENST00000346874.4_Silent_p.Q1214Q|PARD3_ENST00000350537.4_Silent_p.Q1205Q|PARD3_ENST00000374794.3_Silent_p.Q1139Q|PARD3_ENST00000374788.3_Silent_p.Q1248Q|PARD3_ENST00000545260.1_Silent_p.Q1161Q|PARD3_ENST00000545693.1_Silent_p.Q1235Q	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1251					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.Q1251Q(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CTTTGGCACTCTGGAAGCCTT	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	70.0	70.0					10																	34400415		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3753G>A	10.37:g.34400415C>T			F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q1251	ENST00000374789.3	37	c.3753	CCDS7178.1	10																																																																																			PARD3	-	NULL	ENSG00000148498		0.557	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1	97	0.00	0	C	NM_019619		34400415	34400415	-1	no_errors	ENST00000374789	ensembl	human	known	69_37n	silent	58	19.44	14	SNP	1.000	T
PCDHAC1	56135	genome.wustl.edu	37	5	140306796	140306796	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:140306796C>T	ENST00000253807.2	+	1	319	c.319C>T	c.(319-321)Ctg>Ttg	p.L107L	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.L107L	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L107L(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGCTGGAGCTGCACAAGAT	0.617																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											54.0	50.0	51.0					5																	140306796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.319C>T	5.37:g.140306796C>T			Q9Y5F5|Q9Y5I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L107	ENST00000253807.2	37	c.319	CCDS4241.1	5																																																																																			PCDHAC1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000248383		0.617	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	39	0.00	0	C	NM_018898		140306796	140306796	+1	no_errors	ENST00000253807	ensembl	human	known	69_37n	silent	29	29.27	12	SNP	1.000	T
PCDHGA2	56113	genome.wustl.edu	37	5	140719243	140719243	+	Silent	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:140719243G>C	ENST00000394576.2	+	1	705	c.705G>C	c.(703-705)gcG>gcC	p.A235A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A235A(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGGATGCGAACGACAATG	0.592																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											79.0	76.0	77.0					5																	140719243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.705G>C	5.37:g.140719243G>C			Q52LL6|Q9Y5D5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A235	ENST00000394576.2	37	c.705	CCDS47289.1	5																																																																																			PCDHGA2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081853		0.592	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	139	0.00	0	G	NM_018915		140719243	140719243	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	silent	114	23.84	36	SNP	0.000	C
PDE4C	5143	genome.wustl.edu	37	19	18328995	18328995	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:18328995G>T	ENST00000355502.3	-	15	2165	c.1294C>A	c.(1294-1296)Cat>Aat	p.H432N	PDE4C_ENST00000597297.1_Missense_Mutation_p.H202N|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000262805.12_Missense_Mutation_p.H400N|PDE4C_ENST00000447275.3_Missense_Mutation_p.H326N|PDE4C_ENST00000539010.1_Missense_Mutation_p.H201N|PDE4C_ENST00000594465.3_Missense_Mutation_p.H432N|PDE4C_ENST00000594617.3_Missense_Mutation_p.H432N|PDE4C_ENST00000598111.2_Missense_Mutation_p.H147N			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	432					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.H432N(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	ACCCCAGGATGGTCCACGTCG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	103.0	105.0					19																	18328995		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1294C>A	19.37:g.18328995G>T	ENSP00000347689:p.His432Asn		B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.H432N	ENST00000355502.3	37	c.1294	CCDS12373.1	19	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170465	0.57584	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	4.61	4.61	0.57282	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.96947	0.9003	H	0.99336	4.52	0.45806	D	0.998684	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.999;1.0;0.998	D	0.98563	1.0642	10	0.87932	D	0	.	14.9276	0.70890	0.0:0.0:1.0:0.0	.	432;400;238;147	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	N	511;432;420;400;326;238;146;201;541	ENSP00000347689:H432N;ENSP00000262805:H400N;ENSP00000402091:H326N;ENSP00000439470:H201N	ENSP00000262805:H400N	H	-	1	0	PDE4C	18189995	1.000000	0.71417	0.992000	0.48379	0.154000	0.21943	9.468000	0.97676	2.110000	0.64415	0.313000	0.20887	CAT	PDE4C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000105650		0.597	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	76	0.00	0	G			18328995	18328995	-1	no_errors	ENST00000355502	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	T
PER1	5187	genome.wustl.edu	37	17	8053552	8053552	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:8053552G>A	ENST00000317276.4	-	3	596	c.359C>T	c.(358-360)tCc>tTc	p.S120F	PER1_ENST00000354903.5_Missense_Mutation_p.S104F|PER1_ENST00000581082.1_Missense_Mutation_p.S120F	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	120	Interaction with BTRC. {ECO:0000269|PubMed:15917222}.|Ser-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.S120F(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GCCACTGGTGGACGGGTTGTC	0.592			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																														dbGAP		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	1	Substitution - Missense(1)	breast(1)											90.0	88.0	89.0					17																	8053552		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.359C>T	17.37:g.8053552G>A	ENSP00000314420:p.Ser120Phe		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.S120F	ENST00000317276.4	37	c.359	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268725	0.80469	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.52295	2.02;0.67	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.66509	0.2796	M	0.66439	2.03	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.999;0.996	D;D;D	0.74023	0.952;0.972;0.982	T	0.69767	-0.5056	10	0.87932	D	0	-18.7471	15.6785	0.77349	0.0:0.0:1.0:0.0	.	120;104;120	Q6IN51;B4DI49;O15534	.;.;PER1_HUMAN	F	120;104	ENSP00000314420:S120F;ENSP00000346979:S104F	ENSP00000314420:S120F	S	-	2	0	PER1	7994277	1.000000	0.71417	0.906000	0.35671	0.851000	0.48451	8.828000	0.92047	2.573000	0.86826	0.563000	0.77884	TCC	PER1	-	NULL	ENSG00000179094		0.592	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	98	0.00	0	G			8053552	8053552	-1	no_errors	ENST00000317276	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	A
GSAP	54103	genome.wustl.edu	37	7	76984911	76984911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:76984911G>A	ENST00000257626.7	-	15	1159	c.1081C>T	c.(1081-1083)Caa>Taa	p.Q361*		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	361					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)	p.Q361*(1)									TCTGGATGTTGAACATTAAGT	0.378																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											127.0	129.0	129.0					7																	76984911		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1081C>T	7.37:g.76984911G>A	ENSP00000257626:p.Gln361*		A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Nonsense_Mutation	SNP	NULL	p.Q361*	ENST00000257626.7	37	c.1081	CCDS34672.2	7	.	.	.	.	.	.	.	.	.	.	G	39	7.519999	0.98335	.	.	ENSG00000186088	ENST00000257626	.	.	.	5.87	4.99	0.66335	.	0.259074	0.31612	U	0.007344	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	12.084	0.53688	0.0803:0.0:0.9197:0.0	.	.	.	.	X	361	.	ENSP00000257626:Q361X	Q	-	1	0	PION	76822847	1.000000	0.71417	0.829000	0.32907	0.967000	0.64934	4.626000	0.61269	1.487000	0.48415	0.655000	0.94253	CAA	PION	-	NULL	ENSG00000186088		0.378	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PION	HGNC	protein_coding	OTTHUMT00000318672.2	147	0.00	0	G	NM_017439		76984911	76984911	-1	no_errors	ENST00000257626	ensembl	human	known	69_37n	nonsense	211	15.54	39	SNP	0.986	A
PKD2L2	27039	genome.wustl.edu	37	5	137230240	137230240	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:137230240G>A	ENST00000508883.1	+	4	492	c.466G>A	c.(466-468)Ggc>Agc	p.G156S	PKD2L2_ENST00000508638.1_Missense_Mutation_p.G156S|PKD2L2_ENST00000350250.4_Missense_Mutation_p.G122S|PKD2L2_ENST00000502810.1_Missense_Mutation_p.G156S|PKD2L2_ENST00000290431.5_Missense_Mutation_p.G156S			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	156					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.G156S(1)		breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGAATGTTATGGCAAATATAC	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	83.0	84.0					5																	137230240		1836	4087	5923	-	-	-	SO:0001583	missense	0			AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.466G>A	5.37:g.137230240G>A	ENSP00000424725:p.Gly156Ser		A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	p.G156S	ENST00000508883.1	37	c.466		5	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921573	0.33908	.	.	ENSG00000078795	ENST00000503015;ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431;ENST00000511176	T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.62	1.61	0.23674	Polycystin cation channel, PKD1/PKD2 (1);	0.756052	0.12388	N	0.473323	T	0.33089	0.0851	N	0.04132	-0.27	0.09310	N	1	B;B;B	0.32324	0.002;0.364;0.005	B;B;B	0.23275	0.004;0.045;0.004	T	0.17561	-1.0365	10	0.11182	T	0.66	0.015	4.904	0.13789	0.2776:0.0:0.5032:0.2192	.	156;156;156	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	S	66;122;156;156;156;156;66	ENSP00000424885:G66S;ENSP00000344177:G122S;ENSP00000423382:G156S;ENSP00000425513:G156S;ENSP00000424725:G156S;ENSP00000290431:G156S;ENSP00000423926:G66S	ENSP00000290431:G156S	G	+	1	0	PKD2L2	137258139	0.000000	0.05858	0.584000	0.28653	0.826000	0.46750	0.262000	0.18460	0.307000	0.22880	0.591000	0.81541	GGC	PKD2L2	-	pfam_PKD1_2_channel	ENSG00000078795		0.328	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	HGNC	protein_coding	OTTHUMT00000372521.1	117	0.00	0	G	NM_014386		137230240	137230240	+1	no_errors	ENST00000508883	ensembl	human	known	69_37n	missense	111	22.38	32	SNP	0.052	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118196289	118196289	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:118196289C>T	ENST00000369230.3	+	2	262	c.116C>T	c.(115-117)tCa>tTa	p.S39L		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	39					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.S39L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		AGGACTTTCTCAACAGAGTTG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	155.0	159.0					10																	118196289		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.116C>T	10.37:g.118196289C>T	ENSP00000358232:p.Ser39Leu			Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.S39L	ENST00000369230.3	37	c.116	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978548	0.34942	.	.	ENSG00000203837	ENST00000369230	D	0.90324	-2.65	4.56	-2.47	0.06442	Lipase, N-terminal (1);	0.812426	0.09791	N	0.755426	T	0.78972	0.4368	N	0.24115	0.695	0.09310	N	1	B	0.12630	0.006	B	0.24701	0.055	T	0.63238	-0.6682	10	0.23891	T	0.37	.	1.0736	0.01627	0.4525:0.1865:0.1159:0.2451	.	39	Q17RR3	LIPR3_HUMAN	L	39	ENSP00000358232:S39L	ENSP00000358232:S39L	S	+	2	0	PNLIPRP3	118186279	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.479000	0.06567	-0.243000	0.09653	-0.142000	0.14014	TCA	PNLIPRP3	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH	ENSG00000203837		0.433	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	147	0.00	0	C	XM_058404		118196289	118196289	+1	no_errors	ENST00000369230	ensembl	human	known	69_37n	missense	208	16.13	40	SNP	0.000	T
PPHLN1	51535	genome.wustl.edu	37	12	42835152	42835152	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:42835152delG	ENST00000395568.2	+	10	1029	c.945delG	c.(943-945)gtgfs	p.V316fs	PPHLN1_ENST00000449194.2_Frame_Shift_Del_p.V297fs|PPHLN1_ENST00000552761.1_Frame_Shift_Del_p.V268fs|PPHLN1_ENST00000256678.8_Frame_Shift_Del_p.V196fs|PPHLN1_ENST00000358314.7_Frame_Shift_Del_p.V316fs|PPHLN1_ENST00000337898.6_Frame_Shift_Del_p.V261fs|PPHLN1_ENST00000432191.2_Frame_Shift_Del_p.V261fs|PPHLN1_ENST00000317560.9_Frame_Shift_Del_p.V249fs|PPHLN1_ENST00000395580.3_Frame_Shift_Del_p.V323fs|PPHLN1_ENST00000549190.1_Frame_Shift_Del_p.V334fs	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	316					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V316fs*1(2)|p.V323fs*1(1)		breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		TCGGGATGGTGGTGAAAATGC	0.368																																						dbGAP											3	Deletion - Frameshift(3)	breast(3)											171.0	166.0	168.0					12																	42835152		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.945delG	12.37:g.42835152delG	ENSP00000378935:p.Val316fs		E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Frame_Shift_Del	DEL	NULL	p.V316fs	ENST00000395568.2	37	c.945	CCDS31777.1	12																																																																																			PPHLN1	-	NULL	ENSG00000134283		0.368	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	HGNC	protein_coding	OTTHUMT00000404047.1	197	0.00	0	G	NM_201515		42835152	42835152	+1	no_errors	ENST00000395568	ensembl	human	known	69_37n	frame_shift_del	218	10.29	25	DEL	1.000	-
PRR5L	79899	genome.wustl.edu	37	11	36472825	36472825	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:36472825G>A	ENST00000378867.3	+	9	1007	c.652G>A	c.(652-654)Gtt>Att	p.V218I	PRR5L_ENST00000311599.5_Missense_Mutation_p.V145I|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000527487.1_Intron|PRR5L_ENST00000530639.1_Missense_Mutation_p.V218I	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	218					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)	p.V218I(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						GAAGCAAGTGGTTTCTCCTTT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											182.0	151.0	162.0					11																	36472825		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.652G>A	11.37:g.36472825G>A	ENSP00000368144:p.Val218Ile		A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	pfam_HbrB	p.V218I	ENST00000378867.3	37	c.652	CCDS31463.1	11	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910101	0.52439	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867	T;T;T	0.37752	1.39;1.18;1.39	5.16	4.24	0.50183	.	0.153883	0.44285	D	0.000470	T	0.31827	0.0809	L	0.47716	1.5	0.44201	D	0.997021	B;B	0.19935	0.015;0.04	B;B	0.16722	0.016;0.016	T	0.11060	-1.0603	10	0.41790	T	0.15	-36.6403	12.7365	0.57228	0.0804:0.0:0.9196:0.0	.	90;218	Q6MZQ0-3;Q6MZQ0	.;PRR5L_HUMAN	I	218;145;218	ENSP00000435050:V218I;ENSP00000310103:V145I;ENSP00000368144:V218I	ENSP00000310103:V145I	V	+	1	0	PRR5L	36429401	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	5.504000	0.66968	2.417000	0.82017	0.313000	0.20887	GTT	PRR5L	-	NULL	ENSG00000135362		0.537	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1	95	0.00	0	G	NM_024841		36472825	36472825	+1	no_errors	ENST00000378867	ensembl	human	known	69_37n	missense	55	22.54	16	SNP	1.000	A
PRSS58	136541	genome.wustl.edu	37	7	141955050	141955050	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:141955050delC	ENST00000552471.1	-	3	580	c.261delG	c.(259-261)atgfs	p.M87fs	PRSS58_ENST00000547058.2_Frame_Shift_Del_p.M87fs			Q8IYP2	PRS58_HUMAN	protease, serine, 58	87	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						GATGATGAATCATCTTCTCAT	0.403																																						dbGAP											0													204.0	184.0	191.0					7																	141955050		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.261delG	7.37:g.141955050delC	ENSP00000446916:p.Met87fs		B3KVJ6|D3DXD2	Frame_Shift_Del	DEL	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.M87fs	ENST00000552471.1	37	c.261	CCDS5871.1	7																																																																																			PRSS58	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000258223		0.403	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRSS58	HGNC	protein_coding	OTTHUMT00000351328.2	256	0.00	0	C	NM_001001317		141955050	141955050	-1	no_errors	ENST00000547058	ensembl	human	known	69_37n	frame_shift_del	339	67.39	812	DEL	0.875	-
PRSS1	5644	genome.wustl.edu	37	7	142459748	142459748	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:142459748C>T	ENST00000311737.7	+	3	330	c.324C>T	c.(322-324)atC>atT	p.I108I	PRSS1_ENST00000486171.1_Silent_p.I122I	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	108	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	ACAATGACATCATGTTAATCA	0.542																																						dbGAP											0													241.0	222.0	228.0					7																	142459748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.324C>T	7.37:g.142459748C>T			A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.I108	ENST00000311737.7	37	c.324	CCDS5872.1	7																																																																																			PRSS1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000204983		0.542	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	225	0.00	0	C			142459748	142459748	+1	no_errors	ENST00000311737	ensembl	human	known	69_37n	silent	185	18.86	43	SNP	1.000	T
PSMA1	5682	genome.wustl.edu	37	11	14539262	14539262	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:14539262C>A	ENST00000396394.2	-	4	576	c.180G>T	c.(178-180)caG>caT	p.Q60H	PSMA1_ENST00000418988.2_Missense_Mutation_p.Q66H|PSMA1_ENST00000419365.2_Missense_Mutation_p.Q60H|PSMA1_ENST00000396393.1_Missense_Mutation_p.Q60H|PSMA1_ENST00000555531.1_Missense_Mutation_p.Q60H|PSMA1_ENST00000530457.1_Missense_Mutation_p.Q35H	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	60					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)	p.Q66H(1)		large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						GAATTTTTTTCTGATGAGCTG	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	108.0	109.0					11																	14539262		2200	4294	6494	-	-	-	SO:0001583	missense	0			X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.180G>T	11.37:g.14539262C>A	ENSP00000379676:p.Gln60His		A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.Q66H	ENST00000396394.2	37	c.198	CCDS7816.1	11	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403753	0.83230	.	.	ENSG00000129084	ENST00000419365;ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.64	4.73	0.59995	.	0.049708	0.85682	D	0.000000	T	0.51432	0.1674	M	0.81497	2.545	0.80722	D	1	D;P;P	0.89917	1.0;0.911;0.873	D;B;P	0.71656	0.974;0.407;0.543	T	0.57159	-0.7859	10	0.66056	D	0.02	-4.9604	13.0738	0.59075	0.0:0.9256:0.0:0.0744	.	60;66;60	B4E0X6;P25786-2;P25786	.;.;PSA1_HUMAN	H	60;60;60;35;66	ENSP00000392242:Q60H;ENSP00000379676:Q60H;ENSP00000379675:Q60H;ENSP00000441166:Q35H;ENSP00000414359:Q66H	ENSP00000379675:Q60H	Q	-	3	2	PSMA1	14495838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.828000	0.48120	1.372000	0.46190	0.655000	0.94253	CAG	PSMA1	-	pfam_Proteasome_sua/b	ENSG00000129084		0.323	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA1	HGNC	protein_coding	OTTHUMT00000386421.3	170	0.00	0	C	NM_002786		14539262	14539262	-1	no_errors	ENST00000418988	ensembl	human	known	69_37n	missense	111	21.28	30	SNP	1.000	A
R3HDM2	22864	genome.wustl.edu	37	12	57648837	57648837	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:57648837C>T	ENST00000347140.3	-	24	3040	c.2650G>A	c.(2650-2652)Gac>Aac	p.D884N	R3HDM2_ENST00000402412.1_Missense_Mutation_p.D898N|R3HDM2_ENST00000403821.2_Missense_Mutation_p.D918N|RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000441731.2_Missense_Mutation_p.D579N|R3HDM2_ENST00000358907.2_Missense_Mutation_p.D884N|R3HDM2_ENST00000413953.2_Intron			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	884						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D545N(1)|p.D884N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AAGAGTTTGTCCGCCTCAGTA	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											73.0	70.0	71.0					12																	57648837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2650G>A	12.37:g.57648837C>T	ENSP00000317903:p.Asp884Asn		Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.D884N	ENST00000347140.3	37	c.2650	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621438	0.87460	.	.	ENSG00000179912	ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821	T;T;T;T;T;T;T	0.44881	0.91;1.92;1.93;1.92;0.92;1.51;1.91	5.22	5.22	0.72569	.	0.108239	0.64402	D	0.000008	T	0.26376	0.0644	N	0.08118	0	0.37756	D	0.926147	B;B;B;P	0.36535	0.421;0.421;0.421;0.557	B;B;B;B	0.32864	0.154;0.154;0.154;0.152	T	0.34775	-0.9815	10	0.72032	D	0.01	-14.3714	18.0941	0.89483	0.0:1.0:0.0:0.0	.	918;898;884;611	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	N	611;884;898;884;579;649;918	ENSP00000377400:D611N;ENSP00000317903:D884N;ENSP00000385839:D898N;ENSP00000351784:D884N;ENSP00000408536:D579N;ENSP00000394676:D649N;ENSP00000385169:D918N	ENSP00000317903:D884N	D	-	1	0	R3HDM2	55935104	0.997000	0.39634	0.989000	0.46669	0.998000	0.95712	3.577000	0.53885	2.885000	0.99019	0.655000	0.94253	GAC	R3HDM2	-	NULL	ENSG00000179912		0.622	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	89	0.00	0	C	NM_014925		57648837	57648837	-1	no_errors	ENST00000347140	ensembl	human	known	69_37n	missense	85	17.48	18	SNP	1.000	T
RABEP1	9135	genome.wustl.edu	37	17	5235303	5235303	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:5235303C>T	ENST00000546142.2	+	3	410	c.223C>T	c.(223-225)Cga>Tga	p.R75*	RABEP1_ENST00000262477.6_Nonsense_Mutation_p.R75*|RABEP1_ENST00000537505.1_Nonsense_Mutation_p.R32*|RABEP1_ENST00000408982.2_Nonsense_Mutation_p.R75*|RABEP1_ENST00000341923.6_Nonsense_Mutation_p.R75*			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	75					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)	p.R75*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						GGGACACCTTCGAACCCAGCT	0.423																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											117.0	109.0	112.0					17																	5235303		1918	4129	6047	-	-	-	SO:0001587	stop_gained	0			AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.223C>T	17.37:g.5235303C>T	ENSP00000437701:p.Arg75*		B2RAG7|O95369|Q8IVX3	Nonsense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.R75*	ENST00000546142.2	37	c.223	CCDS45592.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.587553	0.98374	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	.	.	.	6.17	5.19	0.71726	.	0.294004	0.38381	N	0.001704	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-15.4845	13.6558	0.62338	0.2816:0.7184:0.0:0.0	.	.	.	.	X	75;75;75;75;75;32	.	ENSP00000262477:R75X	R	+	1	2	RABEP1	5176027	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.519000	0.53458	1.590000	0.49995	0.655000	0.94253	CGA	RABEP1	-	NULL	ENSG00000029725		0.423	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	HGNC	protein_coding	OTTHUMT00000439349.1	133	0.00	0	C	NM_004703		5235303	5235303	+1	no_errors	ENST00000262477	ensembl	human	known	69_37n	nonsense	106	17.83	23	SNP	1.000	T
RBPJL	11317	genome.wustl.edu	37	20	43943089	43943089	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:43943089G>C	ENST00000343694.3	+	9	976	c.904G>C	c.(904-906)Gat>Cat	p.D302H	RBPJL_ENST00000372741.3_Missense_Mutation_p.D302H|RBPJL_ENST00000464504.1_3'UTR|RBPJL_ENST00000372743.1_Missense_Mutation_p.D302H	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	302					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D302H(1)		NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				TGCGCTCCTTGATGTGGATGA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											161.0	138.0	146.0					20																	43943089		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.904G>C	20.37:g.43943089G>C	ENSP00000341243:p.Asp302His		O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.D302H	ENST00000343694.3	37	c.904	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808056	0.50421	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.34472	1.36;1.36;1.36	5.03	5.03	0.67393	Beta-trefoil (2);	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65845	-0.6069	10	0.87932	D	0	-23.7872	17.5316	0.87816	0.0:0.0:1.0:0.0	.	302;302	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	H	302	ENSP00000361828:D302H;ENSP00000361826:D302H;ENSP00000341243:D302H	ENSP00000341243:D302H	D	+	1	0	RBPJL	43376503	1.000000	0.71417	0.409000	0.26459	0.662000	0.39071	7.268000	0.78473	2.607000	0.88179	0.563000	0.77884	GAT	RBPJL	-	pfam_Beta-trefoil_DNA-bd_dom,superfamily_Beta-trefoil_DNA-bd_dom	ENSG00000124232		0.567	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1	214	0.00	0	G	NM_014276		43943089	43943089	+1	no_errors	ENST00000343694	ensembl	human	known	69_37n	missense	149	13.37	23	SNP	0.998	C
RGL3	57139	genome.wustl.edu	37	19	11526649	11526649	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:11526649G>A	ENST00000380456.3	-	5	664	c.601C>T	c.(601-603)Cga>Tga	p.R201*	RGL3_ENST00000393423.3_Nonsense_Mutation_p.R201*	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	201					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.R201*(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						TCCTGCTCTCGCTCAGCCTCC	0.572																																					GBM(174;751 2067 17998 27979 33959)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											143.0	154.0	150.0					19																	11526649		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.601C>T	19.37:g.11526649G>A	ENSP00000369823:p.Arg201*		B5ME84|B7ZL22|Q0P6G0	Nonsense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R201*	ENST00000380456.3	37	c.601	CCDS32910.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.4|29.4	5.005137|5.005137	0.93287|0.93287	.|.	.|.	ENSG00000205517|ENSG00000205517	ENST00000342684|ENST00000393423;ENST00000380456	.|.	.|.	.|.	4.88|4.88	-0.452|-0.452	0.12205|0.12205	.|.	.|1.761970	.|0.03094	.|N	.|0.160138	T|.	0.31734|.	0.0806|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32877|.	-0.9890|.	4|.	0.87932|0.16420	D|T	0|0.52	.|.	11.8371|11.8371	0.52330|0.52330	0.0:0.4918:0.3862:0.122|0.0:0.4918:0.3862:0.122	.|.	.|.	.|.	.|.	V|X	1|201	.|.	ENSP00000344665:A1V|ENSP00000369823:R201X	A|R	-|-	2|1	0|2	RGL3|RGL3	11387649|11387649	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.632000|0.632000	0.37999|0.37999	-0.693000|-0.693000	0.05121|0.05121	0.072000|0.072000	0.16694|0.16694	0.511000|0.511000	0.50034|0.50034	GCG|CGA	RGL3	-	superfamily_Ras_GEF_dom	ENSG00000205517		0.572	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	235	0.00	0	G	XM_290867		11526649	11526649	-1	no_errors	ENST00000393423	ensembl	human	known	69_37n	nonsense	153	18.18	34	SNP	0.000	A
RRM1	6240	genome.wustl.edu	37	11	4133255	4133255	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr11:4133255C>T	ENST00000300738.5	+	7	817	c.613C>T	c.(613-615)Ctc>Ttc	p.L205F	RRM1_ENST00000423050.2_Missense_Mutation_p.L108F	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	205					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)	p.L205F(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	TTCGCCCACTCTCTTCAATGC	0.438																																					NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	96.0	98.0					11																	4133255		2201	4298	6499	-	-	-	SO:0001583	missense	0			X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.613C>T	11.37:g.4133255C>T	ENSP00000300738:p.Leu205Phe		Q9UNN2	Missense_Mutation	SNP	pfam_Ribncl_red_lg_C,pfam_Ribncl_Rdtase_lsu_N,pfam_ATP-cone,superfamily_Ribnucl_Rdtase_R1-su_N,pfscan_ATP-cone,prints_Ribncl_red_lg_C,tigrfam_NrdE_NrdA	p.L205F	ENST00000300738.5	37	c.613	CCDS7750.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.149075	0.94645	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894	T;T	0.38887	1.11;1.19	5.54	5.54	0.83059	Ribonucleotide reductase large subunit, N-terminal (1);Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase R1 subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78824	0.4344	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86553	0.1836	10	0.87932	D	0	-8.6435	18.823	0.92105	0.0:1.0:0.0:0.0	.	205	P23921	RIR1_HUMAN	F	205;108;118	ENSP00000300738:L205F;ENSP00000390539:L108F	ENSP00000300738:L205F	L	+	1	0	RRM1	4089831	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.730000	0.55006	2.747000	0.94245	0.655000	0.94253	CTC	RRM1	-	pfam_Ribncl_Rdtase_lsu_N,superfamily_Ribnucl_Rdtase_R1-su_N,tigrfam_NrdE_NrdA	ENSG00000167325		0.438	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM1	HGNC	protein_coding	OTTHUMT00000257197.1	68	0.00	0	C	NM_001033		4133255	4133255	+1	no_errors	ENST00000300738	ensembl	human	known	69_37n	missense	48	23.81	15	SNP	1.000	T
RSPH10B2	728194	genome.wustl.edu	37	7	6836384	6836384	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:6836384G>A	ENST00000403107.1	+	19	2806	c.2419G>A	c.(2419-2421)Gaa>Aaa	p.E807K	RSPH10B2_ENST00000433859.2_Missense_Mutation_p.E807K|CCZ1B_ENST00000597208.1_Intron|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000359718.3_3'UTR|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.E807K|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.E807K			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	807								p.E807K(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GGAAGATGACGAACTGGAAGC	0.522																																						dbGAP											2	Substitution - Missense(2)	breast(2)											64.0	65.0	65.0					7																	6836384		1830	3825	5655	-	-	-	SO:0001583	missense	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2419G>A	7.37:g.6836384G>A	ENSP00000384766:p.Glu807Lys		A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.E807K	ENST00000403107.1	37	c.2419	CCDS43552.1	7	.	.	.	.	.	.	.	.	.	.	G	11.86	1.766033	0.31228	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	2.94	2.94	0.34122	.	1.705140	0.03939	N	0.286539	T	0.65995	0.2745	L	0.41961	1.31	0.28362	N	0.920421	B	0.19073	0.033	B	0.13407	0.009	T	0.55673	-0.8104	10	0.59425	D	0.04	.	9.5156	0.39104	0.0:0.0:1.0:0.0	.	807	B2RC85	R10B2_HUMAN	K	807	ENSP00000384766:E807K;ENSP00000386102:E807K;ENSP00000297186:E807K;ENSP00000416710:E807K	ENSP00000297186:E807K	E	+	1	0	RSPH10B2	6802909	0.986000	0.35501	0.020000	0.16555	0.087000	0.18053	3.321000	0.51999	1.627000	0.50400	0.187000	0.17357	GAA	RSPH10B2	-	NULL	ENSG00000169402		0.522	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B2	HGNC	protein_coding	OTTHUMT00000324184.4	135	0.00	0	G	NM_001099697		6836384	6836384	+1	no_errors	ENST00000297186	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	0.094	A
SAMD9	54809	genome.wustl.edu	37	7	92732577	92732577	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:92732577C>T	ENST00000379958.2	-	3	3103	c.2834G>A	c.(2833-2835)gGa>gAa	p.G945E		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	945						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.G945E(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTCTTGTTTCCAATTCCTAA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	70.0	70.0					7																	92732577		2194	4292	6486	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2834G>A	7.37:g.92732577C>T	ENSP00000369292:p.Gly945Glu		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.G945E	ENST00000379958.2	37	c.2834	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.453712	0.00175	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.20200	2.09;2.9	5.04	2.19	0.27852	.	1.215720	0.06196	N	0.682275	T	0.09774	0.0240	N	0.03608	-0.345	0.09310	N	1	B	0.21520	0.057	B	0.16722	0.016	T	0.30707	-0.9969	10	0.51188	T	0.08	-0.7093	4.1821	0.10380	0.0784:0.1646:0.4968:0.2602	.	945	Q5K651	SAMD9_HUMAN	E	945	ENSP00000369292:G945E;ENSP00000414529:G945E	ENSP00000369292:G945E	G	-	2	0	SAMD9	92570513	0.000000	0.05858	0.002000	0.10522	0.528000	0.34623	0.165000	0.16564	0.252000	0.21531	-0.316000	0.08728	GGA	SAMD9	-	NULL	ENSG00000205413		0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	143	0.00	0	C	NM_017654		92732577	92732577	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	151	15.64	28	SNP	0.004	T
SART3	9733	genome.wustl.edu	37	12	108920032	108920032	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:108920032G>C	ENST00000228284.3	-	16	2448	c.2214C>G	c.(2212-2214)atC>atG	p.I738M	SART3_ENST00000431469.2_Missense_Mutation_p.I702M	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	738	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.I738M(1)		NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						GGTTGCTGAAGATGGGTCGGA	0.557									Porokeratosis																													dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	96.0	99.0					12																	108920032		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.2214C>G	12.37:g.108920032G>C	ENSP00000228284:p.Ile738Met		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.I738M	ENST00000228284.3	37	c.2214	CCDS9117.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.98|18.98	3.738284|3.738284	0.69304|0.69304	.|.	.|.	ENSG00000075856|ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000546815|ENST00000412617	T;T;T|.	0.16457|.	2.34;2.34;2.34|.	5.81|5.81	0.304|0.304	0.15796|0.15796	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.178524|.	0.51477|.	D|.	0.000086|.	T|T	0.41096|0.41096	0.1144|0.1144	L|L	0.39633|0.39633	1.23|1.23	0.80722|0.80722	D|D	1|1	P;D;D|B	0.60575|0.10296	0.941;0.988;0.988|0.003	P;P;P|B	0.58454|0.10450	0.807;0.839;0.839|0.005	T|T	0.33574|0.33574	-0.9863|-0.9863	10|8	0.48119|0.87932	T|D	0.1|0	-14.4325|-14.4325	1.7513|1.7513	0.02973|0.02973	0.1902:0.197:0.4126:0.2002|0.1902:0.197:0.4126:0.2002	.|.	756;702;738|685	F8VV04;B7ZKM0;Q15020|E7EMI4	.;.;SART3_HUMAN|.	M|V	738;702;303;756|685	ENSP00000228284:I738M;ENSP00000414453:I702M;ENSP00000449386:I756M|.	ENSP00000228284:I738M|ENSP00000400292:L685V	I|L	-|-	3|1	3|0	SART3|SART3	107444162|107444162	0.832000|0.832000	0.29368|0.29368	0.998000|0.998000	0.56505|0.56505	0.922000|0.922000	0.55478|0.55478	-0.185000|-0.185000	0.09684|0.09684	0.039000|0.039000	0.15632|0.15632	0.655000|0.655000	0.94253|0.94253	ATC|CTT	SART3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000075856		0.557	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1	191	0.00	0	G			108920032	108920032	-1	no_errors	ENST00000228284	ensembl	human	known	69_37n	missense	122	21.29	33	SNP	0.985	C
SBF1	6305	genome.wustl.edu	37	22	50893515	50893515	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr22:50893515G>A	ENST00000390679.3	-	33	4717	c.4533C>T	c.(4531-4533)ctC>ctT	p.L1511L	SBF1_ENST00000348911.6_Silent_p.L1512L|SBF1_ENST00000380817.3_Silent_p.L1537L|SBF1_ENST00000476293.1_5'Flank			O95248	MTMR5_HUMAN	SET binding factor 1	1511	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L1537L(1)|p.L1511L(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GGTGGTAGCCGAGGAACTTGA	0.617																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											46.0	53.0	51.0					22																	50893515		2109	4208	6317	-	-	-	SO:0001819	synonymous_variant	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.4533C>T	22.37:g.50893515G>A			A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R71W	ENST00000390679.3	37	c.211		22	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014720	0.19355	.	.	ENSG00000100241	ENST00000418590	.	.	.	3.74	-2.24	0.06909	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43114	-0.9411	4	.	.	.	.	5.9192	0.19072	0.5106:0.1369:0.3524:0.0	.	.	.	.	W	71	.	.	R	-	1	2	SBF1	49240381	0.003000	0.15002	0.993000	0.49108	0.985000	0.73830	-1.327000	0.02682	-0.249000	0.09569	-0.379000	0.06801	CGG	SBF1	-	NULL	ENSG00000100241		0.617	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding		20	0.00	0	G			50893515	50893515	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418590	ensembl	human	putative	69_37n	missense	20	25.93	7	SNP	0.996	A
SCARNA2	677766	genome.wustl.edu	37	1	109643088	109643088	+	lincRNA	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:109643088G>A	ENST00000458748.1	+	0	274					NR_003023.1				small Cajal body-specific RNA 2																		GCTGTGCAGCGAGGCCCCTTA	0.652																																						dbGAP											0													17.0	19.0	18.0					1																	109643088		872	1989	2861	-	-	-			0			BK005568		1q13.1	2013-09-05			ENSG00000238881	ENSG00000270066		"""ncRNAs / Small nucleolar RNAs : Small cajal body-specific"""	32558	non-coding RNA	RNA, small nucleolar						15556860	Standard	NR_003023		Approved	mgU2-25/61, HBII-382	uc001dwo.1				1.37:g.109643088G>A				RNA	SNP	-	NULL	ENST00000458748.1	37	NULL		1																																																																																			SCARNA2	-	-	ENSG00000238881		0.652	SCARNA2-201	KNOWN	basic	snoRNA	SCARNA2	HGNC	lincRNA		33	0.00	0	G	NR_003023		109643088	109643088	+1	no_errors	ENST00000458748	ensembl	human	known	69_37n	rna	10	47.37	9	SNP	0.993	A
ATG16L1	55054	genome.wustl.edu	37	2	234197430	234197430	+	Intron	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:234197430G>A	ENST00000392017.4	+	13	1460				ATG16L1_ENST00000498620.1_Intron|ATG16L1_ENST00000347464.5_Intron|ATG16L1_ENST00000392020.4_Intron|SCARNA6_ENST00000515982.1_RNA|ATG16L1_ENST00000392018.1_Intron|ATG16L1_ENST00000373525.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)						autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GCGATGGGCAGAAGGGCAGCT	0.542																																						dbGAP											0													87.0	80.0	82.0					2																	234197430		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1204-1070G>A	2.37:g.234197430G>A			A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	RNA	SNP	-	NULL	ENST00000392017.4	37	NULL	CCDS2503.2	2																																																																																			SCARNA6	-	-	ENSG00000251791		0.542	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARNA6	HGNC	protein_coding	OTTHUMT00000257069.2	91	0.00	0	G	NM_017974		234197430	234197430	+1	no_errors	ENST00000515982	ensembl	human	known	69_37n	rna	62	28.74	25	SNP	0.000	A
SCMH1	22955	genome.wustl.edu	37	1	41617301	41617301	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:41617301G>A	ENST00000326197.7	-	4	431	c.132C>T	c.(130-132)gtC>gtT	p.V44V	SCMH1_ENST00000372596.1_5'UTR|SCMH1_ENST00000361705.3_Intron|SCMH1_ENST00000337495.5_Silent_p.V54V|SCMH1_ENST00000456518.2_Intron|SCMH1_ENST00000402904.2_Silent_p.V44V|SCMH1_ENST00000397174.2_Silent_p.V24V|SCMH1_ENST00000372597.1_Intron|SCMH1_ENST00000397171.2_5'UTR|SCMH1_ENST00000361191.5_Intron|SCMH1_ENST00000372595.1_5'UTR					sex comb on midleg homolog 1 (Drosophila)									p.V44V(1)|p.V54V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				TGAAGCAATGGACAGGCGCTG	0.363																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											158.0	167.0	164.0					1																	41617301		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.132C>T	1.37:g.41617301G>A				Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.V44	ENST00000326197.7	37	c.132	CCDS30688.1	1																																																																																			SCMH1	-	smart_Mbt,pfscan_Mbt	ENSG00000010803		0.363	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SCMH1	HGNC	protein_coding	OTTHUMT00000015656.1	230	0.00	0	G			41617301	41617301	-1	no_errors	ENST00000326197	ensembl	human	known	69_37n	silent	247	38.71	156	SNP	1.000	A
SDHA	6389	genome.wustl.edu	37	5	236617	236617	+	Silent	SNP	G	G	A	rs200223188	byFrequency	TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:236617G>A	ENST00000264932.6	+	10	1450	c.1335G>A	c.(1333-1335)tcG>tcA	p.S445S	SDHA_ENST00000510361.1_Silent_p.S397S|SDHA_ENST00000504309.1_Silent_p.S445S	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	445					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.S445S(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCTGTGCCTCGGTACATGGTG	0.597									Familial Paragangliomas																													dbGAP											1	Substitution - coding silent(1)	breast(1)											73.0	67.0	69.0					5																	236617		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1335G>A	5.37:g.236617G>A			A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	pfam_FAD_bind_dom,pfam_Fum_Rdtase/Succ_DH_flav-like_C,superfamily_Fum_Rdtase/Succ_DH_flav-like_C,tigrfam_Succ_DH_flav_su_fwd,tigrfam_Succ_Dhase_FrdA_Gneg	p.S445	ENST00000264932.6	37	c.1335	CCDS3853.1	5																																																																																			SDHA	-	pfam_FAD_bind_dom,tigrfam_Succ_DH_flav_su_fwd,tigrfam_Succ_Dhase_FrdA_Gneg	ENSG00000073578		0.597	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHA	HGNC	protein_coding	OTTHUMT00000206599.1	43	0.00	0	G	NM_004168		236617	236617	+1	no_errors	ENST00000264932	ensembl	human	known	69_37n	silent	58	11.94	8	SNP	0.286	A
SEC24D	9871	genome.wustl.edu	37	4	119653922	119653922	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr4:119653922G>A	ENST00000280551.6	-	20	2880	c.2642C>T	c.(2641-2643)tCt>tTt	p.S881F	SEC24D_ENST00000511481.1_Missense_Mutation_p.S512F|SEC24D_ENST00000429811.2_3'UTR|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000379735.5_Missense_Mutation_p.S882F			O94855	SC24D_HUMAN	SEC24 family member D	881					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.S881C(1)|p.S881F(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GAAAAGCTGAGAGTCAGCCAC	0.488																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											163.0	132.0	142.0					4																	119653922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.2642C>T	4.37:g.119653922G>A	ENSP00000280551:p.Ser881Phe		Q8IYI7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.S882F	ENST00000280551.6	37	c.2645	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363530	0.82353	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000511481	D;D;D	0.91124	-2.79;-2.79;-2.79	5.62	5.62	0.85841	Sec23/Sec24, helical domain (2);	0.049835	0.85682	D	0.000000	D	0.94807	0.8323	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.979;0.992;0.997	D	0.94660	0.7847	10	0.62326	D	0.03	-26.4057	19.6571	0.95847	0.0:0.0:1.0:0.0	.	43;882;881	Q9NWP5;O94855-2;O94855	.;.;SC24D_HUMAN	F	881;882;512	ENSP00000280551:S881F;ENSP00000369059:S882F;ENSP00000425491:S512F	ENSP00000280551:S881F	S	-	2	0	SEC24D	119873370	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	5.135000	0.64777	2.643000	0.89663	0.591000	0.81541	TCT	SEC24D	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom	ENSG00000150961		0.488	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	155	0.00	0	G			119653922	119653922	-1	no_errors	ENST00000379735	ensembl	human	known	69_37n	missense	175	17.45	37	SNP	0.998	A
SETD1A	9739	genome.wustl.edu	37	16	30970121	30970121	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:30970121C>T	ENST00000262519.8	+	2	755	c.69C>T	c.(67-69)atC>atT	p.I23I		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	23					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.I23I(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						ACAAGCTCATCGTGGATCCTG	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											111.0	103.0	106.0					16																	30970121		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.69C>T	16.37:g.30970121C>T			A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.I23	ENST00000262519.8	37	c.69	CCDS32435.1	16																																																																																			SETD1A	-	NULL	ENSG00000099381		0.572	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	186	0.00	0	C	NM_014712		30970121	30970121	+1	no_errors	ENST00000262519	ensembl	human	known	69_37n	silent	127	19.62	31	SNP	0.998	T
SH3TC2	79628	genome.wustl.edu	37	5	148427519	148427519	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr5:148427519G>A	ENST00000515425.1	-	3	286	c.185C>T	c.(184-186)tCc>tTc	p.S62F	SH3TC2_ENST00000512049.1_Missense_Mutation_p.S62F|SH3TC2_ENST00000394358.2_5'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	62					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.S62F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACACCTCCTGGAGCGGCTCTT	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	111.0	110.0					5																	148427519		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.185C>T	5.37:g.148427519G>A	ENSP00000423660:p.Ser62Phe		B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	pfam_SH3_domain,pfam_TPR-1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.S62F	ENST00000515425.1	37	c.185	CCDS4293.1	5	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732472	0.69189	.	.	ENSG00000169247	ENST00000515425;ENST00000512049	T;T	0.80566	-1.38;-1.39	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.88250	0.6386	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.88793	0.3279	10	0.72032	D	0.01	-16.7234	16.2805	0.82673	0.0:0.0:1.0:0.0	.	62;62;62	Q14CC0;D6RFX2;Q8TF17	.;.;S3TC2_HUMAN	F	62	ENSP00000423660:S62F;ENSP00000421860:S62F	ENSP00000313025:S62F	S	-	2	0	SH3TC2	148407712	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	5.193000	0.65120	2.710000	0.92621	0.655000	0.94253	TCC	SH3TC2	-	NULL	ENSG00000169247		0.493	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	179	0.00	0	G	NM_024577		148427519	148427519	-1	no_errors	ENST00000515425	ensembl	human	known	69_37n	missense	192	19.67	47	SNP	0.998	A
SLC10A2	6555	genome.wustl.edu	37	13	103701763	103701763	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr13:103701763C>T	ENST00000245312.3	-	5	1391	c.795G>A	c.(793-795)caG>caA	p.Q265Q		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	265					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.Q265Q(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GCTGCGTGTTCTGCATCCCCG	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											145.0	109.0	121.0					13																	103701763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.795G>A	13.37:g.103701763C>T			A1L4F4|Q13839	Silent	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.Q265	ENST00000245312.3	37	c.795	CCDS9506.1	13																																																																																			SLC10A2	-	tigrfam_Bil_ac_transpt	ENSG00000125255		0.448	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A2	HGNC	protein_coding	OTTHUMT00000045716.1	74	0.00	0	C			103701763	103701763	-1	no_errors	ENST00000245312	ensembl	human	known	69_37n	silent	99	13.16	15	SNP	1.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45212300	45212300	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr20:45212300G>T	ENST00000279027.4	-	9	1148	c.1130C>A	c.(1129-1131)tCt>tAt	p.S377Y	SLC13A3_ENST00000396360.1_Missense_Mutation_p.S295Y|SLC13A3_ENST00000413164.2_Missense_Mutation_p.S327Y|SLC13A3_ENST00000290317.5_Missense_Mutation_p.S330Y|SLC13A3_ENST00000464518.1_5'UTR|SLC13A3_ENST00000495082.1_Missense_Mutation_p.S330Y|SLC13A3_ENST00000472148.1_Missense_Mutation_p.S295Y|SLC13A3_ENST00000435032.1_De_novo_Start_InFrame	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	377					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.S377Y(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GACAGCATCAGAAAGAAACCT	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	87.0	92.0					20																	45212300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1130C>A	20.37:g.45212300G>T	ENSP00000279027:p.Ser377Tyr		B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.S377Y	ENST00000279027.4	37	c.1130	CCDS13400.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.842834|4.842834	0.91197|0.91197	.|.	.|.	ENSG00000158296|ENSG00000158296	ENST00000450298|ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915	.|T;T;T;T;T;T;T	.|0.03441	.|3.93;4.12;3.93;4.12;3.93;3.93;3.93	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.24236|0.24236	0.0587|0.0587	M|M	0.86953|0.86953	2.85|2.85	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.994;1.0;0.996;0.998	.|D;D;D;D	.|0.74348	.|0.98;0.982;0.971;0.983	T|T	0.00899|0.00899	-1.1522|-1.1522	5|10	.|0.87932	.|D	.|0	-23.9971|-23.9971	19.8961|19.8961	0.96958|0.96958	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|327;295;330;377	.|B4DIR8;Q8WWT9-3;F6WI18;Q8WWT9	.|.;.;.;S13A3_HUMAN	L|Y	206|330;295;377;295;327;330;330	.|ENSP00000290317:S330Y;ENSP00000379648:S295Y;ENSP00000279027:S377Y;ENSP00000420177:S295Y;ENSP00000415852:S327Y;ENSP00000419621:S330Y;ENSP00000417784:S330Y	.|ENSP00000279027:S377Y	F|S	-|-	3|2	2|0	SLC13A3|SLC13A3	44645707|44645707	1.000000|1.000000	0.71417|0.71417	0.660000|0.660000	0.29694|0.29694	0.928000|0.928000	0.56348|0.56348	8.645000|8.645000	0.91049|0.91049	2.699000|2.699000	0.92147|0.92147	0.655000|0.655000	0.94253|0.94253	TTC|TCT	SLC13A3	-	pfam_Na/sul_symport	ENSG00000158296		0.507	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	91	0.00	0	G			45212300	45212300	-1	no_errors	ENST00000279027	ensembl	human	known	69_37n	missense	89	13.59	14	SNP	1.000	T
SMG8	55181	genome.wustl.edu	37	17	57292214	57292214	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:57292214G>A	ENST00000543872.2	+	5	3091	c.2827G>A	c.(2827-2829)Gaa>Aaa	p.E943K	SMG8_ENST00000300917.5_Missense_Mutation_p.E943K|CTD-2510F5.6_ENST00000577660.1_Missense_Mutation_p.E62K			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	943					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.E943K(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						AGAAAAACAAGAAATCACCCT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	106.0	109.0					17																	57292214		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2827G>A	17.37:g.57292214G>A	ENSP00000438748:p.Glu943Lys		Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.E943K	ENST00000543872.2	37	c.2827	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.574438	0.96553	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.41400	1.0;1.0	5.73	5.73	0.89815	.	0.088367	0.85682	D	0.000000	T	0.54046	0.1834	L	0.56769	1.78	0.80722	D	1	P	0.51449	0.945	P	0.51945	0.685	T	0.48581	-0.9023	10	0.40728	T	0.16	-24.0801	18.8899	0.92395	0.0:0.0:1.0:0.0	.	943	Q8ND04	SMG8_HUMAN	K	943	ENSP00000300917:E943K;ENSP00000438748:E943K	ENSP00000300917:E943K	E	+	1	0	SMG8	54646996	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.192000	0.94947	2.707000	0.92482	0.561000	0.74099	GAA	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.423	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	132	0.00	0	G	NM_018149		57292214	57292214	+1	no_errors	ENST00000300917	ensembl	human	known	69_37n	missense	169	16.34	33	SNP	1.000	A
SSFA2	6744	genome.wustl.edu	37	2	182787116	182787116	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:182787116G>A	ENST00000431877.2	+	16	3831	c.3652G>A	c.(3652-3654)Gag>Aag	p.E1218K	SSFA2_ENST00000409136.1_Missense_Mutation_p.E727K|SSFA2_ENST00000320370.7_Missense_Mutation_p.E1218K|SSFA2_ENST00000409001.1_Missense_Mutation_p.E1196K|SSFA2_ENST00000428267.2_Missense_Mutation_p.E1043K|SSFA2_ENST00000467172.2_3'UTR	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1218						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E1218K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GGAGCAAGATGAGTTGCAGCA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	48.0	50.0					2																	182787116		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3652G>A	2.37:g.182787116G>A	ENSP00000388731:p.Glu1218Lys		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.E1218K	ENST00000431877.2	37	c.3652	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698085	0.88830	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136;ENST00000451836	T;T;T;T;T	0.21932	2.29;1.98;2.26;2.27;2.08	5.95	5.08	0.68730	.	0.100723	0.64402	D	0.000002	T	0.47619	0.1455	M	0.73598	2.24	0.46521	D	0.999084	D;D;D;D;D	0.89917	1.0;1.0;0.998;0.998;0.998	D;D;D;D;D	0.85130	0.997;0.997;0.994;0.994;0.994	T	0.52238	-0.8602	10	0.87932	D	0	-17.6666	15.1228	0.72457	0.0674:0.0:0.9326:0.0	.	1043;727;1196;1218;1218	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	K	1218;1218;1196;1043;727;163	ENSP00000388731:E1218K;ENSP00000314669:E1218K;ENSP00000387319:E1196K;ENSP00000409867:E1043K;ENSP00000386916:E727K	ENSP00000314669:E1218K	E	+	1	0	SSFA2	182495361	1.000000	0.71417	0.928000	0.36995	0.921000	0.55340	6.681000	0.74523	1.534000	0.49203	0.655000	0.94253	GAG	SSFA2	-	NULL	ENSG00000138434		0.393	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	81	0.00	0	G	NM_006751		182787116	182787116	+1	no_errors	ENST00000431877	ensembl	human	known	69_37n	missense	81	19.80	20	SNP	0.997	A
STAM	8027	genome.wustl.edu	37	10	17702462	17702462	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:17702462G>C	ENST00000377524.3	+	2	255		c.e2-1		STAM_ENST00000540523.1_Splice_Site	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1						endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)	p.?(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						ACAATCTACAGAGAAAGCAAC	0.353																																						dbGAP											1	Unknown(1)	breast(1)											153.0	153.0	153.0					10																	17702462		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.41-1G>C	10.37:g.17702462G>C			B0YJ99|D3DRU5|Q8N6D9	Splice_Site	SNP	-	e2-1	ENST00000377524.3	37	c.41-1	CCDS7122.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297761	0.81025	.	.	ENSG00000136738	ENST00000377524	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1488	0.89668	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAM	17742468	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.011000	0.93618	2.581000	0.87130	0.558000	0.71614	.	STAM	-	-	ENSG00000136738		0.353	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM	HGNC	protein_coding	OTTHUMT00000047039.1	226	0.00	0	G	NM_003473	Intron	17702462	17702462	+1	no_errors	ENST00000377524	ensembl	human	known	69_37n	splice_site	282	18.02	62	SNP	1.000	C
STXBP5L	9515	genome.wustl.edu	37	3	120973931	120973931	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:120973931G>A	ENST00000273666.6	+	16	1902	c.1631G>A	c.(1630-1632)aGc>aAc	p.S544N	STXBP5L_ENST00000492541.1_Missense_Mutation_p.S544N|STXBP5L_ENST00000472879.1_Missense_Mutation_p.S544N|STXBP5L_ENST00000497029.1_Missense_Mutation_p.S544N|STXBP5L_ENST00000471454.1_Missense_Mutation_p.S544N	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	544					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S544N(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TATAAATTCAGCAGACATGAA	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	37.0	38.0					3																	120973931		1803	4075	5878	-	-	-	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1631G>A	3.37:g.120973931G>A	ENSP00000273666:p.Ser544Asn		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin	p.S544N	ENST00000273666.6	37	c.1631	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600317	0.46423	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.63096	1.58;1.53;-0.02;1.5;1.53;1.53	5.36	5.36	0.76844	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71821	0.3385	L	0.43923	1.385	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.72338	0.977;0.977	T	0.64664	-0.6354	10	0.14252	T	0.57	-30.9458	19.0813	0.93182	0.0:0.0:1.0:0.0	.	544;544	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	N	544	ENSP00000273666:S544N;ENSP00000420019:S544N;ENSP00000419627:S544N;ENSP00000420287:S544N;ENSP00000420666:S544N;ENSP00000420167:S544N	ENSP00000273666:S544N	S	+	2	0	STXBP5L	122456621	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.370000	0.97159	2.505000	0.84491	0.591000	0.81541	AGC	STXBP5L	-	superfamily_WD40_repeat_dom	ENSG00000145087		0.313	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	40	0.00	0	G			120973931	120973931	+1	no_errors	ENST00000273666	ensembl	human	known	69_37n	missense	71	15.29	13	SNP	1.000	A
SYNE3	161176	genome.wustl.edu	37	14	95921936	95921936	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr14:95921936C>T	ENST00000334258.5	-	5	929	c.915G>A	c.(913-915)atG>atA	p.M305I	SYNE3_ENST00000554873.1_Missense_Mutation_p.M62I|SYNE3_ENST00000553340.1_Missense_Mutation_p.M305I|SYNE3_ENST00000557275.1_Missense_Mutation_p.M305I	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	305					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)	p.M305I(3)		breast(1)|endometrium(2)|lung(25)	28						GAACTTTCCTCATCTCTTCCA	0.622																																						dbGAP											3	Substitution - Missense(3)	breast(3)											100.0	106.0	104.0					14																	95921936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.915G>A	14.37:g.95921936C>T	ENSP00000334308:p.Met305Ile		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.M305I	ENST00000334258.5	37	c.915	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683922	0.29872	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.30981	3.64;1.51;3.61;3.05	4.99	3.89	0.44902	.	0.500343	0.16443	N	0.214214	T	0.33498	0.0865	M	0.68317	2.08	0.34773	D	0.733895	B;B;B	0.31077	0.307;0.162;0.204	B;B;B	0.29716	0.106;0.046;0.049	T	0.50808	-0.8784	10	0.46703	T	0.11	-25.4637	13.9483	0.64099	0.0:0.911:0.0:0.089	.	305;305;305	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	I	305;62;305;305	ENSP00000334308:M305I;ENSP00000452154:M62I;ENSP00000450562:M305I;ENSP00000450774:M305I	ENSP00000334308:M305I	M	-	3	0	C14orf49	94991689	1.000000	0.71417	0.999000	0.59377	0.132000	0.20833	2.520000	0.45554	2.323000	0.78572	0.455000	0.32223	ATG	SYNE3	-	smart_Spectrin/alpha-actinin	ENSG00000176438		0.622	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	123	0.00	0	C	NM_152592		95921936	95921936	-1	no_errors	ENST00000334258	ensembl	human	known	69_37n	missense	62	21.52	17	SNP	0.995	T
T	6862	genome.wustl.edu	37	6	166580304	166580304	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:166580304delC	ENST00000296946.2	-	3	715	c.247delG	c.(247-249)gacfs	p.D83fs	T_ENST00000366871.3_Frame_Shift_Del_p.D83fs	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	83					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GCGTTGGGGTCCAGGCCAGAC	0.652									Chordoma, Familial Clustering of																													dbGAP											0													68.0	58.0	61.0					6																	166580304		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.247delG	6.37:g.166580304delC	ENSP00000296946:p.Asp83fs		E7ERD6|Q4KMP4	Frame_Shift_Del	DEL	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_Brachyury,prints_TF_T-box	p.D83fs	ENST00000296946.2	37	c.247	CCDS5290.1	6																																																																																			T	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000164458		0.652	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	T	HGNC	protein_coding	OTTHUMT00000043037.2	29	0.00	0	C	NM_003181		166580304	166580304	-1	no_errors	ENST00000296946	ensembl	human	known	69_37n	frame_shift_del	5	28.57	2	DEL	1.000	-
TAS2R3	50831	genome.wustl.edu	37	7	141464471	141464471	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:141464471C>T	ENST00000247879.2	+	1	575	c.513C>T	c.(511-513)ttC>ttT	p.F171F	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	171					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.F171F(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					CTGAACACTTCAGAAAGAAGA	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											152.0	136.0	141.0					7																	141464471		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.513C>T	7.37:g.141464471C>T			A4D1U2|Q645W2|Q75MV6	Silent	SNP	pfam_TAS2_rcpt	p.F171	ENST00000247879.2	37	c.513	CCDS5867.1	7																																																																																			TAS2R3	-	pfam_TAS2_rcpt	ENSG00000127362		0.458	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R3	HGNC	protein_coding	OTTHUMT00000349288.1	355	0.00	0	C			141464471	141464471	+1	no_errors	ENST00000247879	ensembl	human	known	69_37n	silent	283	17.97	62	SNP	0.003	T
TCEAL2	140597	genome.wustl.edu	37	X	101381908	101381908	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:101381908C>G	ENST00000372780.1	+	3	325	c.106C>G	c.(106-108)Ctg>Gtg	p.L36V	TCEAL2_ENST00000329035.2_Missense_Mutation_p.L36V	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	36					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L36V(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						AGCTTGTATTCTGGAAGACAA	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	100.0	102.0					X																	101381908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.106C>G	X.37:g.101381908C>G	ENSP00000361866:p.Leu36Val		B2R5C7	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.L36V	ENST00000372780.1	37	c.106	CCDS14496.1	X	.	.	.	.	.	.	.	.	.	.	-	11.96	1.796050	0.31777	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.23950	1.88;1.88	2.52	-0.932	0.10435	.	1.523470	0.04704	N	0.416439	T	0.22399	0.0540	L	0.36672	1.1	0.09310	N	1	B	0.31209	0.313	B	0.33521	0.165	T	0.34304	-0.9834	10	0.29301	T	0.29	.	9.472	0.38849	0.0:0.3656:0.6343:0.0	.	36	Q9H3H9	TCAL2_HUMAN	V	36	ENSP00000361866:L36V;ENSP00000332359:L36V	ENSP00000332359:L36V	L	+	1	2	TCEAL2	101268564	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.118000	0.10692	-0.307000	0.08804	0.523000	0.50628	CTG	TCEAL2	-	NULL	ENSG00000184905		0.428	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	337	0.30	1	C	NM_080390		101381908	101381908	+1	no_errors	ENST00000329035	ensembl	human	known	69_37n	missense	319	15.83	60	SNP	0.000	G
TCTN3	26123	genome.wustl.edu	37	10	97442429	97442429	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr10:97442429G>A	ENST00000371217.5	-	12	1454	c.1431C>T	c.(1429-1431)ctC>ctT	p.L477L	TCTN3_ENST00000265993.9_Silent_p.L495L|TCTN3_ENST00000430368.2_Silent_p.L329L			Q6NUS6	TECT3_HUMAN	tectonic family member 3	477					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L477L(2)|p.L299L(1)		breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		AGTGCCTGTTGAGGATCCTGG	0.438																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											165.0	160.0	162.0					10																	97442429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.1431C>T	10.37:g.97442429G>A			A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Silent	SNP	pfam_DUF1619	p.L495	ENST00000371217.5	37	c.1485	CCDS31258.2	10																																																																																			TCTN3	-	NULL	ENSG00000119977		0.438	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	TCTN3	HGNC	protein_coding	OTTHUMT00000471858.1	178	0.00	0	G	NM_015631		97442429	97442429	-1	no_errors	ENST00000371217	ensembl	human	known	69_37n	silent	163	16.84	33	SNP	0.919	A
TEKT5	146279	genome.wustl.edu	37	16	10721461	10721461	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:10721461C>T	ENST00000283025.2	-	7	1508	c.1437G>A	c.(1435-1437)ccG>ccA	p.P479P	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	479						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.P479P(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CCACCAGGCGCGGGGTGCAGG	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											60.0	60.0	60.0					16																	10721461		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1437G>A	16.37:g.10721461C>T			A1L3Z3	Silent	SNP	pfam_Tektin,prints_Tektin	p.P479	ENST00000283025.2	37	c.1437	CCDS10542.1	16																																																																																			TEKT5	-	NULL	ENSG00000153060		0.577	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	55	0.00	0	C	NM_144674		10721461	10721461	-1	no_errors	ENST00000283025	ensembl	human	known	69_37n	silent	28	40.38	21	SNP	0.172	T
TLK2	11011	genome.wustl.edu	37	17	60654101	60654101	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:60654101G>C	ENST00000326270.9	+	14	1487	c.1219G>C	c.(1219-1221)Gaa>Caa	p.E407Q	TLK2_ENST00000346027.5_Missense_Mutation_p.E385Q|TLK2_ENST00000343388.7_Missense_Mutation_p.E353Q|TLK2_ENST00000542523.1_Missense_Mutation_p.E353Q|TLK2_ENST00000582809.1_Missense_Mutation_p.E236Q	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	407					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E384Q(1)|p.E407Q(1)|p.E385Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TGAACAAGAAGAAATCTTCAA	0.333																																						dbGAP											3	Substitution - Missense(3)	breast(3)											107.0	105.0	106.0					17																	60654101		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1219G>C	17.37:g.60654101G>C	ENSP00000316512:p.Glu407Gln		D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E407Q	ENST00000326270.9	37	c.1219		17	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155519	0.57259	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.68181	-0.28;-0.31;-0.27;-0.31	5.71	5.71	0.89125	.	0.047814	0.85682	D	0.000000	D	0.84361	0.5455	M	0.87038	2.855	0.80722	D	1	P;P;B;D	0.63046	0.858;0.458;0.091;0.992	B;B;B;D	0.66716	0.371;0.391;0.28;0.946	D	0.86138	0.1579	10	0.87932	D	0	.	19.2662	0.93985	0.0:0.0:1.0:0.0	.	407;353;385;385	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Q	385;353;407;353	ENSP00000275780:E385Q;ENSP00000340800:E353Q;ENSP00000316512:E407Q;ENSP00000442311:E353Q	ENSP00000316512:E407Q	E	+	1	0	TLK2	58007833	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.869000	0.98440	0.558000	0.71614	GAA	TLK2	-	NULL	ENSG00000146872		0.333	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1	91	0.00	0	G	NM_006852		60654101	60654101	+1	no_errors	ENST00000326270	ensembl	human	known	69_37n	missense	136	13.29	21	SNP	1.000	C
TMEM89	440955	genome.wustl.edu	37	3	48658405	48658405	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:48658405G>C	ENST00000330862.3	-	2	448	c.350C>G	c.(349-351)tCa>tGa	p.S117*		NM_001008269.1	NP_001008270.1	A2RUT3	TMM89_HUMAN	transmembrane protein 89	117						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.S117*(1)		breast(1)|lung(1)|stomach(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGTGTGGTCTGAGATTGGGGC	0.622																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											75.0	64.0	68.0					3																	48658405		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AX657016	CCDS33751.1	3p21.31	2005-11-02			ENSG00000183396	ENSG00000183396			32372	protein-coding gene	gene with protein product							Standard	NM_001008269		Approved		uc011bbo.2	A2RUT3	OTTHUMG00000156647	ENST00000330862.3:c.350C>G	3.37:g.48658405G>C	ENSP00000329557:p.Ser117*			Nonsense_Mutation	SNP	NULL	p.S117*	ENST00000330862.3	37	c.350	CCDS33751.1	3	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102553	0.56183	.	.	ENSG00000183396	ENST00000330862	.	.	.	4.83	4.83	0.62350	.	0.000000	0.35407	N	0.003238	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.4412	13.298	0.60309	0.0:0.0:1.0:0.0	.	.	.	.	X	117	.	ENSP00000329557:S117X	S	-	2	0	TMEM89	48633409	1.000000	0.71417	0.999000	0.59377	0.093000	0.18481	4.287000	0.59001	2.526000	0.85167	0.563000	0.77884	TCA	TMEM89	-	NULL	ENSG00000183396		0.622	TMEM89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM89	HGNC	protein_coding	OTTHUMT00000345046.1	19	0.00	0	G	NM_001008269		48658405	48658405	-1	no_errors	ENST00000330862	ensembl	human	known	69_37n	nonsense	10	33.33	5	SNP	0.997	C
TOP2A	7153	genome.wustl.edu	37	17	38569453	38569453	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:38569453G>C	ENST00000423485.1	-	6	728	c.570C>G	c.(568-570)ttC>ttG	p.F190L		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	190					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)	p.F190L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TTGCCTGTTTGAACATTTTCT	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	81.0	86.0					17																	38569453		1830	4069	5899	-	-	-	SO:0001583	missense	0				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.570C>G	17.37:g.38569453G>C	ENSP00000411532:p.Phe190Leu		B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_ATPase-like_ATP-bd,superfamily_Topo_IIA_cen,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_CBFA/NFYB_topo	p.F190L	ENST00000423485.1	37	c.570	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	g	15.87	2.960091	0.53400	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.26373	1.74	5.52	4.54	0.55810	ATPase-like, ATP-binding domain (4);DNA topoisomerase, type IIA, subunit B/N-terminal (1);	0.049994	0.85682	D	0.000000	T	0.38772	0.1053	M	0.79475	2.455	0.54753	D	0.999982	B	0.32526	0.374	B	0.42827	0.399	T	0.30119	-0.9989	10	0.51188	T	0.08	.	11.9533	0.52966	0.138:0.0:0.862:0.0	.	190	P11388	TOP2A_HUMAN	L	190;189;189;190	ENSP00000411532:F190L	ENSP00000269577:F189L	F	-	3	2	TOP2A	35822979	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.450000	0.35134	2.617000	0.88574	0.580000	0.79431	TTC	TOP2A	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,smart_Topo_IIA	ENSG00000131747		0.328	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1	21	0.00	0	G			38569453	38569453	-1	no_errors	ENST00000423485	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	C
TPM2	7169	genome.wustl.edu	37	9	35685268	35685268	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr9:35685268C>T	ENST00000360958.2	-	5	665	c.561G>A	c.(559-561)gaG>gaA	p.E187E	TPM2_ENST00000378292.3_Silent_p.E187E|TPM2_ENST00000329305.2_Silent_p.E187E|TPM2_ENST00000378300.5_Silent_p.E187E	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)	187					muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.E187E(2)		NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATCTTTACCTCTCGGCCACCT	0.617																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											42.0	43.0	42.0					9																	35685268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.561G>A	9.37:g.35685268C>T			A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	Silent	SNP	pfam_Tropomyosin,prints_Tropomyosin	p.E187	ENST00000360958.2	37	c.561	CCDS6587.1	9																																																																																			TPM2	-	pfam_Tropomyosin,prints_Tropomyosin	ENSG00000198467		0.617	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM2	HGNC	protein_coding	OTTHUMT00000052376.1	83	0.00	0	C	NM_003289		35685268	35685268	-1	no_errors	ENST00000378300	ensembl	human	known	69_37n	silent	71	19.32	17	SNP	1.000	T
TRAPPC9	83696	genome.wustl.edu	37	8	141468516	141468517	+	5'Flank	INS	-	-	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr8:141468516_141468517insC	ENST00000438773.2	-	0	0				TRAPPC9_ENST00000389327.3_5'Flank|TRAPPC9_ENST00000389328.4_Frame_Shift_Ins_p.H50fs	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9						cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CCACGGTCGTGCCCCCCACGTG	0.743																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187		8.37:g.141468522_141468522dupC	Exception_encountered		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Frame_Shift_Ins	INS	pfam_TRAPP_II_complex_Trs120	p.H49fs	ENST00000438773.2	37	c.148_147	CCDS55278.1	8																																																																																			TRAPPC9	-	NULL	ENSG00000167632		0.743	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	10	0.00	0	-	NM_031466		141468516	141468517	-1	no_errors	ENST00000389328	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.000:0.000	C
TRIM10	10107	genome.wustl.edu	37	6	30126372	30126372	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr6:30126372G>A	ENST00000449742.2	-	3	635	c.560C>T	c.(559-561)tCt>tTt	p.S187F	TRIM10_ENST00000376704.3_Missense_Mutation_p.S187F	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	187					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.S187F(1)		ovary(1)	1						TGCGAACTCAGAAATCACCTG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											236.0	256.0	249.0					6																	30126372		1511	2709	4220	-	-	-	SO:0001583	missense	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.560C>T	6.37:g.30126372G>A	ENSP00000397073:p.Ser187Phe		A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S187F	ENST00000449742.2	37	c.560	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	G	8.262	0.811453	0.16537	.	.	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	T;T	0.04454	3.62;3.62	5.68	3.83	0.44106	.	0.284894	0.26272	N	0.025330	T	0.01905	0.0060	L	0.45422	1.42	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.11329	0.002;0.006	T	0.38714	-0.9648	10	0.54805	T	0.06	.	10.1103	0.42559	0.1741:0.0:0.8259:0.0	.	187;187	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	F	187	ENSP00000397073:S187F;ENSP00000365894:S187F	ENSP00000365894:S187F	S	-	2	0	TRIM10	30234351	0.011000	0.17503	0.875000	0.34327	0.289000	0.27227	1.449000	0.35123	1.336000	0.45506	0.643000	0.83706	TCT	TRIM10	-	NULL	ENSG00000204613		0.527	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	701	0.00	0	G			30126372	30126372	-1	no_errors	ENST00000449742	ensembl	human	known	69_37n	missense	318	32.91	157	SNP	0.077	A
TSPAN10	83882	genome.wustl.edu	37	17	79612316	79612317	+	RNA	INS	-	-	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:79612316_79612317insG	ENST00000572675.1	+	0	335_336				TSPAN10_ENST00000328585.4_RNA			Q9H1Z9	TSN10_HUMAN	tetraspanin 10						establishment of protein localization to organelle (GO:0072594)	integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)	p.L116fs*19(1)		ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GGAAGTGATCTGGGGGGGCCCC	0.683																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-			0			BC032802		17q25.3	2013-10-02			ENSG00000182612	ENSG00000182612		"""Tetraspanins"""	29942	protein-coding gene	gene with protein product	"""oculospanin"""					12107410	Standard	NM_031945		Approved	OCSP	uc010die.3	Q9H1Z9	OTTHUMG00000178037		17.37:g.79612323_79612323dupG			Q8N548	Frame_Shift_Ins	INS	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.P115fs	ENST00000572675.1	37	c.335_336		17																																																																																			TSPAN10	-	pfam_Tetraspanin/Peripherin	ENSG00000182612		0.683	TSPAN10-001	KNOWN	basic	polymorphic_pseudogene	TSPAN10	HGNC	polymorphic_pseudogene	OTTHUMT00000440313.1	21	0.00	0	-	NM_031945		79612316	79612317	+1	no_errors	ENST00000328585	ensembl	human	known	69_37n	frame_shift_ins	18	14.29	3	INS	0.000:0.002	G
TTC7A	57217	genome.wustl.edu	37	2	47249093	47249093	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:47249093C>T	ENST00000319190.5	+	12	1853	c.1485C>T	c.(1483-1485)ctC>ctT	p.L495L	TTC7A_ENST00000409245.1_Silent_p.L461L|TTC7A_ENST00000394850.2_Silent_p.L495L|TTC7A_ENST00000263737.6_Silent_p.L141L|TTC7A_ENST00000461601.1_3'UTR	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	495					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)			p.L495L(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CTCTGGGTCTCACCTATAGCC	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											82.0	78.0	79.0					2																	47249093		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.1485C>T	2.37:g.47249093C>T			Q6PIX4|Q8ND67|Q9BUS3	Silent	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L495	ENST00000319190.5	37	c.1485	CCDS33193.1	2																																																																																			TTC7A	-	smart_TPR_repeat	ENSG00000068724		0.607	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7A	HGNC	protein_coding	OTTHUMT00000329667.2	87	0.00	0	C	XM_372927		47249093	47249093	+1	no_errors	ENST00000319190	ensembl	human	known	69_37n	silent	60	15.49	11	SNP	1.000	T
TUBA1B	10376	genome.wustl.edu	37	12	49521752	49521752	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr12:49521752C>G	ENST00000336023.5	-	4	1439	c.1345G>C	c.(1345-1347)Gag>Cag	p.E449Q	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	449					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E449Q(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						TAGTATTCCTCTCCTTCTTCC	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	138.0	137.0					12																	49521752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1345G>C	12.37:g.49521752C>G	ENSP00000336799:p.Glu449Gln		P04687|P05209|Q27I68|Q8WU19	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.E449Q	ENST00000336023.5	37	c.1345	CCDS31792.1	12	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937644	0.34189	.	.	ENSG00000123416	ENST00000336023;ENST00000429203	T	0.79033	-1.23	5.45	5.45	0.79879	.	0.000000	0.45361	U	0.000366	T	0.80732	0.4679	M	0.68593	2.085	0.80722	D	1	P	0.39094	0.659	B	0.42959	0.403	T	0.82874	-0.0241	10	0.72032	D	0.01	.	18.058	0.89368	0.0:1.0:0.0:0.0	.	449	P68363	TBA1B_HUMAN	Q	449;180	ENSP00000336799:E449Q	ENSP00000336799:E449Q	E	-	1	0	TUBA1B	47808019	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	4.709000	0.61867	2.571000	0.86741	0.650000	0.86243	GAG	TUBA1B	-	NULL	ENSG00000123416		0.468	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	152	0.00	0	C	NM_006082		49521752	49521752	-1	no_errors	ENST00000336023	ensembl	human	known	69_37n	missense	76	14.61	13	SNP	1.000	G
UFD1L	7353	genome.wustl.edu	37	22	19462608	19462608	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr22:19462608G>A	ENST00000263202.10	-	3	281	c.152C>T	c.(151-153)tCg>tTg	p.S51L	UFD1L_ENST00000484101.1_5'UTR|UFD1L_ENST00000360834.4_Intron|UFD1L_ENST00000399523.1_Missense_Mutation_p.S51L	NM_001035247.2|NM_005659.6	NP_001030324.2|NP_005650.2	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1 like (yeast)	51					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			large_intestine(3)|upper_aerodigestive_tract(1)	4	Colorectal(54;0.0993)					GTCCAGGGCCGAGGGTGGCAT	0.378																																						dbGAP											0													87.0	83.0	84.0					22																	19462608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ239058	CCDS13761.1, CCDS33600.1, CCDS33600.2	22q11.2	2014-05-02	2005-10-10		ENSG00000070010	ENSG00000070010			12520	protein-coding gene	gene with protein product		601754	"""ubiquitin fusion degradation 1-like"""			9063746	Standard	NM_005659		Approved	UFD1	uc002zpm.2	Q92890	OTTHUMG00000150130	ENST00000263202.10:c.152C>T	22.37:g.19462608G>A	ENSP00000263202:p.Ser51Leu		A8MW31|Q9Y5N0	Missense_Mutation	SNP	pfam_UFD1	p.S51L	ENST00000263202.10	37	c.152	CCDS13761.1	22	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647381	0.87958	.	.	ENSG00000070010	ENST00000263202;ENST00000399523;ENST00000399525;ENST00000494054	T;T;T	0.59502	0.26;0.26;0.26	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.85164	0.5634	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89802	0.3976	10	0.87932	D	0	.	19.6396	0.95753	0.0:0.0:1.0:0.0	.	51;51;51	B4E3I3;A8MW31;Q92890	.;.;UFD1_HUMAN	L	51;51;51;46	ENSP00000263202:S51L;ENSP00000382439:S51L;ENSP00000418390:S46L	ENSP00000263202:S51L	S	-	2	0	UFD1L	17842608	1.000000	0.71417	0.992000	0.48379	0.575000	0.36095	9.199000	0.95003	2.649000	0.89929	0.650000	0.86243	TCG	UFD1L	-	pfam_UFD1	ENSG00000070010		0.378	UFD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFD1L	HGNC	protein_coding	OTTHUMT00000316460.6	182	0.55	1	G			19462608	19462608	-1	no_errors	ENST00000263202	ensembl	human	known	69_37n	missense	136	11.04	17	SNP	1.000	A
USP33	23032	genome.wustl.edu	37	1	78191440	78191440	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:78191440G>C	ENST00000370793.1	-	12	1582	c.1236C>G	c.(1234-1236)atC>atG	p.I412M	USP33_ENST00000370794.3_Missense_Mutation_p.I381M|USP33_ENST00000370792.3_Missense_Mutation_p.I412M|USP33_ENST00000357428.1_Missense_Mutation_p.I412M	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	412	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.I412M(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						GGACATCAGTGATATATTCTG	0.318																																					Melanoma(152;72 1870 11110 26780 42647)	dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	77.0	81.0					1																	78191440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1236C>G	1.37:g.78191440G>C	ENSP00000359829:p.Ile412Met		Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.S17*	ENST00000370793.1	37	c.50	CCDS678.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.730|8.730	0.916318|0.916318	0.17907|0.17907	.|.	.|.	ENSG00000077254|ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792|ENST00000481579	T;T;T;T|.	0.09630|.	2.97;2.97;2.97;2.96|.	5.51|5.51	2.46|2.46	0.29980|0.29980	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	1.060580|.	0.07187|.	N|.	0.855093|.	T|.	0.10121|.	0.0248|.	L|L	0.29908|0.29908	0.895|0.895	0.22827|0.22827	N|N	0.99868|0.99868	B;B;B|.	0.09022|.	0.0;0.0;0.002|.	B;B;B|.	0.16722|.	0.006;0.006;0.016|.	T|.	0.32322|.	-0.9911|.	10|.	0.34782|.	T|.	0.22|.	.|.	4.5931|4.5931	0.12317|0.12317	0.3864:0.1516:0.462:0.0|0.3864:0.1516:0.462:0.0	.|.	412;381;412|.	Q8TEY7-3;Q8TEY7-2;Q8TEY7|.	.;.;UBP33_HUMAN|.	M|X	381;412;412;412|17	ENSP00000359830:I381M;ENSP00000359829:I412M;ENSP00000350009:I412M;ENSP00000359828:I412M|.	ENSP00000350009:I412M|.	I|S	-|-	3|2	3|0	USP33|USP33	77964028|77964028	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	0.554000|0.554000	0.23407|0.23407	0.292000|0.292000	0.22492|0.22492	-0.143000|-0.143000	0.13931|0.13931	ATC|TCA	USP33	-	pfscan_Peptidase_C19	ENSG00000077254		0.318	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	60	0.00	0	G	NM_015017		78191440	78191440	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000481579	ensembl	human	putative	69_37n	nonsense	100	20.47	26	SNP	0.997	C
UTP23	84294	genome.wustl.edu	37	8	117784063	117784063	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr8:117784063G>A	ENST00000309822.2	+	3	833	c.732G>A	c.(730-732)caG>caA	p.Q244Q	UTP23_ENST00000357148.3_Intron|UTP23_ENST00000520733.1_Intron|UTP23_ENST00000517820.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	244					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.Q244Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						CTGAGAAGCAGAATGCAGAAG	0.328																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	65.0	63.0					8																	117784063		2138	4221	6359	-	-	-	SO:0001819	synonymous_variant	0				CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.732G>A	8.37:g.117784063G>A			B2RE25|Q96NJ8	Silent	SNP	pfam_DUF652	p.Q244	ENST00000309822.2	37	c.732	CCDS6320.1	8																																																																																			UTP23	-	NULL	ENSG00000147679		0.328	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP23	HGNC	protein_coding	OTTHUMT00000381173.1	204	0.00	0	G	NM_032334		117784063	117784063	+1	no_errors	ENST00000309822	ensembl	human	known	69_37n	silent	417	20.38	107	SNP	0.992	A
VSTM1	284415	genome.wustl.edu	37	19	54545444	54545444	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:54545444G>A	ENST00000338372.2	-	6	669	c.494C>T	c.(493-495)tCa>tTa	p.S165L	VSTM1_ENST00000376626.1_Missense_Mutation_p.S134L|VSTM1_ENST00000366170.2_Missense_Mutation_p.S77L|VSTM1_ENST00000425006.2_3'UTR	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	165					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.S165L(1)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		TTCCTCAGATGATGAACCTAC	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	149.0	148.0					19																	54545444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.494C>T	19.37:g.54545444G>A	ENSP00000343366:p.Ser165Leu		B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S165L	ENST00000338372.2	37	c.494	CCDS12872.1	19	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293784	0.23564	.	.	ENSG00000189068	ENST00000419106;ENST00000338372;ENST00000376626;ENST00000366170	T;T;T;T	0.46451	2.55;6.85;6.53;0.87	3.04	3.04	0.35103	.	0.745176	0.10464	U	0.671665	T	0.31451	0.0797	L	0.29908	0.895	0.29195	N	0.875601	P;P	0.46987	0.888;0.888	B;B	0.41571	0.36;0.36	T	0.08472	-1.0720	10	0.35671	T	0.21	-3.4481	9.8827	0.41242	0.0:0.0:1.0:0.0	.	134;165	D2DJS4;Q6UX27	.;VSTM1_HUMAN	L	55;165;134;77	ENSP00000409412:S55L;ENSP00000343366:S165L;ENSP00000365813:S134L;ENSP00000444153:S77L	ENSP00000343366:S165L	S	-	2	0	VSTM1	59237256	0.002000	0.14202	0.009000	0.14445	0.002000	0.02628	1.362000	0.34148	2.036000	0.60181	0.543000	0.68304	TCA	VSTM1	-	NULL	ENSG00000189068		0.493	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM1	HGNC	protein_coding	OTTHUMT00000139358.3	245	0.00	0	G	NM_198481		54545444	54545444	-1	no_errors	ENST00000338372	ensembl	human	known	69_37n	missense	166	15.74	31	SNP	0.012	A
WDR43	23160	genome.wustl.edu	37	2	29152515	29152515	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:29152515C>T	ENST00000407426.3	+	11	1432	c.1376C>T	c.(1375-1377)aCg>aTg	p.T459M	Y_RNA_ENST00000410292.1_RNA|SNORD53_SNORD92_ENST00000577887.1_RNA|SNORD53_ENST00000579969.1_RNA	NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	459						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T502M(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					GACCTCCAGACGAATAGCTTT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	109.0	110.0					2																	29152515		1834	4096	5930	-	-	-	SO:0001583	missense	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1376C>T	2.37:g.29152515C>T	ENSP00000384302:p.Thr459Met		Q15395|Q92577	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T459M	ENST00000407426.3	37	c.1376	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	C	14.40	2.525409	0.44969	.	.	ENSG00000163811	ENST00000407426	T	0.75704	-0.96	5.81	4.94	0.65067	.	0.146333	0.64402	N	0.000009	T	0.67353	0.2884	M	0.65975	2.015	0.50467	D	0.999879	P	0.37525	0.598	B	0.21917	0.037	T	0.71076	-0.4697	10	0.66056	D	0.02	-8.4749	12.1851	0.54234	0.0:0.8621:0.0:0.1378	.	459	Q15061	WDR43_HUMAN	M	459	ENSP00000384302:T459M	ENSP00000384302:T459M	T	+	2	0	WDR43	29006019	0.992000	0.36948	0.890000	0.34922	0.890000	0.51754	3.080000	0.50112	1.459000	0.47892	0.655000	0.94253	ACG	WDR43	-	NULL	ENSG00000163811		0.353	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	106	0.00	0	C	XM_087089		29152515	29152515	+1	no_errors	ENST00000407426	ensembl	human	known	69_37n	missense	106	39.55	70	SNP	0.961	T
WDR82	80335	genome.wustl.edu	37	3	52291511	52291511	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:52291511C>A	ENST00000296490.3	-	9	1218	c.937G>T	c.(937-939)Gac>Tac	p.D313Y		NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	313					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)	p.D313Y(1)							BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		CAGGGTCAGTCATCAATGGTG	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	97.0	98.0					3																	52291511		1940	4139	6079	-	-	-	SO:0001583	missense	0			AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.937G>T	3.37:g.52291511C>A	ENSP00000296490:p.Asp313Tyr		A8K5R5|Q8TEB2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D313Y	ENST00000296490.3	37	c.937	CCDS2851.2	3	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547030	0.86022	.	.	ENSG00000164091	ENST00000296490	T	0.67171	-0.25	5.62	5.62	0.85841	WD40-repeat-containing domain (1);	0.315153	0.37906	N	0.001891	T	0.74160	0.3680	L	0.47716	1.5	0.50813	D	0.999893	D	0.62365	0.991	P	0.55577	0.779	T	0.76340	-0.2995	10	0.87932	D	0	.	19.2378	0.93867	0.0:1.0:0.0:0.0	.	313	Q6UXN9	WDR82_HUMAN	Y	313	ENSP00000296490:D313Y	ENSP00000296490:D313Y	D	-	1	0	WDR82	52266551	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.331000	0.79192	2.653000	0.90120	0.555000	0.69702	GAC	WDR82	-	pfscan_WD40_repeat_dom	ENSG00000164091		0.473	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR82	HGNC	protein_coding	OTTHUMT00000317919.1	118	0.00	0	C	NM_025222		52291511	52291511	-1	no_errors	ENST00000296490	ensembl	human	known	69_37n	missense	63	23.17	19	SNP	1.000	A
WDR82	80335	genome.wustl.edu	37	3	52293748	52293748	+	Silent	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:52293748C>T	ENST00000296490.3	-	6	965	c.684G>A	c.(682-684)gtG>gtA	p.V228V		NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	228					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)	p.V228V(1)							BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		ATGTGTGCATCACCACTCCTT	0.463																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											259.0	248.0	252.0					3																	52293748		2037	4186	6223	-	-	-	SO:0001819	synonymous_variant	0			AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.684G>A	3.37:g.52293748C>T			A8K5R5|Q8TEB2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V228	ENST00000296490.3	37	c.684	CCDS2851.2	3																																																																																			WDR82	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000164091		0.463	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR82	HGNC	protein_coding	OTTHUMT00000317919.1	446	0.00	0	C	NM_025222		52293748	52293748	-1	no_errors	ENST00000296490	ensembl	human	known	69_37n	silent	346	20.82	91	SNP	0.998	T
CFAP44	55779	genome.wustl.edu	37	3	113098205	113098205	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr3:113098205G>T	ENST00000295868.2	-	17	2408	c.2246C>A	c.(2245-2247)tCt>tAt	p.S749Y	WDR52_ENST00000393845.2_Missense_Mutation_p.S749Y|WDR52_ENST00000475568.1_5'Flank	NM_018338.3	NP_060808.2												p.S749Y(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						GAGGATGGGAGAGGGGGTTGA	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	70.0	69.0					3																	113098205		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295868.2:c.2246C>A	3.37:g.113098205G>T	ENSP00000295868:p.Ser749Tyr			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S749Y	ENST00000295868.2	37	c.2246	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	G	16.54	3.153045	0.57259	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.18960	2.18;2.18	5.42	3.62	0.41486	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.29321	0.0730	L	0.47716	1.5	0.80722	D	1	D	0.57257	0.979	P	0.50490	0.642	T	0.05209	-1.0899	9	0.56958	D	0.05	.	16.0347	0.80617	0.0:0.7963:0.2036:0.0	.	749	Q96MT7	WDR52_HUMAN	Y	749	ENSP00000377428:S749Y;ENSP00000295868:S749Y	ENSP00000295868:S749Y	S	-	2	0	WDR52	114580895	1.000000	0.71417	0.173000	0.22940	0.785000	0.44390	3.285000	0.51716	0.842000	0.35045	0.563000	0.77884	TCT	WDR52	-	superfamily_WD40_repeat_dom	ENSG00000206530		0.403	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	299	0.00	0	G			113098205	113098205	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	missense	454	27.55	173	SNP	0.889	T
WWOX	51741	genome.wustl.edu	37	16	78458774	78458774	+	Missense_Mutation	SNP	C	C	T	rs74860463	byFrequency	TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:78458774C>T	ENST00000566780.1	+	7	979	c.613C>T	c.(613-615)Cat>Tat	p.H205Y	WWOX_ENST00000406884.2_Intron|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000402655.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.H205Y	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	205	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CAGGCCTCTTCATGTGCTTGT	0.458																																						dbGAP											0													314.0	322.0	320.0					16																	78458774		1936	4135	6071	-	-	-	SO:0001583	missense	0			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.613C>T	16.37:g.78458774C>T	ENSP00000457230:p.His205Tyr		A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP,prints_Glc/ribitol_DH	p.H205Y	ENST00000566780.1	37	c.613	CCDS42196.1	16	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963939	0.53507	.	.	ENSG00000186153	ENST00000408984;ENST00000299644	T	0.22539	1.95	5.35	5.35	0.76521	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	M	0.71296	2.17	0.58432	D	0.999998	D	0.69078	0.997	D	0.67231	0.95	T	0.48456	-0.9034	10	0.87932	D	0	.	19.0641	0.93103	0.0:1.0:0.0:0.0	.	205	Q9NZC7	WWOX_HUMAN	Y	205;48	ENSP00000386161:H205Y	ENSP00000299644:H48Y	H	+	1	0	WWOX	77016275	1.000000	0.71417	0.996000	0.52242	0.447000	0.32167	7.484000	0.81180	2.479000	0.83701	0.655000	0.94253	CAT	WWOX	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	ENSG00000186153		0.458	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	483	0.00	0	C			78458774	78458774	+1	no_errors	ENST00000566780	ensembl	human	known	69_37n	missense	309	23.51	95	SNP	1.000	T
ZC3H18	124245	genome.wustl.edu	37	16	88691140	88691141	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:88691140_88691141insC	ENST00000301011.5	+	12	2229_2230	c.2029_2030insC	c.(2029-2031)accfs	p.T677fs	ZC3H18_ENST00000452588.2_Frame_Shift_Ins_p.T701fs	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	677	Ser-rich.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R680fs*5(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GCCAGCCAGGACCCCCCCCAGG	0.663																																					Ovarian(121;375 2276 20373 38669)	dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2037dupC	16.37:g.88691148_88691148dupC	ENSP00000301011:p.Thr677fs		Q96DG4|Q96MP7	Frame_Shift_Ins	INS	smart_Znf_CCCH	p.R680fs	ENST00000301011.5	37	c.2029_2030	CCDS10967.1	16																																																																																			ZC3H18	-	NULL	ENSG00000158545		0.663	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1	10	0.00	0	-	NM_144604		88691140	88691141	+1	no_errors	ENST00000301011	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.978:0.568	C
ZC3H7A	29066	genome.wustl.edu	37	16	11868331	11868331	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:11868331G>A	ENST00000396516.2	-	8	861	c.664C>T	c.(664-666)Ccg>Tcg	p.P222S	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.P222S|ZC3H7A_ENST00000575170.1_5'Flank			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	222						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P222S(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CTGGGTGCCGGTAAAGAGACA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	87.0	88.0					16																	11868331		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.664C>T	16.37:g.11868331G>A	ENSP00000379773:p.Pro222Ser		D3DUG5|Q9NPE9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P222S	ENST00000396516.2	37	c.664	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708716	0.48517	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.09911	2.93;2.93	5.97	5.01	0.66863	.	0.373337	0.30593	N	0.009296	T	0.06462	0.0166	N	0.16037	0.36	0.34664	D	0.722983	B	0.10296	0.003	B	0.08055	0.003	T	0.20672	-1.0268	10	0.30854	T	0.27	.	9.5872	0.39524	0.15:0.0:0.85:0.0	.	222	Q8IWR0	Z3H7A_HUMAN	S	222	ENSP00000347999:P222S;ENSP00000379773:P222S	ENSP00000347999:P222S	P	-	1	0	ZC3H7A	11775832	0.483000	0.25956	0.489000	0.27452	0.890000	0.51754	1.696000	0.37773	2.835000	0.97688	0.591000	0.81541	CCG	ZC3H7A	-	NULL	ENSG00000122299		0.418	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	HGNC	protein_coding	OTTHUMT00000437066.1	153	0.00	0	G	NM_014153		11868331	11868331	-1	no_errors	ENST00000355758	ensembl	human	known	69_37n	missense	210	11.39	27	SNP	0.253	A
ZCCHC5	203430	genome.wustl.edu	37	X	77913174	77913174	+	Silent	SNP	G	G	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:77913174G>T	ENST00000321110.1	-	2	1039	c.744C>A	c.(742-744)tcC>tcA	p.S248S		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	248							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S248S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GAAGCTTCTGGGAATCTCCAC	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											26.0	24.0	25.0					X																	77913174		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.744C>A	X.37:g.77913174G>T			B2RMZ0|Q5JQE9	Silent	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.S248	ENST00000321110.1	37	c.744	CCDS14440.1	X																																																																																			ZCCHC5	-	NULL	ENSG00000179300		0.493	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC5	HGNC	protein_coding	OTTHUMT00000057319.1	57	0.00	0	G	NM_152694		77913174	77913174	-1	no_errors	ENST00000321110	ensembl	human	known	69_37n	silent	91	15.74	17	SNP	0.000	T
ZFHX3	463	genome.wustl.edu	37	16	72830478	72830478	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:72830478G>A	ENST00000268489.5	-	9	6775	c.6103C>T	c.(6103-6105)Cag>Tag	p.Q2035*	ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.Q1121*	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2035					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q2035*(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TCTGGGGTCTGGGGCCTCAGT	0.597																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											57.0	63.0	61.0					16																	72830478		2196	4298	6494	-	-	-	SO:0001587	stop_gained	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6103C>T	16.37:g.72830478G>A	ENSP00000268489:p.Gln2035*		D3DWS8|O15101|Q13719	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Q2035*	ENST00000268489.5	37	c.6103	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	48	14.723159	0.99807	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	.	.	.	5.64	5.64	0.86602	.	0.000000	0.38778	N	0.001566	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	19.7094	0.96085	0.0:0.0:1.0:0.0	.	.	.	.	X	2035;1121	.	ENSP00000268489:Q2035X	Q	-	1	0	ZFHX3	71387979	1.000000	0.71417	1.000000	0.80357	0.462000	0.32619	5.619000	0.67729	2.639000	0.89480	0.655000	0.94253	CAG	ZFHX3	-	superfamily_Adenylate_cyclase-assoc_CAP_N	ENSG00000140836		0.597	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	175	0.00	0	G	NM_006885		72830478	72830478	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	nonsense	84	25.00	28	SNP	0.998	A
ZNF208	7757	genome.wustl.edu	37	19	22154006	22154006	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr19:22154006C>G	ENST00000397126.4	-	4	3978	c.3830G>C	c.(3829-3831)gGa>gCa	p.G1277A	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G1149A(2)|p.G1277A(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GAGTTTCTCTCCAGTATGAAT	0.378																																						dbGAP											3	Substitution - Missense(3)	breast(3)											29.0	31.0	31.0					19																	22154006		2049	4219	6268	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3830G>C	19.37:g.22154006C>G	ENSP00000380315:p.Gly1277Ala			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G1277A	ENST00000397126.4	37	c.3830	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	8.660	0.900287	0.17686	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06687	3.27	2.58	0.0718	0.14384	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06600	0.0169	.	.	.	0.24556	N	0.993993	D	0.55605	0.972	B	0.40782	0.34	T	0.34204	-0.9838	8	0.38643	T	0.18	.	7.6316	0.28243	0.18:0.6447:0.1753:0.0	.	1149	O43345	ZN208_HUMAN	A	1277;1149	ENSP00000380315:G1277A	ENSP00000380315:G1277A	G	-	2	0	ZNF208	21945846	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.201000	0.17276	-0.498000	0.06632	-1.624000	0.00789	GGA	ZNF208	-	pfscan_Znf_C2H2	ENSG00000160321		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	217	0.00	0	C	NM_007153		22154006	22154006	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	310	16.22	60	SNP	1.000	G
ZNF23	7571	genome.wustl.edu	37	16	71482893	71482893	+	Silent	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr16:71482893G>A	ENST00000393539.2	-	6	1848	c.1035C>T	c.(1033-1035)ttC>ttT	p.F345F	ZNF23_ENST00000357254.4_Silent_p.F345F|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000417828.1_Silent_p.F345F|ZNF23_ENST00000539742.1_5'UTR|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000564528.1_Silent_p.F287F|ZNF23_ENST00000428724.2_Silent_p.F287F|ZNF23_ENST00000358700.2_3'UTR	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		AGCTGCACCTGAAGCCTTTTC	0.403																																						dbGAP											0													61.0	57.0	59.0					16																	71482893		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1035C>T	16.37:g.71482893G>A			Q8NDP5|Q96IT3|Q9UG42	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F345	ENST00000393539.2	37	c.1035	CCDS10900.1	16																																																																																			ZNF23	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167377		0.403	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF23	HGNC	protein_coding	OTTHUMT00000268985.23	253	0.39	1	G	NM_145911		71482893	71482893	-1	no_errors	ENST00000357254	ensembl	human	known	69_37n	silent	156	10.86	19	SNP	1.000	A
ZNF750	79755	genome.wustl.edu	37	17	80789153	80789153	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr17:80789153C>T	ENST00000269394.3	-	2	2011	c.1178G>A	c.(1177-1179)aGa>aAa	p.R393K	TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_5'UTR|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	393					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R393K(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TTCCGTGTCTCTCTGCCCAGC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	77.0	76.0					17																	80789153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1178G>A	17.37:g.80789153C>T	ENSP00000269394:p.Arg393Lys		Q9H899	Missense_Mutation	SNP	NULL	p.R393K	ENST00000269394.3	37	c.1178	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	C	6.879	0.531546	0.13127	.	.	ENSG00000141579	ENST00000269394	T	0.12984	2.63	4.4	1.94	0.25998	.	0.354168	0.26623	N	0.023349	T	0.13329	0.0323	M	0.63428	1.95	0.80722	D	1	P	0.37500	0.597	B	0.37888	0.26	T	0.04495	-1.0947	9	.	.	.	-27.7993	6.2679	0.20939	0.0:0.6529:0.0:0.3471	.	393	Q32MQ0	ZN750_HUMAN	K	393	ENSP00000269394:R393K	.	R	-	2	0	ZNF750	78382442	0.977000	0.34250	0.916000	0.36221	0.175000	0.22909	1.860000	0.39428	0.988000	0.38734	-0.253000	0.11424	AGA	ZNF750	-	NULL	ENSG00000141579		0.602	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	84	0.00	0	C	NM_024702		80789153	80789153	-1	no_errors	ENST00000269394	ensembl	human	known	69_37n	missense	98	10.91	12	SNP	0.982	T
ZNRF2	223082	genome.wustl.edu	37	7	30363299	30363299	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr7:30363299G>A	ENST00000323037.4	+	2	1562	c.511G>A	c.(511-513)Gaa>Aaa	p.E171K		NM_147128.3	NP_667339.1	Q8NHG8	ZNRF2_HUMAN	zinc and ring finger 2	171						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E171K(1)		breast(1)|endometrium(1)|lung(2)|prostate(1)	5						ATCCTCAGATGAAATGGATTT	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	135.0	133.0					7																	30363299		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF513707	CCDS5426.1	7p15.1	2013-01-09			ENSG00000180233	ENSG00000180233		"""RING-type (C3HC4) zinc fingers"""	22316	protein-coding gene	gene with protein product		612061					Standard	NM_147128		Approved	RNF202	uc003tat.3	Q8NHG8	OTTHUMG00000097759	ENST00000323037.4:c.511G>A	7.37:g.30363299G>A	ENSP00000323879:p.Glu171Lys			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E171K	ENST00000323037.4	37	c.511	CCDS5426.1	7	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274047	0.80580	.	.	ENSG00000180233	ENST00000323037;ENST00000319243	T	0.52295	0.67	5.86	5.86	0.93980	.	0.000000	0.64402	U	0.000003	T	0.48409	0.1498	L	0.55990	1.75	0.58432	D	0.999999	B	0.28998	0.23	B	0.30646	0.118	T	0.43814	-0.9368	10	0.52906	T	0.07	-10.8507	17.6924	0.88272	0.0:0.0:1.0:0.0	.	171	Q8NHG8	ZNRF2_HUMAN	K	171;109	ENSP00000323879:E171K	ENSP00000326497:E109K	E	+	1	0	ZNRF2	30329824	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	8.599000	0.90856	2.781000	0.95711	0.650000	0.86243	GAA	ZNRF2	-	NULL	ENSG00000180233		0.294	ZNRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF2	HGNC	protein_coding	OTTHUMT00000214992.1	164	0.00	0	G	NM_147128		30363299	30363299	+1	no_errors	ENST00000323037	ensembl	human	known	69_37n	missense	249	16.16	48	SNP	1.000	A
ZRANB3	84083	genome.wustl.edu	37	2	136103162	136103162	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr2:136103162C>T	ENST00000264159.6	-	6	751	c.635G>A	c.(634-636)aGa>aAa	p.R212K	ZRANB3_ENST00000536680.1_Missense_Mutation_p.R212K|ZRANB3_ENST00000401392.1_Missense_Mutation_p.R212K	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	212	DNA annealing helicase activity.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.R212K(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTCGGTCCATCTTCCAAATTT	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	103.0	106.0					2																	136103162		1816	4072	5888	-	-	-	SO:0001583	missense	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.635G>A	2.37:g.136103162C>T	ENSP00000264159:p.Arg212Lys		B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R212K	ENST00000264159.6	37	c.635	CCDS46419.1	2	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732124	0.48939	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	D;D;D	0.92545	-3.06;-3.06;-3.06	5.04	4.16	0.48862	SNF2-related (1);	0.142450	0.64402	N	0.000006	D	0.82342	0.5016	N	0.03115	-0.41	0.28062	N	0.932938	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.005;0.006;0.004	T	0.73353	-0.4009	10	0.44086	T	0.13	-3.8175	15.5939	0.76562	0.0:0.1442:0.8558:0.0	.	152;212;212	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	K	212;212;212;152	ENSP00000383979:R212K;ENSP00000264159:R212K;ENSP00000441320:R212K	ENSP00000264159:R212K	R	-	2	0	ZRANB3	135819632	1.000000	0.71417	0.998000	0.56505	0.842000	0.47809	5.470000	0.66756	1.241000	0.43820	-0.357000	0.07601	AGA	ZRANB3	-	pfam_SNF2_N	ENSG00000121988		0.294	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1	41	0.00	0	C	NM_032143		136103162	136103162	-1	no_errors	ENST00000264159	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	T
ZXDB	158586	genome.wustl.edu	37	X	57620855	57620855	+	Missense_Mutation	SNP	G	G	C	rs12845530		TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chrX:57620855G>C	ENST00000374888.1	+	1	2587	c.2374G>C	c.(2374-2376)Gat>Cat	p.D792H		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	792					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						GAAAGAAACAGATCTTATCAC	0.418																																						dbGAP											0													176.0	159.0	165.0					X																	57620855		2203	4300	6503	-	-	-	SO:0001583	missense	0			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.2374G>C	X.37:g.57620855G>C	ENSP00000364023:p.Asp792His		A8K151|Q9UBB3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D792H	ENST00000374888.1	37	c.2374	CCDS35313.1	X	.	.	.	.	.	.	.	.	.	.	.	13.95	2.391301	0.42410	.	.	ENSG00000198455	ENST00000374888	T	0.14766	2.48	3.84	2.97	0.34412	.	0.106709	0.64402	D	0.000006	T	0.15435	0.0372	L	0.48642	1.525	0.53005	D	0.999966	P	0.38250	0.624	B	0.42851	0.4	T	0.02226	-1.1192	10	0.72032	D	0.01	.	8.6359	0.33948	0.1189:0.0:0.8811:0.0	.	792	P98169	ZXDB_HUMAN	H	792	ENSP00000364023:D792H	ENSP00000364023:D792H	D	+	1	0	ZXDB	57637580	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	5.974000	0.70465	0.786000	0.33708	-0.297000	0.09499	GAT	ZXDB	-	NULL	ENSG00000198455		0.418	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	178	0.00	0	G	NM_007157		57620855	57620855	+1	no_errors	ENST00000374888	ensembl	human	known	69_37n	missense	172	10.36	20	SNP	0.999	C
ZZZ3	26009	genome.wustl.edu	37	1	78034122	78034122	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CX-01A-21W-A019-09	TCGA-A2-A0CX-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	975adb76-3561-41a0-959a-68da470816c7	dd43a88d-fd04-4ce4-8bac-1478975304aa	g.chr1:78034122C>G	ENST00000370801.3	-	13	2836	c.2361G>C	c.(2359-2361)agG>agC	p.R787S	ZZZ3_ENST00000370798.1_Missense_Mutation_p.R293S|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	787					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R787S(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CAGGTAAATTCCTATACATGA	0.284																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	58.0	58.0					1																	78034122		2202	4297	6499	-	-	-	SO:0001583	missense	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2361G>C	1.37:g.78034122C>G	ENSP00000359837:p.Arg787Ser		B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.R787S	ENST00000370801.3	37	c.2361	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378532	0.61735	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	.	.	.	5.51	2.63	0.31362	.	0.053271	0.64402	D	0.000001	T	0.44829	0.1312	L	0.50333	1.59	0.50467	D	0.99987	P;D;D	0.76494	0.728;0.993;0.999	B;P;D	0.63283	0.366;0.738;0.913	T	0.49725	-0.8909	9	0.72032	D	0.01	.	3.7341	0.08504	0.2566:0.4052:0.0:0.3382	.	293;787;786	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	S	787;293	.	ENSP00000359834:R293S	R	-	3	2	ZZZ3	77806710	0.995000	0.38212	1.000000	0.80357	0.914000	0.54420	0.290000	0.18975	0.379000	0.24794	0.650000	0.86243	AGG	ZZZ3	-	NULL	ENSG00000036549		0.284	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	84	0.00	0	C	NM_015534		78034122	78034122	-1	no_errors	ENST00000370801	ensembl	human	known	69_37n	missense	71	15.48	13	SNP	0.997	G
