#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APOB	338	genome.wustl.edu	37	2	21260974	21260974	+	Silent	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr2:21260974G>A	ENST00000233242.1	-	5	520	c.393C>T	c.(391-393)ctC>ctT	p.L131L	APOB_ENST00000399256.4_Silent_p.L131L	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	131	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCCAGCTTGAGCTCATACC	0.483																																						dbGAP											0													74.0	70.0	71.0					2																	21260974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.393C>T	2.37:g.21260974G>A			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L131	ENST00000233242.1	37	c.393	CCDS1703.1	2																																																																																			APOB	-	pfam_Lipid_transpt_N,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000084674		0.483	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	174	0.00	0	G			21260974	21260974	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	silent	80	23.08	24	SNP	0.999	A
ATP1A3	478	genome.wustl.edu	37	19	42471431	42471431	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr19:42471431G>A	ENST00000302102.5	-	22	3133	c.2983C>T	c.(2983-2985)Cgc>Tgc	p.R995C	ATP1A3_ENST00000602133.1_Missense_Mutation_p.R965C|ATP1A3_ENST00000543770.1_Missense_Mutation_p.R1006C|ATP1A3_ENST00000545399.1_Missense_Mutation_p.R1008C	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	995					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.R995C(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						ATGAGTTTGCGGATTTCGTCG	0.662																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											40.0	41.0	41.0					19																	42471431		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2983C>T	19.37:g.42471431G>A	ENSP00000302397:p.Arg995Cys		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.R1008C	ENST00000302102.5	37	c.3022	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993934	0.74703	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770	D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99	3.32	2.16	0.27623	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98732	0.9574	H	0.99286	4.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	D	0.97478	1.0045	10	0.87932	D	0	.	9.5421	0.39257	0.0:0.0:0.7902:0.2098	.	1008;1006;995;995	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	C	995;995;1008;965;1006	ENSP00000302397:R995C;ENSP00000411503:R995C;ENSP00000444688:R1008C;ENSP00000437577:R1006C	ENSP00000302397:R995C	R	-	1	0	ATP1A3	47163271	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.305000	0.59110	1.887000	0.54652	0.462000	0.41574	CGC	ATP1A3	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000105409		0.662	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	57	0.00	0	G	NM_152296		42471431	42471431	-1	no_errors	ENST00000545399	ensembl	human	known	69_37n	missense	42	46.15	36	SNP	1.000	A
CTTNBP2	83992	genome.wustl.edu	37	7	117398014	117398014	+	Silent	SNP	C	C	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr7:117398014C>T	ENST00000160373.3	-	11	3274	c.3183G>A	c.(3181-3183)ccG>ccA	p.P1061P		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1061					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCACTGACCACGGCACATTTC	0.448																																						dbGAP											0													62.0	51.0	54.0					7																	117398014		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3183G>A	7.37:g.117398014C>T			O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	NULL	p.R75H	ENST00000160373.3	37	c.224	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.967|1.967	-0.437427|-0.437427	0.04636|0.04636	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000435233;ENST00000416239|ENST00000446636	.|.	.|.	.|.	5.73|5.73	-11.5|-11.5	0.00074|0.00074	.|.	.|.	.|.	.|.	.|.	T|T	0.47838|0.47838	0.1467|0.1467	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.63033|0.63033	-0.6727|-0.6727	4|4	.|.	.|.	.|.	-4.8781|-4.8781	10.2075|10.2075	0.43122|0.43122	0.1456:0.5724:0.0739:0.2081|0.1456:0.5724:0.0739:0.2081	.|.	.|.	.|.	.|.	H|M	75;57|549	.|.	.|.	R|V	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117185250|117185250	0.000000|0.000000	0.05858|0.05858	0.030000|0.030000	0.17652|0.17652	0.309000|0.309000	0.27889|0.27889	-5.485000|-5.485000	0.00118|0.00118	-3.051000|-3.051000	0.00260|0.00260	-0.238000|-0.238000	0.12139|0.12139	CGT|GTG	CTTNBP2	-	NULL	ENSG00000077063		0.448	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	182	0.55	1	C	NM_033427		117398014	117398014	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000435233	ensembl	human	novel	69_37n	missense	67	12.99	10	SNP	0.003	T
DHRS2	10202	genome.wustl.edu	37	14	24112421	24112421	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr14:24112421G>T	ENST00000250383.6	+	5	957	c.481G>T	c.(481-483)Gag>Tag	p.E161*	DHRS2_ENST00000344777.7_Nonsense_Mutation_p.E161*	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	161					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		GCCCTACATGGAGAACAGGTA	0.582																																						dbGAP											0													139.0	137.0	138.0					14																	24112421		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.481G>T	14.37:g.24112421G>T	ENSP00000250383:p.Glu161*		D3DS54|Q53GS4|Q7Z789|Q9H2R2	Nonsense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.E161*	ENST00000250383.6	37	c.481	CCDS9604.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.575961|5.575961	0.96553|0.96553	.|.	.|.	ENSG00000100867|ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777;ENST00000553600|ENST00000557535	.|.	.|.	.|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.234355|.	0.42294|.	D|.	0.000722|.	.|T	.|0.55081	.|0.1898	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63646	.|-0.6590	.|3	0.05833|.	T|.	0.94|.	.|.	11.0392|11.0392	0.47820|0.47820	0.0:0.1884:0.8116:0.0|0.0:0.1884:0.8116:0.0	.|.	.|.	.|.	.|.	X|V	161;161;161;61|76	.|.	ENSP00000250383:E161X|.	E|G	+|+	1|2	0|0	DHRS2|DHRS2	23182261|23182261	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.574000|0.574000	0.36063|0.36063	4.151000|4.151000	0.58105|0.58105	2.533000|2.533000	0.85409|0.85409	0.563000|0.563000	0.77884|0.77884	GAG|GGA	DHRS2	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	ENSG00000100867		0.582	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHRS2	HGNC	protein_coding	OTTHUMT00000071842.2	38	0.00	0	G	NM_182908		24112421	24112421	+1	no_errors	ENST00000344777	ensembl	human	known	69_37n	nonsense	33	55.41	41	SNP	1.000	T
DNM3	26052	genome.wustl.edu	37	1	172376937	172376937	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr1:172376937C>T	ENST00000355305.5	+	21	2723	c.2566C>T	c.(2566-2568)Cgt>Tgt	p.R856C	DNM3_ENST00000367731.1_Missense_Mutation_p.R846C|PIGC_ENST00000484368.1_Intron|DNM3_ENST00000358155.4_Missense_Mutation_p.R850C			Q9UQ16	DYN3_HUMAN	dynamin 3	856					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R850S(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ATCACCAACTCGTCCCACTAT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											211.0	207.0	208.0					1																	172376937		1856	4105	5961	-	-	-	SO:0001583	missense	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2566C>T	1.37:g.172376937C>T	ENSP00000347457:p.Arg856Cys		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.R850C	ENST00000355305.5	37	c.2548		1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.768945	0.69878	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731	T;T;T	0.53423	0.62;0.62;0.62	5.83	5.83	0.93111	.	0.321128	0.30820	N	0.008806	T	0.62159	0.2405	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.64198	-0.6464	10	0.87932	D	0	.	16.8531	0.85999	0.0:1.0:0.0:0.0	.	846;850	Q9UQ16-2;Q9UQ16-3	.;.	C	860;850;856;846	ENSP00000350876:R850C;ENSP00000347457:R856C;ENSP00000356705:R846C	ENSP00000347457:R856C	R	+	1	0	DNM3	170643560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.845000	0.62853	2.770000	0.95276	0.655000	0.94253	CGT	DNM3	-	NULL	ENSG00000197959		0.418	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	591	0.00	0	C	NM_015569		172376937	172376937	+1	no_errors	ENST00000358155	ensembl	human	known	69_37n	missense	932	12.05	128	SNP	1.000	T
DPYS	1807	genome.wustl.edu	37	8	105463599	105463599	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr8:105463599C>G	ENST00000351513.2	-	2	430	c.298G>C	c.(298-300)Gat>Cat	p.D100H		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	100					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATGGCGAAATCAATAATCATG	0.458																																						dbGAP											0													87.0	81.0	83.0					8																	105463599		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.298G>C	8.37:g.105463599C>G	ENSP00000276651:p.Asp100His			Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.D100H	ENST00000351513.2	37	c.298	CCDS6302.1	8	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683288	0.68157	.	.	ENSG00000147647	ENST00000351513	D	0.91996	-2.95	5.5	5.5	0.81552	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.97788	0.9274	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98567	1.0644	10	0.87932	D	0	-30.7756	19.5916	0.95514	0.0:1.0:0.0:0.0	.	100	Q14117	DPYS_HUMAN	H	100	ENSP00000276651:D100H	ENSP00000276651:D100H	D	-	1	0	DPYS	105532775	1.000000	0.71417	0.974000	0.42286	0.542000	0.35054	7.320000	0.79064	2.861000	0.98227	0.655000	0.94253	GAT	DPYS	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000147647		0.458	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYS	HGNC	protein_coding	OTTHUMT00000380814.1	190	0.00	0	C	NM_001385		105463599	105463599	-1	no_errors	ENST00000351513	ensembl	human	known	69_37n	missense	56	54.10	66	SNP	1.000	G
GAREM	64762	genome.wustl.edu	37	18	29867436	29867436	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr18:29867436G>A	ENST00000269209.6	-	4	1127	c.1124C>T	c.(1123-1125)gCc>gTc	p.A375V	GAREM_ENST00000578619.1_5'Flank|RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000399218.4_Missense_Mutation_p.A375V			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	375					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CTCATCGCGGGCGTAGCTGAG	0.562																																						dbGAP											0													101.0	98.0	99.0					18																	29867436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1124C>T	18.37:g.29867436G>A	ENSP00000269209:p.Ala375Val		Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	superfamily_SAM/pointed	p.A375V	ENST00000269209.6	37	c.1124	CCDS56057.1	18	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904573	0.92035	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.20598	2.06;2.06	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.40067	0.1102	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.967	D;P	0.80764	0.994;0.761	T	0.11966	-1.0566	10	0.72032	D	0.01	-24.3933	19.8519	0.96744	0.0:0.0:1.0:0.0	.	375;375	Q9H706;Q9H706-3	FA59A_HUMAN;.	V	375	ENSP00000382165:A375V;ENSP00000269209:A375V	ENSP00000269209:A375V	A	-	2	0	FAM59A	28121434	1.000000	0.71417	0.962000	0.40283	0.791000	0.44710	9.357000	0.97099	2.774000	0.95407	0.561000	0.74099	GCC	FAM59A	-	NULL	ENSG00000141441		0.562	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM59A	HGNC	protein_coding	OTTHUMT00000255365.1	256	0.00	0	G	NM_022751		29867436	29867436	-1	no_errors	ENST00000269209	ensembl	human	known	69_37n	missense	166	12.04	23	SNP	1.000	A
FANCB	2187	genome.wustl.edu	37	X	14871234	14871235	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chrX:14871234_14871235insT	ENST00000324138.3	-	5	1405_1406	c.1252_1253insA	c.(1252-1254)attfs	p.I418fs	FANCB_ENST00000398334.1_Frame_Shift_Ins_p.I418fs	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	418					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TTTTGAAATAATTTTTTCCTTA	0.312								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1253dupA	X.37:g.14871240_14871240dupT	ENSP00000326819:p.Ile418fs		B2RMZ4|Q7Z2U2|Q86XG1	Frame_Shift_Ins	INS	NULL	p.I418fs	ENST00000324138.3	37	c.1253_1252	CCDS14161.1	X																																																																																			FANCB	-	NULL	ENSG00000181544		0.312	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	212	0.00	0	-	NM_152633		14871234	14871235	-1	no_errors	ENST00000324138	ensembl	human	known	69_37n	frame_shift_ins	160	21.95	45	INS	0.859:0.810	T
FBXO30	84085	genome.wustl.edu	37	6	146126058	146126058	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr6:146126058G>A	ENST00000237281.4	-	2	1650	c.1484C>T	c.(1483-1485)cCg>cTg	p.P495L		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	495							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TGTCTGAAACGGACTTGGATT	0.433																																						dbGAP											0													88.0	82.0	84.0					6																	146126058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1484C>T	6.37:g.146126058G>A	ENSP00000237281:p.Pro495Leu		Q9BXZ7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,superfamily_TRAF-like,pfscan_F-box_dom_cyclin-like,pfscan_Znf_TRAF	p.P495L	ENST00000237281.4	37	c.1484	CCDS5208.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981437	0.74474	.	.	ENSG00000118496	ENST00000237281	T	0.30714	1.52	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39143	-0.9628	10	0.87932	D	0	-19.0959	20.4008	0.98991	0.0:0.0:1.0:0.0	.	495	Q8TB52	FBX30_HUMAN	L	495	ENSP00000237281:P495L	ENSP00000237281:P495L	P	-	2	0	FBXO30	146167751	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	CCG	FBXO30	-	NULL	ENSG00000118496		0.433	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO30	HGNC	protein_coding	OTTHUMT00000042570.2	141	0.00	0	G			146126058	146126058	-1	no_errors	ENST00000237281	ensembl	human	known	69_37n	missense	39	39.39	26	SNP	1.000	A
FSCB	84075	genome.wustl.edu	37	14	44973848	44973848	+	Silent	SNP	T	T	C			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr14:44973848T>C	ENST00000340446.4	-	1	2634	c.2343A>G	c.(2341-2343)gaA>gaG	p.E781E	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	781						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CAAATTTTGCTTCACCTTCCA	0.393																																						dbGAP											0													79.0	85.0	83.0					14																	44973848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2343A>G	14.37:g.44973848T>C			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.E781	ENST00000340446.4	37	c.2343	CCDS9679.1	14																																																																																			FSCB	-	NULL	ENSG00000189139		0.393	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	73	0.00	0	T	NM_032135		44973848	44973848	-1	no_errors	ENST00000340446	ensembl	human	known	69_37n	silent	24	50.00	24	SNP	0.000	C
GALNTL6	442117	genome.wustl.edu	37	4	172735880	172735880	+	Intron	SNP	C	C	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr4:172735880C>A	ENST00000506823.1	+	2	795				GALNTL6_ENST00000511251.1_Missense_Mutation_p.T50N	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GTAAGTGCCACCCAGAGAAAG	0.552																																						dbGAP											0													65.0	62.0	63.0					4																	172735880		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.138+11C>A	4.37:g.172735880C>A			Q2L4S6	Missense_Mutation	SNP	NULL	p.T50N	ENST00000506823.1	37	c.149	CCDS34104.1	4	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514561	0.27123	.	.	ENSG00000174473	ENST00000511251	.	.	.	5.9	-3.87	0.04218	.	.	.	.	.	T	0.31857	0.0810	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41787	-0.9489	5	0.62326	D	0.03	.	3.4474	0.07486	0.0812:0.3337:0.2672:0.3179	.	.	.	.	N	50	.	ENSP00000425590:T50N	T	+	2	0	GALNTL6	172972455	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-0.467000	0.06664	-0.442000	0.07190	0.563000	0.77884	ACC	GALNTL6	-	NULL	ENSG00000174473		0.552	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	123	0.00	0	C	NM_001034845		172735880	172735880	+1	no_errors	ENST00000511251	ensembl	human	putative	69_37n	missense	135	17.18	28	SNP	0.000	A
GBP4	115361	genome.wustl.edu	37	1	89661003	89661003	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr1:89661003C>T	ENST00000355754.6	-	3	437	c.340G>A	c.(340-342)Gag>Aag	p.E114K		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	114	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CCCAGGCCCTCGGTGTCCAGA	0.522																																						dbGAP											0													112.0	106.0	108.0					1																	89661003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.340G>A	1.37:g.89661003C>T	ENSP00000359490:p.Glu114Lys		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.E114K	ENST00000355754.6	37	c.340	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618521	0.87359	.	.	ENSG00000162654	ENST00000355754	T	0.64803	-0.12	5.29	5.29	0.74685	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86518	0.5952	H	0.98918	4.37	0.46823	D	0.999212	D	0.89917	1.0	D	0.97110	1.0	D	0.91160	0.4960	10	0.72032	D	0.01	.	16.4548	0.84008	0.0:1.0:0.0:0.0	.	114	Q96PP9	GBP4_HUMAN	K	114	ENSP00000359490:E114K	ENSP00000359490:E114K	E	-	1	0	GBP4	89433591	1.000000	0.71417	0.996000	0.52242	0.592000	0.36648	5.780000	0.68956	2.754000	0.94517	0.591000	0.81541	GAG	GBP4	-	pfam_Guanylate-bd_N	ENSG00000162654		0.522	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	247	0.00	0	C	NM_052941		89661003	89661003	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	missense	129	37.38	77	SNP	1.000	T
GPR182	11318	genome.wustl.edu	37	12	57389412	57389412	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr12:57389412G>A	ENST00000300098.1	+	2	638	c.419G>A	c.(418-420)aGc>aAc	p.S140N	RP11-474N8.5_ENST00000556850.1_RNA|HBCBP_ENST00000600202.1_5'Flank	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	140					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						ATGTATAGCAGCATCTTCTTC	0.602																																						dbGAP											0													166.0	136.0	146.0					12																	57389412		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.419G>A	12.37:g.57389412G>A	ENSP00000300098:p.Ser140Asn			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_G10D_rcpt,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.S140N	ENST00000300098.1	37	c.419	CCDS8927.1	12	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524016	0.85600	.	.	ENSG00000166856	ENST00000300098	T	0.55234	0.53	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75874	0.3909	M	0.88704	2.975	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.81026	-0.1119	10	0.66056	D	0.02	.	14.6905	0.69083	0.0:0.0:1.0:0.0	.	140	O15218	GP182_HUMAN	N	140	ENSP00000300098:S140N	ENSP00000300098:S140N	S	+	2	0	GPR182	55675679	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.588000	0.98232	2.396000	0.81511	0.561000	0.74099	AGC	GPR182	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	ENSG00000166856		0.602	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR182	HGNC	protein_coding	OTTHUMT00000411212.1	303	0.00	0	G	NM_007264		57389412	57389412	+1	no_errors	ENST00000300098	ensembl	human	known	69_37n	missense	87	62.01	142	SNP	1.000	A
GREB1L	80000	genome.wustl.edu	37	18	19098026	19098026	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr18:19098026T>A	ENST00000580732.2	+	31	5684	c.5303T>A	c.(5302-5304)cTt>cAt	p.L1768H	GREB1L_ENST00000269218.6_Missense_Mutation_p.L1659H|GREB1L_ENST00000424526.1_Missense_Mutation_p.L1768H|GREB1L_ENST00000400483.4_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1768						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						ATCTTGCCCCTTCAATACATC	0.488																																						dbGAP											0													97.0	84.0	88.0					18																	19098026		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.5303T>A	18.37:g.19098026T>A	ENSP00000464162:p.Leu1768His		A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.L1768H	ENST00000580732.2	37	c.5303	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	T	20.5	3.993326	0.74703	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.07327	3.2;3.21	5.75	5.75	0.90469	.	.	.	.	.	T	0.17023	0.0409	L	0.43152	1.355	0.80722	D	1	D	0.63046	0.992	P	0.56216	0.794	T	0.01472	-1.1346	9	0.31617	T	0.26	-10.4828	16.0487	0.80740	0.0:0.0:0.0:1.0	.	1768	Q9C091	GRB1L_HUMAN	H	1768;1659	ENSP00000412060:L1768H;ENSP00000269218:L1659H	ENSP00000269218:L1659H	L	+	2	0	GREB1L	17352024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.392000	0.59659	2.189000	0.69895	0.533000	0.62120	CTT	GREB1L	-	NULL	ENSG00000141449		0.488	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	171	0.00	0	T	NM_024935		19098026	19098026	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	95	56.82	125	SNP	1.000	A
IGLV1-47	28822	genome.wustl.edu	37	22	22712558	22712558	+	RNA	SNP	G	G	A	rs556936347		TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr22:22712558G>A	ENST00000390294.2	+	0	357									immunoglobulin lambda variable 1-47																		GCTCCGGTCCGAGGATGAGGC	0.587													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17040	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													129.0	126.0	127.0					22																	22712558		1977	4157	6134	-	-	-			0			Z73663		22q11.2	2012-02-08			ENSG00000211648	ENSG00000211648		"""Immunoglobulins / IGL locus"""	5880	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151048		22.37:g.22712558G>A				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E101K	ENST00000390294.2	37	c.301		22																																																																																			IGLV1-47	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211648		0.587	IGLV1-47-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV1-47	HGNC	IG_V_gene	OTTHUMT00000321108.2	248	0.00	0	G	NG_000002		22712558	22712558	+1	no_stop_codon	ENST00000390294	ensembl	human	known	69_37n	missense	113	27.85	44	SNP	1.000	A
IQGAP2	10788	genome.wustl.edu	37	5	75967586	75967586	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr5:75967586C>A	ENST00000274364.6	+	24	3143	c.2846C>A	c.(2845-2847)tCa>tAa	p.S949*	IQGAP2_ENST00000396234.3_Nonsense_Mutation_p.S445*|IQGAP2_ENST00000379730.3_Nonsense_Mutation_p.S451*|IQGAP2_ENST00000502745.1_Nonsense_Mutation_p.S445*	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	949	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TTTTTTAGATCAAAAGTGGAC	0.443																																						dbGAP											0													65.0	68.0	67.0					5																	75967586		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2846C>A	5.37:g.75967586C>A	ENSP00000274364:p.Ser949*		A8K4V1|B7Z8A4|J3KR91	Nonsense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.S949*	ENST00000274364.6	37	c.2846	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.898729	0.97920	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000502745	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3094	19.395	0.94603	0.0:1.0:0.0:0.0	.	.	.	.	X	949;451;899;502;445;445	.	ENSP00000274364:S949X	S	+	2	0	IQGAP2	76003342	1.000000	0.71417	0.898000	0.35279	0.211000	0.24417	7.818000	0.86416	2.579000	0.87056	0.591000	0.81541	TCA	IQGAP2	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000145703		0.443	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	286	0.00	0	C	NM_006633		75967586	75967586	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	nonsense	146	11.52	19	SNP	1.000	A
IWS1	55677	genome.wustl.edu	37	2	128262380	128262380	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr2:128262380C>A	ENST00000295321.4	-	3	1358	c.1099G>T	c.(1099-1101)Gag>Tag	p.E367*	IWS1_ENST00000455721.2_Nonsense_Mutation_p.E374*|IWS1_ENST00000486662.1_5'Flank|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	367	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TGTTCTTCCTCCTCACTATCA	0.423																																						dbGAP											0													308.0	299.0	302.0					2																	128262380		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1099G>T	2.37:g.128262380C>A	ENSP00000295321:p.Glu367*		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Nonsense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.E367*	ENST00000295321.4	37	c.1099	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	C	38	7.202547	0.98132	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	.	.	.	5.93	5.93	0.95920	.	0.116349	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-25.2055	15.7775	0.78236	0.0:0.8645:0.1355:0.0	.	.	.	.	X	367;320;374	.	ENSP00000295321:E367X	E	-	1	0	IWS1	127978850	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	3.222000	0.51223	2.814000	0.96858	0.563000	0.77884	GAG	IWS1	-	NULL	ENSG00000163166		0.423	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	809	0.00	0	C	NM_017969		128262380	128262380	-1	no_errors	ENST00000295321	ensembl	human	known	69_37n	nonsense	126	82.01	579	SNP	1.000	A
LIPE	3991	genome.wustl.edu	37	19	42930910	42930910	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr19:42930910A>C	ENST00000244289.4	-	1	668	c.392T>G	c.(391-393)tTg>tGg	p.L131W	LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000593740.2_RNA|CTB-50E14.4_ENST00000596781.1_RNA|LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	131					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TCTTTGTCTCAATGCTGGCTC	0.552																																						dbGAP											0													93.0	93.0	93.0					19																	42930910		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.392T>G	19.37:g.42930910A>C	ENSP00000244289:p.Leu131Trp		Q3LRT2|Q6NSL7	Missense_Mutation	SNP	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.L131W	ENST00000244289.4	37	c.392	CCDS12607.1	19	.	.	.	.	.	.	.	.	.	.	A	8.506	0.865388	0.17250	.	.	ENSG00000079435	ENST00000244289	T	0.22945	1.93	4.13	3.1	0.35709	.	1.503940	0.05908	N	0.631180	T	0.41050	0.1142	M	0.62723	1.935	0.09310	N	1	D	0.63046	0.992	P	0.58577	0.841	T	0.13764	-1.0497	10	0.72032	D	0.01	-4.3819	3.6367	0.08151	0.7057:0.0:0.102:0.1923	.	131	Q05469	LIPS_HUMAN	W	131	ENSP00000244289:L131W	ENSP00000244289:L131W	L	-	2	0	LIPE	47622750	0.000000	0.05858	0.010000	0.14722	0.006000	0.05464	0.120000	0.15647	0.879000	0.35944	0.460000	0.39030	TTG	LIPE	-	NULL	ENSG00000079435		0.552	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	HGNC	protein_coding	OTTHUMT00000463861.1	208	0.00	0	A	NM_005357		42930910	42930910	-1	no_errors	ENST00000244289	ensembl	human	known	69_37n	missense	232	38.85	148	SNP	0.003	C
LTN1	26046	genome.wustl.edu	37	21	30316846	30316846	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr21:30316846C>T	ENST00000361371.5	-	22	3920	c.3841G>A	c.(3841-3843)Gcc>Acc	p.A1281T	LTN1_ENST00000389194.2_Missense_Mutation_p.A1327T			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1281					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						AGGTCACAGGCCAAATCACAG	0.383																																						dbGAP											0													67.0	64.0	65.0					21																	30316846		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.3841G>A	21.37:g.30316846C>T	ENSP00000354977:p.Ala1281Thr		A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.A1281T	ENST00000361371.5	37	c.3841		21	.	.	.	.	.	.	.	.	.	.	C	13.14	2.147768	0.37923	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.18810	2.19;2.2	5.12	4.24	0.50183	.	0.192080	0.45361	D	0.000373	T	0.12050	0.0293	L	0.29908	0.895	0.43103	D	0.994799	P	0.40731	0.728	B	0.30943	0.122	T	0.13818	-1.0495	10	0.22706	T	0.39	.	11.1356	0.48373	0.0:0.8519:0.0:0.1481	.	1281	O94822	LTN1_HUMAN	T	1327;1281	ENSP00000373846:A1327T;ENSP00000354977:A1281T	ENSP00000354977:A1281T	A	-	1	0	LTN1	29238717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.960000	0.40422	1.402000	0.46780	0.585000	0.79938	GCC	LTN1	-	NULL	ENSG00000198862		0.383	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	163	0.00	0	C	NM_015565		30316846	30316846	-1	no_errors	ENST00000361371	ensembl	human	known	69_37n	missense	39	60.78	62	SNP	1.000	T
MUC4	4585	genome.wustl.edu	37	3	195505960	195505960	+	Missense_Mutation	SNP	G	G	C	rs112020305	byFrequency	TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr3:195505960G>C	ENST00000463781.3	-	2	12950	c.12491C>G	c.(12490-12492)aCc>aGc	p.T4164S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4164S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4164S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGCGTCGGTGACAGGAAG	0.587													.|||	17	0.00339457	0.0129	0.0	5008	,	,		10875	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	kidney(1)|endometrium(1)											19.0	12.0	14.0					3																	195505960		671	1528	2199	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12491C>G	3.37:g.195505960G>C	ENSP00000417498:p.Thr4164Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T4164S	ENST00000463781.3	37	c.12491	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	4.985	0.182849	0.09495	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.38;1.29	.	.	.	.	.	.	.	.	T	0.19248	0.0462	N	0.19112	0.55	0.09310	N	0.999997	P	0.37985	0.613	B	0.35899	0.213	T	0.14587	-1.0467	7	.	.	.	.	5.8529	0.18704	9.0E-4:0.0:0.9991:0.0	.	4036	E7ESK3	.	S	4164	ENSP00000417498:T4164S;ENSP00000420243:T4164S	.	T	-	2	0	MUC4	196990739	0.002000	0.14202	0.025000	0.17156	0.022000	0.10575	0.413000	0.21148	0.073000	0.16731	0.074000	0.15403	ACC	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	13	0.00	0	G	NM_018406		195505960	195505960	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	206	36.02	116	SNP	0.904	C
MYB	4602	genome.wustl.edu	37	6	135510996	135510997	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr6:135510996_135510997insT	ENST00000367814.4	+	4	467_468	c.281_282insT	c.(280-285)ccttggfs	p.W95fs	MYB_ENST00000316528.8_Frame_Shift_Ins_p.W95fs|MYB_ENST00000534121.1_Frame_Shift_Ins_p.W95fs|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000420123.2_Frame_Shift_Ins_p.W71fs|MYB_ENST00000525369.1_Frame_Shift_Ins_p.W95fs|MYB_ENST00000528774.1_Frame_Shift_Ins_p.W95fs|MYB_ENST00000527615.1_Frame_Shift_Ins_p.W95fs|MYB_ENST00000341911.5_Frame_Shift_Ins_p.W95fs|MYB_ENST00000442647.2_Frame_Shift_Ins_p.W95fs|MYB_ENST00000533624.1_Frame_Shift_Ins_p.W95fs|MYB_ENST00000534044.1_Frame_Shift_Ins_p.W95fs	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	95	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.|Interaction with HIPK2 and NLK. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ATCAAGGGTCCTTGGACCAAAG	0.391			T	NFIB	adenoid cystic carcinoma																																	dbGAP		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.283dupT	6.37:g.135510998_135510998dupT	ENSP00000356788:p.Trp95fs		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Frame_Shift_Ins	INS	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.W95fs	ENST00000367814.4	37	c.281_282	CCDS5174.1	6																																																																																			MYB	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000118513		0.391	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	184	0.00	0	-			135510996	135510997	+1	no_errors	ENST00000341911	ensembl	human	known	69_37n	frame_shift_ins	38	63.81	67	INS	1.000:0.791	T
NTN4	59277	genome.wustl.edu	37	12	96063918	96063918	+	Silent	SNP	T	T	C			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr12:96063918T>C	ENST00000343702.4	-	8	1963	c.1515A>G	c.(1513-1515)aaA>aaG	p.K505K	NTN4_ENST00000538383.1_Silent_p.K468K|NTN4_ENST00000553059.1_Intron|NTN4_ENST00000344911.4_Silent_p.K468K|PGAM1P5_ENST00000552554.1_RNA	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	505					axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TACATTCGCATTTACCTATGG	0.338																																						dbGAP											0													94.0	84.0	87.0					12																	96063918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1515A>G	12.37:g.96063918T>C			B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.K505	ENST00000343702.4	37	c.1515	CCDS9054.1	12																																																																																			NTN4	-	superfamily_TIMP-like_OB-fold	ENSG00000074527		0.338	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN4	HGNC	protein_coding	OTTHUMT00000408372.1	248	0.00	0	T	NM_021229		96063918	96063918	-1	no_errors	ENST00000343702	ensembl	human	known	69_37n	silent	75	69.14	168	SNP	1.000	C
NAA25	80018	genome.wustl.edu	37	12	112513493	112513493	+	Silent	SNP	G	G	C			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr12:112513493G>C	ENST00000261745.4	-	8	1013	c.765C>G	c.(763-765)ctC>ctG	p.L255L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	255						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TTTTTAGTAAGAGGCGCCGGG	0.418																																						dbGAP											0													77.0	80.0	79.0					12																	112513493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.765C>G	12.37:g.112513493G>C			A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.L255	ENST00000261745.4	37	c.765	CCDS9159.1	12																																																																																			NAA25	-	NULL	ENSG00000111300		0.418	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1	209	0.00	0	G	NM_024953		112513493	112513493	-1	no_errors	ENST00000261745	ensembl	human	known	69_37n	silent	241	13.93	39	SNP	1.000	C
OR2W5	441932	genome.wustl.edu	37	1	247654611	247654611	+	RNA	SNP	T	T	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr1:247654611T>A	ENST00000522351.1	+	0	242							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCCATGTACTTCTTTCTTGGG	0.507																																						dbGAP											0													131.0	118.0	123.0					1																	247654611		2203	4300	6503	-	-	-			0					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654611T>A			B9EH85	RNA	SNP	-	NULL	ENST00000522351.1	37	NULL		1																																																																																			OR2W5	-	-	ENSG00000203664		0.507	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	HGNC	pseudogene	OTTHUMT00000375789.1	295	0.00	0	T	NM_001004698		247654611	247654611	+1	no_errors	ENST00000522351	ensembl	human	known	69_37n	rna	300	12.28	42	SNP	1.000	A
OR51A4	401666	genome.wustl.edu	37	11	4967799	4967799	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr11:4967799G>A	ENST00000380373.2	-	1	557	c.532C>T	c.(532-534)Cat>Tat	p.H178Y	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGTAGGAATGGGATAATTGG	0.408																																						dbGAP											0													129.0	123.0	125.0					11																	4967799		2191	4283	6474	-	-	-	SO:0001583	missense	0			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.532C>T	11.37:g.4967799G>A	ENSP00000369731:p.His178Tyr			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H178Y	ENST00000380373.2	37	c.532	CCDS31367.1	11	.	.	.	.	.	.	.	.	.	.	G	4.609	0.113212	0.08831	.	.	ENSG00000205497	ENST00000380373	T	0.40476	1.03	3.44	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.53498	0.1800	M	0.89163	3.01	0.09310	N	1	B	0.21071	0.051	B	0.33799	0.17	T	0.55630	-0.8111	9	0.72032	D	0.01	.	10.1483	0.42778	0.1098:0.0:0.8902:0.0	.	178	Q8NGJ6	O51A4_HUMAN	Y	178	ENSP00000369731:H178Y	ENSP00000369731:H178Y	H	-	1	0	OR51A4	4924375	0.994000	0.37717	0.017000	0.16124	0.065000	0.16274	2.789000	0.47813	1.929000	0.55896	0.479000	0.44913	CAT	OR51A4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000205497		0.408	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A4	HGNC	protein_coding	OTTHUMT00000142821.1	513	0.00	0	G	NM_001005329		4967799	4967799	-1	no_errors	ENST00000380373	ensembl	human	known	69_37n	missense	154	33.04	76	SNP	0.248	A
PMVK	10654	genome.wustl.edu	37	1	154904864	154904864	+	Silent	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr1:154904864G>A	ENST00000368467.3	-	2	428	c.123C>T	c.(121-123)ctC>ctT	p.L41L		NM_006556.3	NP_006547.1	Q15126	PMVK_HUMAN	phosphomevalonate kinase	41					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|response to cholesterol (GO:0070723)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|phosphomevalonate kinase activity (GO:0004631)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGAGAGCCGGAGGACAGCAC	0.562																																						dbGAP											0													103.0	92.0	96.0					1																	154904864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L77213	CCDS1073.1	1q21.3	2012-09-20			ENSG00000163344	ENSG00000163344	2.7.4.2		9141	protein-coding gene	gene with protein product		607622				8663599, 10191291	Standard	NM_006556		Approved	PMK, PMKA, HUMPMKI	uc001ffq.3	Q15126	OTTHUMG00000037415	ENST00000368467.3:c.123C>T	1.37:g.154904864G>A			Q5TZW9	Silent	SNP	pfam_Pmev_kin_anim,pirsf_Pmev_kin_anim,tigrfam_Pmev_kin_anim	p.L41	ENST00000368467.3	37	c.123	CCDS1073.1	1																																																																																			PMVK	-	pfam_Pmev_kin_anim,pirsf_Pmev_kin_anim,tigrfam_Pmev_kin_anim	ENSG00000163344		0.562	PMVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMVK	HGNC	protein_coding	OTTHUMT00000091088.1	256	0.00	0	G	NM_006556		154904864	154904864	-1	no_errors	ENST00000368467	ensembl	human	known	69_37n	silent	248	22.98	74	SNP	0.985	A
PYCR2	29920	genome.wustl.edu	37	1	226109671	226109671	+	Missense_Mutation	SNP	C	C	A	rs538606802	byFrequency	TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr1:226109671C>A	ENST00000343818.6	-	4	575	c.427G>T	c.(427-429)Gtg>Ttg	p.V143L	PYCR2_ENST00000478402.1_5'UTR|RP4-559A3.7_ENST00000432920.2_Intron	NM_013328.2	NP_037460.2	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member 2	143					L-proline biosynthetic process (GO:0055129)	cytoplasm (GO:0005737)	pyrroline-5-carboxylate reductase activity (GO:0004735)			kidney(1)|lung(3)	4	Breast(184;0.197)				L-Proline(DB00172)	CCATCCTCCACCAGGGCATGG	0.622																																						dbGAP											0													54.0	43.0	46.0					1																	226109671		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151351	CCDS31043.1, CCDS73039.1	1q42.13	2008-02-05			ENSG00000143811	ENSG00000143811			30262	protein-coding gene	gene with protein product						12477932	Standard	NM_013328		Approved	P5CR2	uc001hpq.4	Q96C36	OTTHUMG00000037506	ENST00000343818.6:c.427G>T	1.37:g.226109671C>A	ENSP00000342502:p.Val143Leu		A8K798|Q7Z515|Q9Y5J4	Missense_Mutation	SNP	pfam_NADP_OxRdtase_F420,superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	p.V143L	ENST00000343818.6	37	c.427	CCDS31043.1	1	.	.	.	.	.	.	.	.	.	.	c	12.04	1.819096	0.32145	.	.	ENSG00000143811	ENST00000343818;ENST00000316940;ENST00000316918	T	0.62788	0.0	4.67	4.67	0.58626	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.47619	0.1455	N	0.20845	0.615	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38308	-0.9667	10	0.33940	T	0.23	.	15.4503	0.75268	0.0:1.0:0.0:0.0	.	143;142	Q96C36;E7EUS9	P5CR2_HUMAN;.	L	143;142;96	ENSP00000342502:V143L	ENSP00000321499:V96L	V	-	1	0	PYCR2	224176294	.	.	1.000000	0.80357	0.290000	0.27261	.	.	2.570000	0.86706	0.655000	0.94253	GTG	PYCR2	-	pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	ENSG00000143811		0.622	PYCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYCR2	HGNC	protein_coding	OTTHUMT00000091314.1	56	0.00	0	C	NM_013328		226109671	226109671	-1	no_errors	ENST00000343818	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	1.000	A
NUDT5	11164	genome.wustl.edu	37	10	12211338	12211338	+	Intron	SNP	G	G	A	rs570855625		TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr10:12211338G>A	ENST00000491614.1	-	9	946				NUDT5_ENST00000537776.1_Intron|SEC61A2_ENST00000304267.8_3'UTR|SEC61A2_ENST00000495368.1_3'UTR|NUDT5_ENST00000378937.3_Intron|NUDT5_ENST00000378952.3_Intron			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5						D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				AGATAACCCCGCACGGCATTT	0.443													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19106	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													50.0	41.0	44.0					10																	12211338		1552	3536	5088	-	-	-	SO:0001627	intron_variant	0			AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.550+1377C>T	10.37:g.12211338G>A			A8K516|Q6IAG0|Q9UH49	RNA	SNP	-	NULL	ENST00000491614.1	37	NULL	CCDS7089.1	10																																																																																			SEC61A2	-	-	ENSG00000065665		0.443	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A2	HGNC	protein_coding	OTTHUMT00000046811.1	252	0.39	1	G			12211338	12211338	+1	no_errors	ENST00000495368	ensembl	human	known	69_37n	rna	189	19.92	47	SNP	0.000	A
TMEM132B	114795	genome.wustl.edu	37	12	126139187	126139187	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr12:126139187C>A	ENST00000299308.3	+	9	3176	c.3168C>A	c.(3166-3168)tgC>tgA	p.C1056*	TMEM132B_ENST00000535886.1_Nonsense_Mutation_p.C568*	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	1056						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGTGGGTCTGCCAAGATATGG	0.468																																						dbGAP											0													77.0	71.0	73.0					12																	126139187		1871	4098	5969	-	-	-	SO:0001587	stop_gained	0			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.3168C>A	12.37:g.126139187C>A	ENSP00000299308:p.Cys1056*		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Nonsense_Mutation	SNP	NULL	p.C1056*	ENST00000299308.3	37	c.3168	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.576009	0.97676	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	.	.	.	5.81	3.95	0.45737	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.699	0.51560	0.0:0.8529:0.0:0.1471	.	.	.	.	X	1056;568	.	ENSP00000299308:C1056X	C	+	3	2	TMEM132B	124705140	1.000000	0.71417	0.987000	0.45799	0.999000	0.98932	0.877000	0.28106	0.746000	0.32786	0.655000	0.94253	TGC	TMEM132B	-	NULL	ENSG00000139364		0.468	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	63	0.00	0	C	NM_052907		126139187	126139187	+1	no_errors	ENST00000299308	ensembl	human	known	69_37n	nonsense	26	68.67	57	SNP	1.000	A
TMEM161A	54929	genome.wustl.edu	37	19	19240990	19240990	+	Missense_Mutation	SNP	C	C	A	rs368216845		TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr19:19240990C>A	ENST00000162044.9	-	6	634	c.570G>T	c.(568-570)gaG>gaT	p.E190D	TMEM161A_ENST00000592147.1_5'Flank|TMEM161A_ENST00000450333.2_Intron|TMEM161A_ENST00000587583.2_Missense_Mutation_p.E165D	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	190					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			GCTCGAGGGTCTCCTCCCGCA	0.617																																						dbGAP											0													60.0	52.0	55.0					19																	19240990		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.570G>T	19.37:g.19240990C>A	ENSP00000162044:p.Glu190Asp		B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.E190D	ENST00000162044.9	37	c.570	CCDS12393.1	19	.	.	.	.	.	.	.	.	.	.	C	0.307	-0.970394	0.02232	.	.	ENSG00000064545	ENST00000162044	.	.	.	4.35	-4.81	0.03180	.	0.421559	0.27064	N	0.021119	T	0.14184	0.0343	N	0.02315	-0.6	0.27929	N	0.93797	B	0.02656	0.0	B	0.10450	0.005	T	0.30208	-0.9986	9	0.12430	T	0.62	.	13.605	0.62041	0.1009:0.3915:0.5077:0.0	.	190	Q9NX61	T161A_HUMAN	D	190	.	ENSP00000162044:E190D	E	-	3	2	TMEM161A	19101990	0.991000	0.36638	0.005000	0.12908	0.136000	0.21042	0.174000	0.16743	-0.546000	0.06216	-1.961000	0.00478	GAG	TMEM161A	-	pfam_Transmembrane_161A/B	ENSG00000064545		0.617	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161A	HGNC	protein_coding	OTTHUMT00000460089.2	108	0.00	0	C	NM_017814		19240990	19240990	-1	no_errors	ENST00000162044	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	0.948	A
TRIO	7204	genome.wustl.edu	37	5	14504592	14504592	+	Silent	SNP	C	C	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr5:14504592C>T	ENST00000344204.4	+	55	8526	c.8502C>T	c.(8500-8502)cgC>cgT	p.R2834R	TRIO_ENST00000344135.5_Silent_p.R333R|TRIO_ENST00000537187.1_Silent_p.R2658R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2834	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TGATGAAGCGCGACCAGGTCA	0.532																																						dbGAP											0													176.0	179.0	178.0					5																	14504592		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8502C>T	5.37:g.14504592C>T			D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R2834	ENST00000344204.4	37	c.8502	CCDS3883.1	5																																																																																			TRIO	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000038382		0.532	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	100	0.00	0	C	NM_007118		14504592	14504592	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	silent	100	24.24	32	SNP	0.800	T
UHRF1BP1	54887	genome.wustl.edu	37	6	34802149	34802149	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr6:34802149G>A	ENST00000192788.5	+	5	665	c.494G>A	c.(493-495)cGc>cAc	p.R165H	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.R165H	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	165							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						AGTGACCTTCGCCTTACCCGC	0.512																																						dbGAP											0													61.0	59.0	60.0					6																	34802149		1982	4158	6140	-	-	-	SO:0001583	missense	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.494G>A	6.37:g.34802149G>A	ENSP00000192788:p.Arg165His		Q9NXE0	Missense_Mutation	SNP	NULL	p.R165H	ENST00000192788.5	37	c.494	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979683	0.92982	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.12465	2.68;2.68	4.71	3.84	0.44239	.	0.059730	0.64402	N	0.000002	T	0.29256	0.0728	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.18840	-1.0324	10	0.87932	D	0	-6.669	12.8547	0.57878	0.0789:0.0:0.9211:0.0	.	165	Q6BDS2	URFB1_HUMAN	H	165	ENSP00000192788:R165H;ENSP00000400628:R165H	ENSP00000192788:R165H	R	+	2	0	UHRF1BP1	34910127	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	7.769000	0.85360	1.216000	0.43427	0.655000	0.94253	CGC	UHRF1BP1	-	NULL	ENSG00000065060		0.512	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	104	0.95	1	G	NM_017754		34802149	34802149	+1	no_errors	ENST00000192788	ensembl	human	known	69_37n	missense	191	15.42	35	SNP	1.000	A
ZFP90	146198	genome.wustl.edu	37	16	68591931	68591931	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0ET-01A-31D-A045-09	TCGA-A2-A0ET-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7b40023-4adc-4c7d-ae73-5c10ddcbc0fb	2f6a3862-f59a-4b35-9444-11db363db47b	g.chr16:68591931G>T	ENST00000570495.1	+	3	356	c.64G>T	c.(64-66)Gac>Tac	p.D22Y	ZFP90_ENST00000398253.2_Missense_Mutation_p.D22Y|ZFP90_ENST00000563169.2_Missense_Mutation_p.D22Y|ZFP90_ENST00000564323.1_Missense_Mutation_p.D22Y|ZFP90_ENST00000570884.1_3'UTR			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	22	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TGTGTCTGTGGACTTCACCCA	0.458																																						dbGAP											0													146.0	144.0	145.0					16																	68591931		2191	4298	6489	-	-	-	SO:0001583	missense	0			AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.64G>T	16.37:g.68591931G>T	ENSP00000460547:p.Asp22Tyr		B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D22Y	ENST00000570495.1	37	c.64	CCDS42183.1	16	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581063	0.65992	.	.	ENSG00000184939	ENST00000398253	T	0.01887	4.58	5.45	3.46	0.39613	Krueppel-associated box (4);	.	.	.	.	T	0.02047	0.0064	L	0.31804	0.96	0.26601	N	0.973011	B	0.16396	0.017	B	0.13407	0.009	T	0.41466	-0.9507	9	0.52906	T	0.07	-3.276	3.8233	0.08845	0.2028:0.0:0.6049:0.1923	.	22	Q8TF47	ZFP90_HUMAN	Y	22	ENSP00000381304:D22Y	ENSP00000381304:D22Y	D	+	1	0	ZFP90	67149432	0.939000	0.31865	1.000000	0.80357	0.998000	0.95712	-0.068000	0.11561	1.267000	0.44247	0.591000	0.81541	GAC	ZFP90	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000184939		0.458	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP90	HGNC	protein_coding	OTTHUMT00000436217.3	624	0.00	0	G	XM_085375		68591931	68591931	+1	no_errors	ENST00000398253	ensembl	human	known	69_37n	missense	145	49.65	143	SNP	1.000	T
