#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA10	10349	genome.wustl.edu	37	17	67190107	67190107	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr17:67190107G>A	ENST00000269081.4	-	14	2278	c.1369C>T	c.(1369-1371)Caa>Taa	p.Q457*	ABCA10_ENST00000416101.2_Intron	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	457	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TCAGAGAGTTGAGTATTATAA	0.303																																						dbGAP											0													57.0	65.0	62.0					17																	67190107		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1369C>T	17.37:g.67190107G>A	ENSP00000269081:p.Gln457*		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q457*	ENST00000269081.4	37	c.1369	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	G	46	12.184905	0.99644	.	.	ENSG00000154263	ENST00000269081	.	.	.	3.71	-2.21	0.06973	.	1.455890	0.05499	U	0.558053	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7154	0.69265	0.0:0.0:0.145:0.855	.	.	.	.	X	457	.	ENSP00000269081:Q457X	Q	-	1	0	ABCA10	64701702	0.000000	0.05858	0.000000	0.03702	0.890000	0.51754	0.552000	0.23376	-0.804000	0.04410	0.557000	0.71058	CAA	ABCA10	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154263		0.303	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	69	0.00	0	G	NM_080282		67190107	67190107	-1	no_errors	ENST00000269081	ensembl	human	known	69_37n	nonsense	74	28.16	29	SNP	0.000	A
ATP1A4	480	genome.wustl.edu	37	1	160134150	160134150	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:160134150C>G	ENST00000368081.4	+	7	1454	c.983C>G	c.(982-984)gCt>gGt	p.A328G		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	328					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGCTGGAGGCTATCATTTTT	0.512																																						dbGAP											0													330.0	287.0	301.0					1																	160134150		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.983C>G	1.37:g.160134150C>G	ENSP00000357060:p.Ala328Gly		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.A328G	ENST00000368081.4	37	c.983	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962323	0.74016	.	.	ENSG00000132681	ENST00000368081	D	0.91351	-2.83	4.69	4.69	0.59074	ATPase, P-type, ATPase-associated domain (1);	0.053096	0.64402	D	0.000001	D	0.85336	0.5673	L	0.43757	1.38	0.80722	D	1	B	0.17268	0.021	B	0.32533	0.147	D	0.84407	0.0563	10	0.72032	D	0.01	.	15.5129	0.75798	0.0:1.0:0.0:0.0	.	328	Q13733	AT1A4_HUMAN	G	328	ENSP00000357060:A328G	ENSP00000357060:A328G	A	+	2	0	ATP1A4	158400774	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.609000	0.82925	2.593000	0.87608	0.655000	0.94253	GCT	ATP1A4	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000132681		0.512	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	80	0.00	0	C	NM_144699		160134150	160134150	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	missense	103	21.97	29	SNP	1.000	G
ATP9A	10079	genome.wustl.edu	37	20	50238636	50238636	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr20:50238636G>T	ENST00000338821.5	-	19	2356	c.2092C>A	c.(2092-2094)Caa>Aaa	p.Q698K	ATP9A_ENST00000311637.5_Missense_Mutation_p.Q562K|ATP9A_ENST00000402822.1_Missense_Mutation_p.Q577K	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	698					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TGGATGTCTTGGTTTCTGGTC	0.517																																						dbGAP											0													321.0	222.0	256.0					20																	50238636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2092C>A	20.37:g.50238636G>T	ENSP00000342481:p.Gln698Lys		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q698K	ENST00000338821.5	37	c.2092	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937050	0.92458	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.62498	0.02;0.02;0.02	5.36	5.36	0.76844	HAD-like domain (2);	0.052799	0.85682	D	0.000000	T	0.76248	0.3961	M	0.84082	2.675	0.80722	D	1	B;P	0.38148	0.058;0.62	B;P	0.47705	0.025;0.555	T	0.79356	-0.1837	10	0.72032	D	0.01	-19.8661	19.069	0.93125	0.0:0.0:1.0:0.0	.	577;698	O75110-2;O75110	.;ATP9A_HUMAN	K	562;698;577	ENSP00000309086:Q562K;ENSP00000342481:Q698K;ENSP00000385875:Q577K	ENSP00000309086:Q562K	Q	-	1	0	ATP9A	49672043	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	9.476000	0.97823	2.501000	0.84356	0.655000	0.94253	CAA	ATP9A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000054793		0.517	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	HGNC	protein_coding	OTTHUMT00000106494.1	46	0.00	0	G	NM_006045		50238636	50238636	-1	no_errors	ENST00000338821	ensembl	human	known	69_37n	missense	74	18.68	17	SNP	1.000	T
ATXN1	6310	genome.wustl.edu	37	6	16326909	16326909	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr6:16326909G>T	ENST00000244769.4	-	8	2569	c.1633C>A	c.(1633-1635)Cca>Aca	p.P545T	ATXN1_ENST00000436367.1_Missense_Mutation_p.P545T	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	545	Interaction with USP7.|RNA-binding.|Self-association.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ACCATGGCTGGGTAGGCGGCC	0.657																																						dbGAP											0													49.0	60.0	56.0					6																	16326909		2203	4299	6502	-	-	-	SO:0001583	missense	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1633C>A	6.37:g.16326909G>T	ENSP00000244769:p.Pro545Thr		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.P545T	ENST00000244769.4	37	c.1633	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567923	0.45798	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.78364	-1.17;-1.17	4.83	4.83	0.62350	.	0.367187	0.30464	N	0.009568	T	0.54095	0.1837	L	0.32530	0.975	0.38210	D	0.940432	P	0.43094	0.799	B	0.30401	0.115	T	0.63782	-0.6559	10	0.42905	T	0.14	-11.7481	17.913	0.88940	0.0:0.0:1.0:0.0	.	545	P54253	ATX1_HUMAN	T	545	ENSP00000244769:P545T;ENSP00000416360:P545T	ENSP00000244769:P545T	P	-	1	0	ATXN1	16434888	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.605000	0.67634	2.228000	0.72767	0.561000	0.74099	CCA	ATXN1	-	NULL	ENSG00000124788		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	22	0.00	0	G	NM_000332		16326909	16326909	-1	no_errors	ENST00000244769	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	T
AWAT2	158835	genome.wustl.edu	37	X	69263413	69263413	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chrX:69263413C>A	ENST00000276101.3	-	4	392	c.387G>T	c.(385-387)aaG>aaT	p.K129N		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	129					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						CAGGAAATATCTTGGAGAAGC	0.517																																					NSCLC(80;1334 1436 9350 24214 26427)	dbGAP											0													58.0	51.0	54.0					X																	69263413		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.387G>T	X.37:g.69263413C>A	ENSP00000421172:p.Lys129Asn		Q6IEE3|Q6P437	Missense_Mutation	SNP	pfam_DAGAT	p.K129N	ENST00000276101.3	37	c.387	CCDS35320.1	X	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911992	0.52439	.	.	ENSG00000147160	ENST00000276101	T	0.14516	2.5	4.62	4.62	0.57501	.	0.086182	0.48767	D	0.000168	T	0.32194	0.0821	M	0.73598	2.24	0.46701	D	0.99916	P	0.48998	0.918	P	0.57244	0.816	T	0.04593	-1.0940	10	0.54805	T	0.06	.	13.7568	0.62942	0.0:1.0:0.0:0.0	.	129	Q6E213	AWAT2_HUMAN	N	129	ENSP00000421172:K129N	ENSP00000421172:K129N	K	-	3	2	AWAT2	69180138	1.000000	0.71417	0.932000	0.37286	0.196000	0.23810	5.393000	0.66279	2.111000	0.64477	0.513000	0.50165	AAG	AWAT2	-	pfam_DAGAT	ENSG00000147160		0.517	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT2	HGNC	protein_coding	OTTHUMT00000358738.1	50	0.00	0	C	NM_001002254		69263413	69263413	-1	no_errors	ENST00000276101	ensembl	human	known	69_37n	missense	29	39.58	19	SNP	0.998	A
BRWD3	254065	genome.wustl.edu	37	X	79999555	79999555	+	Silent	SNP	A	A	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chrX:79999555A>G	ENST00000373275.4	-	8	1005	c.789T>C	c.(787-789)caT>caC	p.H263H		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	263					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TAGAAGCTGAATGGCCCTGAA	0.373																																						dbGAP											0													107.0	93.0	98.0					X																	79999555		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.789T>C	X.37:g.79999555A>G			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.H263	ENST00000373275.4	37	c.789	CCDS14447.1	X																																																																																			BRWD3	-	pfam_WD40_repeat,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165288		0.373	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	45	0.00	0	A	NM_153252		79999555	79999555	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	silent	39	38.10	24	SNP	1.000	G
C5	727	genome.wustl.edu	37	9	123789552	123789552	+	Splice_Site	SNP	T	T	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr9:123789552T>A	ENST00000223642.1	-	8	788	c.759A>T	c.(757-759)agA>agT	p.R253S		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	253					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TATAAAAATATCTGTCAGACA	0.303																																						dbGAP											0													93.0	81.0	85.0					9																	123789552		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.759-1A>T	9.37:g.123789552T>A			Q14CJ0|Q27I61	Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.R253S	ENST00000223642.1	37	c.759	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	T	12.19	1.863772	0.32884	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.34667	1.35	5.75	0.819	0.18785	.	0.140384	0.64402	D	0.000004	T	0.22437	0.0541	L	0.45470	1.425	0.36018	D	0.83856	B;B	0.30033	0.266;0.002	B;B	0.15484	0.013;0.003	T	0.11036	-1.0604	10	0.29301	T	0.29	.	5.287	0.15706	0.0:0.2747:0.2346:0.4907	.	324;253	Q59GS8;P01031	.;CO5_HUMAN	S	253;324	ENSP00000223642:R253S	ENSP00000223642:R253S	R	-	3	2	C5	122829373	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	0.566000	0.23593	0.121000	0.18284	-0.256000	0.11100	AGA	C5	-	NULL	ENSG00000106804		0.303	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	73	0.00	0	T	NM_001735	Missense_Mutation	123789552	123789552	-1	no_errors	ENST00000223642	ensembl	human	known	69_37n	missense	56	34.12	29	SNP	1.000	A
CCDC60	160777	genome.wustl.edu	37	12	119966483	119966483	+	Silent	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr12:119966483G>A	ENST00000327554.2	+	12	1758	c.1293G>A	c.(1291-1293)aaG>aaA	p.K431K	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	431										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		ATTTTCAAAAGGACATAGCAA	0.398																																						dbGAP											0													149.0	139.0	143.0					12																	119966483		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1293G>A	12.37:g.119966483G>A				Silent	SNP	NULL	p.K431	ENST00000327554.2	37	c.1293	CCDS9190.1	12																																																																																			CCDC60	-	NULL	ENSG00000183273		0.398	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	46	0.00	0	G	NM_178499		119966483	119966483	+1	no_errors	ENST00000327554	ensembl	human	known	69_37n	silent	28	28.21	11	SNP	1.000	A
CEP85	64793	genome.wustl.edu	37	1	26582252	26582252	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:26582252T>G	ENST00000252992.4	+	4	930	c.799T>G	c.(799-801)Tgg>Ggg	p.W267G	CEP85_ENST00000451429.2_Missense_Mutation_p.W216G	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	267						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						CTCTCAGGTGTGGCAGCCGAG	0.552																																						dbGAP											0													53.0	55.0	55.0					1																	26582252		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.799T>G	1.37:g.26582252T>G	ENSP00000252992:p.Trp267Gly		B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	NULL	p.W267G	ENST00000252992.4	37	c.799	CCDS277.1	1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344676	0.61073	.	.	ENSG00000130695	ENST00000451429;ENST00000252992	T;T	0.11604	2.76;2.76	5.95	5.95	0.96441	.	0.260277	0.41712	D	0.000830	T	0.30230	0.0758	L	0.56769	1.78	0.53688	D	0.999974	D;D;D	0.89917	0.974;1.0;1.0	P;D;D	0.91635	0.669;0.999;0.998	T	0.00724	-1.1593	10	0.59425	D	0.04	-6.2212	14.9948	0.71421	0.0:0.0:0.0:1.0	.	216;267;267	F8W7K4;Q6P2H3;Q6P2H3-2	.;CEP85_HUMAN;.	G	216;267	ENSP00000417002:W216G;ENSP00000252992:W267G	ENSP00000252992:W267G	W	+	1	0	CEP85	26454839	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.238000	0.65366	2.279000	0.76181	0.533000	0.62120	TGG	CEP85	-	NULL	ENSG00000130695		0.552	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	HGNC	protein_coding	OTTHUMT00000009492.2	16	0.00	0	T	NM_022778		26582252	26582252	+1	no_errors	ENST00000252992	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	1.000	G
CHPT1	56994	genome.wustl.edu	37	12	102117039	102117039	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr12:102117039A>C	ENST00000229266.3	+	6	1109	c.874A>C	c.(874-876)Aag>Cag	p.K292Q	CHPT1_ENST00000549872.1_Missense_Mutation_p.K292Q	NM_020244.2	NP_064629.2	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	292					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	diacylglycerol binding (GO:0019992)|diacylglycerol cholinephosphotransferase activity (GO:0004142)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TGTGTTTGAAAAGCATCCTTG	0.328																																						dbGAP											0													114.0	115.0	115.0					12																	102117039		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9086.1	12q	2010-07-08				ENSG00000111666	2.7.8.2		17852	protein-coding gene	gene with protein product	"""phosphatidylcholine synthesizing enzyme"""					10893425	Standard	NM_020244		Approved	CPT1	uc001tin.3	Q8WUD6		ENST00000229266.3:c.874A>C	12.37:g.102117039A>C	ENSP00000229266:p.Lys292Gln		B3KQM2|Q7Z7H0|Q7Z7H1|Q7Z7H2|Q8IWQ4|Q8IWQ5|Q8WYI4|Q9NRQ6|Q9NRQ7|Q9Y6M6	Missense_Mutation	SNP	pfam_CDP-OH_P_trans,pirsf_CHOPT	p.K292Q	ENST00000229266.3	37	c.874	CCDS9086.1	12	.	.	.	.	.	.	.	.	.	.	A	10.18	1.280363	0.23392	.	.	ENSG00000111666	ENST00000229266;ENST00000549872;ENST00000543999	T;T	0.45276	0.9;0.9	5.94	4.8	0.61643	.	0.205826	0.51477	D	0.000085	T	0.34919	0.0914	L	0.47016	1.485	0.29063	N	0.8838	B;B	0.28055	0.199;0.107	B;B	0.34180	0.177;0.058	T	0.29397	-1.0013	10	0.17832	T	0.49	-12.7668	7.6759	0.28486	0.7888:0.1401:0.0711:0.0	.	292;292	F8W1B3;Q8WUD6	.;CHPT1_HUMAN	Q	292;292;125	ENSP00000229266:K292Q;ENSP00000448766:K292Q	ENSP00000229266:K292Q	K	+	1	0	CHPT1	100641170	1.000000	0.71417	1.000000	0.80357	0.041000	0.13682	3.399000	0.52586	1.068000	0.40764	0.523000	0.50628	AAG	CHPT1	-	pirsf_CHOPT	ENSG00000111666		0.328	CHPT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHPT1	HGNC	protein_coding	OTTHUMT00000409173.1	83	0.00	0	A	NM_020244		102117039	102117039	+1	no_errors	ENST00000229266	ensembl	human	known	69_37n	missense	79	34.17	41	SNP	1.000	C
CX3CR1	1524	genome.wustl.edu	37	3	39306996	39306997	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr3:39306996_39306997delTC	ENST00000541347.1	-	2	1243_1244	c.1004_1005delGA	c.(1003-1005)ggafs	p.G335fs	CX3CR1_ENST00000542107.1_Frame_Shift_Del_p.G335fs|CX3CR1_ENST00000358309.3_Frame_Shift_Del_p.G367fs|CX3CR1_ENST00000399220.2_Frame_Shift_Del_p.G335fs	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	335					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TCAGAACACTTCCATGCCTGCT	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.1004_1005delGA	3.37:g.39306996_39306997delTC	ENSP00000439140:p.Gly335fs		A0N0N6|B2R5Z4|J3KP17	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_fractalkine_CX3CR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.G367fs	ENST00000541347.1	37	c.1101_1100	CCDS43069.1	3																																																																																			CX3CR1	-	prints_Chemokine_fractalkine_CX3CR1	ENSG00000168329		0.490	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	21	0.00	0	TC	NM_001337		39306996	39306997	-1	no_errors	ENST00000358309	ensembl	human	known	69_37n	frame_shift_del	13	38.10	8	DEL	0.002:0.002	-
CX3CR1	1524	genome.wustl.edu	37	3	39307000	39307000	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr3:39307000delT	ENST00000541347.1	-	2	1240	c.1001delA	c.(1000-1002)catfs	p.H334fs	CX3CR1_ENST00000542107.1_Frame_Shift_Del_p.H334fs|CX3CR1_ENST00000358309.3_Frame_Shift_Del_p.H366fs|CX3CR1_ENST00000399220.2_Frame_Shift_Del_p.H334fs	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	334					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		AACACTTCCATGCCTGCTCCT	0.483																																						dbGAP											0													147.0	143.0	144.0					3																	39307000		1981	4170	6151	-	-	-	SO:0001589	frameshift_variant	0			BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.1001delA	3.37:g.39307000delT	ENSP00000439140:p.His334fs		A0N0N6|B2R5Z4|J3KP17	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_fractalkine_CX3CR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.H366fs	ENST00000541347.1	37	c.1097	CCDS43069.1	3																																																																																			CX3CR1	-	prints_Chemokine_fractalkine_CX3CR1	ENSG00000168329		0.483	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	23	0.00	0	T	NM_001337		39307000	39307000	-1	no_errors	ENST00000358309	ensembl	human	known	69_37n	frame_shift_del	12	36.36	8	DEL	0.003	-
ERC1	23085	genome.wustl.edu	37	12	1517405	1517405	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr12:1517405C>G	ENST00000397203.2	+	17	3422	c.3016C>G	c.(3016-3018)Cca>Gca	p.P1006A	ERC1_ENST00000355446.5_Missense_Mutation_p.P1006A|ERC1_ENST00000546231.2_Missense_Mutation_p.P1010A|ERC1_ENST00000589028.1_Missense_Mutation_p.P1006A|ERC1_ENST00000360905.4_Missense_Mutation_p.P1006A|ERC1_ENST00000543086.3_Missense_Mutation_p.P978A			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	1006					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CAAGCCCTCCCCAGACCAGGT	0.388																																						dbGAP											0													80.0	68.0	72.0					12																	1517405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.3016C>G	12.37:g.1517405C>G	ENSP00000380386:p.Pro1006Ala		A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,pfam_Rab-bd_FIP-RBD,superfamily_Prefoldin	p.P1006A	ENST00000397203.2	37	c.3016	CCDS8508.1	12	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512048	0.85389	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T	0.37752	1.36;1.74;1.73;1.24;1.64;1.74;1.18	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.974	D;D;D;P	0.91635	0.999;0.997;0.997;0.813	T	0.17531	-1.0366	10	0.13853	T	0.58	-15.429	20.3409	0.98764	0.0:1.0:0.0:0.0	.	714;982;978;1006	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	A	938;1006;982;938;710;978;982;710;1006;1006;1006;982;714	ENSP00000340054:P938A;ENSP00000380386:P1006A;ENSP00000438546:P978A;ENSP00000442976:P710A;ENSP00000347621:P1006A;ENSP00000354158:P1006A;ENSP00000410064:P982A	ENSP00000299183:P710A	P	+	1	0	ERC1	1387666	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.142000	0.77339	2.814000	0.96858	0.655000	0.94253	CCA	ERC1	-	NULL	ENSG00000082805		0.388	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC1	HGNC	protein_coding	OTTHUMT00000398380.2	49	0.00	0	C	NM_015064		1517405	1517405	+1	no_errors	ENST00000360905	ensembl	human	known	69_37n	missense	47	29.85	20	SNP	1.000	G
FIGLA	344018	genome.wustl.edu	37	2	71012744	71012744	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr2:71012744T>C	ENST00000332372.6	-	3	416	c.412A>G	c.(412-414)Agt>Ggt	p.S138G		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	138					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						CTGTTGTTACTATAGCTCTGC	0.373																																						dbGAP											0													397.0	382.0	387.0					2																	71012744		1958	4163	6121	-	-	-	SO:0001583	missense	0			BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.412A>G	2.37:g.71012744T>C	ENSP00000333097:p.Ser138Gly			Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S138G	ENST00000332372.6	37	c.412	CCDS46320.1	2	.	.	.	.	.	.	.	.	.	.	T	1.417	-0.573818	0.03882	.	.	ENSG00000183733	ENST00000332372	D	0.95622	-3.76	4.12	4.12	0.48240	Helix-loop-helix DNA-binding (1);	0.204000	0.32703	N	0.005744	D	0.90920	0.7146	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.77416	-0.2596	10	0.15066	T	0.55	.	9.8261	0.40912	0.0:0.0:0.0:1.0	.	138	Q6QHK4	FIGLA_HUMAN	G	138	ENSP00000333097:S138G	ENSP00000333097:S138G	S	-	1	0	FIGLA	70866252	0.040000	0.19996	0.081000	0.20488	0.003000	0.03518	0.609000	0.24238	2.084000	0.62774	0.528000	0.53228	AGT	FIGLA	-	superfamily_HLH_DNA-bd	ENSG00000183733		0.373	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGLA	HGNC	protein_coding	OTTHUMT00000331214.1	106	0.00	0	T	NM_001004311		71012744	71012744	-1	no_errors	ENST00000332372	ensembl	human	known	69_37n	missense	86	20.18	22	SNP	0.120	C
GIMAP6	474344	genome.wustl.edu	37	7	150325382	150325382	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr7:150325382G>T	ENST00000328902.5	-	3	520	c.304C>A	c.(304-306)Ccc>Acc	p.P102T	GIMAP6_ENST00000493969.1_Intron	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	102	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGACCTGGGGGGACAGAATG	0.617																																						dbGAP											0													77.0	79.0	78.0					7																	150325382		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.304C>A	7.37:g.150325382G>T	ENSP00000330374:p.Pro102Thr		C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	pfam_AIG1	p.P102T	ENST00000328902.5	37	c.304	CCDS34778.1	7	.	.	.	.	.	.	.	.	.	.	G	9.303	1.053672	0.19907	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.33438	1.41	4.07	-0.48	0.12085	AIG1 (1);	0.355032	0.29286	N	0.012598	T	0.16342	0.0393	L	0.34521	1.04	0.80722	D	1	B	0.14012	0.009	B	0.23150	0.044	T	0.32052	-0.9921	10	0.02654	T	1	.	7.9265	0.29878	0.5004:0.0:0.4996:0.0	.	102	Q6P9H5	GIMA6_HUMAN	T	102;163	ENSP00000330374:P102T	ENSP00000330374:P102T	P	-	1	0	GIMAP6	149956315	0.064000	0.20934	0.003000	0.11579	0.000000	0.00434	-0.263000	0.08670	-0.209000	0.10156	-1.134000	0.01955	CCC	GIMAP6	-	pfam_AIG1	ENSG00000133561		0.617	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP6	HGNC	protein_coding	OTTHUMT00000353457.1	30	0.00	0	G	NM_024711		150325382	150325382	-1	no_errors	ENST00000328902	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.805	T
GLI2	2736	genome.wustl.edu	37	2	121685040	121685040	+	Missense_Mutation	SNP	C	C	G	rs201412339	byFrequency	TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr2:121685040C>G	ENST00000452319.1	+	3	312	c.252C>G	c.(250-252)caC>caG	p.H84Q	GLI2_ENST00000361492.4_Missense_Mutation_p.H84Q|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR					GLI family zinc finger 2									p.H84Q(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				ACGGTGTGCACGGGTAAGTCC	0.612																																						dbGAP											1	Substitution - Missense(1)	lung(1)											215.0	166.0	183.0					2																	121685040		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.252C>G	2.37:g.121685040C>G	ENSP00000390436:p.His84Gln			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H84Q	ENST00000452319.1	37	c.252	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036317	0.54896	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000440937;ENST00000360874	T;T;T	0.70045	-0.45;-0.45;-0.45	5.24	-2.05	0.07321	.	0.124304	0.53938	N	0.000053	T	0.76615	0.4012	M	0.69823	2.125	0.80722	D	1	D;D;P;D	0.76494	0.999;0.992;0.8;0.999	D;P;P;D	0.72625	0.978;0.862;0.476;0.935	T	0.76329	-0.2999	10	0.87932	D	0	.	12.9343	0.58305	0.0:0.4012:0.0:0.5988	.	84;84;84;84	B4DT63;P10070;Q0VGA0;F5H4D9	.;GLI2_HUMAN;.;.	Q	84;84;84;76	ENSP00000390436:H84Q;ENSP00000354586:H84Q;ENSP00000441454:H76Q	ENSP00000441454:H76Q	H	+	3	2	GLI2	121401510	0.530000	0.26330	0.723000	0.30687	0.851000	0.48451	-0.228000	0.09114	-0.575000	0.05982	-2.010000	0.00438	CAC	GLI2	-	NULL	ENSG00000074047		0.612	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	35	0.00	0	C	NM_005270		121685040	121685040	+1	no_errors	ENST00000361492	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	0.904	G
GPR144	347088	genome.wustl.edu	37	9	127218946	127218946	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr9:127218946G>A	ENST00000334810.1	+	8	1495	c.1495G>A	c.(1495-1497)Gca>Aca	p.A499T				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	499					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GCAGCGCCTGGCACCCCTGCT	0.662																																						dbGAP											0													64.0	73.0	70.0					9																	127218946		692	1591	2283	-	-	-	SO:0001583	missense	0			AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1495G>A	9.37:g.127218946G>A	ENSP00000335156:p.Ala499Thr		Q86SL4|Q8NH12	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,prints_Pentaxin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.A499T	ENST00000334810.1	37	c.1495	CCDS48016.1	9	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910175	0.52439	.	.	ENSG00000180264	ENST00000334810;ENST00000439837	T	0.54479	0.57	4.37	3.47	0.39725	.	.	.	.	.	T	0.59390	0.2190	L	0.59436	1.845	0.27209	N	0.959958	D	0.69078	0.997	P	0.54815	0.761	T	0.50964	-0.8765	9	0.45353	T	0.12	.	10.1822	0.42975	0.0939:0.0:0.9061:0.0	.	499	Q7Z7M1	GP144_HUMAN	T	499;185	ENSP00000335156:A499T	ENSP00000335156:A499T	A	+	1	0	GPR144	126258767	1.000000	0.71417	0.991000	0.47740	0.332000	0.28634	3.842000	0.55858	0.966000	0.38159	-0.355000	0.07637	GCA	GPR144	-	NULL	ENSG00000180264		0.662	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	HGNC	protein_coding	OTTHUMT00000054026.2	14	0.00	0	G	NM_182611		127218946	127218946	+1	no_errors	ENST00000334810	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.957	A
GSK3A	2931	genome.wustl.edu	37	19	42744148	42744148	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr19:42744148G>C	ENST00000222330.3	-	2	557	c.430C>G	c.(430-432)Cta>Gta	p.L144V	AC006486.9_ENST00000594664.1_Missense_Mutation_p.L57V|GSK3A_ENST00000398249.4_Missense_Mutation_p.L62V|AC006486.1_ENST00000378108.1_5'Flank	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				ATGGCGACTAGTTCCCTGGTC	0.572																																						dbGAP											0													164.0	112.0	129.0					19																	42744148		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.430C>G	19.37:g.42744148G>C	ENSP00000222330:p.Leu144Val		O14959	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L144V	ENST00000222330.3	37	c.430	CCDS12599.1	19	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528886	0.27387	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.66099	-0.19;-0.19	4.98	1.51	0.23008	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.068082	0.56097	D	0.000027	T	0.38268	0.1034	N	0.20845	0.615	0.32755	N	0.505901	B;B	0.09022	0.002;0.0	B;B	0.12156	0.007;0.003	T	0.20874	-1.0262	10	0.22706	T	0.39	-6.1621	4.1662	0.10308	0.2868:0.0:0.5562:0.157	.	144;62	P49840;A8MT37	GSK3A_HUMAN;.	V	144;62;89	ENSP00000222330:L144V;ENSP00000381301:L62V	ENSP00000222330:L144V	L	-	1	2	GSK3A	47435988	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	2.366000	0.44204	0.177000	0.19895	-0.378000	0.06908	CTA	GSK3A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105723		0.572	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3A	HGNC	protein_coding	OTTHUMT00000319782.1	42	0.00	0	G			42744148	42744148	-1	no_errors	ENST00000222330	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	0.999	C
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72658429	72658429	+	RNA	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr7:72658429G>A	ENST00000425256.1	-	0	1482									GTF2I repeat domain containing 2 pseudogene 1																		cggacacatcgaaattctcat	0.443																																						dbGAP											0																																										-	-	-			0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658429G>A				RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.443	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	68	0.00	0	G	NR_002164		72658429	72658429	-1	no_errors	ENST00000425256	ensembl	human	known	69_37n	rna	70	32.04	33	SNP	0.982	A
HIST1H2BE	8344	genome.wustl.edu	37	6	26184396	26184397	+	In_Frame_Ins	INS	-	-	TGG			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr6:26184396_26184397insTGG	ENST00000356530.3	+	1	439_440	c.373_374insTGG	c.(373-375)tcc>tTGGcc	p.125_125S>LA		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	125					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(1)	4						GTACACCAGCTCCAAGTAAACT	0.54																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	Exception_encountered	6.37:g.26184396_26184397insTGG	ENSP00000348924:p.Ser125delinsLeuAla		P02278|Q3B872|Q4VB69|Q93078|Q93080	In_Frame_Ins	INS	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.S125in_frame_insLA	ENST00000356530.3	37	c.373_374	CCDS4588.1	6																																																																																			HIST1H2BE	-	superfamily_Histone-fold	ENSG00000197697		0.540	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BE	HGNC	protein_coding	OTTHUMT00000040090.1	33	0.00	0	-	NM_003523		26184396	26184397	+1	no_errors	ENST00000356530	ensembl	human	known	69_37n	in_frame_ins	19	24.00	6	INS	1.000:1.000	TGG
HIST1H2AI	8329	genome.wustl.edu	37	6	27776320	27776320	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr6:27776320C>A	ENST00000358739.3	+	1	422	c.333C>A	c.(331-333)aaC>aaA	p.N111K	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2BL_ENST00000377401.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	111						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						TCCTGCCCAACATCCAGGCCG	0.577																																						dbGAP											0													76.0	74.0	75.0					6																	27776320		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.333C>A	6.37:g.27776320C>A	ENSP00000351589:p.Asn111Lys		P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.N111K	ENST00000358739.3	37	c.333	CCDS4626.1	6	.	.	.	.	.	.	.	.	.	.	.	14.46	2.540786	0.45280	.	.	ENSG00000196747	ENST00000358739	T	0.44881	0.91	4.67	1.85	0.25348	.	0.000000	0.43747	D	0.000528	T	0.29389	0.0732	.	.	.	0.32958	D	0.520628	.	.	.	.	.	.	T	0.14587	-1.0467	7	0.72032	D	0.01	.	6.9152	0.24355	0.1412:0.7042:0.0:0.1546	.	.	.	.	K	111	ENSP00000351589:N111K	ENSP00000351589:N111K	N	+	3	2	HIST1H2AI	27884299	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	2.429000	0.44758	0.246000	0.21394	0.561000	0.74099	AAC	HIST1H2AI	-	superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000196747		0.577	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AI	HGNC	protein_coding	OTTHUMT00000040152.1	49	0.00	0	C	NM_003509		27776320	27776320	+1	no_errors	ENST00000358739	ensembl	human	known	69_37n	missense	35	32.69	17	SNP	1.000	A
IQGAP2	10788	genome.wustl.edu	37	5	75970488	75970488	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr5:75970488C>T	ENST00000274364.6	+	27	3778	c.3481C>T	c.(3481-3483)Ctc>Ttc	p.L1161F	IQGAP2_ENST00000396234.3_Missense_Mutation_p.L657F|IQGAP2_ENST00000379730.3_Missense_Mutation_p.L663F|IQGAP2_ENST00000502745.1_Missense_Mutation_p.L657F	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1161					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAATGAGCATCTCTCATCTAT	0.428																																						dbGAP											0													86.0	83.0	84.0					5																	75970488		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3481C>T	5.37:g.75970488C>T	ENSP00000274364:p.Leu1161Phe		A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.L1161F	ENST00000274364.6	37	c.3481	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982947	0.74474	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78	5.67	4.81	0.61882	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.116078	0.56097	D	0.000035	D	0.89798	0.6819	M	0.80508	2.5	0.54753	D	0.999981	D;D;D	0.71674	0.994;0.998;0.988	D;D;P	0.73708	0.969;0.981;0.802	D	0.90179	0.4241	10	0.87932	D	0	-13.5752	9.2525	0.37564	0.1448:0.7823:0.0:0.0728	.	663;657;1161	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	F	1161;663;1111;657;657	ENSP00000274364:L1161F;ENSP00000442313:L663F;ENSP00000421097:L1111F;ENSP00000379535:L657F;ENSP00000426027:L657F	ENSP00000274364:L1161F	L	+	1	0	IQGAP2	76006244	0.990000	0.36364	0.988000	0.46212	0.955000	0.61496	2.415000	0.44635	1.399000	0.46721	0.591000	0.81541	CTC	IQGAP2	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000145703		0.428	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	28	0.00	0	C	NM_006633		75970488	75970488	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	1.000	T
ITGAX	3687	genome.wustl.edu	37	16	31384615	31384615	+	Silent	SNP	A	A	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr16:31384615A>G	ENST00000268296.4	+	20	2533	c.2412A>G	c.(2410-2412)gaA>gaG	p.E804E	ITGAX_ENST00000562522.1_Silent_p.E804E	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	804					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TGAACGCAGAAGTGATGGTGT	0.562																																						dbGAP											0													137.0	103.0	115.0					16																	31384615		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2412A>G	16.37:g.31384615A>G			Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.E804	ENST00000268296.4	37	c.2412	CCDS10711.1	16																																																																																			ITGAX	-	pfam_Integrin_alpha-2	ENSG00000140678		0.562	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	21	0.00	0	A	NM_000887		31384615	31384615	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	0.000	G
ITIH2	3698	genome.wustl.edu	37	10	7773943	7773943	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr10:7773943T>C	ENST00000358415.4	+	13	1797	c.1631T>C	c.(1630-1632)gTt>gCt	p.V544A	ITIH2_ENST00000379587.4_Missense_Mutation_p.V533A	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	544					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						ATAGAGAGCGTTATCACGGCG	0.448																																						dbGAP											0													137.0	129.0	131.0					10																	7773943		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1631T>C	10.37:g.7773943T>C	ENSP00000351190:p.Val544Ala		Q14659|Q15484|Q5T986	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.V544A	ENST00000358415.4	37	c.1631	CCDS31141.1	10	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833402	0.32421	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.10477	2.87;2.87	5.44	5.44	0.79542	.	0.421460	0.27464	N	0.019258	T	0.10465	0.0256	L	0.34521	1.04	0.09310	N	0.999999	B	0.19706	0.038	B	0.20767	0.031	T	0.19484	-1.0304	10	0.27785	T	0.31	-9.2508	15.513	0.75798	0.0:0.0:0.0:1.0	.	544	P19823	ITIH2_HUMAN	A	544;533	ENSP00000351190:V544A;ENSP00000368906:V533A	ENSP00000351190:V544A	V	+	2	0	ITIH2	7813949	0.798000	0.28890	0.007000	0.13788	0.004000	0.04260	5.440000	0.66563	2.070000	0.61991	0.523000	0.50628	GTT	ITIH2	-	NULL	ENSG00000151655		0.448	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH2	HGNC	protein_coding	OTTHUMT00000046678.2	53	0.00	0	T	NM_002216		7773943	7773943	+1	no_errors	ENST00000358415	ensembl	human	known	69_37n	missense	35	36.36	20	SNP	0.342	C
KBTBD4	55709	genome.wustl.edu	37	11	47599443	47599444	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:47599443_47599444insA	ENST00000526005.1	-	2	261_262	c.108_109insT	c.(106-111)aaactgfs	p.L37fs	NDUFS3_ENST00000534208.1_5'Flank|NDUFS3_ENST00000528192.1_5'Flank|KBTBD4_ENST00000525720.1_Frame_Shift_Ins_p.L86fs|KBTBD4_ENST00000450908.1_3'UTR|KBTBD4_ENST00000533290.1_Frame_Shift_Ins_p.L62fs|KBTBD4_ENST00000395288.2_Frame_Shift_Ins_p.L37fs|RNU5E-10P_ENST00000363506.1_RNA|NDUFS3_ENST00000529276.1_5'Flank|NDUFS3_ENST00000533507.1_Intron|NDUFS3_ENST00000534716.2_5'Flank|KBTBD4_ENST00000430070.2_Frame_Shift_Ins_p.L53fs|NDUFS3_ENST00000263774.4_5'Flank			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	37										NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						TCTAGACACAGTTTCATGATGC	0.52																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.108_109insT	11.37:g.47599443_47599444insA	ENSP00000433340:p.Leu37fs		D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.L52fs	ENST00000526005.1	37	c.157_156	CCDS7940.1	11																																																																																			KBTBD4	-	superfamily_BTB/POZ_fold	ENSG00000123444		0.520	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	HGNC	protein_coding	OTTHUMT00000391763.1	33	0.00	0	-	NM_016506		47599443	47599444	-1	no_errors	ENST00000430070	ensembl	human	known	69_37n	frame_shift_ins	27	15.62	5	INS	1.000:1.000	A
KIAA0319	9856	genome.wustl.edu	37	6	24559272	24559272	+	Missense_Mutation	SNP	C	C	G	rs370433424		TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr6:24559272C>G	ENST00000378214.3	-	17	3227	c.2703G>C	c.(2701-2703)ttG>ttC	p.L901F	KIAA0319_ENST00000535378.1_Missense_Mutation_p.L892F|KIAA0319_ENST00000430948.2_Missense_Mutation_p.L856F|KIAA0319_ENST00000537886.1_Missense_Mutation_p.L901F|KIAA0319_ENST00000543707.1_Missense_Mutation_p.L901F	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	901					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CCTTGAAAAGCAAGAAGTCAG	0.443																																						dbGAP											0													72.0	60.0	64.0					6																	24559272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2703G>C	6.37:g.24559272C>G	ENSP00000367459:p.Leu901Phe		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.L901F	ENST00000378214.3	37	c.2703	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281903	0.59758	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.11930	2.75;2.73;2.74;2.73;2.73	4.02	3.14	0.36123	.	0.000000	0.64402	D	0.000007	T	0.22322	0.0538	M	0.79011	2.435	0.45378	D	0.998361	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.997	T	0.01045	-1.1470	10	0.59425	D	0.04	-10.2707	5.4041	0.16312	0.1784:0.6617:0.0:0.1598	.	901;892;901	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	F	901;892;856;901;901	ENSP00000439700:L901F;ENSP00000442403:L892F;ENSP00000401086:L856F;ENSP00000367459:L901F;ENSP00000437656:L901F	ENSP00000367459:L901F	L	-	3	2	KIAA0319	24667251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.048000	0.30379	2.227000	0.72691	0.644000	0.83932	TTG	KIAA0319	-	NULL	ENSG00000137261		0.443	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	37	0.00	0	C	NM_014809		24559272	24559272	-1	no_errors	ENST00000378214	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	1.000	G
LILRA6	79168	genome.wustl.edu	37	19	54745496	54745496	+	Missense_Mutation	SNP	C	C	T	rs77659630	byFrequency	TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr19:54745496C>T	ENST00000396365.2	-	4	653	c.614G>A	c.(613-615)cGg>cAg	p.R205Q	LILRA6_ENST00000245621.5_Missense_Mutation_p.R205Q|LILRA6_ENST00000440558.2_Missense_Mutation_p.R205Q|LILRA6_ENST00000419410.2_Missense_Mutation_p.R205Q|LILRA6_ENST00000270464.5_Missense_Mutation_p.R205Q|LILRA6_ENST00000391735.3_Intron|LILRB3_ENST00000407860.2_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	205					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGACCACACCCGGGGGGTGTT	0.617																																						dbGAP											0													51.0	57.0	55.0					19																	54745496		1978	4035	6013	-	-	-	SO:0001583	missense	0			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.614G>A	19.37:g.54745496C>T	ENSP00000379651:p.Arg205Gln			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R205Q	ENST00000396365.2	37	c.614	CCDS42610.1	19	.	.	.	.	.	.	.	.	.	.	T	2.462	-0.323916	0.05350	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T	0.00695	5.83;5.83;5.83;5.83;5.83	2.38	2.38	0.29361	Immunoglobulin-like fold (1);	1.294080	0.05328	N	0.527713	T	0.00356	0.0011	N	0.00633	-1.31	0.09310	N	1	B;B;B;B	0.18741	0.006;0.03;0.005;0.003	B;B;B;B	0.08055	0.001;0.003;0.0;0.001	T	0.41124	-0.9526	10	0.08837	T	0.75	.	4.4951	0.11833	0.0:0.1675:0.0:0.8325	.	205;205;205;205	C9JFH3;Q6PI73;F8WCY4;D3YTC4	.;LIRA6_HUMAN;.;.	Q	205	ENSP00000390120:R205Q;ENSP00000270464:R205Q;ENSP00000411227:R205Q;ENSP00000379651:R205Q;ENSP00000245621:R205Q	ENSP00000245621:R205Q	R	-	2	0	LILRA6	59437308	0.000000	0.05858	0.029000	0.17559	0.103000	0.19146	-0.731000	0.04909	0.334000	0.23590	-1.877000	0.00547	CGG	LILRA6	-	NULL	ENSG00000244482		0.617	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	HGNC	protein_coding	OTTHUMT00000313725.1	22	0.00	0	C	NM_024318		54745496	54745496	-1	no_errors	ENST00000270464	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.036	T
LIN9	286826	genome.wustl.edu	37	1	226426761	226426761	+	Silent	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:226426761G>T	ENST00000328205.5	-	12	1749	c.1204C>A	c.(1204-1206)Cgg>Agg	p.R402R	LIN9_ENST00000481685.1_Silent_p.R367R|LIN9_ENST00000366801.1_Silent_p.R351R	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	386					DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		GCATATCTCCGCTGAAATTCA	0.348																																					Ovarian(197;1696 2974 11248 14117)	dbGAP											0													109.0	103.0	105.0					1																	226426761		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.1204C>A	1.37:g.226426761G>T			Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Silent	SNP	pfam_DIRP	p.R402	ENST00000328205.5	37	c.1204	CCDS1553.1	1																																																																																			LIN9	-	NULL	ENSG00000183814		0.348	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN9	HGNC	protein_coding	OTTHUMT00000091523.2	65	0.00	0	G	NM_173083		226426761	226426761	-1	no_errors	ENST00000328205	ensembl	human	known	69_37n	silent	52	46.39	45	SNP	1.000	T
LNX2	222484	genome.wustl.edu	37	13	28134091	28134091	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr13:28134091G>T	ENST00000316334.3	-	6	1385	c.1256C>A	c.(1255-1257)gCt>gAt	p.A419D		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	419	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CCCTGGTCTAGCAATTGTTAA	0.433																																						dbGAP											0													243.0	205.0	218.0					13																	28134091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1256C>A	13.37:g.28134091G>T	ENSP00000325929:p.Ala419Asp		Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.A419D	ENST00000316334.3	37	c.1256	CCDS9323.1	13	.	.	.	.	.	.	.	.	.	.	G	17.73	3.462419	0.63513	.	.	ENSG00000139517	ENST00000316334	T	0.40225	1.04	5.57	5.57	0.84162	PDZ/DHR/GLGF (3);	0.182248	0.49916	D	0.000135	T	0.52041	0.1710	M	0.78801	2.425	0.45541	D	0.998495	B	0.31705	0.336	B	0.36335	0.222	T	0.51919	-0.8644	10	0.40728	T	0.16	.	19.5365	0.95255	0.0:0.0:1.0:0.0	.	419	Q8N448	LNX2_HUMAN	D	419	ENSP00000325929:A419D	ENSP00000325929:A419D	A	-	2	0	LNX2	27032091	1.000000	0.71417	0.992000	0.48379	0.943000	0.58893	4.761000	0.62243	2.618000	0.88619	0.563000	0.77884	GCT	LNX2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000139517		0.433	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX2	HGNC	protein_coding	OTTHUMT00000044302.2	115	0.00	0	G			28134091	28134091	-1	no_errors	ENST00000316334	ensembl	human	known	69_37n	missense	89	35.97	50	SNP	0.996	T
LYST	1130	genome.wustl.edu	37	1	235891402	235891402	+	Missense_Mutation	SNP	T	T	C	rs80338665		TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:235891402T>C	ENST00000389794.3	-	38	9310	c.9136A>G	c.(9136-9138)Aat>Gat	p.N3046D	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.N3046D			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3046					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCAGAAGCATTATCTTCCACA	0.333																																						dbGAP											0													123.0	120.0	121.0					1																	235891402		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9136A>G	1.37:g.235891402T>C	ENSP00000374444:p.Asn3046Asp		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N3046D	ENST00000389794.3	37	c.9136	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.236508	0.79800	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.62941	-0.01;-0.01	5.56	5.56	0.83823	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.60625	0.2283	L	0.58101	1.795	0.80722	D	1	P	0.40360	0.714	B	0.41236	0.351	T	0.57957	-0.7721	10	0.18276	T	0.48	.	16.002	0.80301	0.0:0.0:0.0:1.0	.	3046	Q99698	LYST_HUMAN	D	3046	ENSP00000374444:N3046D;ENSP00000374443:N3046D	ENSP00000374443:N3046D	N	-	1	0	LYST	233958025	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.449000	0.80643	2.241000	0.73720	0.533000	0.62120	AAT	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.333	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	55	0.00	0	T			235891402	235891402	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	missense	59	27.16	22	SNP	1.000	C
MAP3K13	9175	genome.wustl.edu	37	3	185165736	185165736	+	Splice_Site	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr3:185165736G>A	ENST00000265026.3	+	5	1344		c.e5+1		MAP3K13_ENST00000446828.1_Splice_Site|MAP3K13_ENST00000424227.1_Splice_Site|MAP3K13_ENST00000535426.1_Splice_Site|MAP3K13_ENST00000443863.1_Splice_Site	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TTGATATATGGTGAGTGGCGC	0.458																																						dbGAP											0													52.0	50.0	50.0					3																	185165736		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1010+1G>A	3.37:g.185165736G>A				Splice_Site	SNP	-	e4+1	ENST00000265026.3	37	c.1010+1	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107717	0.77096	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6412	0.95758	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP3K13	186648430	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	9.869000	0.99810	2.710000	0.92621	0.555000	0.69702	.	MAP3K13	-	-	ENSG00000073803		0.458	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1	26	0.00	0	G	NM_004721	Intron	185165736	185165736	+1	no_errors	ENST00000265026	ensembl	human	known	69_37n	splice_site	23	25.81	8	SNP	1.000	A
MAP3K6	9064	genome.wustl.edu	37	1	27682955	27682955	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:27682955G>C	ENST00000493901.1	-	27	3800	c.3561C>G	c.(3559-3561)taC>taG	p.Y1187*	MAP3K6_ENST00000374040.3_Nonsense_Mutation_p.Y1179*|MAP3K6_ENST00000357582.2_Nonsense_Mutation_p.Y1187*	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	1187					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCAGGGCCTGGTACTCCCGTT	0.642																																						dbGAP											0													31.0	35.0	34.0					1																	27682955		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.3561C>G	1.37:g.27682955G>C	ENSP00000419591:p.Tyr1187*		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y1187*	ENST00000493901.1	37	c.3561	CCDS299.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.595300|9.595300	0.99214|0.99214	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000486046|ENST00000374040;ENST00000493901;ENST00000374036;ENST00000357582	.|.	.|.	.|.	5.45|5.45	4.54|4.54	0.55810|0.55810	.|.	.|.	.|.	.|.	.|.	T|.	0.26629|.	0.0651|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.26643|.	-1.0097|.	3|.	.|0.02654	.|T	.|1	.|.	11.4233|11.4233	0.49996|0.49996	0.0854:0.0:0.9146:0.0|0.0854:0.0:0.9146:0.0	.|.	.|.	.|.	.|.	S|X	3|1179;1187;25;1187	.|.	.|ENSP00000350195:Y1187X	T|Y	-|-	2|3	0|2	MAP3K6|MAP3K6	27555542|27555542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.198000|0.198000	0.23893|0.23893	3.188000|3.188000	0.50958|0.50958	1.292000|1.292000	0.44672|0.44672	0.655000|0.655000	0.94253|0.94253	ACC|TAC	MAP3K6	-	NULL	ENSG00000142733		0.642	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2	21	0.00	0	G	NM_004672		27682955	27682955	-1	no_errors	ENST00000357582	ensembl	human	known	69_37n	nonsense	10	50.00	10	SNP	1.000	C
KMT2A	4297	genome.wustl.edu	37	11	118344574	118344575	+	Frame_Shift_Ins	INS	-	-	TAAA			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:118344574_118344575insTAAA	ENST00000389506.5	+	3	2700_2701	c.2700_2701insTAAA	c.(2701-2703)agtfs	p.S901fs	KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.S901fs|KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.S901fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	901					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGAAATTCAGAGTAGTTCTGC	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	Exception_encountered	11.37:g.118344574_118344575insTAAA	ENSP00000374157:p.Ser901fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.S900fs	ENST00000389506.5	37	c.2700_2701	CCDS31686.1	11																																																																																			MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.460	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	89	0.00	0	-	NM_005933		118344574	118344575	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	frame_shift_ins	22	42.11	16	INS	1.000:1.000	TAAA
MOGAT3	346606	genome.wustl.edu	37	7	100842014	100842014	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr7:100842014G>C	ENST00000223114.4	-	4	552	c.386C>G	c.(385-387)aCc>aGc	p.T129S	MOGAT3_ENST00000440203.2_Missense_Mutation_p.T129S|MOGAT3_ENST00000379423.3_Missense_Mutation_p.T129S	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	129					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					ATTGCTCTCGGTGGAGAAATT	0.597																																						dbGAP											0													71.0	76.0	74.0					7																	100842014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.386C>G	7.37:g.100842014G>C	ENSP00000223114:p.Thr129Ser		Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	pfam_DAGAT	p.T129S	ENST00000223114.4	37	c.386	CCDS5714.1	7	.	.	.	.	.	.	.	.	.	.	.	19.50	3.839965	0.71488	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	D;T;T	0.93076	-3.16;2.34;2.34	5.56	3.7	0.42460	.	0.049495	0.85682	N	0.000000	D	0.94512	0.8233	L	0.60012	1.86	0.46701	D	0.999161	P;D	0.65815	0.952;0.995	P;D	0.65573	0.554;0.936	D	0.92918	0.6353	10	0.51188	T	0.08	-22.153	8.8977	0.35474	0.0828:0.1511:0.7661:0.0	.	129;129	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	S	129	ENSP00000223114:T129S;ENSP00000403756:T129S;ENSP00000368734:T129S	ENSP00000223114:T129S	T	-	2	0	MOGAT3	100628734	1.000000	0.71417	0.006000	0.13384	0.070000	0.16714	6.060000	0.71141	0.666000	0.31087	0.655000	0.94253	ACC	MOGAT3	-	pfam_DAGAT	ENSG00000106384		0.597	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT3	HGNC	protein_coding	OTTHUMT00000059649.3	26	0.00	0	G	NM_178176		100842014	100842014	-1	no_errors	ENST00000440203	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	0.955	C
NSFL1C	55968	genome.wustl.edu	37	20	1435746	1435746	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr20:1435746G>C	ENST00000216879.4	-	4	1177	c.310C>G	c.(310-312)Cag>Gag	p.Q104E	NSFL1C_ENST00000353088.2_Missense_Mutation_p.Q104E|NSFL1C_ENST00000381658.4_Intron|NSFL1C_ENST00000350991.4_Missense_Mutation_p.Q106E|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000476071.1_Missense_Mutation_p.Q106E	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	104						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						ACAATCTGCTGTCCACTTCTC	0.483																																						dbGAP											0													198.0	209.0	205.0					20																	1435746		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.310C>G	20.37:g.1435746G>C	ENSP00000216879:p.Gln104Glu		A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	pfam_SEP_domain,pfam_UBX,superfamily_SEP_domain,superfamily_UBA-like,smart_SEP_domain,smart_UBX,pfscan_UBX	p.Q106E	ENST00000216879.4	37	c.316	CCDS13015.1	20	.	.	.	.	.	.	.	.	.	.	G	9.060	0.994202	0.19043	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000350991	T;T;T;T	0.50813	0.73;0.85;0.84;0.84	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.67543	0.2904	M	0.71581	2.175	0.80722	D	1	P;D	0.54964	0.954;0.969	D;D	0.67900	0.954;0.93	T	0.68988	-0.5264	10	0.62326	D	0.03	-14.1867	17.2387	0.87007	0.0:0.0:1.0:0.0	.	104;104	Q9UNZ2-4;Q9UNZ2	.;NSF1C_HUMAN	E	104;106;104;106	ENSP00000338643:Q104E;ENSP00000418529:Q106E;ENSP00000216879:Q104E;ENSP00000202584:Q106E	ENSP00000216879:Q104E	Q	-	1	0	NSFL1C	1383746	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.359000	0.79477	2.805000	0.96524	0.655000	0.94253	CAG	NSFL1C	-	NULL	ENSG00000088833		0.483	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NSFL1C	HGNC	protein_coding	OTTHUMT00000077525.2	63	0.00	0	G	NM_016143		1435746	1435746	-1	no_errors	ENST00000350991	ensembl	human	known	69_37n	missense	69	21.59	19	SNP	1.000	C
NTRK2	4915	genome.wustl.edu	37	9	87563383	87563383	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr9:87563383A>T	ENST00000323115.4	+	14	2076	c.1723A>T	c.(1723-1725)Aag>Tag	p.K575*	NTRK2_ENST00000277120.3_Nonsense_Mutation_p.K591*|NTRK2_ENST00000376214.1_Nonsense_Mutation_p.K591*|NTRK2_ENST00000376213.1_Nonsense_Mutation_p.K575*			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	575	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCAGACCCTGAAGGATGCCAG	0.502										TSP Lung(25;0.17)																												dbGAP											0													95.0	72.0	80.0					9																	87563383		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1723A>T	9.37:g.87563383A>T	ENSP00000314586:p.Lys575*		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.K591*	ENST00000323115.4	37	c.1771	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	A	48	14.131397	0.99781	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3196	0.74112	1.0:0.0:0.0:0.0	.	.	.	.	X	591;575;591;575	.	ENSP00000277120:K591X	K	+	1	0	NTRK2	86753203	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.339000	0.96797	2.029000	0.59856	0.533000	0.62120	AAG	NTRK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000148053		0.502	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1	35	0.00	0	A			87563383	87563383	+1	no_errors	ENST00000277120	ensembl	human	known	69_37n	nonsense	28	17.65	6	SNP	1.000	T
ONECUT2	9480	genome.wustl.edu	37	18	55103476	55103477	+	In_Frame_Ins	INS	-	-	CAC			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr18:55103476_55103477insCAC	ENST00000491143.2	+	1	560_561	c.528_529insCAC	c.(529-531)cac>CACcac	p.177_177H>HH	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	177	Poly-His.				cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		accaccatccgcaccaccacca	0.658																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.550_552dupCAC	18.37:g.55103483_55103485dupCAC	ENSP00000419185:p.His184dup			In_Frame_Ins	INS	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.180in_frame_insH	ENST00000491143.2	37	c.528_529	CCDS42440.1	18																																																																																			ONECUT2	-	NULL	ENSG00000119547		0.658	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT2	HGNC	protein_coding	OTTHUMT00000357264.3	16	0.00	0	-			55103476	55103477	+1	no_errors	ENST00000262095	ensembl	human	known	69_37n	in_frame_ins	21	32.26	10	INS	0.715:1.000	CAC
PARP4	143	genome.wustl.edu	37	13	25058867	25058867	+	Missense_Mutation	SNP	C	C	T	rs143070451	byFrequency	TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr13:25058867C>T	ENST00000381989.3	-	12	1477	c.1372G>A	c.(1372-1374)Gta>Ata	p.V458I		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	458	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCTTCCACTACTTTGGGTAAA	0.453																																						dbGAP											0													136.0	138.0	137.0					13																	25058867		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1372G>A	13.37:g.25058867C>T	ENSP00000371419:p.Val458Ile		O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.V458I	ENST00000381989.3	37	c.1372	CCDS9307.1	13	47	0.02152014652014652	23	0.046747967479674794	2	0.0055248618784530384	7	0.012237762237762238	15	0.01978891820580475	C	16.65	3.183039	0.57800	.	.	ENSG00000102699	ENST00000381989	T	0.13901	2.55	4.35	3.4	0.38934	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.162995	0.39985	N	0.001218	T	0.01523	0.0049	L	0.41906	1.305	0.26728	N	0.970657	P	0.37708	0.606	B	0.39904	0.313	T	0.12528	-1.0544	10	0.42905	T	0.14	-16.8693	5.0719	0.14611	0.0:0.7642:0.0:0.2358	.	458	Q9UKK3	PARP4_HUMAN	I	458	ENSP00000371419:V458I	ENSP00000371419:V458I	V	-	1	0	PARP4	23956867	0.210000	0.23517	0.999000	0.59377	0.973000	0.67179	0.932000	0.28884	2.229000	0.72834	0.650000	0.86243	GTA	PARP4	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000102699		0.453	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	48	0.00	0	C	NM_006437		25058867	25058867	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.992	T
PHKA2	5256	genome.wustl.edu	37	X	18942252	18942252	+	Splice_Site	SNP	G	G	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chrX:18942252G>T	ENST00000379942.4	-	17	2380	c.1715C>A	c.(1714-1716)aCa>aAa	p.T572K		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	572					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCCATCATTTGCTAAGGAAAA	0.338																																						dbGAP											0													60.0	64.0	63.0					X																	18942252		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1715-1C>A	X.37:g.18942252G>T			A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.T572K	ENST00000379942.4	37	c.1715	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	N	12.09	1.835101	0.32421	.	.	ENSG00000044446	ENST00000379942	D	0.90197	-2.63	5.77	4.85	0.62838	Glycoside hydrolase 15-related (1);	0.278723	0.42548	D	0.000690	T	0.79052	0.4381	N	0.16567	0.415	0.39412	D	0.966763	B	0.16166	0.016	B	0.22601	0.04	T	0.68142	-0.5487	10	0.13853	T	0.58	.	4.0269	0.09692	0.2531:0.0:0.5732:0.1737	.	572	P46019	KPB2_HUMAN	K	572	ENSP00000369274:T572K	ENSP00000369274:T572K	T	-	2	0	PHKA2	18852173	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.046000	0.30354	1.185000	0.42971	0.597000	0.82753	ACA	PHKA2	-	pfam_Glyco_hydro_15	ENSG00000044446		0.338	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	29	0.00	0	G	NM_000292	Missense_Mutation	18942252	18942252	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	T
RBM46	166863	genome.wustl.edu	37	4	155719029	155719029	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr4:155719029A>T	ENST00000281722.3	+	3	453	c.218A>T	c.(217-219)tAt>tTt	p.Y73F	RBM46_ENST00000510397.1_Missense_Mutation_p.Y73F|RBM46_ENST00000514866.1_Missense_Mutation_p.Y73F	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	73	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				CGTGATATGTATGAAGATGAG	0.373																																						dbGAP											0													129.0	132.0	131.0					4																	155719029		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.218A>T	4.37:g.155719029A>T	ENSP00000281722:p.Tyr73Phe		B3KWU8|B4DZ27	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.Y73F	ENST00000281722.3	37	c.218	CCDS3790.1	4	.	.	.	.	.	.	.	.	.	.	A	9.819	1.185286	0.21870	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.9	5.9	0.94986	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.09642	0.0237	N	0.05177	-0.1	0.80722	D	1	B;B;B	0.17268	0.021;0.011;0.01	B;B;B	0.26614	0.028;0.035;0.071	T	0.16512	-1.0400	10	0.07482	T	0.82	-14.9079	16.3245	0.82970	1.0:0.0:0.0:0.0	.	73;73;73	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	F	73	ENSP00000424500:Y73F;ENSP00000281722:Y73F;ENSP00000422813:Y73F;ENSP00000426672:Y73F	ENSP00000281722:Y73F	Y	+	2	0	RBM46	155938479	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.881000	0.69706	2.254000	0.74563	0.460000	0.39030	TAT	RBM46	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000151962		0.373	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM46	HGNC	protein_coding	OTTHUMT00000365259.1	79	0.00	0	A	NM_144979		155719029	155719029	+1	no_errors	ENST00000281722	ensembl	human	known	69_37n	missense	65	29.35	27	SNP	1.000	T
RNASEK	440400	genome.wustl.edu	37	17	6917541	6917541	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr17:6917541T>C	ENST00000548577.1	+	3	500	c.350T>C	c.(349-351)cTc>cCc	p.L117P	MIR497HG_ENST00000572453.1_RNA|C17orf49_ENST00000546495.1_5'Flank|RNASEK_ENST00000402093.1_Missense_Mutation_p.L78P|MIR497HG_ENST00000443997.1_RNA|AC027763.2_ENST00000399541.2_5'Flank|C17orf49_ENST00000546760.1_5'Flank|AC027763.2_ENST00000575727.1_5'Flank|AC027763.2_ENST00000399540.2_5'Flank|C17orf49_ENST00000552775.1_5'Flank|AC027763.2_ENST00000574377.1_5'Flank|RNASEK-C17orf49_ENST00000547302.2_Missense_Mutation_p.S30P|AC040977.1_ENST00000593646.1_Missense_Mutation_p.E72G|RNASEK_ENST00000552321.1_Missense_Mutation_p.L76P|AC027763.2_ENST00000573939.1_5'Flank|C17orf49_ENST00000439424.2_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|C17orf49_ENST00000552402.1_5'Flank	NM_001004333.4	NP_001004333.2	Q6P5S7	RNK_HUMAN	ribonuclease, RNase K	117					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA transcription (GO:0009303)	integral component of membrane (GO:0016021)	endoribonuclease activity (GO:0004521)			lung(1)	1						CTTTACCTCCTCCTCGGAGGC	0.562																																						dbGAP											0													40.0	42.0	42.0					17																	6917541		1929	4127	6056	-	-	-	SO:0001583	missense	0			AK289930	CCDS45594.1, CCDS45594.2	17p13.1	2010-10-28				ENSG00000219200			33911	protein-coding gene	gene with protein product						17881363	Standard	NM_001004333		Approved	MGC71993		Q6P5S7		ENST00000548577.1:c.350T>C	17.37:g.6917541T>C	ENSP00000449500:p.Leu117Pro		G3V1Z9|Q502Z2	Missense_Mutation	SNP	NULL	p.L117P	ENST00000548577.1	37	c.350	CCDS45594.2	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.4|22.4	4.279527|4.279527	0.80692|0.80692	.|.	.|.	ENSG00000219200|ENSG00000161939	ENST00000548577;ENST00000402093;ENST00000552321|ENST00000547302	.|.	.|.	.|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|.	.|.	.|.	.|.	T|T	0.57344|0.57344	0.2047|0.2047	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.44195|.	0.828|.	B|.	0.38803|.	0.282|.	T|T	0.54390|0.54390	-0.8301|-0.8301	7|5	.|.	.|.	.|.	-7.0133|-7.0133	13.9033|13.9033	0.63819|0.63819	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	78|.	Q6P5S7|.	RNK_HUMAN|.	P|P	117;78;76|30	.|.	.|.	L|S	+|+	2|1	0|0	RNASEK|C17orf49	6858265|6858265	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.358000|2.358000	0.44134|0.44134	2.163000|2.163000	0.67991|0.67991	0.533000|0.533000	0.62120|0.62120	CTC|TCC	RNASEK	-	NULL	ENSG00000219200		0.562	RNASEK-001	KNOWN	basic|CCDS	protein_coding	RNASEK	HGNC	protein_coding	OTTHUMT00000407651.1	26	0.00	0	T	NM_001004333		6917541	6917541	+1	no_errors	ENST00000548577	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	C
RHBDF2	79651	genome.wustl.edu	37	17	74470176	74470176	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr17:74470176T>C	ENST00000313080.4	-	13	1873	c.1600A>G	c.(1600-1602)Atg>Gtg	p.M534V	RHBDF2_ENST00000591885.1_Missense_Mutation_p.M505V|RHBDF2_ENST00000389760.4_Missense_Mutation_p.M505V	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	534					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						GACTTGTCCATGGGGGGCCCA	0.642																																						dbGAP											0													45.0	45.0	45.0					17																	74470176		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1600A>G	17.37:g.74470176T>C	ENSP00000322775:p.Met534Val		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.M534V	ENST00000313080.4	37	c.1600	CCDS32743.1	17	.	.	.	.	.	.	.	.	.	.	T	8.914	0.959423	0.18507	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.53423	0.62;0.63	4.87	1.34	0.21922	.	0.411474	0.29015	N	0.013407	T	0.24890	0.0604	N	0.16478	0.41	0.25411	N	0.988351	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.12066	-1.0562	10	0.25751	T	0.34	-22.7179	5.0393	0.14451	0.0:0.2344:0.3049:0.4607	.	480;534;505	Q6ZWP8;Q6PJF5;Q6PJF5-2	.;RHDF2_HUMAN;.	V	534;505;480	ENSP00000322775:M534V;ENSP00000374410:M505V	ENSP00000322775:M534V	M	-	1	0	RHBDF2	71981771	0.424000	0.25490	0.997000	0.53966	0.996000	0.88848	0.357000	0.20199	-0.043000	0.13513	0.459000	0.35465	ATG	RHBDF2	-	NULL	ENSG00000129667		0.642	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	HGNC	protein_coding	OTTHUMT00000450134.1	23	0.00	0	T	NM_024599		74470176	74470176	-1	no_errors	ENST00000313080	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.984	C
ROCK1	6093	genome.wustl.edu	37	18	18586456	18586456	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr18:18586456G>C	ENST00000399799.2	-	16	2681	c.1741C>G	c.(1741-1743)Ctg>Gtg	p.L581V		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	581	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TCTCTGTTCAGGGACTCTAAC	0.398																																						dbGAP											0													165.0	149.0	154.0					18																	18586456		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1741C>G	18.37:g.18586456G>C	ENSP00000382697:p.Leu581Val		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rho-bd,pfam_HR1_rho-bd,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L581V	ENST00000399799.2	37	c.1741	CCDS11870.2	18	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631864	0.29068	.	.	ENSG00000067900	ENST00000399799	T	0.66995	-0.24	5.31	3.53	0.40419	.	0.079509	0.52532	D	0.000067	T	0.57330	0.2046	L	0.47716	1.5	0.45427	D	0.998405	B	0.13145	0.007	B	0.14023	0.01	T	0.51188	-0.8737	10	0.29301	T	0.29	.	11.7296	0.51728	0.1419:0.0:0.8581:0.0	.	581	Q13464	ROCK1_HUMAN	V	581	ENSP00000382697:L581V	ENSP00000382697:L581V	L	-	1	2	ROCK1	16840454	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	1.266000	0.33039	0.818000	0.34468	0.563000	0.77884	CTG	ROCK1	-	pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000067900		0.398	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK1	HGNC	protein_coding	OTTHUMT00000254641.2	63	0.00	0	G	NM_005406		18586456	18586456	-1	no_errors	ENST00000399799	ensembl	human	known	69_37n	missense	53	35.37	29	SNP	1.000	C
SART3	9733	genome.wustl.edu	37	12	108920132	108920132	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr12:108920132G>A	ENST00000228284.3	-	16	2348	c.2114C>T	c.(2113-2115)aCc>aTc	p.T705I	SART3_ENST00000431469.2_Missense_Mutation_p.T669I	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	705	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						GACAAAGACGGTGATGCTGTC	0.612									Porokeratosis																													dbGAP											0													112.0	87.0	95.0					12																	108920132		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.2114C>T	12.37:g.108920132G>A	ENSP00000228284:p.Thr705Ile		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.T705I	ENST00000228284.3	37	c.2114	CCDS9117.1	12	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876271	0.51801	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000546815	T;T;T	0.49720	3.17;1.86;0.77	5.7	5.7	0.88788	RNA recognition motif domain (2);	0.092981	0.85682	D	0.000000	T	0.75184	0.3815	M	0.89601	3.045	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.991	D;P;P	0.67900	0.954;0.901;0.701	T	0.79217	-0.1894	10	0.59425	D	0.04	-29.9548	19.8471	0.96713	0.0:0.0:1.0:0.0	.	723;669;705	F8VV04;B7ZKM0;Q15020	.;.;SART3_HUMAN	I	705;669;723	ENSP00000228284:T705I;ENSP00000414453:T669I;ENSP00000449386:T723I	ENSP00000228284:T705I	T	-	2	0	SART3	107444262	1.000000	0.71417	0.896000	0.35187	0.017000	0.09413	6.993000	0.76245	2.688000	0.91661	0.655000	0.94253	ACC	SART3	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000075856		0.612	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1	34	0.00	0	G			108920132	108920132	-1	no_errors	ENST00000228284	ensembl	human	known	69_37n	missense	22	60.00	33	SNP	0.998	A
TMEM86A	144110	genome.wustl.edu	37	11	18723330	18723330	+	Missense_Mutation	SNP	G	G	C	rs534042578		TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:18723330G>C	ENST00000280734.2	+	3	593	c.497G>C	c.(496-498)cGg>cCg	p.R166P		NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A	166						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						GCAGGGCTGCGGCTGGCCGGG	0.607																																						dbGAP											0													52.0	49.0	50.0					11																	18723330		2199	4293	6492	-	-	-	SO:0001583	missense	0			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4		ENST00000280734.2:c.497G>C	11.37:g.18723330G>C	ENSP00000280734:p.Arg166Pro		Q96AJ0	Missense_Mutation	SNP	pfam_YhhN	p.R166P	ENST00000280734.2	37	c.497	CCDS7844.1	11	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275973	0.40294	.	.	ENSG00000151117	ENST00000535380;ENST00000280734	T	0.24908	1.83	5.43	0.388	0.16264	.	0.261871	0.39407	N	0.001364	T	0.20007	0.0481	L	0.42245	1.32	0.34837	D	0.740332	B	0.29085	0.232	B	0.34038	0.174	T	0.20107	-1.0285	9	.	.	.	-6.4084	8.8407	0.35140	0.5935:0.0:0.4065:0.0	.	166	Q8N2M4	TM86A_HUMAN	P	166	ENSP00000280734:R166P	.	R	+	2	0	TMEM86A	18679906	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	1.915000	0.39976	-0.074000	0.12820	-0.137000	0.14449	CGG	TMEM86A	-	pfam_YhhN	ENSG00000151117		0.607	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM86A	HGNC	protein_coding	OTTHUMT00000387812.1	27	0.00	0	G	NM_153347		18723330	18723330	+1	no_errors	ENST00000280734	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	C
SLC3A2	6520	genome.wustl.edu	37	11	62652118	62652118	+	Silent	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:62652118C>T	ENST00000377890.2	+	8	1245	c.1077C>T	c.(1075-1077)ttC>ttT	p.F359F	SLC3A2_ENST00000377892.1_Silent_p.F390F|SLC3A2_ENST00000338663.7_Silent_p.F258F|SLC3A2_ENST00000377891.2_Silent_p.F360F|SLC3A2_ENST00000377889.2_Silent_p.F297F|SLC3A2_ENST00000538682.1_3'UTR|SLC3A2_ENST00000536981.1_5'UTR|SLC3A2_ENST00000535296.1_Silent_p.F328F	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	359					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						CATCCTCATTCTTGGCTGAGT	0.498											OREG0021032	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													127.0	118.0	121.0					11																	62652118		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.1077C>T	11.37:g.62652118C>T		1062	Q13543	Silent	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.F390	ENST00000377890.2	37	c.1170	CCDS8039.2	11																																																																																			SLC3A2	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000168003		0.498	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	SLC3A2	HGNC	protein_coding	OTTHUMT00000157306.1	96	0.00	0	C	NM_001012661		62652118	62652118	+1	no_errors	ENST00000377892	ensembl	human	known	69_37n	silent	64	31.91	30	SNP	0.102	T
TNFSF4	7292	genome.wustl.edu	37	1	173157660	173157660	+	Splice_Site	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:173157660C>T	ENST00000281834.3	-	2	338	c.202G>A	c.(202-204)Gaa>Aaa	p.E68K	TNFSF4_ENST00000367718.1_Splice_Site_p.E18K|TNFSF4_ENST00000488053.1_5'UTR	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	68					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						CAATACTTACCGGTAAATTGT	0.318																																						dbGAP											0													73.0	82.0	79.0					1																	173157660		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.202+1G>A	1.37:g.173157660C>T			Q5JZA5|Q8IV74|Q9HCN9	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF	p.E68K	ENST00000281834.3	37	c.202	CCDS1306.1	1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.712978	0.00706	.	.	ENSG00000117586	ENST00000367718;ENST00000281834;ENST00000545292	.	.	.	4.87	-4.42	0.03579	Tumour necrosis factor (1);Tumour necrosis factor-like (1);	1.761270	0.02461	N	0.086582	T	0.02767	0.0083	N	0.01352	-0.895	0.19300	N	0.999976	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15263	-1.0443	9	0.08381	T	0.77	1.7144	7.0802	0.25227	0.0:0.4722:0.138:0.3898	.	68;18	P23510;Q8IV74	TNFL4_HUMAN;.	K	18;68;18	.	ENSP00000281834:E68K	E	-	1	0	TNFSF4	171424283	0.001000	0.12720	0.006000	0.13384	0.019000	0.09904	-0.955000	0.03869	-0.924000	0.03780	-0.793000	0.03317	GAA	TNFSF4	-	superfamily_Tumour_necrosis_fac-like,smart_TNF	ENSG00000117586		0.318	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF4	HGNC	protein_coding	OTTHUMT00000084271.1	50	0.00	0	C		Missense_Mutation	173157660	173157660	-1	no_errors	ENST00000281834	ensembl	human	known	69_37n	missense	70	23.08	21	SNP	0.009	T
TRIM50	135892	genome.wustl.edu	37	7	72727112	72727112	+	Silent	SNP	G	G	T	rs369269818		TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr7:72727112G>T	ENST00000333149.2	-	7	1469	c.1269C>A	c.(1267-1269)ggC>ggA	p.G423G	TRIM50_ENST00000453152.1_Silent_p.G423G	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	423	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						AGGTGAGTTCGCCCTGCTCAT	0.672																																						dbGAP											0													29.0	24.0	26.0					7																	72727112		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.1269C>A	7.37:g.72727112G>T			Q86XT3	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G423	ENST00000333149.2	37	c.1269	CCDS34654.1	7																																																																																			TRIM50	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000146755		0.672	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM50	HGNC	protein_coding	OTTHUMT00000345925.1	9	0.00	0	G	NM_178125		72727112	72727112	-1	no_errors	ENST00000333149	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	0.034	T
TTC17	55761	genome.wustl.edu	37	11	43411360	43411360	+	Silent	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:43411360C>T	ENST00000039989.4	+	3	422	c.408C>T	c.(406-408)agC>agT	p.S136S	TTC17_ENST00000299240.6_Silent_p.S136S|RP11-484D2.4_ENST00000394183.2_RNA	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	136					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTTTGGAGAGCAAAGACATCA	0.363																																						dbGAP											0													118.0	117.0	118.0					11																	43411360		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.408C>T	11.37:g.43411360C>T			G3XAB3|Q8NEC0	Silent	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S136	ENST00000039989.4	37	c.408	CCDS31466.1	11																																																																																			TTC17	-	NULL	ENSG00000052841		0.363	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	HGNC	protein_coding	OTTHUMT00000389577.2	43	0.00	0	C	NM_018259		43411360	43411360	+1	no_errors	ENST00000039989	ensembl	human	known	69_37n	silent	44	42.11	32	SNP	1.000	T
TRIM64B	642446	genome.wustl.edu	37	11	89608899	89608899	+	Missense_Mutation	SNP	T	T	G	rs201022110	byFrequency	TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr11:89608899T>G	ENST00000329862.6	-	1	286	c.287A>C	c.(286-288)gAg>gCg	p.E96A		NM_001136486.1|NM_001164397.1	NP_001129958.1|NP_001157869.1	A6NI03	TR64B_HUMAN	tripartite motif containing 64B	96						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)	2						CTTAGTCTCCTCATGGAGCAC	0.507													t|||	1413	0.282149	0.4433	0.2378	5008	,	,		24915	0.1696		0.2197	False		,,,				2504	0.2761					dbGAP											0													7.0	7.0	7.0					11																	89608899		495	1394	1889	-	-	-	SO:0001583	missense	0				CCDS53693.1	11q14.3	2014-04-02	2011-01-25		ENSG00000189253	ENSG00000189253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37147	protein-coding gene	gene with protein product			"""tripartite motif-containing 64B"""				Standard	NM_001164397		Approved		uc021qoo.1	A6NI03	OTTHUMG00000167638	ENST00000329862.6:c.287A>C	11.37:g.89608899T>G	ENSP00000332969:p.Glu96Ala			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.E96A	ENST00000329862.6	37	c.287	CCDS53693.1	11	.	.	.	.	.	.	.	.	.	.	.	7.335	0.619740	0.14193	.	.	ENSG00000189253	ENST00000329862	T	0.57436	0.4	2.06	-2.81	0.05805	.	.	.	.	.	T	0.49081	0.1536	M	0.67569	2.06	0.80722	P	0.0	.	.	.	.	.	.	T	0.51733	-0.8668	5	.	.	.	.	3.3853	0.07269	0.0:0.2863:0.2094:0.5043	.	.	.	.	A	96	ENSP00000332969:E96A	.	E	-	2	0	TRIM64B	89248547	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.140000	0.16056	-0.854000	0.04131	0.321000	0.21382	GAG	TRIM64B	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000189253		0.507	TRIM64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM64B	HGNC	protein_coding	OTTHUMT00000395440.1	15	0.00	0	T			89608899	89608899	-1	no_errors	ENST00000329862	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	0.000	G
TTLL5	23093	genome.wustl.edu	37	14	76246009	76246011	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	AAC	AAC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr14:76246009_76246011delAAC	ENST00000298832.9	+	24	2684_2686	c.2479_2481delAAC	c.(2479-2481)aacdel	p.N830del	TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000557636.1_In_Frame_Del_p.N844del|TTLL5_ENST00000554510.1_In_Frame_Del_p.N339del|TTLL5_ENST00000556893.1_In_Frame_Del_p.N381del	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	830	Poly-Asn.				fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		AATTTCTAAGAACAACAACAATT	0.379																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2479_2481delAAC	14.37:g.76246015_76246017delAAC	ENSP00000298832:p.Asn830del		B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	In_Frame_Del	DEL	pfam_Tub_tyr_ligase	p.N830in_frame_del	ENST00000298832.9	37	c.2479_2481	CCDS32124.1	14																																																																																			TTLL5	-	NULL	ENSG00000119685		0.379	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	67	0.00	0	AAC	NM_015072		76246009	76246011	+1	no_errors	ENST00000298832	ensembl	human	known	69_37n	in_frame_del	31	47.46	28	DEL	0.983:1.000:1.000	-
ULK2	9706	genome.wustl.edu	37	17	19699025	19699025	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr17:19699025C>T	ENST00000395544.4	-	20	2510	c.2011G>A	c.(2011-2013)Ggg>Agg	p.G671R	ULK2_ENST00000580130.1_5'Flank|ULK2_ENST00000361658.2_Missense_Mutation_p.G671R	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	671					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G671W(1)		large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GATAACTTCCCGGTACTGACA	0.343																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											167.0	167.0	167.0					17																	19699025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2011G>A	17.37:g.19699025C>T	ENSP00000378914:p.Gly671Arg		A8MY69|O75119	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G671R	ENST00000395544.4	37	c.2011	CCDS11213.1	17	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644977	0.87859	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.57107	0.42;0.42	5.57	5.57	0.84162	.	0.101073	0.64402	D	0.000002	T	0.73931	0.3650	M	0.73962	2.25	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.76408	-0.2970	10	0.87932	D	0	-9.1414	18.5287	0.90983	0.0:1.0:0.0:0.0	.	671	Q8IYT8	ULK2_HUMAN	R	671	ENSP00000354877:G671R;ENSP00000378914:G671R	ENSP00000354877:G671R	G	-	1	0	ULK2	19639617	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.205000	0.77881	2.628000	0.89032	0.655000	0.94253	GGG	ULK2	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2	ENSG00000083290		0.343	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ULK2	HGNC	protein_coding	OTTHUMT00000132375.2	75	0.00	0	C	NM_014683		19699025	19699025	-1	no_errors	ENST00000361658	ensembl	human	known	69_37n	missense	72	27.00	27	SNP	1.000	T
USP1	7398	genome.wustl.edu	37	1	62905637	62905637	+	Silent	SNP	T	T	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr1:62905637T>G	ENST00000339950.4	+	2	914	c.99T>G	c.(97-99)acT>acG	p.T33T	USP1_ENST00000371146.1_Silent_p.T33T	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	33					DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		AAAAGGAAACTAAGAGAGCTT	0.328																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											0													43.0	50.0	48.0					1																	62905637		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.99T>G	1.37:g.62905637T>G			A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.T33	ENST00000339950.4	37	c.99	CCDS621.1	1																																																																																			USP1	-	NULL	ENSG00000162607		0.328	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	29	0.00	0	T	NM_001017415		62905637	62905637	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	silent	29	39.58	19	SNP	0.997	G
WDR33	55339	genome.wustl.edu	37	2	128526530	128526530	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr2:128526530G>A	ENST00000322313.4	-	3	408	c.250C>T	c.(250-252)Cct>Tct	p.P84S	WDR33_ENST00000393006.1_Missense_Mutation_p.P84S|WDR33_ENST00000409658.3_Missense_Mutation_p.P84S	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	84					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CCTGCATCAGGCTGAATTGCC	0.308																																						dbGAP											0													157.0	143.0	148.0					2																	128526530		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.250C>T	2.37:g.128526530G>A	ENSP00000325377:p.Pro84Ser		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P84S	ENST00000322313.4	37	c.250	CCDS2150.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042815	0.75732	.	.	ENSG00000136709	ENST00000322313;ENST00000436787;ENST00000393006;ENST00000409658;ENST00000408998	T;T;T;T;T	0.71103	4.9;-0.54;4.9;4.9;-0.5	5.29	5.29	0.74685	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87649	0.6230	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.984;0.994	D	0.89701	0.3905	10	0.72032	D	0.01	-6.4875	19.2876	0.94085	0.0:0.0:1.0:0.0	.	84;84;84	Q9C0J8-2;Q6NUQ0;Q9C0J8	.;.;WDR33_HUMAN	S	84;6;84;84;84	ENSP00000325377:P84S;ENSP00000397547:P6S;ENSP00000376730:P84S;ENSP00000387186:P84S;ENSP00000386861:P84S	ENSP00000325377:P84S	P	-	1	0	WDR33	128243000	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.467000	0.97671	2.627000	0.88993	0.655000	0.94253	CCT	WDR33	-	superfamily_WD40_repeat_dom	ENSG00000136709		0.308	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	53	0.00	0	G	NM_018383		128526530	128526530	-1	no_errors	ENST00000322313	ensembl	human	known	69_37n	missense	45	37.84	28	SNP	1.000	A
WWC3	55841	genome.wustl.edu	37	X	10102560	10102560	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chrX:10102560C>G	ENST00000380861.4	+	19	3078	c.2687C>G	c.(2686-2688)tCg>tGg	p.S896W	WWC3_ENST00000454666.1_Missense_Mutation_p.S896W	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	896					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GCCCGAGGGTCGCCTTTTGTT	0.562																																						dbGAP											0													116.0	112.0	114.0					X																	10102560		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2687C>G	X.37:g.10102560C>G	ENSP00000370242:p.Ser896Trp		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.S896W	ENST00000380861.4	37	c.2687	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695356	0.48202	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.44881	0.91;0.91	5.71	5.71	0.89125	.	0.108085	0.64402	D	0.000004	T	0.67524	0.2902	M	0.78801	2.425	0.51012	D	0.999901	D	0.89917	1.0	D	0.87578	0.998	T	0.68318	-0.5440	9	.	.	.	-4.6008	18.9359	0.92584	0.0:1.0:0.0:0.0	.	896	Q9ULE0	WWC3_HUMAN	W	896;896;391	ENSP00000370242:S896W;ENSP00000399584:S896W	.	S	+	2	0	WWC3	10062560	0.925000	0.31364	0.004000	0.12327	0.059000	0.15707	5.903000	0.69877	2.419000	0.82065	0.523000	0.50628	TCG	WWC3	-	NULL	ENSG00000047644		0.562	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	47	0.00	0	C	NM_015691		10102560	10102560	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	missense	27	57.81	37	SNP	0.336	G
ZNF16	7564	genome.wustl.edu	37	8	146157623	146157623	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr8:146157623C>T	ENST00000276816.4	-	4	736	c.550G>A	c.(550-552)Gac>Aac	p.D184N	ZNF16_ENST00000394909.2_Missense_Mutation_p.D184N	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	184	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D184N(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		CCACCCATGTCATATGGATGT	0.493																																						dbGAP											1	Substitution - Missense(1)	lung(1)											140.0	133.0	135.0					8																	146157623		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.550G>A	8.37:g.146157623C>T	ENSP00000276816:p.Asp184Asn		B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D184N	ENST00000276816.4	37	c.550	CCDS6437.1	8	.	.	.	.	.	.	.	.	.	.	C	9.895	1.205162	0.22205	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351	T;T;T	0.28255	1.62;1.62;2.45	3.64	0.596	0.17496	.	.	.	.	.	T	0.11281	0.0275	N	0.10782	0.045	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.34800	-0.9814	9	0.02654	T	1	.	3.8709	0.09036	0.3311:0.4787:0.0:0.1901	.	184	P17020	ZNF16_HUMAN	N	184	ENSP00000276816:D184N;ENSP00000378369:D184N;ENSP00000434321:D184N	ENSP00000276816:D184N	D	-	1	0	ZNF16	146128427	0.000000	0.05858	0.001000	0.08648	0.107000	0.19398	-2.127000	0.01315	-0.015000	0.14150	0.563000	0.77884	GAC	ZNF16	-	NULL	ENSG00000170631		0.493	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF16	HGNC	protein_coding	OTTHUMT00000382978.1	30	0.00	0	C	NM_006958		146157623	146157623	-1	no_errors	ENST00000276816	ensembl	human	known	69_37n	missense	44	18.18	10	SNP	0.001	T
ZNF546	339327	genome.wustl.edu	37	19	40520249	40520249	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A25E-01A-11D-A167-09	TCGA-A2-A25E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8dce6a9d-ecb7-4699-9fda-1b09b1b1de43	17b3d764-49f2-4ba6-ac9e-44619e31943f	g.chr19:40520249G>A	ENST00000347077.4	+	7	1288	c.1072G>A	c.(1072-1074)Gaa>Aaa	p.E358K	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.E332K	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GAGGCCTTATGAATGTAAGGT	0.373																																						dbGAP											0													74.0	72.0	73.0					19																	40520249		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1072G>A	19.37:g.40520249G>A	ENSP00000339823:p.Glu358Lys		A8K913	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E358K	ENST00000347077.4	37	c.1072	CCDS12548.1	19	.	.	.	.	.	.	.	.	.	.	g	4.477	0.088394	0.08583	.	.	ENSG00000187187	ENST00000347077	T	0.18657	2.2	2.7	0.402	0.16344	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06781	0.0173	N	0.02876	-0.465	0.09310	N	1	B;B	0.21071	0.011;0.051	B;B	0.23716	0.003;0.048	T	0.38351	-0.9665	9	0.20519	T	0.43	.	1.5453	0.02563	0.1316:0.2109:0.4423:0.2152	.	332;358	B3KVL3;Q86UE3	.;ZN546_HUMAN	K	358	ENSP00000339823:E358K	ENSP00000339823:E358K	E	+	1	0	ZNF546	45212089	0.000000	0.05858	0.210000	0.23637	0.912000	0.54170	-1.776000	0.01781	0.162000	0.19483	0.655000	0.94253	GAA	ZNF546	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187187		0.373	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2	47	0.00	0	G	NM_178544		40520249	40520249	+1	no_errors	ENST00000347077	ensembl	human	known	69_37n	missense	50	33.33	25	SNP	0.044	A
