#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAN	176	genome.wustl.edu	37	15	89416111	89416111	+	Splice_Site	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:89416111G>C	ENST00000561243.1	+	15	7188		c.e15-1		ACAN_ENST00000559004.1_Splice_Site|ACAN_ENST00000439576.2_Splice_Site|ACAN_ENST00000352105.7_Splice_Site			P16112	PGCA_HUMAN	aggrecan						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCCACCCACAGCAATTTGAGA	0.572																																						dbGAP											0													88.0	92.0	90.0					15																	89416111		2068	4223	6291	-	-	-	SO:0001630	splice_region_variant	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.7189-1G>C	15.37:g.89416111G>C			Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Splice_Site	SNP	-	e15-1	ENST00000561243.1	37	c.7189-1	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598957	0.66332	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9081	0.88926	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACAN	87217115	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	9.672000	0.98629	2.453000	0.82957	0.655000	0.94253	.	ACAN	-	-	ENSG00000157766		0.572	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	21	0.00	0	G	NM_001135	Intron	89416111	89416111	+1	no_errors	ENST00000439576	ensembl	human	known	69_37n	splice_site	13	45.83	11	SNP	1.000	C
ACTR1A	10121	genome.wustl.edu	37	10	104239003	104239003	+	3'UTR	SNP	C	C	T	rs144405489	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr10:104239003C>T	ENST00000369905.4	-	0	2811				ACTR1A_ENST00000487599.1_3'UTR|ACTR1A_ENST00000470322.1_5'UTR	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		TCTATCGGAACGACTTTATTT	0.557													C|||	5	0.000998403	0.003	0.0014	5008	,	,		20606	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.*1617G>A	10.37:g.104239003C>T			B2R6B0|P42024	RNA	SNP	-	NULL	ENST00000369905.4	37	NULL	CCDS7536.1	10																																																																																			ACTR1A	-	-	ENSG00000138107		0.557	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR1A	HGNC	protein_coding	OTTHUMT00000050053.1	21	0.00	0	C			104239003	104239003	-1	no_errors	ENST00000470322	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	0.994	T
ADAMTSL4	54507	genome.wustl.edu	37	1	150528007	150528007	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:150528007G>A	ENST00000369038.2	+	6	1538	c.1337G>A	c.(1336-1338)gGa>gAa	p.G446E	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.G469E|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.G446E|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.G446E|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	446					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGTCAGCCTGGAGCCCCTGAC	0.587																																						dbGAP											0													93.0	84.0	87.0					1																	150528007		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1337G>A	1.37:g.150528007G>A	ENSP00000358034:p.Gly446Glu		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.G469E	ENST00000369038.2	37	c.1406	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116298	0.77323	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	4.69	4.69	0.59074	.	.	.	.	.	T	0.59756	0.2217	N	0.25485	0.75	0.39169	D	0.962556	D;D;D;D	0.76494	0.995;0.993;0.997;0.999	P;D;D;D	0.72075	0.843;0.918;0.915;0.976	T	0.62282	-0.6887	9	0.42905	T	0.14	.	15.1631	0.72801	0.0:0.0:1.0:0.0	.	469;469;446;446	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	E	446;446;469;446	ENSP00000358037:G446E;ENSP00000271643:G446E;ENSP00000358035:G469E;ENSP00000358034:G446E	ENSP00000271643:G446E	G	+	2	0	ADAMTSL4	148794631	0.982000	0.34865	0.994000	0.49952	0.943000	0.58893	1.599000	0.36751	2.426000	0.82243	0.561000	0.74099	GGA	ADAMTSL4	-	NULL	ENSG00000143382		0.587	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4	29	0.00	0	G	NM_019032		150528007	150528007	+1	no_errors	ENST00000369039	ensembl	human	known	69_37n	missense	33	40.00	22	SNP	1.000	A
ADAM15	8751	genome.wustl.edu	37	1	155028475	155028475	+	Splice_Site	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:155028475C>T	ENST00000356955.2	+	8	844	c.743C>T	c.(742-744)aCa>aTa	p.T248I	ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000447332.3_Splice_Site_p.T232I|ADAM15_ENST00000368413.1_Intron|ADAM15_ENST00000271836.6_Splice_Site_p.T248I|ADAM15_ENST00000355956.2_Splice_Site_p.T248I|ADAM15_ENST00000368412.3_Splice_Site_p.T248I|ADAM15_ENST00000368410.2_Intron|ADAM15_ENST00000449910.2_Splice_Site_p.T248I|ADAM15_ENST00000360674.4_Splice_Site_p.T248I|ADAM15_ENST00000531455.1_Splice_Site_p.T258I|ADAM15_ENST00000359280.4_Splice_Site_p.T248I	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	248	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TTGCTGGACACAGTGAGTGCT	0.602																																						dbGAP											0													66.0	65.0	65.0					1																	155028475		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.744+1C>T	1.37:g.155028475C>T			B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.T248I	ENST00000356955.2	37	c.743	CCDS1087.1	1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877250	0.51801	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000271836;ENST00000531455	T;T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	4.98	3.13	0.36017	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.155196	0.30252	N	0.010056	T	0.36110	0.0955	N	0.17594	0.5	0.80722	D	1	P;P;P;P;P;P;P;P;B;P	0.40970	0.589;0.589;0.589;0.58;0.734;0.534;0.534;0.534;0.097;0.633	P;B;P;B;B;B;B;B;B;B	0.46208	0.507;0.41;0.507;0.287;0.273;0.287;0.287;0.287;0.138;0.41	T	0.36817	-0.9732	10	0.59425	D	0.04	.	9.1942	0.37217	0.0:0.8238:0.0:0.1762	.	258;265;232;248;248;248;248;248;248;248	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444	.;.;.;.;.;.;.;.;.;ADA15_HUMAN	I	248;248;248;248;248;248;248;258	ENSP00000349436:T248I;ENSP00000403843:T248I;ENSP00000352226:T248I;ENSP00000353892:T248I;ENSP00000357397:T248I;ENSP00000348227:T248I;ENSP00000271836:T248I;ENSP00000432927:T258I	ENSP00000271836:T248I	T	+	2	0	ADAM15	153295099	0.017000	0.18338	0.829000	0.32907	0.939000	0.58152	0.663000	0.25053	0.706000	0.31912	0.462000	0.41574	ACA	ADAM15	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000143537		0.602	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	HGNC	protein_coding	OTTHUMT00000387168.1	56	0.00	0	C	NM_003815	Missense_Mutation	155028475	155028475	+1	no_errors	ENST00000356955	ensembl	human	known	69_37n	missense	83	31.97	39	SNP	0.986	T
AHI1	54806	genome.wustl.edu	37	6	135611584	135611584	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:135611584C>G	ENST00000367800.4	-	26	3781	c.3565G>C	c.(3565-3567)Ggc>Cgc	p.G1189R	AHI1_ENST00000457866.2_Missense_Mutation_p.G1189R|AHI1_ENST00000417892.2_3'UTR	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	1189					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		acttttctgcctgcttgcttg	0.423																																						dbGAP											0													381.0	368.0	372.0					6																	135611584		1922	4140	6062	-	-	-	SO:0001583	missense	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.3565G>C	6.37:g.135611584C>G	ENSP00000356774:p.Gly1189Arg		E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.G1189R	ENST00000367800.4	37	c.3565	CCDS47483.1	6	.	.	.	.	.	.	.	.	.	.	C	9.426	1.084210	0.20309	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602	T;T;T	0.57752	0.38;0.38;0.38	4.48	-0.444	0.12245	.	0.370331	0.26507	N	0.023991	T	0.13372	0.0324	N	0.08118	0	0.09310	N	0.999999	P	0.44627	0.839	P	0.44394	0.448	T	0.32955	-0.9887	10	0.28530	T	0.3	-0.0264	7.3251	0.26551	0.0:0.4683:0.0:0.5317	.	1189	Q8N157	AHI1_HUMAN	R	1189	ENSP00000356774:G1189R;ENSP00000388650:G1189R;ENSP00000265602:G1189R	ENSP00000265602:G1189R	G	-	1	0	AHI1	135653277	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.522000	0.06237	-0.103000	0.12175	0.591000	0.81541	GGC	AHI1	-	NULL	ENSG00000135541		0.423	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	152	0.00	0	C	NM_017651		135611584	135611584	-1	no_errors	ENST00000265602	ensembl	human	known	69_37n	missense	140	39.39	91	SNP	0.000	G
AKAP1	8165	genome.wustl.edu	37	17	55183771	55183771	+	Missense_Mutation	SNP	G	G	A	rs138803240		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:55183771G>A	ENST00000337714.3	+	2	1179	c.946G>A	c.(946-948)Ggc>Agc	p.G316S	AKAP1_ENST00000571629.1_Missense_Mutation_p.G316S|AKAP1_ENST00000314126.3_Missense_Mutation_p.G316S|AKAP1_ENST00000539273.1_Missense_Mutation_p.G316S|AKAP1_ENST00000572557.1_Missense_Mutation_p.G316S	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	316					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G316S(1)		endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					AAATGAGGAGGGCTTGGATAG	0.537																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											90.0	97.0	95.0					17																	55183771		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.946G>A	17.37:g.55183771G>A	ENSP00000337736:p.Gly316Ser		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.G316S	ENST00000337714.3	37	c.946	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	G	5.256	0.232698	0.09969	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.32023	1.47;1.98;1.47	2.7	-1.29	0.09288	.	.	.	.	.	T	0.13200	0.0320	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32798	-0.9893	9	0.20046	T	0.44	.	7.7099	0.28671	0.4984:0.0:0.5016:0.0	.	316	Q92667	AKAP1_HUMAN	S	316;316;358;316	ENSP00000337736:G316S;ENSP00000314075:G316S;ENSP00000443139:G316S	ENSP00000314075:G316S	G	+	1	0	AKAP1	52538770	0.304000	0.24472	0.000000	0.03702	0.109000	0.19521	-2.009000	0.01455	-0.456000	0.07043	-1.328000	0.01277	GGC	AKAP1	-	NULL	ENSG00000121057		0.537	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	26	0.00	0	G			55183771	55183771	+1	no_errors	ENST00000337714	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	0.000	A
ALS2CR11	151254	genome.wustl.edu	37	2	202483806	202483806	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:202483806G>A	ENST00000286195.3	-	1	92	c.48C>T	c.(46-48)aaC>aaT	p.N16N	ALS2CR11_ENST00000439140.1_Silent_p.N16N|ALS2CR11_ENST00000450242.1_Silent_p.N16N|ALS2CR11_ENST00000439802.1_Silent_p.N16N	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	16										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						GCCCGCTGCGGTTATCAAGTG	0.587																																						dbGAP											0													111.0	103.0	106.0					2																	202483806		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.48C>T	2.37:g.202483806G>A			C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Silent	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.N16	ENST00000286195.3	37	c.48	CCDS2349.1	2																																																																																			ALS2CR11	-	NULL	ENSG00000155754		0.587	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	112	0.00	0	G	NM_152525		202483806	202483806	-1	no_errors	ENST00000286195	ensembl	human	known	69_37n	silent	126	36.36	72	SNP	0.000	A
AMBN	258	genome.wustl.edu	37	4	71472137	71472137	+	Missense_Mutation	SNP	T	T	C	rs368861309		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:71472137T>C	ENST00000322937.6	+	13	1137	c.1034T>C	c.(1033-1035)cTa>cCa	p.L345P	AMBN_ENST00000449493.2_Missense_Mutation_p.L330P	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	345					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			CTTACAGAGCTAGAACCTGCT	0.587																																						dbGAP											0													58.0	57.0	57.0					4																	71472137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.1034T>C	4.37:g.71472137T>C	ENSP00000313809:p.Leu345Pro		Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.L345P	ENST00000322937.6	37	c.1034	CCDS3543.1	4	.	.	.	.	.	.	.	.	.	.	T	8.284	0.816310	0.16607	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.39787	1.06;1.06	5.7	-2.07	0.07276	.	1.759080	0.02725	N	0.114388	T	0.47893	0.1470	L	0.50333	1.59	0.09310	N	0.999998	D	0.55385	0.971	P	0.57620	0.824	T	0.40979	-0.9534	10	0.46703	T	0.11	0.1271	2.2331	0.04002	0.1588:0.119:0.4351:0.2871	.	345	Q9NP70	AMBN_HUMAN	P	345;344;330	ENSP00000313809:L345P;ENSP00000391234:L330P	ENSP00000313809:L345P	L	+	2	0	AMBN	71506726	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.113000	0.10774	0.019000	0.15079	0.482000	0.46254	CTA	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.587	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	31	0.00	0	T	NM_016519		71472137	71472137	+1	no_errors	ENST00000322937	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.000	C
AMZ1	155185	genome.wustl.edu	37	7	2748833	2748833	+	Silent	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:2748833C>A	ENST00000312371.4	+	5	1094	c.726C>A	c.(724-726)ggC>ggA	p.G242G	AMZ1_ENST00000407112.1_Intron|AMZ1_ENST00000489665.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	242							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		AGGACAGGGGCTGGGCCCTGT	0.687																																						dbGAP											0													15.0	19.0	17.0					7																	2748833		2198	4289	6487	-	-	-	SO:0001819	synonymous_variant	0			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.726C>A	7.37:g.2748833C>A			B3KRS0|Q8TF51	Silent	SNP	pfam_Pept_M54_archaemetzincn	p.G242	ENST00000312371.4	37	c.726	CCDS34589.1	7																																																																																			AMZ1	-	NULL	ENSG00000174945		0.687	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	21	0.00	0	C	NM_133463		2748833	2748833	+1	no_errors	ENST00000312371	ensembl	human	known	69_37n	silent	12	33.33	6	SNP	0.004	A
ANKRD17	26057	genome.wustl.edu	37	4	73962844	73962844	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:73962844C>A	ENST00000358602.4	-	27	5283	c.5167G>T	c.(5167-5169)Gtt>Ttt	p.V1723F	ANKRD17_ENST00000509867.2_Missense_Mutation_p.V1610F|ANKRD17_ENST00000330838.6_Missense_Mutation_p.V1472F	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1723					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTCTTACAACTTCTTTCCAT	0.368																																						dbGAP											0													268.0	269.0	269.0					4																	73962844		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5167G>T	4.37:g.73962844C>A	ENSP00000351416:p.Val1723Phe		E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.V1723F	ENST00000358602.4	37	c.5167	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	C	19.77	3.888633	0.72524	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.26373	1.74;1.74;1.74	5.82	5.82	0.92795	.	0.000000	0.53938	D	0.000051	T	0.45316	0.1336	L	0.38175	1.15	0.53688	D	0.999971	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	D;D;D;D	0.83275	0.996;0.996;0.991;0.991	T	0.32402	-0.9908	10	0.87932	D	0	.	20.0893	0.97812	0.0:1.0:0.0:0.0	.	1722;1472;1723;1610	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	F	1723;1130;1472;1610;107	ENSP00000351416:V1723F;ENSP00000332265:V1472F;ENSP00000427151:V1610F	ENSP00000332265:V1472F	V	-	1	0	ANKRD17	74181708	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.244000	0.65400	2.761000	0.94854	0.655000	0.94253	GTT	ANKRD17	-	NULL	ENSG00000132466		0.368	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	HGNC	protein_coding	OTTHUMT00000362475.1	94	0.00	0	C	NM_032217		73962844	73962844	-1	no_errors	ENST00000358602	ensembl	human	known	69_37n	missense	130	16.67	26	SNP	1.000	A
ANKRD20A8P	729171	genome.wustl.edu	37	2	95513888	95513888	+	RNA	SNP	A	A	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:95513888A>T	ENST00000432432.2	-	0	723				RNU6-1320P_ENST00000390838.1_RNA	NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		TACAGCAAGCATGAGAGCTGA	0.338																																						dbGAP											0																																										-	-	-			0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95513888A>T			A6NC18	RNA	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			ANKRD20A8P	-	-	ENSG00000229089		0.338	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	HGNC	pseudogene	OTTHUMT00000451404.1	274	0.00	0	A			95513888	95513888	-1	no_errors	ENST00000432432	ensembl	human	known	69_37n	rna	288	28.71	116	SNP	0.785	T
ANKRD30A	91074	genome.wustl.edu	37	10	37508106	37508106	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr10:37508106T>C	ENST00000602533.1	+	34	3397	c.3298T>C	c.(3298-3300)Tca>Cca	p.S1100P	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.S1219P|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.S1100P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1156					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAAAGAGGAATCATTAACTAA	0.338																																						dbGAP											0													135.0	135.0	135.0					10																	37508106		1824	4072	5896	-	-	-	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3298T>C	10.37:g.37508106T>C	ENSP00000473551:p.Ser1100Pro		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1100P	ENST00000602533.1	37	c.3298		10	.	.	.	.	.	.	.	.	.	.	t	2.266	-0.368119	0.05069	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.14640	2.49;2.49	2.81	0.249	0.15531	.	.	.	.	.	T	0.06142	0.0159	N	0.19112	0.55	0.09310	N	1	P	0.39940	0.696	B	0.31191	0.125	T	0.30387	-0.9980	9	0.72032	D	0.01	.	2.8257	0.05484	0.6166:0.0:0.1565:0.2268	.	1156	Q9BXX3	AN30A_HUMAN	P	1100;1219	ENSP00000354432:S1100P;ENSP00000363792:S1219P	ENSP00000354432:S1100P	S	+	1	0	ANKRD30A	37548112	0.933000	0.31639	0.008000	0.14137	0.003000	0.03518	0.541000	0.23207	0.200000	0.20447	-0.656000	0.03901	TCA	ANKRD30A	-	NULL	ENSG00000148513		0.338	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	47	0.00	0	T	NM_052997		37508106	37508106	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	0.133	C
ANO3	63982	genome.wustl.edu	37	11	26660720	26660720	+	Silent	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:26660720C>G	ENST00000256737.3	+	21	2925	c.2073C>G	c.(2071-2073)ctC>ctG	p.L691L	ANO3_ENST00000531568.1_Silent_p.L545L|ANO3_ENST00000525139.1_Silent_p.L675L|ANO3_ENST00000537978.1_Silent_p.L675L	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	691					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TGATAGACCTCTGCCTCCAGA	0.408																																						dbGAP											0													177.0	148.0	158.0					11																	26660720		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2073C>G	11.37:g.26660720C>G			B7Z3F5	Silent	SNP	pfam_Anoctamin	p.L691	ENST00000256737.3	37	c.2073	CCDS31447.1	11																																																																																			ANO3	-	pfam_Anoctamin	ENSG00000134343		0.408	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	78	0.00	0	C	NM_031418		26660720	26660720	+1	no_errors	ENST00000256737	ensembl	human	known	69_37n	silent	69	44.35	55	SNP	1.000	G
ARHGEF4	50649	genome.wustl.edu	37	2	131673316	131673316	+	5'Flank	SNP	C	C	T	rs3739129	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:131673316C>T	ENST00000326016.5	+	0	0				ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000409359.1_Silent_p.P269P|ARHGEF4_ENST00000392953.3_5'Flank|ARHGEF4_ENST00000428230.2_5'Flank	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		ACTGCGGCCCCGGGGCTGAGG	0.662													C|||	3076	0.614217	0.3533	0.7219	5008	,	,		14134	0.8323		0.6451	False		,,,				2504	0.6339					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657		2.37:g.131673316C>T	Exception_encountered		Q9HDC6|Q9UPP0	Silent	SNP	NULL	p.P269	ENST00000326016.5	37	c.807	CCDS2165.1	2																																																																																			ARHGEF4	-	NULL	ENSG00000136002		0.662	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	39	0.00	0	C			131673316	131673316	+1	no_errors	ENST00000409359	ensembl	human	putative	69_37n	silent	42	10.64	5	SNP	0.000	T
ATPIF1	93974	genome.wustl.edu	37	1	28562699	28562699	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:28562699C>G	ENST00000335514.5	+	1	56	c.5C>G	c.(4-6)gCa>gGa	p.A2G	ATPIF1_ENST00000497986.1_Missense_Mutation_p.A2G|ATPIF1_ENST00000465645.1_Missense_Mutation_p.A2G|ATPIF1_ENST00000468425.2_Missense_Mutation_p.A2G	NM_016311.4	NP_057395.1	Q9UII2	ATIF1_HUMAN	ATPase inhibitory factor 1	2					angiogenesis (GO:0001525)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of nucleotide metabolic process (GO:0045980)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|reactive oxygen species metabolic process (GO:0072593)	cell surface (GO:0009986)|mitochondrion (GO:0005739)	angiostatin binding (GO:0043532)|ATPase binding (GO:0051117)|ATPase inhibitor activity (GO:0042030)|calmodulin binding (GO:0005516)|enzyme inhibitor activity (GO:0004857)|protein homodimerization activity (GO:0042803)			lung(4)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|BRCA - Breast invasive adenocarcinoma(304;0.00574)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGCAATGGCAGTGACGGCG	0.657																																						dbGAP											0													43.0	42.0	42.0					1																	28562699		2196	4297	6493	-	-	-	SO:0001583	missense	0			AL050386	CCDS319.1, CCDS320.1, CCDS44096.1	1p35.3	2011-07-04			ENSG00000130770	ENSG00000130770		"""Mitochondrial respiratory chain complex / Complex V"""	871	protein-coding gene	gene with protein product	"""ATPase inhibitor protein"", ""ATP synthase inhibitor protein"""	614981				10664857, 19559621	Standard	NM_016311		Approved	ATPI, IP, ATPIP, MGC1167, MGC8898	uc001bpq.3	Q9UII2	OTTHUMG00000003533	ENST00000335514.5:c.5C>G	1.37:g.28562699C>G	ENSP00000335203:p.Ala2Gly		Q5JXL8|Q6IAQ7|Q9BSL9	Missense_Mutation	SNP	pfam_ATPase_inhibitor_IATP_mt	p.A2G	ENST00000335514.5	37	c.5	CCDS319.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036107	0.75617	.	.	ENSG00000130770	ENST00000497986;ENST00000417632;ENST00000335514;ENST00000468425;ENST00000465645	.	.	.	5.1	5.1	0.69264	.	0.637795	0.15939	N	0.237267	T	0.74779	0.3761	M	0.72479	2.2	0.34832	D	0.739817	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.996	T	0.80398	-0.1399	9	0.66056	D	0.02	-13.4397	14.2121	0.65771	0.0:1.0:0.0:0.0	.	2;2	Q9UII2;Q9UII2-2	ATIF1_HUMAN;.	G	2	.	ENSP00000335203:A2G	A	+	2	0	ATPIF1	28435286	0.994000	0.37717	0.976000	0.42696	0.095000	0.18619	3.685000	0.54678	2.814000	0.96858	0.655000	0.94253	GCA	ATPIF1	-	NULL	ENSG00000130770		0.657	ATPIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPIF1	HGNC	protein_coding	OTTHUMT00000009841.1	166	0.00	0	C	NM_016311		28562699	28562699	+1	no_errors	ENST00000335514	ensembl	human	known	69_37n	missense	179	13.94	29	SNP	0.979	G
BCAR1	9564	genome.wustl.edu	37	16	75263783	75263783	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:75263783A>G	ENST00000162330.5	-	7	2365	c.2239T>C	c.(2239-2241)Tac>Cac	p.Y747H	BCAR1_ENST00000546196.1_Missense_Mutation_p.Y718H|BCAR1_ENST00000418647.3_Missense_Mutation_p.Y793H|BCAR1_ENST00000542031.2_Missense_Mutation_p.Y745H|BCAR1_ENST00000535626.2_Missense_Mutation_p.Y599H|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000420641.3_Missense_Mutation_p.Y765H|RP11-331F4.4_ENST00000489723.1_RNA|BCAR1_ENST00000538440.2_Missense_Mutation_p.Y747H|BCAR1_ENST00000393422.2_Missense_Mutation_p.Y765H|BCAR1_ENST00000393420.6_Missense_Mutation_p.Y765H	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	747	Divergent helix-loop-helix motif.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGCTCCAGGTAGAAGAGCAGC	0.672																																						dbGAP											0													51.0	53.0	52.0					16																	75263783		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2239T>C	16.37:g.75263783A>G	ENSP00000162330:p.Tyr747His		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.Y793H	ENST00000162330.5	37	c.2377	CCDS10915.1	16	.	.	.	.	.	.	.	.	.	.	A	23.7	4.442647	0.83993	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	4.69	4.69	0.59074	CAS family, DUF3513 (1);	0.000000	0.64402	D	0.000001	T	0.57902	0.2085	M	0.82517	2.595	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;0.998;0.997;0.997;0.998;1.0;0.998;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.997;0.999;0.997;0.995;0.995;0.997;0.999;0.997;0.999	T	0.65034	-0.6266	10	0.87932	D	0	-25.5919	13.304	0.60342	1.0:0.0:0.0:0.0	.	765;599;793;745;765;765;747;747;537	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	H	747;765;765;747;793;599;765;745;718	ENSP00000162330:Y747H;ENSP00000377074:Y765H;ENSP00000392708:Y765H;ENSP00000443841:Y747H;ENSP00000391669:Y793H;ENSP00000440370:Y599H;ENSP00000377072:Y765H;ENSP00000440415:Y745H;ENSP00000442161:Y718H	ENSP00000162330:Y747H	Y	-	1	0	BCAR1	73821284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	1.873000	0.54277	0.460000	0.39030	TAC	BCAR1	-	pfam_CAS_DUF3513	ENSG00000050820		0.672	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1	100	0.00	0	A	NM_014567		75263783	75263783	-1	no_errors	ENST00000418647	ensembl	human	known	69_37n	missense	86	30.65	38	SNP	1.000	G
BDP1	55814	genome.wustl.edu	37	5	70754468	70754468	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:70754468C>T	ENST00000358731.4	+	2	538	c.275C>T	c.(274-276)tCa>tTa	p.S92L	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	92	Interaction with ZBTB43.|Ser-rich.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TCTACTGTTTCACAGAGAAGA	0.373																																						dbGAP											0													143.0	141.0	142.0					5																	70754468		1915	4130	6045	-	-	-	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.275C>T	5.37:g.70754468C>T	ENSP00000351575:p.Ser92Leu		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.S92L	ENST00000358731.4	37	c.275	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500598	0.26861	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	T	0.56103	0.48	5.28	4.17	0.49024	.	0.510812	0.20114	N	0.098942	T	0.60261	0.2255	L	0.46741	1.465	0.80722	D	1	B;D;P	0.89917	0.27;1.0;0.607	B;D;B	0.83275	0.225;0.996;0.12	T	0.60414	-0.7268	10	0.54805	T	0.06	.	5.5645	0.17163	0.0:0.793:0.0:0.207	.	92;92;92	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	L	92	ENSP00000351575:S92L	ENSP00000351575:S92L	S	+	2	0	BDP1	70790224	0.373000	0.25073	0.988000	0.46212	0.118000	0.20060	1.552000	0.36244	2.622000	0.88805	0.585000	0.79938	TCA	BDP1	-	NULL	ENSG00000145734		0.373	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	63	0.00	0	C	NM_018429		70754468	70754468	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	0.897	T
BEAN1	146227	genome.wustl.edu	37	16	66526997	66526997	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:66526997G>C	ENST00000561796.1	+	5	643	c.280G>C	c.(280-282)Gag>Cag	p.E94Q	BEAN1_ENST00000563075.1_3'UTR|RP11-403P17.5_ENST00000561728.1_Intron	NM_001197224.2|NM_001197225.2	NP_001184153.1|NP_001184154.1	Q3B7T3	BEAN1_HUMAN	brain expressed, associated with NEDD4, 1	0	Arg-rich.|His-rich.				cell death (GO:0008219)	integral component of membrane (GO:0016021)				kidney(1)	1						CATCAGCAAAGAGAATGTCAA	0.557																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC000818	CCDS54015.1, CCDS58469.1, CCDS58470.1	16q21	2014-07-30			ENSG00000166546	ENSG00000166546			24160	protein-coding gene	gene with protein product		612051	"""spinocerebellar ataxia 31"""	SCA31		11042109, 8619474, 23607545	Standard	NM_001178020		Approved		uc021tjl.1	Q3B7T3	OTTHUMG00000173370	ENST00000561796.1:c.280G>C	16.37:g.66526997G>C	ENSP00000455212:p.Glu94Gln		B3KPC0|H3BP97	Missense_Mutation	SNP	NULL	p.E94Q	ENST00000561796.1	37	c.280	CCDS58470.1	16																																																																																			BEAN1	-	NULL	ENSG00000166546		0.557	BEAN1-004	NOVEL	basic|CCDS	protein_coding	BEAN1	HGNC	protein_coding	OTTHUMT00000422912.1	86	0.00	0	G	NM_001136106		66526997	66526997	+1	no_errors	ENST00000561796	ensembl	human	novel	69_37n	missense	129	11.03	16	SNP	0.098	C
BRWD1	54014	genome.wustl.edu	37	21	40590186	40590186	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr21:40590186G>C	ENST00000333229.2	-	31	3878	c.3551C>G	c.(3550-3552)gCt>gGt	p.A1184G	BRWD1-IT1_ENST00000435608.1_RNA|BRWD1_ENST00000342449.3_Missense_Mutation_p.A1184G|BRWD1_ENST00000380800.3_Missense_Mutation_p.A1184G	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1184	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GCCTGCAAAAGCTGCTGCTAT	0.383																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													104.0	104.0	104.0					21																	40590186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3551C>G	21.37:g.40590186G>C	ENSP00000330753:p.Ala1184Gly		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1184G	ENST00000333229.2	37	c.3551	CCDS13662.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.42|19.42	3.824918|3.824918	0.71143|0.71143	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800;ENST00000380783|ENST00000424441	T;T;T|.	0.19532|.	2.14;2.14;2.14|.	5.56|5.56	5.56|5.56	0.83823|0.83823	Bromodomain (5);|.	0.194051|.	0.36972|.	N|.	0.002312|.	T|T	0.70745|0.70745	0.3259|0.3259	M|M	0.63208|0.63208	1.945|1.945	0.80722|0.80722	D|D	1|1	D;D;D|.	0.64830|.	0.968;0.988;0.994|.	P;P;D|.	0.64506|.	0.81;0.885;0.926|.	T|T	0.69135|0.69135	-0.5225|-0.5225	10|5	0.30078|.	T|.	0.28|.	-10.1807|-10.1807	14.3722|14.3722	0.66849|0.66849	0.0:0.0:0.852:0.148|0.0:0.0:0.852:0.148	.|.	1184;1184;1184|.	Q9NSI6-3;Q9NSI6-2;Q9NSI6|.	.;.;BRWD1_HUMAN|.	G|R	1184;1184;1184;188|169	ENSP00000330753:A1184G;ENSP00000344333:A1184G;ENSP00000370178:A1184G|.	ENSP00000330753:A1184G|.	A|S	-|-	2|3	0|2	BRWD1|BRWD1	39512056|39512056	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	6.186000|6.186000	0.72026|0.72026	2.624000|2.624000	0.88883|0.88883	0.462000|0.462000	0.41574|0.41574	GCT|AGC	BRWD1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000185658		0.383	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	55	0.00	0	G	NM_033656		40590186	40590186	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	102	11.21	13	SNP	0.999	C
C16orf46	123775	genome.wustl.edu	37	16	81095551	81095551	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:81095551C>T	ENST00000299578.5	-	4	638	c.403G>A	c.(403-405)Gca>Aca	p.A135T	C16orf46_ENST00000444657.3_5'UTR|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000378611.4_Missense_Mutation_p.A135T	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	135						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						TGGGGGGCTGCCTGAGTCTGG	0.572																																						dbGAP											0													65.0	72.0	69.0					16																	81095551		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.403G>A	16.37:g.81095551C>T	ENSP00000299578:p.Ala135Thr		Q96MA7	Missense_Mutation	SNP	NULL	p.A135T	ENST00000299578.5	37	c.403	CCDS10932.1	16	.	.	.	.	.	.	.	.	.	.	C	1.921	-0.448285	0.04572	.	.	ENSG00000166455	ENST00000378611;ENST00000299578	T;T	0.15372	2.43;2.43	5.61	3.64	0.41730	.	0.411858	0.23160	N	0.051257	T	0.09113	0.0225	N	0.22421	0.69	0.09310	N	1	B;B	0.24721	0.11;0.11	B;B	0.19391	0.025;0.025	T	0.32534	-0.9903	10	0.13108	T	0.6	.	6.5242	0.22293	0.0:0.6863:0.148:0.1657	.	135;135	Q6P387-2;Q6P387	.;CP046_HUMAN	T	135	ENSP00000367874:A135T;ENSP00000299578:A135T	ENSP00000299578:A135T	A	-	1	0	C16orf46	79653052	0.000000	0.05858	0.008000	0.14137	0.004000	0.04260	-0.136000	0.10405	1.367000	0.46095	0.563000	0.77884	GCA	C16orf46	-	NULL	ENSG00000166455		0.572	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C16orf46	HGNC	protein_coding	OTTHUMT00000269054.2	38	0.00	0	C	NM_152337		81095551	81095551	-1	no_errors	ENST00000299578	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	0.002	T
VPS9D1	9605	genome.wustl.edu	37	16	89776248	89776248	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:89776248C>A	ENST00000389386.3	-	11	1449	c.1325G>T	c.(1324-1326)tGc>tTc	p.C442F	VPS9D1_ENST00000561976.1_Missense_Mutation_p.C372F|VPS9D1_ENST00000565452.1_5'Flank|VPS9D1-AS1_ENST00000562866.1_RNA	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	442					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										GCAGGCCAGGCAGCGGTCCTT	0.617																																						dbGAP											0													103.0	127.0	119.0					16																	89776248		2124	4252	6376	-	-	-	SO:0001583	missense	0			AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.1325G>T	16.37:g.89776248C>A	ENSP00000374037:p.Cys442Phe			Missense_Mutation	SNP	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	p.C442F	ENST00000389386.3	37	c.1325	CCDS42220.1	16	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508208	0.85282	.	.	ENSG00000075399	ENST00000389386	T	0.28255	1.62	5.54	5.54	0.83059	.	0.093427	0.85682	D	0.000000	T	0.57169	0.2035	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.59091	-0.7519	10	0.72032	D	0.01	-26.6161	18.0438	0.89326	0.0:1.0:0.0:0.0	.	442	Q9Y2B5	CP007_HUMAN	F	442	ENSP00000374037:C442F	ENSP00000374037:C442F	C	-	2	0	C16orf7	88303749	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.217000	0.65252	2.606000	0.88127	0.655000	0.94253	TGC	C16orf7	-	NULL	ENSG00000075399		0.617	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C16orf7	HGNC	protein_coding	OTTHUMT00000422508.1	64	0.00	0	C	NM_004913		89776248	89776248	-1	no_errors	ENST00000389386	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	1.000	A
C6orf118	168090	genome.wustl.edu	37	6	165693507	165693507	+	3'UTR	SNP	T	T	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:165693507T>A	ENST00000230301.8	-	0	1469				C6orf118_ENST00000494696.2_5'UTR	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118											breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		ACATGGAAGTTAAGAATTTCC	0.328																																						dbGAP											0													136.0	119.0	124.0					6																	165693507		2203	4299	6502	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.*39A>T	6.37:g.165693507T>A			Q8TC11	RNA	SNP	-	NULL	ENST00000230301.8	37	NULL	CCDS5288.1	6																																																																																			C6orf118	-	-	ENSG00000112539		0.328	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	42	0.00	0	T	NM_144980		165693507	165693507	-1	no_errors	ENST00000494696	ensembl	human	known	69_37n	rna	55	16.42	11	SNP	0.000	A
C8orf48	157773	genome.wustl.edu	37	8	13424528	13424528	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:13424528A>G	ENST00000297324.4	+	1	177	c.28A>G	c.(28-30)Acg>Gcg	p.T10A	RP11-145O15.3_ENST00000529018.1_RNA	NM_001007090.2	NP_001007091	Q96LL4	CH048_HUMAN	chromosome 8 open reading frame 48	10										NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	5						ATTGGCCCAAACGGACAAAAG	0.517																																						dbGAP											0													14.0	13.0	13.0					8																	13424528		692	1591	2283	-	-	-	SO:0001583	missense	0			AK058131	CCDS47809.1	8p22	2012-04-13			ENSG00000164743	ENSG00000164743			26345	protein-coding gene	gene with protein product						12477932	Standard	NM_001007090		Approved	FLJ25402	uc003wwp.3	Q96LL4	OTTHUMG00000165482	ENST00000297324.4:c.28A>G	8.37:g.13424528A>G	ENSP00000297324:p.Thr10Ala		Q96LJ9	Missense_Mutation	SNP	NULL	p.T10A	ENST00000297324.4	37	c.28	CCDS47809.1	8	.	.	.	.	.	.	.	.	.	.	A	10.88	1.476299	0.26511	.	.	ENSG00000164743	ENST00000297324	T	0.35236	1.32	4.48	-2.34	0.06704	.	1.710770	0.03860	N	0.273762	T	0.19366	0.0465	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.21109	-1.0255	10	0.59425	D	0.04	3.1938	0.9169	0.01306	0.4209:0.1584:0.2678:0.1529	.	10	Q96LL4	CH048_HUMAN	A	10	ENSP00000297324:T10A	ENSP00000297324:T10A	T	+	1	0	C8orf48	13468899	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.383000	0.07398	-0.372000	0.07992	0.533000	0.62120	ACG	C8orf48	-	NULL	ENSG00000164743		0.517	C8orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf48	HGNC	protein_coding	OTTHUMT00000384400.1	52	0.00	0	A	NM_001007090		13424528	13424528	+1	no_errors	ENST00000297324	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	0.000	G
C9orf131	138724	genome.wustl.edu	37	9	35044014	35044014	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:35044014G>C	ENST00000312292.5	+	2	1435	c.1388G>C	c.(1387-1389)tGg>tCg	p.W463S	C9orf131_ENST00000354479.5_Missense_Mutation_p.W390S|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000421362.2_Missense_Mutation_p.W415S	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	463										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GAAAATATTTGGGTCCCTGCA	0.547																																						dbGAP											0													77.0	80.0	79.0					9																	35044014		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1388G>C	9.37:g.35044014G>C	ENSP00000308279:p.Trp463Ser		A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.W463S	ENST00000312292.5	37	c.1388	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	G	1.050	-0.676220	0.03378	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292	T;T;T	0.13420	2.59;2.59;2.59	4.91	3.02	0.34903	.	1.275760	0.05279	N	0.519046	T	0.14485	0.0350	L	0.59436	1.845	0.09310	N	1	B;B;B	0.25441	0.048;0.126;0.126	B;B;B	0.18561	0.022;0.022;0.022	T	0.42565	-0.9444	10	0.11794	T	0.64	8.4443	7.835	0.29365	0.0:0.1989:0.6269:0.1742	.	463;390;415	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	S	415;390;463	ENSP00000393683:W415S;ENSP00000346472:W390S;ENSP00000308279:W463S	ENSP00000308279:W463S	W	+	2	0	C9orf131	35034014	0.102000	0.21896	0.038000	0.18304	0.003000	0.03518	1.794000	0.38774	0.749000	0.32854	-0.181000	0.13052	TGG	C9orf131	-	NULL	ENSG00000174038		0.547	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	24	0.00	0	G	NM_203299		35044014	35044014	+1	no_errors	ENST00000312292	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.001	C
CALML6	163688	genome.wustl.edu	37	1	1848258	1848258	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:1848258C>G	ENST00000307786.3	+	4	775	c.321C>G	c.(319-321)aaC>aaG	p.N107K	CALML6_ENST00000462293.1_3'UTR	NM_138705.2	NP_619650.2	Q8TD86	CALL6_HUMAN	calmodulin-like 6	107	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		AGGCCCAGAACCAGGAGAGCG	0.577																																						dbGAP											0													111.0	122.0	119.0					1																	1848258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490905	CCDS30566.1	1p36.33	2013-01-10			ENSG00000169885	ENSG00000169885		"""EF-hand domain containing"""	24193	protein-coding gene	gene with protein product		610171					Standard	NM_138705		Approved	CAGLP	uc001aih.1	Q8TD86	OTTHUMG00000000943	ENST00000307786.3:c.321C>G	1.37:g.1848258C>G	ENSP00000304643:p.Asn107Lys		A2A2M3|Q6Q2C4	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.N107K	ENST00000307786.3	37	c.321	CCDS30566.1	1	.	.	.	.	.	.	.	.	.	.	.	9.015	0.983436	0.18889	.	.	ENSG00000169885	ENST00000307786;ENST00000378604	T;T	0.36157	1.27;1.27	2.86	1.9	0.25705	EF-hand-like domain (1);	.	.	.	.	T	0.21590	0.0520	N	0.13235	0.315	0.27465	N	0.953033	P	0.51791	0.948	B	0.43783	0.431	T	0.09292	-1.0681	9	0.72032	D	0.01	.	5.1804	0.15158	0.0:0.8182:0.0:0.1818	.	107	Q8TD86	CALL6_HUMAN	K	107;90	ENSP00000304643:N107K;ENSP00000367867:N90K	ENSP00000304643:N107K	N	+	3	2	CALML6	1838118	0.083000	0.21467	0.053000	0.19242	0.872000	0.50106	0.571000	0.23669	0.506000	0.28125	0.313000	0.20887	AAC	CALML6	-	pfscan_EF_HAND_2	ENSG00000169885		0.577	CALML6-004	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	CALML6	HGNC	protein_coding	OTTHUMT00000276929.1	39	0.00	0	C	NM_138705		1848258	1848258	+1	no_errors	ENST00000307786	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	0.991	G
CAMK2A	815	genome.wustl.edu	37	5	149669201	149669201	+	5'UTR	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:149669201C>A	ENST00000348628.6	-	0	653				CAMK2A_ENST00000398376.3_5'Flank	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha						calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCGCTGGGCAGGCAGGTGA	0.632																																						dbGAP											0													59.0	71.0	67.0					5																	149669201		2139	4270	6409	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.-13G>T	5.37:g.149669201C>A			Q9UL21|Q9Y2H4|Q9Y352	RNA	SNP	-	NULL	ENST00000348628.6	37	NULL	CCDS43386.1	5																																																																																			CAMK2A	-	-	ENSG00000070808		0.632	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2A	HGNC	protein_coding	OTTHUMT00000258869.2	90	0.00	0	C	NM_015981		149669201	149669201	-1	no_errors	ENST00000507995	ensembl	human	known	69_37n	rna	100	29.58	42	SNP	0.010	A
CCDC121	79635	genome.wustl.edu	37	2	27850034	27850034	+	Missense_Mutation	SNP	C	C	G	rs140693737	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:27850034C>G	ENST00000324364.3	-	2	813	c.633G>C	c.(631-633)gaG>gaC	p.E211D	ZNF512_ENST00000556601.1_Intron|CCDC121_ENST00000394775.3_Missense_Mutation_p.E373D|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000424214.1_5'Flank|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000515877.1_5'Flank|GPN1_ENST00000264718.3_5'Flank|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000407583.3_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	211										breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					TCTGGGCTTGCTCAATTAGCT	0.478																																						dbGAP											0													60.0	62.0	61.0					2																	27850034		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.633G>C	2.37:g.27850034C>G	ENSP00000339087:p.Glu211Asp		B3KW66|J3KQZ8|Q9H8G6	Missense_Mutation	SNP	NULL	p.E373D	ENST00000324364.3	37	c.1119	CCDS1759.1	2	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440565	0.25900	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	T;T	0.32753	1.44;1.44	5.02	2.11	0.27256	.	1.605840	0.03651	N	0.240985	T	0.23249	0.0562	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.24155	0.051	T	0.26121	-1.0112	10	0.54805	T	0.06	-37.8163	6.0878	0.19976	0.3266:0.5824:0.0:0.0909	.	211	Q6ZUS5	CC121_HUMAN	D	211;373	ENSP00000339087:E211D;ENSP00000412150:E373D	ENSP00000339087:E211D	E	-	3	2	CCDC121	27703538	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.377000	0.20552	0.479000	0.27511	-0.293000	0.09583	GAG	CCDC121	-	NULL	ENSG00000176714		0.478	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC121	HGNC	protein_coding	OTTHUMT00000250215.1	83	0.00	0	C	NM_024584		27850034	27850034	-1	no_errors	ENST00000394775	ensembl	human	known	69_37n	missense	96	37.25	57	SNP	0.000	G
CCDC141	285025	genome.wustl.edu	37	2	179718298	179718298	+	Silent	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:179718298A>G	ENST00000420890.2	-	20	3231	c.3114T>C	c.(3112-3114)taT>taC	p.Y1038Y	CCDC141_ENST00000295723.5_Silent_p.Y463Y	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1038										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ACTCTGTGGAATATTTTCCAA	0.398																																						dbGAP											0													117.0	116.0	116.0					2																	179718298		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3114T>C	2.37:g.179718298A>G			H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y1038	ENST00000420890.2	37	c.3114		2																																																																																			CCDC141	-	NULL	ENSG00000163492		0.398	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		82	0.00	0	A	NM_173648		179718298	179718298	-1	no_errors	ENST00000420890	ensembl	human	known	69_37n	silent	89	23.93	28	SNP	1.000	G
CCDC146	57639	genome.wustl.edu	37	7	76909802	76909802	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:76909802T>C	ENST00000285871.4	+	14	1878	c.1751T>C	c.(1750-1752)aTg>aCg	p.M584T	CCDC146_ENST00000431197.1_Missense_Mutation_p.M298T|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	584										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AGAGAGAGCATGCAAAACGAT	0.348																																						dbGAP											0													60.0	52.0	55.0					7																	76909802		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1751T>C	7.37:g.76909802T>C	ENSP00000285871:p.Met584Thr		A8K8X6|Q9P223	Missense_Mutation	SNP	NULL	p.M584T	ENST00000285871.4	37	c.1751	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	T	15.17	2.752788	0.49362	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.26957	1.7;1.7	6.17	6.17	0.99709	.	0.147885	0.64402	D	0.000009	T	0.24586	0.0596	L	0.36672	1.1	0.33102	D	0.539425	B;P	0.35226	0.372;0.491	B;B	0.34824	0.069;0.19	T	0.31503	-0.9941	10	0.49607	T	0.09	-14.4261	16.4837	0.84171	0.0:0.0:0.0:1.0	.	298;584	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	T	584;298	ENSP00000285871:M584T;ENSP00000413885:M298T	ENSP00000285871:M584T	M	+	2	0	AC007000.1	76747738	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.760000	0.68793	2.371000	0.80710	0.533000	0.62120	ATG	CCDC146	-	NULL	ENSG00000135205		0.348	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	34	0.00	0	T	NM_020879		76909802	76909802	+1	no_errors	ENST00000285871	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	1.000	C
CCDC27	148870	genome.wustl.edu	37	1	3683150	3683150	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:3683150G>A	ENST00000294600.2	+	9	1588	c.1504G>A	c.(1504-1506)Gaa>Aaa	p.E502K		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	502										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		GGGGCTCATTGAAAAGGACAA	0.507																																						dbGAP											0													79.0	74.0	76.0					1																	3683150		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1504G>A	1.37:g.3683150G>A	ENSP00000294600:p.Glu502Lys		Q5TBV3|Q96M50	Missense_Mutation	SNP	superfamily_Prefoldin	p.E502K	ENST00000294600.2	37	c.1504	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640078	0.67244	.	.	ENSG00000162592	ENST00000294600	T	0.32023	1.47	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000017	T	0.44138	0.1279	L	0.36672	1.1	0.43250	D	0.995172	D	0.71674	0.998	D	0.70487	0.969	T	0.29088	-1.0023	10	0.49607	T	0.09	-33.7466	13.9664	0.64211	0.0:0.0:1.0:0.0	.	502	Q2M243	CCD27_HUMAN	K	502	ENSP00000294600:E502K	ENSP00000294600:E502K	E	+	1	0	CCDC27	3673010	0.998000	0.40836	0.927000	0.36925	0.377000	0.30045	3.430000	0.52807	2.341000	0.79615	0.591000	0.81541	GAA	CCDC27	-	NULL	ENSG00000162592		0.507	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	43	0.00	0	G	NM_152492		3683150	3683150	+1	no_errors	ENST00000294600	ensembl	human	known	69_37n	missense	24	60.66	37	SNP	0.975	A
CCDC30	728621	genome.wustl.edu	37	1	43042704	43042704	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:43042704T>G	ENST00000340612.4	+	6	869	c.869T>G	c.(868-870)cTa>cGa	p.L290R	CCDC30_ENST00000342022.4_Missense_Mutation_p.L290R|CCDC30_ENST00000390640.4_Missense_Mutation_p.L79R|CCDC30_ENST00000428554.2_Missense_Mutation_p.L290R|CCDC30_ENST00000507855.1_Missense_Mutation_p.L79R			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	290						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						AAGATTGAACTAAAGCATGCC	0.388																																						dbGAP											0													65.0	61.0	62.0					1																	43042704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.869T>G	1.37:g.43042704T>G	ENSP00000340378:p.Leu290Arg		Q14F06|Q5VVM5	Missense_Mutation	SNP	NULL	p.L290R	ENST00000340612.4	37	c.869	CCDS30690.1	1	.	.	.	.	.	.	.	.	.	.	T	16.63	3.178095	0.57692	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.64438	0.15;-0.1;0.15;0.15;-0.1	5.75	4.61	0.57282	.	0.075727	0.53938	D	0.000046	T	0.73760	0.3628	M	0.66939	2.045	0.36215	D	0.851598	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.98;0.95;0.995	T	0.76217	-0.3040	10	0.30078	T	0.28	.	10.4174	0.44329	0.1463:0.0:0.0:0.8537	.	290;74;79	Q5VVM6;Q6N081;Q5VVM6-2	CCD30_HUMAN;.;.	R	290;79;290;290;79	ENSP00000397035:L290R;ENSP00000426711:L79R;ENSP00000340378:L290R;ENSP00000339280:L290R;ENSP00000375051:L79R	ENSP00000340378:L290R	L	+	2	0	CCDC30	42815291	1.000000	0.71417	0.999000	0.59377	0.634000	0.38068	3.770000	0.55310	0.987000	0.38709	0.533000	0.62120	CTA	CCDC30	-	NULL	ENSG00000186409		0.388	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding	OTTHUMT00000019524.3	31	0.00	0	T	NM_025030		43042704	43042704	+1	no_errors	ENST00000340612	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	G
CCDC17	149483	genome.wustl.edu	37	1	46087625	46087625	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:46087625G>A	ENST00000528266.1	-	8	1157	c.1010C>T	c.(1009-1011)cCg>cTg	p.P337L	CCDC17_ENST00000464739.1_Intron|CCDC17_ENST00000343901.2_Missense_Mutation_p.P305L|CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000421127.2_Missense_Mutation_p.P328L			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	337										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					CCTCCCCTTCGGTTGTAGGCT	0.607																																						dbGAP											0													23.0	26.0	25.0					1																	46087625		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1010C>T	1.37:g.46087625G>A	ENSP00000432172:p.Pro337Leu		A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	NULL	p.P305L	ENST00000528266.1	37	c.914	CCDS44131.2	1	.	.	.	.	.	.	.	.	.	.	G	3.836	-0.034718	0.07543	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	T;T;T	0.15718	2.4;2.41;2.4	4.88	-4.8	0.03190	.	1.593590	0.04046	N	0.303922	T	0.03783	0.0107	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.001	T	0.30119	-0.9989	10	0.08381	T	0.77	-0.1315	0.5322	0.00630	0.3493:0.1117:0.2101:0.3289	.	337;328;305	Q96LX7;Q96LX7-5;F2Z395	CCD17_HUMAN;.;.	L	328;305;337	ENSP00000389415:P328L;ENSP00000341451:P305L;ENSP00000432172:P337L	ENSP00000341451:P305L	P	-	2	0	CCDC17	45860212	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.810000	0.04505	-0.505000	0.06568	-1.840000	0.00586	CCG	CCDC17	-	NULL	ENSG00000159588		0.607	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC17	HGNC	protein_coding	OTTHUMT00000386833.1	61	0.00	0	G	NM_152500		46087625	46087625	-1	no_errors	ENST00000343901	ensembl	human	known	69_37n	missense	68	26.60	25	SNP	0.000	A
CCNB3	85417	genome.wustl.edu	37	X	50053904	50053904	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:50053904A>C	ENST00000376042.1	+	6	3033	c.2735A>C	c.(2734-2736)aAg>aCg	p.K912T	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.K912T|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	912					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CTCCTCAAAAAGCCATTAGCC	0.478																																						dbGAP											0													74.0	67.0	69.0					X																	50053904		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2735A>C	X.37:g.50053904A>C	ENSP00000365210:p.Lys912Thr		B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.K912T	ENST00000376042.1	37	c.2735	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	A	8.545	0.874132	0.17395	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.18810	2.19;2.19	3.17	-1.07	0.09968	.	16.166700	0.00166	N	0.000001	T	0.06917	0.0176	N	0.02011	-0.69	0.09310	N	1	B	0.19073	0.033	B	0.15484	0.013	T	0.14839	-1.0458	9	.	.	.	.	0.2608	0.00218	0.3925:0.2229:0.1481:0.2365	.	912	Q8WWL7	CCNB3_HUMAN	T	912	ENSP00000365210:K912T;ENSP00000276014:K912T	.	K	+	2	0	CCNB3	50070644	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	1.440000	0.35024	-0.299000	0.08909	0.441000	0.28932	AAG	CCNB3	-	NULL	ENSG00000147082		0.478	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	30	0.00	0	A			50053904	50053904	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	0.000	C
CCNF	899	genome.wustl.edu	37	16	2499874	2499874	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:2499874A>G	ENST00000397066.4	+	13	1533	c.1445A>G	c.(1444-1446)tAt>tGt	p.Y482C	RP11-715J22.3_ENST00000561653.1_RNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	482					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GGATTCTCCTATGAAGACCTC	0.617																																						dbGAP											0													149.0	139.0	142.0					16																	2499874		2198	4300	6498	-	-	-	SO:0001583	missense	0			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1445A>G	16.37:g.2499874A>G	ENSP00000380256:p.Tyr482Cys		B2R8H3|Q96EG9	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,pfam_F-box_dom_cyclin-like,superfamily_Cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Cyclin-like,pfscan_F-box_dom_cyclin-like	p.Y482C	ENST00000397066.4	37	c.1445	CCDS10467.1	16	.	.	.	.	.	.	.	.	.	.	A	3.989	-0.004812	0.07773	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.21932	1.98	5.2	-10.4	0.00318	Cyclin, C-terminal (1);Cyclin-like (3);	0.824932	0.11429	N	0.565022	T	0.08447	0.0210	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.15549	-1.0433	10	0.37606	T	0.19	2.6589	0.9807	0.01435	0.4542:0.1714:0.1202:0.2543	.	482	P41002	CCNF_HUMAN	C	482;397	ENSP00000380256:Y482C	ENSP00000293968:Y397C	Y	+	2	0	CCNF	2439875	0.012000	0.17670	0.005000	0.12908	0.064000	0.16182	0.514000	0.22786	-2.322000	0.00640	-1.498000	0.00962	TAT	CCNF	-	pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000162063		0.617	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNF	HGNC	protein_coding	OTTHUMT00000250801.1	47	0.00	0	A	NM_001761		2499874	2499874	+1	no_errors	ENST00000397066	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	0.023	G
CDC25C	995	genome.wustl.edu	37	5	137654919	137654919	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:137654919G>C	ENST00000323760.6	-	7	882	c.604C>G	c.(604-606)Caa>Gaa	p.Q202E	CDC25C_ENST00000415130.2_Missense_Mutation_p.Q129E|CDC25C_ENST00000513970.1_Missense_Mutation_p.Q202E|CDC25C_ENST00000348983.3_Missense_Mutation_p.Q129E|CDC25C_ENST00000356505.3_Missense_Mutation_p.Q172E|CDC25C_ENST00000514555.1_Missense_Mutation_p.Q172E|CDC25C_ENST00000357274.3_Missense_Mutation_p.Q159E	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	202					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TTTGCTTCTTGATCTTTCAGG	0.343																																						dbGAP											0													137.0	137.0	137.0					5																	137654919		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.604C>G	5.37:g.137654919G>C	ENSP00000321656:p.Gln202Glu		D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.Q202E	ENST00000323760.6	37	c.604	CCDS4202.1	5	.	.	.	.	.	.	.	.	.	.	G	9.606	1.130014	0.21041	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555;ENST00000503022	T;T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04	4.57	2.62	0.31277	.	0.988349	0.08232	N	0.977446	T	0.20981	0.0505	L	0.54323	1.7	0.26551	N	0.973915	B;B;B;B;B	0.33266	0.347;0.404;0.004;0.347;0.248	B;B;B;B;B	0.30782	0.069;0.093;0.006;0.12;0.064	T	0.18587	-1.0332	10	0.24483	T	0.36	-2.631	10.8888	0.46984	0.0:0.3663:0.6337:0.0	.	219;159;172;129;202	G3V1P6;P30307-3;P30307-2;P30307-4;P30307	.;.;.;.;MPIP3_HUMAN	E	202;172;159;129;129;202;219;172;202	ENSP00000321656:Q202E;ENSP00000348898:Q172E;ENSP00000349821:Q159E;ENSP00000345205:Q129E;ENSP00000392631:Q129E;ENSP00000424795:Q202E;ENSP00000425470:Q172E;ENSP00000427251:Q202E	ENSP00000321656:Q202E	Q	-	1	0	CDC25C	137682818	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.617000	0.36943	1.099000	0.41499	0.563000	0.77884	CAA	CDC25C	-	pfam_MPI_Phosphatase	ENSG00000158402		0.343	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25C	HGNC	protein_coding	OTTHUMT00000251280.1	90	0.00	0	G			137654919	137654919	-1	no_errors	ENST00000323760	ensembl	human	known	69_37n	missense	123	26.79	45	SNP	1.000	C
CFP	5199	genome.wustl.edu	37	X	47485563	47485563	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:47485563C>A	ENST00000396992.3	-	8	1258	c.1138G>T	c.(1138-1140)Gga>Tga	p.G380*	CFP_ENST00000480317.1_5'Flank|CFP_ENST00000377005.2_Nonsense_Mutation_p.G380*|CFP_ENST00000247153.3_Nonsense_Mutation_p.G380*	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	380	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GACCATGATCCTTTCACTGCA	0.602																																						dbGAP											0													28.0	22.0	24.0					X																	47485563		2185	4269	6454	-	-	-	SO:0001587	stop_gained	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.1138G>T	X.37:g.47485563C>A	ENSP00000380189:p.Gly380*		O15134|O15135|O15136|O75826	Nonsense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G380*	ENST00000396992.3	37	c.1138	CCDS14282.1	X	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972535	0.92919	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.718	0.62710	0.0:1.0:0.0:0.0	.	.	.	.	X	380	.	ENSP00000247153:G380X	G	-	1	0	CFP	47370507	0.978000	0.34361	0.993000	0.49108	0.291000	0.27294	5.083000	0.64456	2.397000	0.81536	0.600000	0.82982	GGA	CFP	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000126759		0.602	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	69	0.00	0	C	NM_002621		47485563	47485563	-1	no_errors	ENST00000247153	ensembl	human	known	69_37n	nonsense	52	20.00	13	SNP	0.997	A
CHD2	1106	genome.wustl.edu	37	15	93524061	93524061	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:93524061A>G	ENST00000394196.4	+	23	3961	c.2893A>G	c.(2893-2895)Aaa>Gaa	p.K965E	CHD2_ENST00000557381.1_Missense_Mutation_p.K965E	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	965					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCCTTTTAATAAAGAAGAGCT	0.368																																						dbGAP											0													42.0	46.0	45.0					15																	93524061		2193	4295	6488	-	-	-	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2893A>G	15.37:g.93524061A>G	ENSP00000377747:p.Lys965Glu		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K965E	ENST00000394196.4	37	c.2893	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	A	28.8	4.953257	0.92660	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.95137	-3.62;-3.62	5.38	5.38	0.77491	.	0.000000	0.36268	U	0.002681	D	0.96367	0.8815	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.80764	0.952;0.994	D	0.96873	0.9641	10	0.72032	D	0.01	-25.0853	15.3959	0.74794	1.0:0.0:0.0:0.0	.	965;965	O14647;O14647-2	CHD2_HUMAN;.	E	965	ENSP00000377747:K965E;ENSP00000451366:K965E	ENSP00000377747:K965E	K	+	1	0	CHD2	91325065	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.307000	0.96226	2.048000	0.60808	0.459000	0.35465	AAA	CHD2	-	NULL	ENSG00000173575		0.368	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	27	0.00	0	A	NM_001271		93524061	93524061	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	missense	58	21.62	16	SNP	1.000	G
CHL1	10752	genome.wustl.edu	37	3	402080	402080	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:402080C>T	ENST00000256509.2	+	12	1921	c.1279C>T	c.(1279-1281)Ctt>Ttt	p.L427F	CHL1_ENST00000397491.2_Missense_Mutation_p.L411F|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L427I(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TGGAACTATCCTTGCCAATGC	0.443																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											253.0	229.0	237.0					3																	402080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1279C>T	3.37:g.402080C>T	ENSP00000256509:p.Leu427Phe		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L427F	ENST00000256509.2	37	c.1279	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747154	0.69418	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.66815	-0.23;-0.23	5.16	4.28	0.50868	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.76716	0.4026	L	0.53671	1.685	0.50813	D	0.999898	D;D;D	0.89917	0.995;0.995;1.0	D;D;D	0.87578	0.958;0.958;0.998	T	0.78513	-0.2175	10	0.87932	D	0	.	11.8781	0.52558	0.0:0.9172:0.0:0.0828	.	411;411;427	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	F	427;411	ENSP00000256509:L427F;ENSP00000380628:L411F	ENSP00000256509:L427F	L	+	1	0	CHL1	377080	1.000000	0.71417	0.841000	0.33234	0.980000	0.70556	2.816000	0.48026	1.288000	0.44600	0.655000	0.94253	CTT	CHL1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000134121		0.443	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	98	0.00	0	C	NM_006614		402080	402080	+1	no_errors	ENST00000256509	ensembl	human	known	69_37n	missense	138	17.37	29	SNP	0.995	T
CHST2	9435	genome.wustl.edu	37	3	142840143	142840144	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:142840143_142840144AC>TA	ENST00000309575.3	+	2	1869_1870	c.485_486AC>TA	c.(484-486)gAC>gTA	p.D162V		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	162					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						GGCGTCGGGGACAAGCGGCAGC	0.688																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	Exception_encountered	3.37:g.142840143_142840144delinsTA	ENSP00000307911:p.Asp162Val		D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.D162V|p.D162E	ENST00000309575.3	37	c.485|c.486	CCDS3129.1	3																																																																																			CHST2	-	pirsf_Carbohydrate_sulfotransferase	ENSG00000175040		0.688	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST2	HGNC	protein_coding	OTTHUMT00000354850.1	40	0.00	0	A|C	NM_004267		142840143|142840144	142840143|142840144	+1	no_errors	ENST00000309575	ensembl	human	known	69_37n	missense	42|41	32.26|31.67	20|19	SNP	0.827|0.929	T|A
CIITA	4261	genome.wustl.edu	37	16	10997664	10997664	+	Silent	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:10997664G>T	ENST00000324288.8	+	9	982	c.849G>T	c.(847-849)cgG>cgT	p.R283R	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Silent_p.R234R	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	283					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CTCCAGACCGGCCAGGCTCCA	0.627			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																	dbGAP		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0													95.0	85.0	89.0					16																	10997664		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.849G>T	16.37:g.10997664G>T			A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,prints_MHC_II_transact	p.R283	ENST00000324288.8	37	c.849	CCDS10544.1	16																																																																																			CIITA	-	NULL	ENSG00000179583		0.627	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	55	0.00	0	G	NM_000246		10997664	10997664	+1	no_errors	ENST00000324288	ensembl	human	known	69_37n	silent	64	20.99	17	SNP	0.673	T
COL12A1	1303	genome.wustl.edu	37	6	75833729	75833729	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:75833729C>A	ENST00000322507.8	-	42	7115	c.6806G>T	c.(6805-6807)gGt>gTt	p.G2269V	COL12A1_ENST00000416123.2_Missense_Mutation_p.G2269V|COL12A1_ENST00000483888.2_Missense_Mutation_p.G2269V|COL12A1_ENST00000345356.6_Missense_Mutation_p.G1105V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2269	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AACAGTGACACCATAATCAGT	0.433																																						dbGAP											0													123.0	116.0	118.0					6																	75833729		1905	4138	6043	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6806G>T	6.37:g.75833729C>A	ENSP00000325146:p.Gly2269Val		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G2269V	ENST00000322507.8	37	c.6806	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	9.562	1.118665	0.20877	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.54	5.54	0.83059	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.462737	0.22526	N	0.058915	T	0.06005	0.0156	N	0.22421	0.69	0.19300	N	0.999973	B;B	0.26147	0.118;0.143	B;B	0.27170	0.075;0.077	T	0.11203	-1.0597	10	0.62326	D	0.03	.	6.7261	0.23357	0.0:0.7091:0.1782:0.1127	.	1105;2269	Q99715-2;Q99715	.;COCA1_HUMAN	V	2269;2269;1105;2269;2269	ENSP00000325146:G2269V;ENSP00000305147:G1105V;ENSP00000412864:G2269V;ENSP00000421216:G2269V	ENSP00000325146:G2269V	G	-	2	0	COL12A1	75890449	0.838000	0.29461	0.013000	0.15412	0.856000	0.48823	1.510000	0.35790	2.779000	0.95612	0.591000	0.81541	GGT	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.433	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	82	0.00	0	C	NM_004370		75833729	75833729	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	78	28.44	31	SNP	0.008	A
COL14A1	7373	genome.wustl.edu	37	8	121379445	121379445	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:121379445G>T	ENST00000297848.3	+	46	5383	c.5113G>T	c.(5113-5115)Ggc>Tgc	p.G1705C	COL14A1_ENST00000309791.4_Missense_Mutation_p.G1705C|COL14A1_ENST00000247781.3_Missense_Mutation_p.G1610C	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AGGAAATCCAGGCGTTGGAAC	0.358																																						dbGAP											0													52.0	54.0	53.0					8																	121379445		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5113G>T	8.37:g.121379445G>T	ENSP00000297848:p.Gly1705Cys			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G1705C	ENST00000297848.3	37	c.5113	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225928	0.79576	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29	5.36	5.36	0.76844	.	0.113563	0.64402	D	0.000011	D	0.99785	0.9910	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97149	0.9830	10	0.87932	D	0	.	19.0936	0.93240	0.0:0.0:1.0:0.0	.	1705	Q05707	COEA1_HUMAN	C	1705;1705;1610;52	ENSP00000311809:G1705C;ENSP00000297848:G1705C;ENSP00000247781:G1610C;ENSP00000403640:G52C	ENSP00000247781:G1610C	G	+	1	0	COL14A1	121448626	1.000000	0.71417	0.927000	0.36925	0.966000	0.64601	7.120000	0.77153	2.682000	0.91365	0.650000	0.86243	GGC	COL14A1	-	pfam_Collagen	ENSG00000187955		0.358	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	19	0.00	0	G	NM_021110		121379445	121379445	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	1.000	T
COL4A6	1288	genome.wustl.edu	37	X	107420161	107420161	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:107420161C>G	ENST00000372216.4	-	28	2699	c.2599G>C	c.(2599-2601)Ggc>Cgc	p.G867R	COL4A6_ENST00000394872.2_Missense_Mutation_p.G867R|COL4A6_ENST00000334504.7_Missense_Mutation_p.G866R|COL4A6_ENST00000538570.1_Missense_Mutation_p.G866R|COL4A6_ENST00000545689.1_Missense_Mutation_p.G866R	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	867	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCAGGAAGGCCTTTTAGCCCT	0.532									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	dbGAP											0													140.0	138.0	139.0					X																	107420161		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2599G>C	X.37:g.107420161C>G	ENSP00000361290:p.Gly867Arg		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G867R	ENST00000372216.4	37	c.2599	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689785	0.29962	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99537	-5.77;-5.77;-5.77;-6.11;-6.11	4.08	4.08	0.47627	.	0.000000	0.43260	D	0.000586	D	0.99837	0.9926	H	0.99487	4.59	0.51767	D	0.999938	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96226	0.9164	10	0.87932	D	0	.	16.5388	0.84380	0.0:1.0:0.0:0.0	.	866;866;867;866	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	R	867;866;867;866;866;866	ENSP00000361290:G867R;ENSP00000334733:G866R;ENSP00000378340:G867R;ENSP00000443707:G866R;ENSP00000445236:G866R	ENSP00000334733:G866R	G	-	1	0	COL4A6	107306817	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	6.469000	0.73555	2.287000	0.76781	0.436000	0.28706	GGC	COL4A6	-	pfam_Collagen	ENSG00000197565		0.532	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	97	0.00	0	C			107420161	107420161	-1	no_errors	ENST00000372216	ensembl	human	known	69_37n	missense	77	12.50	11	SNP	1.000	G
CPA2	1358	genome.wustl.edu	37	7	129913559	129913559	+	Intron	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:129913559G>C	ENST00000222481.4	+	5	541					NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)						protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					AGTTCTGGTCGTATGCAGAAG	0.333																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.486+542G>C	7.37:g.129913559G>C			A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	pfam_Prot_inh_M14A,pfam_Peptidase_M14,superfamily_Prot_inh_propept	p.R165P	ENST00000222481.4	37	c.494	CCDS5817.2	7																																																																																			CPA2	-	pfam_Peptidase_M14	ENSG00000158516		0.333	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA2	HGNC	protein_coding	OTTHUMT00000347124.2	22	0.00	0	G	NM_001869		129913559	129913559	+1	no_errors	ENST00000416698	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.001	C
DCAF10	79269	genome.wustl.edu	37	9	37854783	37854784	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:37854783_37854784insT	ENST00000377724.3	+	4	1223_1224	c.858_859insT	c.(859-861)gaafs	p.E287fs	DCAF10_ENST00000242323.7_Frame_Shift_Ins_p.E287fs|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	287					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						GTAGGTATACAGAAGATGGGTG	0.351																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	Exception_encountered	9.37:g.37854783_37854784insT	ENSP00000366953:p.Glu287fs		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E286fs	ENST00000377724.3	37	c.858_859	CCDS6613.2	9																																																																																			DCAF10	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000122741		0.351	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	43	0.00	0	-	NM_024345		37854783	37854784	+1	no_errors	ENST00000377724	ensembl	human	known	69_37n	frame_shift_ins	46	17.86	10	INS	1.000:1.000	T
DCAF10	79269	genome.wustl.edu	37	9	37854784	37854785	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:37854784_37854785insGT	ENST00000377724.3	+	4	1224_1225	c.859_860insGT	c.(859-861)gaafs	p.E287fs	DCAF10_ENST00000242323.7_Frame_Shift_Ins_p.E287fs|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	287					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TAGGTATACAGAAGATGGGTGT	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	Exception_encountered	9.37:g.37854784_37854785insGT	ENSP00000366953:p.Glu287fs		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E287fs	ENST00000377724.3	37	c.859_860	CCDS6613.2	9																																																																																			DCAF10	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000122741		0.347	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	44	0.00	0	-	NM_024345		37854784	37854785	+1	no_errors	ENST00000377724	ensembl	human	known	69_37n	frame_shift_ins	45	18.18	10	INS	1.000:1.000	GT
DCAF10	79269	genome.wustl.edu	37	9	37854785	37854786	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:37854785_37854786insT	ENST00000377724.3	+	4	1225_1226	c.860_861insT	c.(859-864)gaagatfs	p.ED287fs	DCAF10_ENST00000242323.7_Frame_Shift_Ins_p.ED287fs|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	287					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						AGGTATACAGAAGATGGGTGTC	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	Exception_encountered	9.37:g.37854785_37854786insT	ENSP00000366953:p.Glu287fs		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E287fs	ENST00000377724.3	37	c.860_861	CCDS6613.2	9																																																																																			DCAF10	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000122741		0.347	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	45	0.00	0	-	NM_024345		37854785	37854786	+1	no_errors	ENST00000377724	ensembl	human	known	69_37n	frame_shift_ins	45	18.18	10	INS	1.000:1.000	T
DCAF12	25853	genome.wustl.edu	37	9	34125207	34125207	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:34125207G>A	ENST00000361264.4	-	2	488	c.147C>T	c.(145-147)taC>taT	p.Y49Y	DCAF12_ENST00000463286.1_5'UTR	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	49					protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						GGTTCTTCAAGTAGTATACTA	0.463																																						dbGAP											0													90.0	85.0	87.0					9																	34125207		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A		11572484, 9110174	Standard	NM_015397		Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.147C>T	9.37:g.34125207G>A			A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y49	ENST00000361264.4	37	c.147	CCDS6549.1	9																																																																																			DCAF12	-	NULL	ENSG00000198876		0.463	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12	HGNC	protein_coding	OTTHUMT00000052133.2	48	0.00	0	G	NM_015397		34125207	34125207	-1	no_errors	ENST00000361264	ensembl	human	known	69_37n	silent	48	40.74	33	SNP	1.000	A
DENND2C	163259	genome.wustl.edu	37	1	115127989	115127989	+	3'UTR	DEL	A	A	-			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:115127989delA	ENST00000393274.1	-	0	3644				DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_3'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C						positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCTGCTATAAAAAAAAAAT	0.408																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.*232T>-	1.37:g.115127989delA			B1AL26|Q5TCX6|Q6P3R3	RNA	DEL	-	NULL	ENST00000393274.1	37	NULL	CCDS58018.1	1																																																																																			DENND2C	-	-	ENSG00000175984		0.408	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	12	0.00	0	A	NM_198459		115127989	115127989	-1	no_errors	ENST00000495031	ensembl	human	known	69_37n	rna	18	14.29	3	DEL	0.000	-
DNAH10	196385	genome.wustl.edu	37	12	124332600	124332600	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:124332600G>C	ENST00000409039.3	+	32	5578	c.5553G>C	c.(5551-5553)ttG>ttC	p.L1851F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1851	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCTTGGGCTTGCTCTGTGTTG	0.572																																						dbGAP											0													124.0	126.0	126.0					12																	124332600		2033	4207	6240	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5553G>C	12.37:g.124332600G>C	ENSP00000386770:p.Leu1851Phe		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.L1851F	ENST00000409039.3	37	c.5553	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761269	0.69763	.	.	ENSG00000197653	ENST00000409039	T	0.10477	2.87	5.67	2.74	0.32292	ATPase, AAA+ type, core (1);	0.237219	0.24864	U	0.034988	T	0.24586	0.0596	M	0.63428	1.95	0.46167	D	0.998908	D	0.89917	1.0	D	0.83275	0.996	T	0.00583	-1.1659	10	0.37606	T	0.19	.	7.5133	0.27585	0.0672:0.1252:0.6846:0.123	.	1851	Q8IVF4	DYH10_HUMAN	F	1851	ENSP00000386770:L1851F	ENSP00000386770:L1851F	L	+	3	2	DNAH10	122898553	1.000000	0.71417	0.999000	0.59377	0.803000	0.45373	1.292000	0.33342	0.285000	0.22329	0.555000	0.69702	TTG	DNAH10	-	smart_AAA+_ATPase	ENSG00000197653		0.572	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	56	0.00	0	G			124332600	124332600	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	43	51.14	45	SNP	1.000	C
DNAH17	8632	genome.wustl.edu	37	17	76445507	76445507	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:76445507C>A	ENST00000585328.1	-	69	11309	c.11185G>T	c.(11185-11187)Gtt>Ttt	p.V3729F	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.V3720F	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3720					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGAAACGTAACTTGTGCCAGG	0.547																																						dbGAP											0													117.0	82.0	94.0					17																	76445507		2131	4140	6271	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.11185G>T	17.37:g.76445507C>A	ENSP00000465516:p.Val3729Phe		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.V3720F	ENST00000585328.1	37	c.11158		17	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662365	0.29515	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.58060	0.36	4.48	3.51	0.40186	.	0.125722	0.35772	N	0.002985	T	0.42630	0.1211	L	0.44542	1.39	0.36607	D	0.875006	B	0.31989	0.35	B	0.31946	0.138	T	0.51212	-0.8734	10	0.72032	D	0.01	.	8.4162	0.32672	0.0:0.7505:0.0:0.2495	.	3729	E7EUM8	.	F	3729;3720	ENSP00000374490:V3720F	ENSP00000300671:V3729F	V	-	1	0	DNAH17	73957102	1.000000	0.71417	0.424000	0.26647	0.434000	0.31775	2.195000	0.42677	0.886000	0.36113	0.561000	0.74099	GTT	DNAH17	-	NULL	ENSG00000187775		0.547	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	58	0.00	0	C	NM_173628		76445507	76445507	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	38	48.65	36	SNP	0.998	A
DQX1	165545	genome.wustl.edu	37	2	74751035	74751035	+	Intron	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:74751035T>C	ENST00000404568.3	-	4	1036				DQX1_ENST00000393951.2_Intron|DQX1_ENST00000495597.1_5'UTR	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						ttttttgttttgttttgtttt	0.478																																						dbGAP											0													10.0	10.0	10.0					2																	74751035		2138	4263	6401	-	-	-	SO:0001627	intron_variant	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.816+14A>G	2.37:g.74751035T>C			Q6B017|Q8NAM8	RNA	SNP	-	NULL	ENST00000404568.3	37	NULL	CCDS1949.2	2																																																																																			DQX1	-	-	ENSG00000144045		0.478	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	27	0.00	0	T	NM_133637		74751035	74751035	-1	no_errors	ENST00000495597	ensembl	human	known	69_37n	rna	38	28.30	15	SNP	0.001	C
DTWD1	56986	genome.wustl.edu	37	15	49917567	49917567	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:49917567A>G	ENST00000251250.6	+	3	410	c.203A>G	c.(202-204)tAc>tGc	p.Y68C	DTWD1_ENST00000559223.1_3'UTR|DTWD1_ENST00000558653.1_Missense_Mutation_p.Y68C|DTWD1_ENST00000329873.5_Missense_Mutation_p.Y68C|DTWD1_ENST00000403028.3_Missense_Mutation_p.Y68C	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	68										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AGAATGTTCTACTGCTATACA	0.343																																						dbGAP											0													94.0	87.0	90.0					15																	49917567		2196	4295	6491	-	-	-	SO:0001583	missense	0			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.203A>G	15.37:g.49917567A>G	ENSP00000251250:p.Tyr68Cys		Q567Q3|Q8WVG9|Q9NRU6	Missense_Mutation	SNP	pfam_DTW	p.Y68C	ENST00000251250.6	37	c.203	CCDS10132.1	15	.	.	.	.	.	.	.	.	.	.	A	18.49	3.635950	0.67130	.	.	ENSG00000104047	ENST00000403028;ENST00000329873;ENST00000251250	T;T;T	0.36699	1.4;1.24;1.4	5.09	5.09	0.68999	DTW (1);	0.052045	0.85682	D	0.000000	T	0.61912	0.2385	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.65985	-0.6035	9	.	.	.	-9.4207	15.1692	0.72858	1.0:0.0:0.0:0.0	.	68	Q8N5C7	DTWD1_HUMAN	C	68	ENSP00000385399:Y68C;ENSP00000329313:Y68C;ENSP00000251250:Y68C	.	Y	+	2	0	DTWD1	47704859	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.292000	0.72725	2.029000	0.59856	0.482000	0.46254	TAC	DTWD1	-	pfam_DTW	ENSG00000104047		0.343	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	HGNC	protein_coding	OTTHUMT00000254431.2	103	0.00	0	A	NM_020234		49917567	49917567	+1	no_errors	ENST00000251250	ensembl	human	known	69_37n	missense	135	13.46	21	SNP	1.000	G
DYNC2LI1	51626	genome.wustl.edu	37	2	44023934	44023934	+	Splice_Site	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:44023934G>T	ENST00000260605.8	+	8	754	c.654G>T	c.(652-654)atG>atT	p.M218I	DYNC2LI1_ENST00000489222.2_3'UTR|DYNC2LI1_ENST00000605786.1_Splice_Site_p.M219I|DYNC2LI1_ENST00000443170.3_Splice_Site_p.M92I	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	218					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CATCATTAATGGTTTGTACAT	0.353																																						dbGAP											0													145.0	131.0	136.0					2																	44023934		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.654+1G>T	2.37:g.44023934G>T			A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Missense_Mutation	SNP	pfam_Dynein_light_int_chain	p.M218I	ENST00000260605.8	37	c.654	CCDS1813.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.746|5.746	0.322037|0.322037	0.10900|0.10900	.|.	.|.	ENSG00000138036|ENSG00000138036	ENST00000378587|ENST00000260605;ENST00000443170	.|T;T	.|0.09538	.|2.97;2.97	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.170040	.|0.64402	.|D	.|0.000005	T|T	0.04634|0.04634	0.0126|0.0126	N|N	0.02296|0.02296	-0.605|-0.605	0.46521|0.46521	D|D	0.999086|0.999086	.|B;B;B	.|0.09022	.|0.002;0.001;0.002	.|B;B;B	.|0.09377	.|0.004;0.002;0.004	T|T	0.25606|0.25606	-1.0127|-1.0127	5|10	.|0.02654	.|T	.|1	-19.1174|-19.1174	18.5354|18.5354	0.91009|0.91009	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|219;218;218	.|Q8TCX1-2;Q8TCX1;Q8TCX1-3	.|.;DC2L1_HUMAN;.	F|I	202|218;92	.|ENSP00000260605:M218I;ENSP00000388941:M92I	.|ENSP00000260605:M218I	C|M	+|+	2|3	0|0	DYNC2LI1|DYNC2LI1	43877438|43877438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.161000|3.161000	0.50747|0.50747	2.591000|2.591000	0.87537|0.87537	0.650000|0.650000	0.86243|0.86243	TGT|ATG	DYNC2LI1	-	NULL	ENSG00000138036		0.353	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYNC2LI1	HGNC	protein_coding	OTTHUMT00000250536.2	44	0.00	0	G	NM_016008	Missense_Mutation	44023934	44023934	+1	no_errors	ENST00000260605	ensembl	human	known	69_37n	missense	108	11.48	14	SNP	1.000	T
EBF1	1879	genome.wustl.edu	37	5	158140136	158140136	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:158140136G>A	ENST00000313708.6	-	13	1493	c.1211C>T	c.(1210-1212)gCg>gTg	p.A404V	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.A373V|EBF1_ENST00000517373.1_Missense_Mutation_p.A396V	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	404					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AATGTCGGCCGCTCTCTTCAG	0.532			T	HMGA2	lipoma																																	dbGAP		Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													75.0	64.0	68.0					5																	158140136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1211C>T	5.37:g.158140136G>A	ENSP00000322898:p.Ala404Val		Q8IW11	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_HLH_DNA-bd,smart_IPT_TIG_rcpt	p.A404V	ENST00000313708.6	37	c.1211	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.223572	0.95139	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.46451	0.87;0.87;0.87	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.69351	0.3101	M	0.82716	2.605	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;D	0.70227	0.821;0.954;0.92;0.968	T	0.70648	-0.4814	10	0.56958	D	0.05	-4.4587	20.2985	0.98592	0.0:0.0:1.0:0.0	.	404;391;404;373	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	V	404;404;373;396	ENSP00000322898:A404V;ENSP00000370029:A373V;ENSP00000428020:A396V	ENSP00000322898:A404V	A	-	2	0	EBF1	158072714	1.000000	0.71417	0.968000	0.41197	0.961000	0.63080	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	GCG	EBF1	-	superfamily_HLH_DNA-bd	ENSG00000164330		0.532	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	89	0.00	0	G	NM_024007		158140136	158140136	-1	no_errors	ENST00000313708	ensembl	human	known	69_37n	missense	88	10.20	10	SNP	1.000	A
FAAH2	158584	genome.wustl.edu	37	X	57458464	57458464	+	Silent	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:57458464T>C	ENST00000374900.4	+	8	1230	c.1110T>C	c.(1108-1110)gaT>gaC	p.D370D	FAAH2_ENST00000491179.1_Intron	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	370						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						AGGGACATGATGGGAAGGTAT	0.348										HNSCC(52;0.14)																												dbGAP											0													117.0	94.0	102.0					X																	57458464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1110T>C	X.37:g.57458464T>C			Q86VT2|Q96N98	Silent	SNP	pfam_Amidase,superfamily_Amidase_dom	p.D370	ENST00000374900.4	37	c.1110	CCDS14375.1	X																																																																																			FAAH2	-	pfam_Amidase,superfamily_Amidase_dom	ENSG00000165591		0.348	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	92	0.00	0	T	NM_174912		57458464	57458464	+1	no_errors	ENST00000374900	ensembl	human	known	69_37n	silent	83	23.85	26	SNP	0.995	C
FABP6	2172	genome.wustl.edu	37	5	159640763	159640763	+	Silent	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:159640763T>G	ENST00000393980.4	+	3	218	c.72T>G	c.(70-72)tcT>tcG	p.S24S	FABP6_ENST00000393982.1_Silent_p.S24S	NM_001130958.1	NP_001124430.1	P51161	FABP6_HUMAN	fatty acid binding protein 6, ileal	0					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGTGTTGTCTGCGTGCACAT	0.507																																					Colon(29;562 677 12756 16385 20992)	dbGAP											0													145.0	152.0	150.0					5																	159640763		2065	4235	6300	-	-	-	SO:0001819	synonymous_variant	0			U19869	CCDS4349.1, CCDS43393.1	5q23-q35	2013-03-01	2008-08-01		ENSG00000170231	ENSG00000170231		"""Fatty acid binding protein family"""	3561	protein-coding gene	gene with protein product	"""illeal lipid-binding protein"", ""ileal bile acid binding protein"", ""gastrotropin"""	600422				7894165, 7619861	Standard	NM_001130958		Approved	I-15P, ILLBP, I-BAP, ILBP3, I-BABP, ILBP, I-BALB	uc003lxx.1	P51161	OTTHUMG00000130329	ENST00000393980.4:c.72T>G	5.37:g.159640763T>G			Q07DR7|Q8TBI3|Q9UGI7	Silent	SNP	superfamily_Calycin-like,prints_Fatty_acid-bd	p.S24	ENST00000393980.4	37	c.72	CCDS43393.1	5																																																																																			FABP6	-	NULL	ENSG00000170231		0.507	FABP6-001	KNOWN	basic|CCDS	protein_coding	FABP6	HGNC	protein_coding	OTTHUMT00000252678.4	40	0.00	0	T	NM_001040442		159640763	159640763	+1	no_errors	ENST00000393980	ensembl	human	known	69_37n	silent	60	21.05	16	SNP	0.000	G
FAM150B	285016	genome.wustl.edu	37	2	283135	283135	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:283135G>A	ENST00000403610.4	-	5	769	c.429C>T	c.(427-429)gtC>gtT	p.V143V	FAM150B_ENST00000344414.5_Silent_p.V51V|FAM150B_ENST00000401503.1_Silent_p.V51V|FAM150B_ENST00000405290.1_Silent_p.V51V	NM_001002919.2	NP_001002919.2	Q6UX46	F150B_HUMAN	family with sequence similarity 150, member B	143						extracellular region (GO:0005576)				breast(1)|kidney(2)	3	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.00091)|Epithelial(75;0.00656)|OV - Ovarian serous cystadenocarcinoma(76;0.00954)|GBM - Glioblastoma multiforme(21;0.128)		ACACTGGACTGACAGCCAGCC	0.433																																						dbGAP											0													57.0	58.0	57.0					2																	283135		1883	4114	5997	-	-	-	SO:0001819	synonymous_variant	0				CCDS46218.1	2p25.3	2008-05-02			ENSG00000189292	ENSG00000189292			27683	protein-coding gene	gene with protein product							Standard	NM_001002919		Approved		uc002qwi.4	Q6UX46	OTTHUMG00000151366	ENST00000403610.4:c.429C>T	2.37:g.283135G>A			B5MC76	Missense_Mutation	SNP	NULL	p.S94L	ENST00000403610.4	37	c.281	CCDS46218.1	2	.	.	.	.	.	.	.	.	.	.	G	6.947	0.544610	0.13312	.	.	ENSG00000189292	ENST00000401489	.	.	.	4.69	2.77	0.32553	.	.	.	.	.	T	0.60235	0.2253	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57774	-0.7753	4	.	.	.	.	10.8035	0.46502	0.0:0.4643:0.5357:0.0	.	.	.	.	L	94	.	.	S	-	2	0	FAM150B	273135	1.000000	0.71417	0.995000	0.50966	0.593000	0.36681	0.691000	0.25467	1.168000	0.42723	0.655000	0.94253	TCA	FAM150B	-	NULL	ENSG00000189292		0.433	FAM150B-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM150B	HGNC	protein_coding	OTTHUMT00000322394.2	85	0.00	0	G	NM_001002919		283135	283135	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000401489	ensembl	human	novel	69_37n	missense	131	10.27	15	SNP	1.000	A
FAM65B	9750	genome.wustl.edu	37	6	24843451	24843451	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:24843451C>A	ENST00000259698.4	-	14	1734	c.1559G>T	c.(1558-1560)cGc>cTc	p.R520L	FAM65B_ENST00000540914.1_Missense_Mutation_p.R470L|FAM65B_ENST00000473070.1_5'Flank|FAM65B_ENST00000378023.4_Missense_Mutation_p.R470L|FAM65B_ENST00000510784.2_Missense_Mutation_p.R504L|FAM65B_ENST00000538035.1_Missense_Mutation_p.R499L	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	520			R -> C (in dbSNP:rs35780910).		cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GGACTGTCGGCGGCAAGCCTC	0.582																																						dbGAP											0													67.0	67.0	67.0					6																	24843451		1907	4114	6021	-	-	-	SO:0001583	missense	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1559G>T	6.37:g.24843451C>A	ENSP00000259698:p.Arg520Leu		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R520L	ENST00000259698.4	37	c.1559	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	C	2.901	-0.227584	0.06022	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.12255	3.09;3.08;2.72;2.71;2.7	3.46	-3.63	0.04529	.	0.986918	0.08246	U	0.975378	T	0.02380	0.0073	L	0.36672	1.1	0.09310	N	0.999999	B;B;B;B	0.24483	0.0;0.001;0.104;0.001	B;B;B;B	0.19666	0.001;0.004;0.026;0.004	T	0.43310	-0.9399	10	0.25106	T	0.35	.	4.9972	0.14245	0.0:0.411:0.2629:0.3261	.	504;499;470;520	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	L	520;499;470;470;504	ENSP00000259698:R520L;ENSP00000441138:R499L;ENSP00000367262:R470L;ENSP00000438425:R470L;ENSP00000441305:R504L	ENSP00000259698:R520L	R	-	2	0	FAM65B	24951430	0.877000	0.30153	0.000000	0.03702	0.009000	0.06853	0.020000	0.13466	-1.368000	0.02149	-0.136000	0.14681	CGC	FAM65B	-	NULL	ENSG00000111913		0.582	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	73	0.00	0	C			24843451	24843451	-1	no_errors	ENST00000259698	ensembl	human	known	69_37n	missense	67	30.21	29	SNP	0.006	A
FAM69A	388650	genome.wustl.edu	37	1	93309463	93309463	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:93309463C>G	ENST00000370310.4	-	5	834	c.764G>C	c.(763-765)aGa>aCa	p.R255T	SNORA51_ENST00000384295.1_RNA	NM_001006605.4|NM_001252269.1|NM_001252271.1	NP_001006606.2|NP_001239198.1|NP_001239200.1	Q5T7M9	FA69A_HUMAN	family with sequence similarity 69, member A	255						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4		all_lung(203;0.00265)|Lung NSC(277;0.00562)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000563)|all cancers(265;0.000751)|Epithelial(280;0.127)		ATCCATGCTTCTTCTGAACCC	0.428																																						dbGAP											0													120.0	98.0	105.0					1																	93309463		692	1591	2283	-	-	-	SO:0001583	missense	0			AK027146	CCDS44173.1, CCDS72822.1, CCDS72823.1, CCDS72824.1, CCDS72825.1	1p22	2014-06-25			ENSG00000154511	ENSG00000154511			32213	protein-coding gene	gene with protein product		614542				21334309	Standard	NM_001006605		Approved	FLJ23493	uc001dpg.3	Q5T7M9	OTTHUMG00000010894	ENST00000370310.4:c.764G>C	1.37:g.93309463C>G	ENSP00000359333:p.Arg255Thr		Q6IRV2	Missense_Mutation	SNP	pfam_Uncharacterised_FAM69	p.R255T	ENST00000370310.4	37	c.764	CCDS44173.1	1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194769	0.38806	.	.	ENSG00000154511	ENST00000370310	T	0.47177	0.85	5.82	5.82	0.92795	.	0.089323	0.85682	D	0.000000	T	0.43897	0.1268	M	0.61703	1.905	0.46396	D	0.99902	P;P	0.47484	0.611;0.896	B;P	0.51550	0.419;0.673	T	0.23762	-1.0179	10	0.24483	T	0.36	-22.6908	12.9831	0.58575	0.0:0.9256:0.0:0.0744	.	248;255	B4E174;Q5T7M9	.;FA69A_HUMAN	T	255	ENSP00000359333:R255T	ENSP00000359333:R255T	R	-	2	0	FAM69A	93082051	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.672000	0.61597	2.748000	0.94277	0.655000	0.94253	AGA	FAM69A	-	pfam_Uncharacterised_FAM69	ENSG00000154511		0.428	FAM69A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69A	HGNC	protein_coding	OTTHUMT00000030046.2	49	0.00	0	C	NM_001006605		93309463	93309463	-1	no_errors	ENST00000370310	ensembl	human	known	69_37n	missense	52	37.35	31	SNP	1.000	G
FAM86DP	692099	genome.wustl.edu	37	3	75471823	75471823	+	RNA	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:75471823T>C	ENST00000459803.1	-	0	1318					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TGTGTCCACATTGGGGGAACG	0.488																																						dbGAP											0																																										-	-	-			0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471823T>C				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.488	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	23	0.00	0	T	NR_024241		75471823	75471823	-1	no_errors	ENST00000459803	ensembl	human	known	69_37n	rna	16	40.74	11	SNP	0.080	C
FAT3	120114	genome.wustl.edu	37	11	92088166	92088166	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:92088166C>T	ENST00000298047.6	+	1	2905	c.2888C>T	c.(2887-2889)cCa>cTa	p.P963L	FAT3_ENST00000409404.2_Missense_Mutation_p.P963L|FAT3_ENST00000525166.1_Missense_Mutation_p.P813L|FAT3_ENST00000541502.1_Missense_Mutation_p.P963L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	963	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCCATGATCCAGATCTTGGA	0.463										TCGA Ovarian(4;0.039)																												dbGAP											0													79.0	78.0	78.0					11																	92088166		1889	4124	6013	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2888C>T	11.37:g.92088166C>T	ENSP00000298047:p.Pro963Leu		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.P963L	ENST00000298047.6	37	c.2888		11	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657815	0.47467	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.82	5.82	0.92795	.	.	.	.	.	T	0.44519	0.1297	L	0.28608	0.87	0.58432	D	0.999999	P	0.38729	0.644	B	0.41723	0.365	T	0.31475	-0.9942	9	0.44086	T	0.13	.	19.0835	0.93192	0.0:1.0:0.0:0.0	.	963	Q8TDW7-3	.	L	963;963;963;813	ENSP00000298047:P963L;ENSP00000387040:P963L;ENSP00000443786:P963L;ENSP00000432586:P813L	ENSP00000298047:P963L	P	+	2	0	FAT3	91727814	1.000000	0.71417	0.993000	0.49108	0.731000	0.41821	7.755000	0.85180	2.767000	0.95098	0.655000	0.94253	CCA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.463	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		77	0.00	0	C	NM_001008781		92088166	92088166	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	57	42.42	42	SNP	1.000	T
FOXO3	2309	genome.wustl.edu	37	6	108985251	108985251	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:108985251G>A	ENST00000343882.6	+	3	1519	c.1215G>A	c.(1213-1215)ggG>ggA	p.G405G	FOXO3_ENST00000406360.1_Silent_p.G405G|FOXO3_ENST00000540898.1_Silent_p.G185G	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	405					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		CGCCCACTGGGGGACTCATGC	0.587																																						dbGAP											0													48.0	50.0	49.0					6																	108985251		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1215G>A	6.37:g.108985251G>A			B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G405	ENST00000343882.6	37	c.1215	CCDS5068.1	6																																																																																			FOXO3	-	NULL	ENSG00000118689		0.587	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO3	HGNC	protein_coding	OTTHUMT00000041722.2	74	0.00	0	G			108985251	108985251	+1	no_errors	ENST00000343882	ensembl	human	known	69_37n	silent	70	32.69	34	SNP	0.003	A
FTCD	10841	genome.wustl.edu	37	21	47575476	47575476	+	5'UTR	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr21:47575476T>G	ENST00000291670.5	-	0	5				FTCD_ENST00000355384.2_5'UTR|FTCD_ENST00000397743.1_5'UTR|FTCD_ENST00000359679.2_5'UTR|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397748.1_5'UTR|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000397746.3_5'UTR	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase						cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TCTGGGCAGATGGAAGGACAG	0.622																																						dbGAP											0													62.0	51.0	55.0					21																	47575476		2200	4299	6499	-	-	-	SO:0001623	5_prime_UTR_variant	0			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.-39A>C	21.37:g.47575476T>G			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	RNA	SNP	-	NULL	ENST00000291670.5	37	NULL	CCDS13731.1	21																																																																																			FTCD	-	-	ENSG00000160282		0.622	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1	30	0.00	0	T	NM_006657		47575476	47575476	-1	no_errors	ENST00000498355	ensembl	human	known	69_37n	rna	22	26.67	8	SNP	0.000	G
GABRA4	2557	genome.wustl.edu	37	4	46967110	46967110	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:46967110A>C	ENST00000264318.3	-	8	1993	c.1011T>G	c.(1009-1011)ttT>ttG	p.F337L		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	337					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGACAGCAGCAAACTCGATAA	0.468																																					Ovarian(6;283 369 8234 12290 33402)	dbGAP											0													127.0	120.0	122.0					4																	46967110		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1011T>G	4.37:g.46967110A>C	ENSP00000264318:p.Phe337Leu		Q8IYR7	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABBAa4_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.F337L	ENST00000264318.3	37	c.1011	CCDS3473.1	4	.	.	.	.	.	.	.	.	.	.	A	23.4	4.411914	0.83340	.	.	ENSG00000109158	ENST00000264318	D	0.83992	-1.79	4.81	3.63	0.41609	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	L	0.38838	1.175	0.51012	D	0.999901	D	0.89917	1.0	D	0.91635	0.999	D	0.84977	0.0886	10	0.87932	D	0	.	9.6287	0.39765	0.9178:0.0:0.0822:0.0	.	337	P48169	GBRA4_HUMAN	L	337	ENSP00000264318:F337L	ENSP00000264318:F337L	F	-	3	2	GABRA4	46661867	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.239000	0.65371	0.864000	0.35578	-0.353000	0.07706	TTT	GABRA4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000109158		0.468	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	55	0.00	0	A			46967110	46967110	-1	no_errors	ENST00000264318	ensembl	human	known	69_37n	missense	84	19.23	20	SNP	1.000	C
GANC	2595	genome.wustl.edu	37	15	42621623	42621623	+	Silent	SNP	C	C	G	rs115265256	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:42621623C>G	ENST00000318010.8	+	14	1860	c.1620C>G	c.(1618-1620)ctC>ctG	p.L540L		NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	540					carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	ACAGAGAGCTCCACAACATCT	0.428																																						dbGAP											0													94.0	84.0	87.0					15																	42621623		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487	ENST00000318010.8:c.1620C>G	15.37:g.42621623C>G			Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Silent	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.L540	ENST00000318010.8	37	c.1620	CCDS10084.1	15																																																																																			GANC	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000214013		0.428	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GANC	HGNC	protein_coding	OTTHUMT00000252887.2	74	0.00	0	C	NM_198141		42621623	42621623	+1	no_errors	ENST00000318010	ensembl	human	known	69_37n	silent	86	35.56	48	SNP	0.984	G
GFRA3	2676	genome.wustl.edu	37	5	137589525	137589525	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:137589525G>A	ENST00000274721.3	-	6	1200	c.954C>T	c.(952-954)tgC>tgT	p.C318C	GFRA3_ENST00000378362.3_Silent_p.C287C	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	318					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CACTGCCTCGGCAGGTGCAGC	0.562																																						dbGAP											0													65.0	60.0	61.0					5																	137589525		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.954C>T	5.37:g.137589525G>A			B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Silent	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,prints_GDNF_rcpt,prints_GDNF_rcpt_A3	p.C318	ENST00000274721.3	37	c.954	CCDS4201.1	5																																																																																			GFRA3	-	pfam_GDNF/GAS1,smart_GDNF/GAS1,prints_GDNF_rcpt	ENSG00000146013		0.562	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GFRA3	HGNC	protein_coding	OTTHUMT00000251277.1	48	0.00	0	G	NM_001496		137589525	137589525	-1	no_errors	ENST00000274721	ensembl	human	known	69_37n	silent	36	36.21	21	SNP	1.000	A
GPM6B	2824	genome.wustl.edu	37	X	13795518	13795518	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:13795518C>T	ENST00000356942.5	-	5	1045	c.604G>A	c.(604-606)Gga>Aga	p.G202R	GPM6B_ENST00000398361.3_Missense_Mutation_p.G116R|GPM6B_ENST00000454189.2_Missense_Mutation_p.G183R|GPM6B_ENST00000493677.1_Missense_Mutation_p.G216R|GPM6B_ENST00000316715.4_Missense_Mutation_p.G242R|GPM6B_ENST00000355135.2_Missense_Mutation_p.G242R	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	202					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						CATATTTTTCCGGGGAAAGCA	0.433																																						dbGAP											0													142.0	119.0	127.0					X																	13795518		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.604G>A	X.37:g.13795518C>T	ENSP00000349420:p.Gly202Arg		O76077|Q86X43|Q8N956	Missense_Mutation	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.G242R	ENST00000356942.5	37	c.724	CCDS14158.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.9|28.9	4.960988|4.960988	0.92791|0.92791	.|.	.|.	ENSG00000046653|ENSG00000046653	ENST00000316715;ENST00000454189;ENST00000493677;ENST00000355135;ENST00000356942;ENST00000398361;ENST00000495211|ENST00000472735	D;D;D;D;D;D;D|.	0.99677|.	-6.37;-6.37;-6.37;-6.37;-6.37;-6.37;-6.37|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77046|0.77046	0.4073|0.4073	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;0.998;1.0;0.999;1.0;1.0|.	T|T	0.76680|0.76680	-0.2870|-0.2870	10|5	0.34782|.	T|.	0.22|.	-12.4836|-12.4836	18.7865|18.7865	0.91957|0.91957	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	216;183;202;242;194;242|.	B7Z613;Q13491-2;Q13491;Q13491-3;Q59FD5;Q8N956|.	.;.;GPM6B_HUMAN;.;.;.|.	R|Q	242;183;216;242;202;116;167|97	ENSP00000316861:G242R;ENSP00000389915:G183R;ENSP00000419904:G216R;ENSP00000347258:G242R;ENSP00000349420:G202R;ENSP00000381402:G116R;ENSP00000419409:G167R|.	ENSP00000316861:G242R|.	G|R	-|-	1|2	0|0	GPM6B|GPM6B	13705439|13705439	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	7.211000|7.211000	0.77933|0.77933	2.469000|2.469000	0.83416|0.83416	0.600000|0.600000	0.82982|0.82982	GGA|CGG	GPM6B	-	pfam_Myelin_PLP,smart_Myelin_PLP	ENSG00000046653		0.433	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPM6B	HGNC	protein_coding	OTTHUMT00000055822.1	33	0.00	0	C	NM_001001995		13795518	13795518	-1	no_errors	ENST00000316715	ensembl	human	known	69_37n	missense	38	36.67	22	SNP	1.000	T
GPNMB	10457	genome.wustl.edu	37	7	23313462	23313462	+	Intron	SNP	A	A	G	rs2268747	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:23313462A>G	ENST00000381990.2	+	11	1720				GPNMB_ENST00000478451.1_Intron|GPNMB_ENST00000453162.2_Intron|GPNMB_ENST00000258733.4_Intron|GPNMB_ENST00000539136.1_Intron	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb						bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			AATTATGTCAACTTAATTTTA	0.323													A|||	1561	0.311701	0.4077	0.3026	5008	,	,		19606	0.1835		0.3449	False		,,,				2504	0.2863					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1560-222A>G	7.37:g.23313462A>G			A4D155|Q6UVX1|Q8N1A1	RNA	SNP	-	NULL	ENST00000381990.2	37	NULL	CCDS34610.1	7																																																																																			GPNMB	-	-	ENSG00000136235		0.323	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPNMB	HGNC	protein_coding	OTTHUMT00000327152.1	21	0.00	0	A	NM_001005340		23313462	23313462	+1	no_errors	ENST00000470994	ensembl	human	putative	69_37n	rna	15	16.67	3	SNP	0.000	G
GSTCD	79807	genome.wustl.edu	37	4	106746941	106746941	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:106746941G>A	ENST00000515279.1	+	8	1734	c.1514G>A	c.(1513-1515)gGg>gAg	p.G505E	RP11-45L9.1_ENST00000509003.1_RNA|RP11-45L9.1_ENST00000506527.1_RNA|RP11-45L9.1_ENST00000504955.1_RNA|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394730.3_Missense_Mutation_p.G418E|GSTCD_ENST00000360505.5_Missense_Mutation_p.G505E|GSTCD_ENST00000394728.3_Missense_Mutation_p.G505E			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	505						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		TATTTTACTGGGATGTTTAAT	0.264																																						dbGAP											0													93.0	93.0	93.0					4																	106746941		1789	4056	5845	-	-	-	SO:0001583	missense	0			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1514G>A	4.37:g.106746941G>A	ENSP00000422354:p.Gly505Glu		A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	pfam_rRNA_ssu_MeTfrase_G,pfam_Small_mtfrase_dom,superfamily_Glutathione-S-Trfase_C-like	p.G505E	ENST00000515279.1	37	c.1514	CCDS43257.1	4	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313238	0.81358	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	L	0.42744	1.35	0.80722	D	1	D;P	0.89917	1.0;0.804	D;P	0.80764	0.994;0.771	T	0.57260	-0.7842	10	0.48119	T	0.1	-5.3801	19.0135	0.92884	0.0:0.0:1.0:0.0	.	505;128	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	E	418;505;505;505	ENSP00000378218:G418E;ENSP00000422354:G505E;ENSP00000353695:G505E;ENSP00000378216:G505E	ENSP00000353695:G505E	G	+	2	0	GSTCD	106966390	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	7.277000	0.78572	2.568000	0.86640	0.650000	0.86243	GGG	GSTCD	-	NULL	ENSG00000138780		0.264	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	23	0.00	0	G	NM_024751		106746941	106746941	+1	no_errors	ENST00000360505	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	A
HAL	3034	genome.wustl.edu	37	12	96389672	96389672	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:96389672A>G	ENST00000261208.3	-	2	385	c.17T>C	c.(16-18)gTg>gCg	p.V6A	HAL_ENST00000538703.1_Missense_Mutation_p.V6A|HAL_ENST00000541929.1_5'UTR|RP11-256L6.3_ENST00000551849.1_RNA	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	6					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	ACGTACGTGCACCGTGTATCT	0.637																																					NSCLC(169;943 2815 23563 30031)	dbGAP											0													31.0	27.0	28.0					12																	96389672		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.17T>C	12.37:g.96389672A>G	ENSP00000261208:p.Val6Ala		B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.V6A	ENST00000261208.3	37	c.17	CCDS9058.1	12	.	.	.	.	.	.	.	.	.	.	A	11.19	1.566176	0.27915	.	.	ENSG00000084110	ENST00000261208;ENST00000538703;ENST00000552509	T;T;D	0.88124	-1.34;-1.28;-2.34	5.2	4.04	0.47022	.	0.108957	0.64402	N	0.000008	D	0.82323	0.5012	L	0.50333	1.59	0.80722	D	1	B;B	0.24651	0.02;0.108	B;B	0.20184	0.028;0.017	T	0.76924	-0.2779	10	0.37606	T	0.19	-13.2164	11.1895	0.48677	0.927:0.0:0.073:0.0	.	6;6	F5GXF2;P42357	.;HUTH_HUMAN	A	6	ENSP00000261208:V6A;ENSP00000440861:V6A;ENSP00000450372:V6A	ENSP00000261208:V6A	V	-	2	0	HAL	94913803	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	7.118000	0.77137	0.914000	0.36822	0.402000	0.26972	GTG	HAL	-	NULL	ENSG00000084110		0.637	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	60	0.00	0	A			96389672	96389672	-1	no_errors	ENST00000261208	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	1.000	G
MROH2B	133558	genome.wustl.edu	37	5	41018468	41018468	+	Missense_Mutation	SNP	G	G	A	rs369144504		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:41018468G>A	ENST00000399564.4	-	27	3188	c.2738C>T	c.(2737-2739)gCg>gTg	p.A913V	MROH2B_ENST00000506092.2_Missense_Mutation_p.A468V	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	913								p.A913V(1)									CAGCACTTTCGCAGTGATCTG	0.393																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											107.0	97.0	100.0					5																	41018468		1871	4105	5976	-	-	-	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2738C>T	5.37:g.41018468G>A	ENSP00000382476:p.Ala913Val		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A913V	ENST00000399564.4	37	c.2738	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639507	0.47153	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.69685	-0.24;-0.42	5.96	5.09	0.68999	Armadillo-type fold (1);	0.312863	0.27513	N	0.019027	T	0.58235	0.2108	L	0.32530	0.975	0.09310	N	1	D	0.56035	0.974	P	0.47251	0.542	T	0.50676	-0.8800	10	0.13108	T	0.6	.	13.0642	0.59024	0.0:0.1728:0.8272:0.0	.	913	Q7Z745	HTRB2_HUMAN	V	468;618;913	ENSP00000441504:A468V;ENSP00000382476:A913V	ENSP00000296803:A618V	A	-	2	0	HEATR7B2	41054225	0.567000	0.26626	0.019000	0.16419	0.671000	0.39405	2.974000	0.49272	1.519000	0.48950	0.655000	0.94253	GCG	HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.393	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	50	0.00	0	G	NM_173489		41018468	41018468	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	missense	31	47.46	28	SNP	0.016	A
HPR	3250	genome.wustl.edu	37	16	72110338	72110338	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:72110338T>A	ENST00000540303.2	+	5	437	c.405T>A	c.(403-405)aaT>aaA	p.N135K	HPR_ENST00000561690.1_Intron|HPR_ENST00000356967.5_Missense_Mutation_p.N135K|HPR_ENST00000228226.8_Missense_Mutation_p.N172K	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	135	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				CGCTGATCAATGAACAATGGC	0.507																																						dbGAP											0													86.0	59.0	68.0					16																	72110338		2047	4187	6234	-	-	-	SO:0001583	missense	0			BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.405T>A	16.37:g.72110338T>A	ENSP00000441828:p.Asn135Lys		Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Complement_control_module,smart_Peptidase_S1_S6,pirsf_Haptoglobin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.N172K	ENST00000540303.2	37	c.516	CCDS42193.1	16	.	.	.	.	.	.	.	.	.	.	.	8.564	0.878522	0.17395	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	D;D;D	0.93426	-3.22;-3.22;-3.22	2.46	2.46	0.29980	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.789045	0.12407	N	0.471637	D	0.93229	0.7843	M	0.86343	2.81	0.26483	N	0.975078	B	0.27166	0.17	B	0.34038	0.174	D	0.87841	0.2651	10	0.48119	T	0.1	.	6.5233	0.22287	0.0:0.0:0.248:0.752	.	135	P00739	HPTR_HUMAN	K	135;135;172	ENSP00000349451:N135K;ENSP00000441828:N135K;ENSP00000228226:N172K	ENSP00000228226:N172K	N	+	3	2	HP	70667839	0.009000	0.17119	0.982000	0.44146	0.184000	0.23303	-0.214000	0.09292	1.135000	0.42183	0.163000	0.16589	AAT	HPR	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Haptoglobin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000261701		0.507	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPR	HGNC	protein_coding	OTTHUMT00000421696.1	41	0.00	0	T	NM_020995		72110338	72110338	+1	no_errors	ENST00000228226	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	0.998	A
HRC	3270	genome.wustl.edu	37	19	49657150	49657150	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:49657150C>G	ENST00000252825.4	-	1	1531	c.1345G>C	c.(1345-1347)Gaa>Caa	p.E449Q	HRC_ENST00000595625.1_Missense_Mutation_p.E449Q	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	449					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TGGCCAGTTTCTTCATCTTGG	0.552																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													127.0	112.0	117.0					19																	49657150		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1345G>C	19.37:g.49657150C>G	ENSP00000252825:p.Glu449Gln		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.E449Q	ENST00000252825.4	37	c.1345	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	C	1.832	-0.469597	0.04445	.	.	ENSG00000130528	ENST00000252825;ENST00000391863;ENST00000434964	T	0.47528	0.84	3.18	0.886	0.19194	.	.	.	.	.	T	0.24851	0.0603	N	0.22421	0.69	0.09310	N	1	B	0.33073	0.396	B	0.26202	0.067	T	0.12863	-1.0531	9	0.21540	T	0.41	-0.7327	3.8175	0.08821	0.238:0.6239:0.0:0.138	.	449	P23327	SRCH_HUMAN	Q	449;148;419	ENSP00000252825:E449Q	ENSP00000252825:E449Q	E	-	1	0	HRC	54348962	0.000000	0.05858	0.016000	0.15963	0.050000	0.14768	0.230000	0.17852	0.027000	0.15297	0.462000	0.41574	GAA	HRC	-	NULL	ENSG00000130528		0.552	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	99	0.00	0	C	NM_002152		49657150	49657150	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	missense	114	31.33	52	SNP	0.123	G
HSD3B1	3283	genome.wustl.edu	37	1	120056825	120056825	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:120056825G>A	ENST00000369413.3	+	4	824	c.679G>A	c.(679-681)Ggc>Agc	p.G227S	HSD3B1_ENST00000528909.1_Missense_Mutation_p.G227S|HSD3B1_ENST00000235547.6_Missense_Mutation_p.G229S			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	227					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	AGTCTATGTTGGCAATGTGGC	0.517																																						dbGAP											0													76.0	80.0	79.0					1																	120056825		2203	4300	6503	-	-	-	SO:0001583	missense	0			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.679G>A	1.37:g.120056825G>A	ENSP00000358421:p.Gly227Ser		A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	p.G229S	ENST00000369413.3	37	c.685	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000761	0.74818	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.85773	-2.03;-2.03;-2.03	3.26	3.26	0.37387	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.051687	0.85682	D	0.000000	D	0.87354	0.6156	M	0.83953	2.67	0.58432	D	0.999991	D;B	0.58620	0.983;0.153	P;B	0.54924	0.764;0.124	D	0.88680	0.3201	10	0.59425	D	0.04	-8.8252	12.346	0.55122	0.0:0.0:1.0:0.0	.	229;227	Q5TDG2;P14060	.;3BHS1_HUMAN	S	227;229;227	ENSP00000358421:G227S;ENSP00000235547:G229S;ENSP00000432268:G227S	ENSP00000235547:G229S	G	+	1	0	HSD3B1	119858348	1.000000	0.71417	0.993000	0.49108	0.680000	0.39746	7.065000	0.76727	1.799000	0.52666	0.313000	0.20887	GGC	HSD3B1	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	ENSG00000203857		0.517	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	HGNC	protein_coding	OTTHUMT00000034993.3	56	0.00	0	G	NM_000862		120056825	120056825	+1	no_errors	ENST00000235547	ensembl	human	known	69_37n	missense	97	28.15	38	SNP	1.000	A
HSP90AB1	3326	genome.wustl.edu	37	6	44220997	44220997	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:44220997G>A	ENST00000371554.1	+	11	2161	c.1947G>A	c.(1945-1947)aaG>aaA	p.K649K	SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000371646.5_Silent_p.K649K|HSP90AB1_ENST00000353801.3_Silent_p.K649K|MIR4647_ENST00000583964.1_RNA			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	649					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGAATGATAAGGCAGTTAAGG	0.547																																						dbGAP											0													239.0	246.0	243.0					6																	44220997		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1947G>A	6.37:g.44220997G>A			B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	p.K649	ENST00000371554.1	37	c.1947	CCDS4909.1	6																																																																																			HSP90AB1	-	pfam_Hsp90,pirsf_Hsp90	ENSG00000096384		0.547	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1	59	0.00	0	G	NM_007355		44220997	44220997	+1	no_errors	ENST00000353801	ensembl	human	known	69_37n	silent	123	12.14	17	SNP	1.000	A
IGFN1	91156	genome.wustl.edu	37	1	201178470	201178470	+	Silent	SNP	G	G	A	rs12757706	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:201178470G>A	ENST00000335211.4	+	12	4579	c.4449G>A	c.(4447-4449)agG>agA	p.R1483R	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTGGTTTAAGGGGTTCTGGGG	0.502													G|||	1523	0.304113	0.1755	0.3141	5008	,	,		16820	0.3095		0.3499	False		,,,				2504	0.4182					dbGAP											0													33.0	31.0	31.0					1																	201178470		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.4449G>A	1.37:g.201178470G>A			F8WAI1|Q9NT72	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R1483	ENST00000335211.4	37	c.4449	CCDS53455.1	1																																																																																			IGFN1	-	NULL	ENSG00000163395		0.502	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		21	0.00	0	G	NM_178275		201178470	201178470	+1	no_errors	ENST00000335211	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.092	A
IGSF10	285313	genome.wustl.edu	37	3	151155222	151155222	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:151155222delC	ENST00000282466.3	-	6	7126	c.7127delG	c.(7126-7128)ggcfs	p.G2376fs	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2376	Ig-like C2-type 10.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AAATCGTGTGCCATTTGGTAA	0.383																																						dbGAP											0													130.0	129.0	130.0					3																	151155222		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7127delG	3.37:g.151155222delC	ENSP00000282466:p.Gly2376fs		Q86YJ9|Q8N772|Q8NA84	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G2376fs	ENST00000282466.3	37	c.7127	CCDS3160.1	3																																																																																			IGSF10	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000152580		0.383	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	18	0.00	0	C	NM_178822		151155222	151155222	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	frame_shift_del	19	24.00	6	DEL	1.000	-
KCNAB2	8514	genome.wustl.edu	37	1	6100694	6100694	+	Silent	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:6100694G>C	ENST00000164247.1	+	2	630	c.66G>C	c.(64-66)ggG>ggC	p.G22G	KCNAB2_ENST00000378087.3_Silent_p.G22G|KCNAB2_ENST00000378092.1_Silent_p.G22G|KCNAB2_ENST00000602612.1_Silent_p.G22G|KCNAB2_ENST00000352527.1_Silent_p.G22G|KCNAB2_ENST00000378097.1_Silent_p.G22G|KCNAB2_ENST00000341524.1_Silent_p.G22G|KCNAB2_ENST00000378111.1_Silent_p.G22G|AL035406.1_ENST00000594544.1_Missense_Mutation_p.S6C|KCNAB2_ENST00000459822.1_3'UTR	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	22					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCCCCCGGGATGATCTACA	0.652																																						dbGAP											0													24.0	28.0	27.0					1																	6100694		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.66G>C	1.37:g.6100694G>C			A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.G6A	ENST00000164247.1	37	c.17	CCDS55.1	1																																																																																			KCNAB2	-	NULL	ENSG00000069424		0.652	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	HGNC	protein_coding	OTTHUMT00000002114.3	19	0.00	0	G	NM_172130		6100694	6100694	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000472700	ensembl	human	putative	69_37n	missense	7	69.57	16	SNP	1.000	C
IGSF9	57549	genome.wustl.edu	37	1	159901663	159901663	+	Missense_Mutation	SNP	C	C	G	rs376059608		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:159901663C>G	ENST00000368094.1	-	11	1498	c.1301G>C	c.(1300-1302)cGg>cCg	p.R434P	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R418P	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	434	Ig-like 5.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCAGCTCCCGCCCTACTTC	0.592																																						dbGAP											0													56.0	65.0	62.0					1																	159901663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1301G>C	1.37:g.159901663C>G	ENSP00000357073:p.Arg434Pro			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R434P	ENST00000368094.1	37	c.1301	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650747	0.67472	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.78707	-1.2;-1.2	4.41	4.41	0.53225	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35677	N	0.003043	D	0.87931	0.6302	M	0.90542	3.125	0.44155	D	0.996954	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.985	D	0.90351	0.4366	9	.	.	.	-16.1096	14.5219	0.67856	0.0:1.0:0.0:0.0	.	434;434	Q9P2J2;C9JI81	TUTLA_HUMAN;.	P	418;434;434	ENSP00000355049:R418P;ENSP00000357073:R434P	.	R	-	2	0	IGSF9	158168287	1.000000	0.71417	0.999000	0.59377	0.549000	0.35272	7.083000	0.76859	2.003000	0.58678	0.561000	0.74099	CGG	IGSF9	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000085552		0.592	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1	50	0.00	0	C	NM_020789		159901663	159901663	-1	no_errors	ENST00000368094	ensembl	human	known	69_37n	missense	55	33.73	28	SNP	1.000	G
KCNK6	9424	genome.wustl.edu	37	19	38817294	38817294	+	Silent	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:38817294C>G	ENST00000263372.3	+	2	491	c.384C>G	c.(382-384)ctC>ctG	p.L128L		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	128					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	CCTTTGCGCTCCTGGGCGTGC	0.587																																						dbGAP											0													82.0	77.0	79.0					19																	38817294		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.384C>G	19.37:g.38817294C>G			Q9HB47	Silent	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK2,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TWIK1	p.L128	ENST00000263372.3	37	c.384	CCDS12513.1	19																																																																																			KCNK6	-	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl	ENSG00000099337		0.587	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK6	HGNC	protein_coding	OTTHUMT00000460524.1	103	0.00	0	C	NM_004823		38817294	38817294	+1	no_errors	ENST00000263372	ensembl	human	known	69_37n	silent	98	33.78	50	SNP	0.961	G
KIAA1549	57670	genome.wustl.edu	37	7	138601731	138601731	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:138601731T>C	ENST00000422774.1	-	2	2689	c.2641A>G	c.(2641-2643)Acg>Gcg	p.T881A	KIAA1549_ENST00000242365.4_Missense_Mutation_p.T831A|KIAA1549_ENST00000440172.1_Missense_Mutation_p.T881A			Q9HCM3	K1549_HUMAN	KIAA1549	881						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CTCACTTCCGTGGAGGTGTTC	0.617			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	dbGAP		Dom	yes		7	7q34	57670	KIAA1549		O	0													39.0	46.0	44.0					7																	138601731		2107	4223	6330	-	-	-	SO:0001583	missense	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2641A>G	7.37:g.138601731T>C	ENSP00000416040:p.Thr881Ala		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.T881A	ENST00000422774.1	37	c.2641	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	T	9.433	1.086088	0.20390	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.24538	1.85;1.85;1.85	4.4	-5.58	0.02512	.	0.822089	0.10675	N	0.647044	T	0.10680	0.0261	N	0.24115	0.695	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.37957	-0.9683	10	0.11182	T	0.66	.	4.5386	0.12045	0.0958:0.1839:0.5182:0.2021	.	881;881	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	A	881;831;881	ENSP00000406661:T881A;ENSP00000242365:T831A;ENSP00000416040:T881A	ENSP00000242365:T831A	T	-	1	0	KIAA1549	138252271	0.002000	0.14202	0.017000	0.16124	0.121000	0.20230	-1.212000	0.02994	-0.752000	0.04728	-0.366000	0.07423	ACG	KIAA1549	-	NULL	ENSG00000122778		0.617	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	77	0.00	0	T			138601731	138601731	-1	no_errors	ENST00000422774	ensembl	human	known	69_37n	missense	101	22.14	29	SNP	0.002	C
CCDC183	84960	genome.wustl.edu	37	9	139694614	139694614	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:139694614delT	ENST00000338005.6	+	4	466	c.431delT	c.(430-432)ctgfs	p.L145fs	RP11-216L13.18_ENST00000471502.1_RNA|KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.17_ENST00000456614.2_Frame_Shift_Del_p.L175fs|RP11-216L13.19_ENST00000415992.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		145										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GAGCTGCGGCTGCTGCAGGTG	0.741																																						dbGAP											0													4.0	4.0	4.0					9																	139694614		1630	3666	5296	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000338005.6:c.431delT	9.37:g.139694614delT	ENSP00000338013:p.Leu145fs		B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Frame_Shift_Del	DEL	NULL	p.L144fs	ENST00000338005.6	37	c.431	CCDS43906.1	9																																																																																			KIAA1984	-	NULL	ENSG00000213213		0.741	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1984	HGNC	protein_coding	OTTHUMT00000354899.1	9	0.00	0	T			139694614	139694614	+1	no_errors	ENST00000338005	ensembl	human	known	69_37n	frame_shift_del	5	37.50	3	DEL	0.028	-
KIRREL3	84623	genome.wustl.edu	37	11	126294819	126294819	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:126294819C>T	ENST00000525144.2	-	17	2242	c.1993G>A	c.(1993-1995)Ggc>Agc	p.G665S	KIRREL3_ENST00000529097.2_Missense_Mutation_p.G653S|KIRREL3_ENST00000416561.2_Missense_Mutation_p.G132S	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	665					hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CGCTGCTTGCCCGCAGGACGC	0.632																																						dbGAP											0													30.0	36.0	34.0					11																	126294819		2131	4232	6363	-	-	-	SO:0001583	missense	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1993G>A	11.37:g.126294819C>T	ENSP00000435466:p.Gly665Ser		Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G665S	ENST00000525144.2	37	c.1993	CCDS53723.1	11	.	.	.	.	.	.	.	.	.	.	C	10.86	1.468420	0.26335	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000416561	T;T;T	0.47177	0.85;0.85;0.85	4.88	4.88	0.63580	.	0.219816	0.37715	N	0.001974	T	0.22666	0.0547	N	0.08118	0	0.38849	D	0.956238	B;B	0.27823	0.19;0.083	B;B	0.21546	0.028;0.035	T	0.15492	-1.0435	10	0.07990	T	0.79	-8.2934	10.5442	0.45050	0.0:0.9107:0.0:0.0893	.	653;665	E9PRX9;Q8IZU9	.;KIRR3_HUMAN	S	665;653;132	ENSP00000435466:G665S;ENSP00000434081:G653S;ENSP00000408692:G132S	ENSP00000408692:G132S	G	-	1	0	KIRREL3	125800029	0.835000	0.29415	0.927000	0.36925	0.906000	0.53458	1.699000	0.37804	2.543000	0.85770	0.655000	0.94253	GGC	KIRREL3	-	NULL	ENSG00000149571		0.632	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2	32	0.00	0	C	NM_032531		126294819	126294819	-1	no_errors	ENST00000525144	ensembl	human	known	69_37n	missense	12	55.56	15	SNP	0.992	T
KRT3	3850	genome.wustl.edu	37	12	53189396	53189396	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:53189396C>T	ENST00000417996.2	-	1	505	c.431G>A	c.(430-432)gGt>gAt	p.G144D	KRT3_ENST00000309505.3_Missense_Mutation_p.G144D	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	144	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						accagacccaccaaagccacc	0.622																																						dbGAP											0													153.0	195.0	181.0					12																	53189396		2187	4287	6474	-	-	-	SO:0001583	missense	0				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.431G>A	12.37:g.53189396C>T	ENSP00000413479:p.Gly144Asp		A6NIS2|Q701L8	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.G144D	ENST00000417996.2	37	c.431	CCDS44895.1	12	.	.	.	.	.	.	.	.	.	.	c	9.349	1.064944	0.20067	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.98747	-5.11;-5.11	3.94	3.94	0.45596	.	.	.	.	.	D	0.99162	0.9710	M	0.92555	3.32	0.41689	D	0.989339	D	0.69078	0.997	P	0.60682	0.878	D	0.99323	1.0907	9	0.66056	D	0.02	.	15.9881	0.80176	0.0:1.0:0.0:0.0	.	144	P12035	K2C3_HUMAN	D	144	ENSP00000413479:G144D;ENSP00000312206:G144D	ENSP00000312206:G144D	G	-	2	0	KRT3	51475663	0.001000	0.12720	0.442000	0.26870	0.173000	0.22820	0.575000	0.23729	1.934000	0.56057	0.603000	0.83216	GGT	KRT3	-	NULL	ENSG00000186442		0.622	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRT3	HGNC	protein_coding	OTTHUMT00000405930.1	129	0.00	0	C	NM_057088		53189396	53189396	-1	no_errors	ENST00000309505	ensembl	human	known	69_37n	missense	103	30.41	45	SNP	0.964	T
LELP1	149018	genome.wustl.edu	37	1	153177231	153177231	+	Silent	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:153177231C>T	ENST00000368747.1	+	2	158	c.48C>T	c.(46-48)ccC>ccT	p.P16P		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	16										NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACTGAGCCCAAGAACTGCG	0.448																																						dbGAP											0													136.0	131.0	133.0					1																	153177231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.48C>T	1.37:g.153177231C>T			A1L4E1	Silent	SNP	NULL	p.P16	ENST00000368747.1	37	c.48	CCDS30869.1	1																																																																																			LELP1	-	NULL	ENSG00000203784		0.448	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LELP1	HGNC	protein_coding	OTTHUMT00000039104.1	32	0.00	0	C	NM_001010857		153177231	153177231	+1	no_errors	ENST00000368747	ensembl	human	known	69_37n	silent	73	12.94	11	SNP	0.906	T
LHFP	10186	genome.wustl.edu	37	13	40175303	40175303	+	Silent	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr13:40175303A>G	ENST00000379589.3	-	2	513	c.51T>C	c.(49-51)ttT>ttC	p.F17F	LHFP_ENST00000495922.1_5'Flank	NM_005780.2	NP_005771.1	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner	17						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)		HMGA2/LHFP(2)	breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(6)|prostate(2)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		CAGCACAAAGAAAAGACAGCA	0.542			T	HMGA2	lipoma																																	dbGAP		Dom	yes		13	13q12	10186	lipoma HMGIC fusion partner		M	0													70.0	63.0	66.0					13																	40175303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF098807	CCDS9369.1	13q12	2008-07-18			ENSG00000183722	ENSG00000183722			6586	protein-coding gene	gene with protein product		606710				10329012	Standard	NM_005780		Approved	MGC22429	uc001uxf.3	Q9Y693	OTTHUMG00000016767	ENST00000379589.3:c.51T>C	13.37:g.40175303A>G			B2R7M2|Q53FC0|Q96SH5	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.F17	ENST00000379589.3	37	c.51	CCDS9369.1	13																																																																																			LHFP	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000183722		0.542	LHFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFP	HGNC	protein_coding	OTTHUMT00000044619.1	21	0.00	0	A	NM_005780		40175303	40175303	-1	no_errors	ENST00000379589	ensembl	human	known	69_37n	silent	12	33.33	6	SNP	0.985	G
LOXHD1	125336	genome.wustl.edu	37	18	44126941	44126941	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr18:44126941T>A	ENST00000398722.4	-	15	2596	c.2597A>T	c.(2596-2598)gAg>gTg	p.E866V	LOXHD1_ENST00000441893.2_Missense_Mutation_p.E77V|LOXHD1_ENST00000579038.1_5'UTR|LOXHD1_ENST00000582408.1_Missense_Mutation_p.E33V|LOXHD1_ENST00000300591.6_Missense_Mutation_p.E33V|LOXHD1_ENST00000441551.2_Missense_Mutation_p.E938V|LOXHD1_ENST00000536736.1_Missense_Mutation_p.E1144V			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	866					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CACATAGGACTCATCCACTGG	0.572																																						dbGAP											0													74.0	80.0	78.0					18																	44126941		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2597A>T	18.37:g.44126941T>A	ENSP00000381707:p.Glu866Val		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.E1144V	ENST00000398722.4	37	c.3431		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.23|15.23	2.770915|2.770915	0.49680|0.49680	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097|ENST00000441551	T;T;T;T;T|.	0.26957|.	1.74;3.18;3.2;3.24;1.7|.	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	0.180956|.	0.48286|.	D|.	0.000185|.	T|.	0.69620|.	0.3131|.	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999995|0.999995	P;D;D|.	0.69078|.	0.676;0.995;0.997|.	P;D;D|.	0.83275|.	0.711;0.991;0.996|.	T|.	0.68914|.	-0.5283|.	10|.	0.52906|.	T|.	0.07|.	.|.	14.8313|14.8313	0.70151|0.70151	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1144;77;866|.	F5GZB4;F8WA52;Q8IVV2-2|.	.;.;.|.	V|C	33;866;1144;77;866;46;46|1124	ENSP00000300591:E33V;ENSP00000381707:E866V;ENSP00000444586:E1144V;ENSP00000409062:E77V;ENSP00000440060:E46V|.	ENSP00000300591:E33V|.	E|X	-|-	2|3	0|0	LOXHD1|LOXHD1	42380939|42380939	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.856000|0.856000	0.48823|0.48823	8.021000|8.021000	0.88750|0.88750	1.898000|1.898000	0.54952|0.54952	0.460000|0.460000	0.39030|0.39030	GAG|TGA	LOXHD1	-	NULL	ENSG00000167210		0.572	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		45	0.00	0	T	NM_144612		44126941	44126941	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	1.000	A
LRBA	987	genome.wustl.edu	37	4	151656509	151656509	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:151656509G>C	ENST00000357115.3	-	36	5898	c.5655C>G	c.(5653-5655)agC>agG	p.S1885R	LRBA_ENST00000535741.1_Missense_Mutation_p.S1885R|LRBA_ENST00000510413.1_Missense_Mutation_p.S1885R|LRBA_ENST00000507224.1_Missense_Mutation_p.S1885R	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1885						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TCATTGTCTGGCTAAGCAACC	0.373																																						dbGAP											0													219.0	196.0	204.0					4																	151656509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5655C>G	4.37:g.151656509G>C	ENSP00000349629:p.Ser1885Arg		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.S1885R	ENST00000357115.3	37	c.5655	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.48|15.48	2.847487|2.847487	0.51164|0.51164	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|T;T;T;T	.|0.51817	.|0.69;0.69;0.69;0.69	5.06|5.06	2.37|2.37	0.29283|0.29283	.|Domain of unknown function DUF1088 (1);	.|0.044215	.|0.85682	.|D	.|0.000000	T|T	0.61362|0.61362	0.2341|0.2341	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.91635	.|0.999;0.978	T|T	0.60782|0.60782	-0.7195|-0.7195	5|10	.|0.59425	.|D	.|0.04	.|.	9.5919|9.5919	0.39550|0.39550	0.2948:0.0:0.7052:0.0|0.2948:0.0:0.7052:0.0	.|.	.|1885;1885	.|P50851;P50851-2	.|LRBA_HUMAN;.	G|R	538|1885	.|ENSP00000446299:S1885R;ENSP00000421552:S1885R;ENSP00000349629:S1885R;ENSP00000422180:S1885R	.|ENSP00000349629:S1885R	A|S	-|-	2|3	0|2	LRBA|LRBA	151875959|151875959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.901000|0.901000	0.52897|0.52897	1.543000|1.543000	0.36147|0.36147	0.639000|0.639000	0.30564|0.30564	-0.157000|-0.157000	0.13467|0.13467	GCC|AGC	LRBA	-	pfam_DUF1088	ENSG00000198589		0.373	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	80	0.00	0	G			151656509	151656509	-1	no_errors	ENST00000357115	ensembl	human	known	69_37n	missense	95	21.49	26	SNP	1.000	C
LRP1	4035	genome.wustl.edu	37	12	57556676	57556677	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:57556676_57556677TG>CT	ENST00000243077.3	+	15	2906_2907	c.2440_2441TG>CT	c.(2440-2442)TGc>CTc	p.C814L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	814	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CAATGGCGGCTGCAGCAGCCTG	0.619																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	Exception_encountered	12.37:g.57556676_57556677delinsCT	ENSP00000243077:p.Cys814Leu		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.C814R|p.C814F	ENST00000243077.3	37	c.2440|c.2441	CCDS8932.1	12																																																																																			LRP1	-	smart_EGF-like	ENSG00000123384		0.619	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	139|137	0.00	0	T|G	NM_002332		57556676|57556677	57556676|57556677	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	161|158	10.44|10.23	19|18	SNP	1.000	C|T
LRP1	4035	genome.wustl.edu	37	12	57591445	57591445	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:57591445C>T	ENST00000243077.3	+	58	9746	c.9280C>T	c.(9280-9282)Cag>Tag	p.Q3094*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3094					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGCAATGTGCAGGTGAGGCG	0.572																																						dbGAP											0													88.0	79.0	82.0					12																	57591445		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9280C>T	12.37:g.57591445C>T	ENSP00000243077:p.Gln3094*		Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Q3094*	ENST00000243077.3	37	c.9280	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	51	18.255711	0.99902	.	.	ENSG00000123384	ENST00000243077	.	.	.	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	16.717	0.85399	0.0:1.0:0.0:0.0	.	.	.	.	X	3094	.	ENSP00000243077:Q3094X	Q	+	1	0	LRP1	55877712	0.976000	0.34144	1.000000	0.80357	0.176000	0.22953	1.886000	0.39688	2.463000	0.83235	0.511000	0.50034	CAG	LRP1	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.572	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	46	0.00	0	C	NM_002332		57591445	57591445	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	nonsense	48	30.43	21	SNP	1.000	T
LRRC27	80313	genome.wustl.edu	37	10	134158188	134158188	+	Intron	SNP	A	A	G	rs2273278		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr10:134158188A>G	ENST00000368614.3	+	5	658				LRRC27_ENST00000356571.4_Intron|LRRC27_ENST00000368615.3_Intron|LRRC27_ENST00000432555.2_Intron|LRRC27_ENST00000392638.2_Intron|LRRC27_ENST00000368610.3_Intron|LRRC27_ENST00000368613.4_Intron|LRRC27_ENST00000344079.5_Intron|LRRC27_ENST00000368612.1_Intron	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27											breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		AAATCACATTAACGTTGAAGT	0.443																																						dbGAP											0													56.0	63.0	60.0					10																	134158188		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.553+34A>G	10.37:g.134158188A>G			A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	RNA	SNP	-	NULL	ENST00000368614.3	37	NULL	CCDS31316.1	10																																																																																			LRRC27	-	-	ENSG00000148814		0.443	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	51	0.00	0	A	XM_290462		134158188	134158188	+1	no_errors	ENST00000489204	ensembl	human	known	69_37n	rna	74	11.90	10	SNP	0.000	G
LRRTM1	347730	genome.wustl.edu	37	2	80529855	80529855	+	Missense_Mutation	SNP	C	C	T	rs570950310		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:80529855C>T	ENST00000295057.3	-	2	1746	c.1090G>A	c.(1090-1092)Gag>Aag	p.E364K	CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.E364K|CTNNA2_ENST00000402739.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	364	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GCCCCATCCTCGCACAGGTGG	0.701										HNSCC(69;0.2)																												dbGAP											0													16.0	17.0	16.0					2																	80529855		2198	4290	6488	-	-	-	SO:0001583	missense	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1090G>A	2.37:g.80529855C>T	ENSP00000295057:p.Glu364Lys		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E364K	ENST00000295057.3	37	c.1090	CCDS1966.1	2	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292923	0.23564	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.39229	1.09;1.09	5.32	5.32	0.75619	.	0.060415	0.64402	U	0.000004	T	0.25121	0.0610	N	0.22421	0.69	0.80722	D	1	P	0.50066	0.931	B	0.27887	0.084	T	0.08953	-1.0697	9	.	.	.	.	18.995	0.92809	0.0:1.0:0.0:0.0	.	364	Q86UE6	LRRT1_HUMAN	K	364	ENSP00000295057:E364K;ENSP00000386646:E364K	.	E	-	1	0	LRRTM1	80383366	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.764000	0.85297	2.452000	0.82932	0.655000	0.94253	GAG	LRRTM1	-	NULL	ENSG00000162951		0.701	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	50	0.00	0	C	NM_178839		80529855	80529855	-1	no_errors	ENST00000295057	ensembl	human	known	69_37n	missense	43	33.85	22	SNP	1.000	T
LRRTM2	26045	genome.wustl.edu	37	5	138210118	138210118	+	Silent	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:138210118G>C	ENST00000274711.6	-	2	510	c.132C>G	c.(130-132)ctC>ctG	p.L44L	CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000523537.1_Intron|CTNNA1_ENST00000540387.1_5'Flank|LRRTM2_ENST00000518785.1_Intron|CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000518825.1_Intron|LRRTM2_ENST00000521094.2_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	44	LRRNT.				long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CGCAGTAGAAGAGCAGCTTCT	0.542																																						dbGAP											0													42.0	41.0	41.0					5																	138210118		2004	4156	6160	-	-	-	SO:0001819	synonymous_variant	0			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.132C>G	5.37:g.138210118G>C			A0AVL3|A8K4U9|B7ZLN8|Q7L770	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L44	ENST00000274711.6	37	c.132	CCDS47272.1	5																																																																																			LRRTM2	-	NULL	ENSG00000146006		0.542	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM2	HGNC	protein_coding	OTTHUMT00000374043.2	32	0.00	0	G			138210118	138210118	-1	no_errors	ENST00000274711	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	1.000	C
LRTM2	654429	genome.wustl.edu	37	12	1943943	1943943	+	3'UTR	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:1943943C>G	ENST00000543818.1	+	0	2011				LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000299194.1_3'UTR|LRTM2_ENST00000535041.1_3'UTR|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000585708.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CGGCATTGCTCAGCCACAGCT	0.682																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.*56C>G	12.37:g.1943943C>G			A7E2U6	RNA	SNP	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			LRTM2	-	-	ENSG00000166159		0.682	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	16	0.00	0	C			1943943	1943943	+1	no_errors	ENST00000543730	ensembl	human	putative	69_37n	rna	23	30.30	10	SNP	0.001	G
LTF	4057	genome.wustl.edu	37	3	46488803	46488803	+	Missense_Mutation	SNP	G	G	C	rs113405101		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:46488803G>C	ENST00000231751.4	-	10	1594	c.1299C>G	c.(1297-1299)aaC>aaG	p.N433K	LTF_ENST00000426532.2_Missense_Mutation_p.N389K|LTF_ENST00000417439.1_Missense_Mutation_p.N431K	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	433	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		ACTTACTGTAGTTCTCTGCCA	0.478																																						dbGAP											0													214.0	183.0	193.0					3																	46488803		2203	4296	6499	-	-	-	SO:0001583	missense	0				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1299C>G	3.37:g.46488803G>C	ENSP00000231751:p.Asn433Lys		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.N433K	ENST00000231751.4	37	c.1299	CCDS33747.1	3	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305044	0.40795	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.06608	3.28;3.28;3.28;3.28	4.76	0.174	0.15040	.	0.677060	0.16730	N	0.201869	T	0.14614	0.0353	L	0.58810	1.83	0.09310	N	1	D;D;D	0.89917	0.993;1.0;0.993	D;D;D	0.77557	0.962;0.99;0.943	T	0.08617	-1.0713	10	0.38643	T	0.18	-21.5093	5.1598	0.15054	0.3235:0.1532:0.5233:0.0	.	431;420;433	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	K	433;389;431;420	ENSP00000231751:N433K;ENSP00000405719:N389K;ENSP00000405546:N431K;ENSP00000397427:N420K	ENSP00000231751:N433K	N	-	3	2	LTF	46463807	0.001000	0.12720	0.008000	0.14137	0.979000	0.70002	-0.153000	0.10144	0.151000	0.19162	0.563000	0.77884	AAC	LTF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000012223		0.478	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2	75	0.00	0	G	NM_002343		46488803	46488803	-1	no_errors	ENST00000231751	ensembl	human	known	69_37n	missense	69	34.29	36	SNP	0.008	C
LUZP2	338645	genome.wustl.edu	37	11	24750806	24750806	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:24750806C>T	ENST00000336930.6	+	2	220	c.154C>T	c.(154-156)Ctt>Ttt	p.L52F	LUZP2_ENST00000533227.1_5'UTR|LUZP2_ENST00000531187.1_3'UTR			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	52						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						ATCAAGAGAACTTGATGGAAT	0.413																																						dbGAP											0													73.0	75.0	74.0					11																	24750806		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.154C>T	11.37:g.24750806C>T	ENSP00000336817:p.Leu52Phe		A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	NULL	p.L52F	ENST00000336930.6	37	c.154	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793743	0.90453	.	.	ENSG00000187398	ENST00000336930;ENST00000529015	T;T	0.50001	0.76;0.76	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.67711	0.2922	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66842	-0.5821	10	0.59425	D	0.04	-10.7255	17.923	0.88973	0.0:1.0:0.0:0.0	.	52	Q86TE4	LUZP2_HUMAN	F	52	ENSP00000336817:L52F;ENSP00000437032:L52F	ENSP00000336817:L52F	L	+	1	0	LUZP2	24707382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.336000	0.65935	2.839000	0.97877	0.650000	0.86243	CTT	LUZP2	-	NULL	ENSG00000187398		0.413	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	34	0.00	0	C	NM_001009909		24750806	24750806	+1	no_errors	ENST00000336930	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	T
MAGEA11	4110	genome.wustl.edu	37	X	148798081	148798081	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:148798081C>G	ENST00000355220.5	+	5	1037	c.935C>G	c.(934-936)tCt>tGt	p.S312C	MAGEA11_ENST00000333104.4_Missense_Mutation_p.S283C	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	312	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ATGCCCAAGTCTGGCCTCCTG	0.507																																						dbGAP											0													129.0	120.0	123.0					X																	148798081		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.935C>G	X.37:g.148798081C>G	ENSP00000347358:p.Ser312Cys		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S312C	ENST00000355220.5	37	c.935	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	8.852	0.944892	0.18356	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.05025	3.51;3.51;3.51	0.909	-1.82	0.07857	.	.	.	.	.	T	0.13329	0.0323	L	0.54323	1.7	0.09310	N	1	D;D	0.65815	0.988;0.995	P;D	0.67231	0.854;0.95	T	0.14337	-1.0476	9	0.87932	D	0	.	2.7947	0.05398	0.3043:0.3936:0.3021:0.0	.	283;312	G5E962;P43364	.;MAGAB_HUMAN	C	283;283;312	ENSP00000391496:S283C;ENSP00000328177:S283C;ENSP00000347358:S312C	ENSP00000328177:S283C	S	+	2	0	MAGEA11	148576324	0.000000	0.05858	0.003000	0.11579	0.023000	0.10783	-1.320000	0.02700	-0.937000	0.03719	0.377000	0.23210	TCT	MAGEA11	-	pfam_MAGE,pfscan_MAGE	ENSG00000185247		0.507	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	71	0.00	0	C	NM_005366		148798081	148798081	+1	no_errors	ENST00000355220	ensembl	human	known	69_37n	missense	93	23.14	28	SNP	0.002	G
MAGI1	9223	genome.wustl.edu	37	3	65350532	65350532	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:65350532T>C	ENST00000497477.2	-	18	3084	c.3085A>G	c.(3085-3087)Aca>Gca	p.T1029A	MAGI1_ENST00000330909.8_Missense_Mutation_p.T1124A|MAGI1_ENST00000483466.1_Missense_Mutation_p.T1125A|MAGI1_ENST00000402939.2_Missense_Mutation_p.T1096A			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1100	Interaction with FCHSD2.|PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCTGACCTTGTCTCCTGGGTC	0.473																																						dbGAP											0													214.0	202.0	206.0					3																	65350532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.3085A>G	3.37:g.65350532T>C	ENSP00000424369:p.Thr1029Ala		A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.T1096A	ENST00000497477.2	37	c.3286		3	.	.	.	.	.	.	.	.	.	.	T	4.905	0.168163	0.09339	.	.	ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257	T;T;T;T;T;T	0.18657	2.74;2.31;2.32;2.32;2.2;2.35	6.16	2.5	0.30297	.	0.342138	0.33691	N	0.004657	T	0.13372	0.0324	L	0.40543	1.245	0.46701	D	0.999169	B;B;B;B	0.17667	0.012;0.003;0.023;0.001	B;B;B;B	0.21917	0.037;0.006;0.007;0.01	T	0.09773	-1.0659	10	0.07325	T	0.83	.	6.8497	0.24008	0.0:0.1312:0.1283:0.7405	.	1029;1125;1096;1124	Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	.;.;.;.	A	1096;1124;1020;1000;1125;1029;883	ENSP00000385450:T1096A;ENSP00000331157:T1124A;ENSP00000418177:T1000A;ENSP00000420323:T1125A;ENSP00000424369:T1029A;ENSP00000420796:T883A	ENSP00000331157:T1124A	T	-	1	0	MAGI1	65325572	0.982000	0.34865	0.995000	0.50966	0.816000	0.46133	0.035000	0.13797	0.542000	0.28846	0.528000	0.53228	ACA	MAGI1	-	superfamily_PDZ	ENSG00000151276		0.473	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2	31	0.00	0	T	NM_004742		65350532	65350532	-1	no_errors	ENST00000402939	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.998	C
MAMLD1	10046	genome.wustl.edu	37	X	149631069	149631069	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:149631069A>T	ENST00000370401.2	+	3	438	c.128A>T	c.(127-129)gAt>gTt	p.D43V	MAMLD1_ENST00000432680.2_Intron|MAMLD1_ENST00000426613.2_Intron|MAMLD1_ENST00000468306.1_Intron|MAMLD1_ENST00000262858.5_Missense_Mutation_p.D43V			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	43					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGAAGAAGATTTATCTTTT	0.488																																						dbGAP											0													62.0	63.0	63.0					X																	149631069		1925	4116	6041	-	-	-	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.128A>T	X.37:g.149631069A>T	ENSP00000359428:p.Asp43Val		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.D43V	ENST00000370401.2	37	c.128	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	A	6.381	0.438362	0.12104	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000358892;ENST00000262858	T;T	0.61274	0.12;0.12	0.929	0.929	0.19449	.	.	.	.	.	T	0.29914	0.0748	N	0.08118	0	0.09310	N	1	B	0.24483	0.104	B	0.23275	0.045	T	0.17379	-1.0371	9	0.21540	T	0.41	.	3.863	0.09004	1.0:0.0:0.0:0.0	.	43	Q13495	MAMD1_HUMAN	V	5;43;43;43	ENSP00000359428:D43V;ENSP00000262858:D43V	ENSP00000262858:D43V	D	+	2	0	MAMLD1	149381727	0.014000	0.17966	0.015000	0.15790	0.015000	0.08874	1.187000	0.32090	0.620000	0.30215	0.376000	0.23039	GAT	MAMLD1	-	NULL	ENSG00000013619		0.488	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	39	0.00	0	A	NM_005491		149631069	149631069	+1	no_errors	ENST00000262858	ensembl	human	known	69_37n	missense	43	38.57	27	SNP	0.015	T
MAP3K1	4214	genome.wustl.edu	37	5	56160701	56160701	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:56160701C>A	ENST00000399503.3	+	4	975	c.975C>A	c.(973-975)aaC>aaA	p.N325K	AC008937.2_ENST00000415589.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	325					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TAGGGCCTAACTCTTTCCTGA	0.463																																						dbGAP											0													109.0	108.0	108.0					5																	56160701		1876	4111	5987	-	-	-	SO:0001583	missense	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.975C>A	5.37:g.56160701C>A	ENSP00000382423:p.Asn325Lys			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.N325K	ENST00000399503.3	37	c.975	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445795	0.84101	.	.	ENSG00000095015	ENST00000399503	T	0.68331	-0.32	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.76955	0.4060	L	0.50333	1.59	0.58432	D	0.999992	D	0.69078	0.997	D	0.75484	0.986	T	0.77986	-0.2381	10	0.72032	D	0.01	.	13.9984	0.64416	0.0:0.9273:0.0:0.0727	.	325	Q13233	M3K1_HUMAN	K	325	ENSP00000382423:N325K	ENSP00000382423:N325K	N	+	3	2	MAP3K1	56196458	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.867000	0.39499	2.737000	0.93849	0.563000	0.77884	AAC	MAP3K1	-	NULL	ENSG00000095015		0.463	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	49	0.00	0	C	XM_042066		56160701	56160701	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	missense	55	11.29	7	SNP	1.000	A
MAPK15	225689	genome.wustl.edu	37	8	144803948	144803948	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:144803948G>A	ENST00000338033.4	+	13	1475	c.1356G>A	c.(1354-1356)gcG>gcA	p.A452A	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	452					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGGGAGCTGCGCCCTCCCTGA	0.687																																						dbGAP											0													40.0	50.0	47.0					8																	144803948		2011	4153	6164	-	-	-	SO:0001819	synonymous_variant	0			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1356G>A	8.37:g.144803948G>A			Q2TCF9|Q8N362	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A452	ENST00000338033.4	37	c.1356	CCDS6409.2	8																																																																																			MAPK15	-	NULL	ENSG00000181085		0.687	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1	35	0.00	0	G	NM_139021		144803948	144803948	+1	no_errors	ENST00000338033	ensembl	human	known	69_37n	silent	77	16.13	15	SNP	0.213	A
MCM3AP	8888	genome.wustl.edu	37	21	47669888	47669888	+	Intron	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr21:47669888C>T	ENST00000397708.1	-	21	4545				AP001469.7_ENST00000444966.1_RNA|AP001469.9_ENST00000447037.1_RNA|MCM3AP_ENST00000291688.1_Intron|MCM3AP-AS1_ENST00000455567.1_RNA|AP001469.9_ENST00000430259.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000467026.1_Intron			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ACAATGATGGCACTAAGGCAC	0.512																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4290+1554G>A	21.37:g.47669888C>T			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	RNA	SNP	-	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			MCM3AP-AS1	-	-	ENSG00000215424		0.512	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP-AS1	HGNC	protein_coding	OTTHUMT00000207254.1	32	0.00	0	C	NM_003906		47669888	47669888	+1	no_errors	ENST00000414659	ensembl	human	known	69_37n	rna	28	17.65	6	SNP	0.001	T
MERTK	10461	genome.wustl.edu	37	2	112704979	112704979	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:112704979C>T	ENST00000295408.4	+	4	849	c.592C>T	c.(592-594)Cac>Tac	p.H198Y	MERTK_ENST00000409780.1_Missense_Mutation_p.H22Y|MERTK_ENST00000421804.2_Missense_Mutation_p.H198Y			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	198	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						AGGACTTCCTCACTTTACTAA	0.488																																						dbGAP											0													75.0	75.0	75.0					2																	112704979		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.592C>T	2.37:g.112704979C>T	ENSP00000295408:p.His198Tyr		Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H198Y	ENST00000295408.4	37	c.592	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	C	1.366	-0.587398	0.03799	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000409780	T;T;T	0.34859	1.34;1.34;1.34	5.24	-2.27	0.06846	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.804385	0.10138	N	0.711278	T	0.11580	0.0282	N	0.01424	-0.875	0.28067	N	0.932755	B	0.02656	0.0	B	0.06405	0.002	T	0.38045	-0.9679	10	0.02654	T	1	-4.9782	13.0407	0.58897	0.0:0.3672:0.0:0.6328	.	198	Q12866	MERTK_HUMAN	Y	198;198;22	ENSP00000295408:H198Y;ENSP00000389152:H198Y;ENSP00000387277:H22Y	ENSP00000295408:H198Y	H	+	1	0	MERTK	112421450	0.006000	0.16342	0.939000	0.37840	0.991000	0.79684	-0.324000	0.07986	-0.428000	0.07339	-0.140000	0.14226	CAC	MERTK	-	pfscan_Ig-like	ENSG00000153208		0.488	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	64	0.00	0	C			112704979	112704979	+1	no_errors	ENST00000295408	ensembl	human	known	69_37n	missense	92	10.68	11	SNP	0.840	T
KMT2A	4297	genome.wustl.edu	37	11	118373416	118373416	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:118373416delA	ENST00000389506.5	+	27	6800	c.6800delA	c.(6799-6801)caafs	p.Q2267fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.Q2270fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.Q2229fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2267					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TCAAATTTGCAAAGGACAGTG	0.418																																						dbGAP											0													79.0	75.0	76.0					11																	118373416		2200	4296	6496	-	-	-	SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6800delA	11.37:g.118373416delA	ENSP00000374157:p.Gln2267fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R2268fs	ENST00000389506.5	37	c.6800	CCDS31686.1	11																																																																																			MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.418	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	27	0.00	0	A	NM_005933		118373416	118373416	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	frame_shift_del	16	38.46	10	DEL	0.815	-
KMT2A	4297	genome.wustl.edu	37	11	118373824	118373824	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:118373824A>G	ENST00000389506.5	+	27	7208	c.7208A>G	c.(7207-7209)aAg>aGg	p.K2403R	KMT2A_ENST00000534358.1_Missense_Mutation_p.K2406R|KMT2A_ENST00000354520.4_Missense_Mutation_p.K2365R			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2403					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AAAACCTTGAAGCTATCTGGA	0.413																																						dbGAP											0													69.0	67.0	68.0					11																	118373824		2200	4296	6496	-	-	-	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7208A>G	11.37:g.118373824A>G	ENSP00000374157:p.Lys2403Arg		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.K2403R	ENST00000389506.5	37	c.7208	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103764	0.56291	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82711	-1.64;-1.64;-1.6	5.19	5.19	0.71726	.	0.054425	0.64402	D	0.000001	D	0.84261	0.5433	N	0.19112	0.55	0.39692	D	0.971062	D;D	0.63880	0.993;0.993	D;D	0.70935	0.971;0.971	D	0.86502	0.1804	10	0.51188	T	0.08	.	15.2143	0.73250	1.0:0.0:0.0:0.0	.	2406;2403	E9PQG7;Q03164	.;MLL1_HUMAN	R	2406;2403;2365;1313	ENSP00000436786:K2406R;ENSP00000374157:K2403R;ENSP00000346516:K2365R	ENSP00000346516:K2365R	K	+	2	0	MLL	117879034	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.382000	0.59594	2.179000	0.69175	0.460000	0.39030	AAG	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.413	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	37	0.00	0	A	NM_005933		118373824	118373824	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	0.980	G
MMP2	4313	genome.wustl.edu	37	16	55536778	55536778	+	Silent	SNP	C	C	G	rs371947760		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:55536778C>G	ENST00000219070.4	+	12	2366	c.1857C>G	c.(1855-1857)gcC>gcG	p.A619A	MMP2_ENST00000570308.1_Silent_p.A543A|MMP2_ENST00000543485.1_Silent_p.A543A|MMP2_ENST00000437642.2_Silent_p.A569A	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	619	Required for inhibitor TIMP2 binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	ACCTGGATGCCGTCGTGGACC	0.567																																						dbGAP											0													64.0	54.0	58.0					16																	55536778		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1857C>G	16.37:g.55536778C>G			B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin/matrixin_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A_matrixin	p.A619	ENST00000219070.4	37	c.1857	CCDS10752.1	16																																																																																			MMP2	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000087245		0.567	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	HGNC	protein_coding	OTTHUMT00000256913.3	37	0.00	0	C			55536778	55536778	+1	no_errors	ENST00000219070	ensembl	human	known	69_37n	silent	40	21.57	11	SNP	0.644	G
MRPL23	6150	genome.wustl.edu	37	11	1973402	1973402	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:1973402C>A	ENST00000397298.3	+	3	271	c.186C>A	c.(184-186)aaC>aaA	p.N62K	MRPL23_ENST00000397297.3_Missense_Mutation_p.N62K|MRPL23_ENST00000381514.3_Missense_Mutation_p.N62K|MRPL23_ENST00000381519.1_Missense_Mutation_p.N62K|MRPL23_ENST00000397294.3_Missense_Mutation_p.N62K	NM_021134.3	NP_066957.3	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	62					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|ovary(1)	4		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GCATCTATAACGTGCCCGTGG	0.552																																						dbGAP											0													73.0	65.0	68.0					11																	1973402		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB051340	CCDS31336.1	11p15.5	2012-09-13			ENSG00000214026	ENSG00000214026		"""Mitochondrial ribosomal proteins / large subunits"""	10322	protein-coding gene	gene with protein product		600789		RPL23L		8541832	Standard	NM_021134		Approved	L23MRP	uc001lux.3	Q16540	OTTHUMG00000012476	ENST00000397298.3:c.186C>A	11.37:g.1973402C>A	ENSP00000380466:p.Asn62Lys		A8MT29|Q96Q71	Missense_Mutation	SNP	pfam_Ribosomal_L25/23,superfamily_Ribosomal_L23/L15e_core_dom	p.N62K	ENST00000397298.3	37	c.186	CCDS31336.1	11	.	.	.	.	.	.	.	.	.	.	C	8.041	0.763849	0.15914	.	.	ENSG00000214026	ENST00000397298;ENST00000381519;ENST00000397297;ENST00000381514;ENST00000397294	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	3.87	-5.95	0.02241	Ribosomal protein L23/L15e (1);Nucleotide-binding, alpha-beta plait (1);	0.505254	0.20413	U	0.092835	T	0.30008	0.0751	L	0.45698	1.435	0.23070	N	0.998341	P	0.35894	0.526	B	0.37888	0.26	T	0.13980	-1.0489	10	0.38643	T	0.18	.	9.9364	0.41554	0.0:0.1802:0.1146:0.7052	.	62	Q16540	RM23_HUMAN	K	62	ENSP00000380466:N62K;ENSP00000370930:N62K;ENSP00000380465:N62K;ENSP00000370925:N62K;ENSP00000380462:N62K	ENSP00000370925:N62K	N	+	3	2	MRPL23	1929978	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-2.695000	0.00828	-1.511000	0.01794	-0.339000	0.08088	AAC	MRPL23	-	pfam_Ribosomal_L25/23,superfamily_Ribosomal_L23/L15e_core_dom	ENSG00000214026		0.552	MRPL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL23	HGNC	protein_coding	OTTHUMT00000034765.2	89	0.00	0	C	NM_021134		1973402	1973402	+1	no_errors	ENST00000381519	ensembl	human	known	69_37n	missense	81	11.96	11	SNP	0.062	A
MTIF2	4528	genome.wustl.edu	37	2	55467276	55467276	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:55467276C>T	ENST00000263629.4	-	14	2056	c.1741G>A	c.(1741-1743)Gtt>Att	p.V581I	MTIF2_ENST00000403721.1_Missense_Mutation_p.V581I|MTIF2_ENST00000394600.3_Missense_Mutation_p.V581I	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	581					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TGTTGGATAACATTGCCTGCA	0.323																																						dbGAP											0													56.0	54.0	55.0					2																	55467276		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1741G>A	2.37:g.55467276C>T	ENSP00000263629:p.Val581Ile		D6W5D0	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_TIF_IF2_dom3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Small_GTP-bd_dom	p.V581I	ENST00000263629.4	37	c.1741	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	C	8.708	0.911400	0.17833	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	6.07	5.2	0.72013	Translation initiation factor IF- 2, domain 3 (3);	0.512416	0.21591	N	0.072083	T	0.28134	0.0694	L	0.27053	0.805	0.20196	N	0.999922	B	0.02656	0.0	B	0.04013	0.001	T	0.13683	-1.0500	10	0.40728	T	0.16	-6.9962	7.1579	0.25647	0.1414:0.7078:0.0:0.1508	.	581	P46199	IF2M_HUMAN	I	581;581;581;259	ENSP00000384481:V581I;ENSP00000263629:V581I;ENSP00000378099:V581I;ENSP00000403492:V259I	ENSP00000263629:V581I	V	-	1	0	MTIF2	55320780	0.550000	0.26489	0.840000	0.33206	0.116000	0.19942	1.041000	0.30291	1.583000	0.49898	0.655000	0.94253	GTT	MTIF2	-	pfam_TIF_IF2_dom3,superfamily_TIF_IF2_dom3	ENSG00000085760		0.323	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	49	0.00	0	C	NM_002453		55467276	55467276	-1	no_errors	ENST00000263629	ensembl	human	known	69_37n	missense	80	27.93	31	SNP	0.918	T
MUC6	4588	genome.wustl.edu	37	11	1031654	1031654	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:1031654G>C	ENST00000421673.2	-	4	486	c.436C>G	c.(436-438)Ctg>Gtg	p.L146V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	146	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCCAGCTCCAGCTGCTTGGCC	0.657																																						dbGAP											0													26.0	29.0	28.0					11																	1031654		1871	3841	5712	-	-	-	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.436C>G	11.37:g.1031654G>C	ENSP00000406861:p.Leu146Val		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.L146V	ENST00000421673.2	37	c.436	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	G	10.97	1.500743	0.26861	.	.	ENSG00000184956	ENST00000421673;ENST00000525923	T;T	0.60424	0.19;0.19	3.74	2.72	0.32119	von Willebrand factor, type D domain (3);	0.346540	0.15544	U	0.256796	T	0.61578	0.2358	L	0.50993	1.605	0.25569	N	0.986911	D	0.61697	0.99	P	0.59595	0.86	T	0.48948	-0.8989	10	0.23302	T	0.38	.	9.178	0.37123	0.0:0.0:0.5477:0.4523	.	146	Q6W4X9	MUC6_HUMAN	V	146;170	ENSP00000406861:L146V;ENSP00000433790:L170V	ENSP00000406861:L146V	L	-	1	2	MUC6	1021654	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	0.875000	0.28079	1.818000	0.53035	0.313000	0.20887	CTG	MUC6	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000184956		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	77	0.00	0	G	XM_290540		1031654	1031654	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	missense	38	53.09	43	SNP	1.000	C
NBPF20	100288142	genome.wustl.edu	37	1	148341944	148341944	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:148341944G>C	ENST00000369202.1	-	6	826	c.629C>G	c.(628-630)aCt>aGt	p.T210S	NBPF20_ENST00000414710.2_Missense_Mutation_p.T210S			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	210	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						ATTTGAACAAGTGATGGCACA	0.483																																						dbGAP											0													52.0	61.0	58.0					1																	148341944		2100	4201	6301	-	-	-	SO:0001583	missense	0				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.629C>G	1.37:g.148341944G>C	ENSP00000358203:p.Thr210Ser			Missense_Mutation	SNP	pfam_NBPF_dom	p.T210S	ENST00000369202.1	37	c.629		1	.	.	.	.	.	.	.	.	.	.	.	9.850	1.193321	0.22037	.	.	ENSG00000203832	ENST00000369202;ENST00000369188;ENST00000369189;ENST00000414710	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	0.514	-0.871	0.10642	DUF1220 (2);	.	.	.	.	T	0.15696	0.0378	.	.	.	0.20563	N	0.999888	P;P;B;P	0.51057	0.473;0.941;0.378;0.646	B;P;B;P	0.60415	0.045;0.874;0.121;0.621	T	0.05053	-1.0909	6	0.46703	T	0.11	.	.	.	.	.	135;210;210;135	Q6P3W6-2;Q6P3W6;F5H1Q5;Q5VTG7	.;NBPFA_HUMAN;.;.	S	210;210;135;210	ENSP00000358203:T210S;ENSP00000358189:T210S;ENSP00000358190:T135S;ENSP00000389520:T210S	ENSP00000358189:T210S	T	-	2	0	NBPF20	146708568	0.895000	0.30542	0.001000	0.08648	0.168000	0.22595	0.852000	0.27764	-0.306000	0.08818	0.121000	0.15741	ACT	NBPF20	-	pfam_NBPF_dom	ENSG00000203832		0.483	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	NBPF20	HGNC	protein_coding	OTTHUMT00000100689.2	115	0.00	0	G			148341944	148341944	-1	no_errors	ENST00000369202	ensembl	human	known	69_37n	missense	181	10.84	22	SNP	0.001	C
NDUFA7	4701	genome.wustl.edu	37	19	8381404	8381404	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:8381404A>G	ENST00000301457.2	-	3	264	c.227T>C	c.(226-228)cTg>cCg	p.L76P	NDUFA7_ENST00000598884.1_Missense_Mutation_p.L76P	NM_005001.3	NP_004992.2	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa	76					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)	5						GCCTGACACCAGCGCCTTCTG	0.597																																						dbGAP											0													68.0	74.0	72.0					19																	8381404		2086	4223	6309	-	-	-	SO:0001583	missense	0			AF050637	CCDS42492.1	19p13.2	2013-05-14	2002-08-29		ENSG00000267855	ENSG00000267855		"""Mitochondrial respiratory chain complex / Complex I"""	7691	protein-coding gene	gene with protein product	"""complex I B14.5a subunit"""	602139	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (14.5kD, B14.5a)"""			9763676	Standard	NM_005001		Approved	B14.5a	uc002mjm.2	O95182	OTTHUMG00000182459	ENST00000301457.2:c.227T>C	19.37:g.8381404A>G	ENSP00000301457:p.Leu76Pro			Missense_Mutation	SNP	pfam_NADH-UbQ_OxRdtase_B14.5a_su	p.L76P	ENST00000301457.2	37	c.227	CCDS42492.1	19	.	.	.	.	.	.	.	.	.	.	A	16.33	3.092962	0.56075	.	.	ENSG00000167774	ENST00000301457	T	0.61859	0.07	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000003	T	0.73194	0.3556	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75964	-0.3132	10	0.72032	D	0.01	-10.7493	14.6116	0.68519	1.0:0.0:0.0:0.0	.	76	O95182	NDUA7_HUMAN	P	76	ENSP00000301457:L76P	ENSP00000301457:L76P	L	-	2	0	NDUFA7	8287404	1.000000	0.71417	0.266000	0.24541	0.011000	0.07611	8.859000	0.92264	2.194000	0.70268	0.459000	0.35465	CTG	NDUFA7	-	pfam_NADH-UbQ_OxRdtase_B14.5a_su	ENSG00000167774		0.597	NDUFA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA7	HGNC	protein_coding	OTTHUMT00000461373.1	28	0.00	0	A	NM_005001		8381404	8381404	-1	no_errors	ENST00000301457	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.971	G
NEDD4	4734	genome.wustl.edu	37	15	56126305	56126305	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:56126305G>C	ENST00000508342.1	-	22	3917	c.3618C>G	c.(3616-3618)gaC>gaG	p.D1206E	NEDD4_ENST00000506154.1_Missense_Mutation_p.D1190E|NEDD4_ENST00000435532.3_Missense_Mutation_p.D787E|NEDD4_ENST00000338963.2_Missense_Mutation_p.D1134E	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	1206	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GTTCCCTCCAGTCATTCACAT	0.333																																						dbGAP											0													168.0	152.0	158.0					15																	56126305		2193	4292	6485	-	-	-	SO:0001583	missense	0			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.3618C>G	15.37:g.56126305G>C	ENSP00000424827:p.Asp1206Glu		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.D1206E	ENST00000508342.1	37	c.3618		15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.74|19.74	3.884199|3.884199	0.72410|0.72410	.|.	.|.	ENSG00000069869|ENSG00000069869	ENST00000508342;ENST00000435532;ENST00000338963;ENST00000506154|ENST00000508871	T;T;T;T|.	0.58652|.	0.32;0.32;0.32;0.32|.	5.55|5.55	3.69|3.69	0.42338|0.42338	HECT (4);|.	0.089622|.	0.85682|.	D|.	0.000000|.	T|T	0.66684|0.66684	0.2814|0.2814	M|M	0.76938|0.76938	2.355|2.355	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;D|.	0.62365|.	0.958;0.991;0.989;0.962|.	P;D;D;P|.	0.68483|.	0.708;0.919;0.958;0.89|.	T|T	0.64659|0.64659	-0.6355|-0.6355	10|5	0.87932|.	D|.	0|.	.|.	8.9492|8.9492	0.35779|0.35779	0.2506:0.0:0.7494:0.0|0.2506:0.0:0.7494:0.0	.|.	1190;787;1206;1134|.	P46934-2;P46934-4;P46934;P46934-3|.	.;.;NEDD4_HUMAN;.|.	E|S	1206;787;1134;1190|797	ENSP00000424827:D1206E;ENSP00000410613:D787E;ENSP00000345530:D1134E;ENSP00000422705:D1190E|.	ENSP00000345530:D1134E|.	D|T	-|-	3|2	2|0	NEDD4|NEDD4	53913597|53913597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	4.832000|4.832000	0.62759|0.62759	0.713000|0.713000	0.32060|0.32060	-0.136000|-0.136000	0.14681|0.14681	GAC|ACT	NEDD4	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000069869		0.333	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1	61	0.00	0	G	NM_198400		56126305	56126305	-1	no_errors	ENST00000508342	ensembl	human	known	69_37n	missense	64	20.00	16	SNP	1.000	C
NEK9	91754	genome.wustl.edu	37	14	75576564	75576564	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr14:75576564C>G	ENST00000238616.5	-	10	1164	c.1006G>C	c.(1006-1008)Gaa>Caa	p.E336Q		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	336					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		ATGGGTGCTTCAGTCACAGTG	0.443																																						dbGAP											0													50.0	48.0	49.0					14																	75576564		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1006G>C	14.37:g.75576564C>G	ENSP00000238616:p.Glu336Gln		Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E336Q	ENST00000238616.5	37	c.1006	CCDS9839.1	14	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683985	0.68157	.	.	ENSG00000119638	ENST00000238616;ENST00000540227	T	0.24538	1.85	5.97	5.97	0.96955	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);Protein kinase-like domain (1);	0.102412	0.64402	D	0.000003	T	0.19685	0.0473	N	0.22421	0.69	0.58432	D	0.999997	P	0.34909	0.475	B	0.26770	0.073	T	0.02150	-1.1205	10	0.38643	T	0.18	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	336	Q8TD19	NEK9_HUMAN	Q	336;318	ENSP00000238616:E336Q	ENSP00000238616:E336Q	E	-	1	0	NEK9	74646317	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.836000	0.97738	0.655000	0.94253	GAA	NEK9	-	superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom	ENSG00000119638		0.443	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	21	0.00	0	C	NM_033116		75576564	75576564	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	G
NFATC3	4775	genome.wustl.edu	37	16	68156617	68156617	+	Silent	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:68156617C>T	ENST00000346183.3	+	2	855	c.831C>T	c.(829-831)tcC>tcT	p.S277S	NFATC3_ENST00000575270.1_Silent_p.S277S|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000329524.4_Silent_p.S277S|NFATC3_ENST00000349223.5_Silent_p.S277S|RP11-67A1.2_ENST00000548144.1_RNA	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	277	3 X SP repeats.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		GGAGGCACTCCAGTGCTGAAG	0.572																																						dbGAP											0													109.0	100.0	103.0					16																	68156617		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.831C>T	16.37:g.68156617C>T			O75211|Q14516|Q99840|Q99841|Q99842	Nonsense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.Q262*	ENST00000346183.3	37	c.784	CCDS10860.1	16																																																																																			NFATC3	-	NULL	ENSG00000072736		0.572	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	41	0.00	0	C	NM_004555		68156617	68156617	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000570212	ensembl	human	putative	69_37n	nonsense	55	21.43	15	SNP	1.000	T
NFKBIB	4793	genome.wustl.edu	37	19	39390822	39390822	+	Silent	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:39390822C>G	ENST00000313582.5	+	1	184	c.150C>G	c.(148-150)gtC>gtG	p.V50V	NFKBIB_ENST00000392079.3_Missense_Mutation_p.S37C|SIRT2_ENST00000249396.7_5'Flank|NFKBIB_ENST00000572515.1_Silent_p.V50V|SIRT2_ENST00000481381.1_5'Flank|SIRT2_ENST00000392081.2_5'Flank|SIRT2_ENST00000358931.5_5'Flank	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	50					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CTCCCCTCGTCTTCGGCTACG	0.672																																					Pancreas(165;1492 2005 6979 7739 34483)	dbGAP											0													15.0	18.0	17.0					19																	39390822		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.150C>G	19.37:g.39390822C>G			A8K3F4|Q96BJ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S37C	ENST00000313582.5	37	c.110	CCDS12524.1	19	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163963	0.57476	.	.	ENSG00000104825	ENST00000392079	T	0.48836	0.8	4.97	1.48	0.22813	.	.	.	.	.	T	0.32496	0.0831	.	.	.	0.22317	N	0.999205	B	0.12630	0.006	B	0.16289	0.015	T	0.21245	-1.0251	8	0.39692	T	0.17	-31.6917	6.8395	0.23955	0.0:0.6606:0.1587:0.1807	.	37	G5E9C2	.	C	37	ENSP00000375929:S37C	ENSP00000375929:S37C	S	+	2	0	NFKBIB	44082662	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.470000	0.22084	0.705000	0.31890	0.609000	0.83330	TCT	NFKBIB	-	NULL	ENSG00000104825		0.672	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIB	HGNC	protein_coding	OTTHUMT00000438155.1	138	0.00	0	C	NM_002503		39390822	39390822	+1	no_errors	ENST00000392079	ensembl	human	known	69_37n	missense	224	11.81	30	SNP	0.999	G
NLRP8	126205	genome.wustl.edu	37	19	56466905	56466905	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:56466905G>A	ENST00000291971.3	+	3	1552	c.1481G>A	c.(1480-1482)cGg>cAg	p.R494Q	NLRP8_ENST00000590542.1_Missense_Mutation_p.R494Q	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	494	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGTATTCTTCGGAGAATTGCA	0.468																																						dbGAP											0													175.0	162.0	166.0					19																	56466905		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1481G>A	19.37:g.56466905G>A	ENSP00000291971:p.Arg494Gln		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R494Q	ENST00000291971.3	37	c.1481	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.460246	0.01062	.	.	ENSG00000179709	ENST00000291971	D	0.84516	-1.86	2.04	-3.13	0.05266	.	.	.	.	.	T	0.60117	0.2244	N	0.12746	0.255	0.09310	N	1	P;B	0.40083	0.702;0.207	B;B	0.26864	0.074;0.02	T	0.56709	-0.7934	9	0.13108	T	0.6	.	6.6736	0.23082	0.6605:0.0:0.3395:0.0	.	494;494	Q86W28-2;Q86W28	.;NALP8_HUMAN	Q	494	ENSP00000291971:R494Q	ENSP00000291971:R494Q	R	+	2	0	NLRP8	61158717	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.301000	0.08232	-0.798000	0.04444	0.514000	0.50259	CGG	NLRP8	-	NULL	ENSG00000179709		0.468	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	87	0.00	0	G	NM_176811		56466905	56466905	+1	no_errors	ENST00000291971	ensembl	human	known	69_37n	missense	113	30.25	49	SNP	0.000	A
NPAS4	266743	genome.wustl.edu	37	11	66189985	66189985	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:66189985G>A	ENST00000311034.2	+	3	567	c.391G>A	c.(391-393)Gtg>Atg	p.V131M		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	131	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CCACCTCACTGTGCGCCAGCA	0.582																																						dbGAP											0													153.0	130.0	138.0					11																	66189985		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.391G>A	11.37:g.66189985G>A	ENSP00000311196:p.Val131Met		B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.V131M	ENST00000311034.2	37	c.391	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	G	8.204	0.798834	0.16397	.	.	ENSG00000174576	ENST00000311034	T	0.19669	2.13	4.71	4.71	0.59529	PAS (2);	0.000000	0.50627	D	0.000113	T	0.08670	0.0215	N	0.04746	-0.17	0.43522	D	0.995797	B	0.29988	0.264	B	0.31751	0.135	T	0.18178	-1.0345	10	0.06365	T	0.9	-11.5504	8.7275	0.34478	0.1014:0.0:0.8986:0.0	.	131	Q8IUM7	NPAS4_HUMAN	M	131	ENSP00000311196:V131M	ENSP00000311196:V131M	V	+	1	0	NPAS4	65946561	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.327000	0.65881	2.440000	0.82611	0.563000	0.77884	GTG	NPAS4	-	smart_PAS,pfscan_PAS	ENSG00000174576		0.582	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	67	0.00	0	G	NM_178864		66189985	66189985	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	missense	46	34.29	24	SNP	1.000	A
NR1H4	9971	genome.wustl.edu	37	12	100957179	100957179	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:100957179A>G	ENST00000551379.1	+	9	1401	c.1373A>G	c.(1372-1374)aAt>aGt	p.N458S	NR1H4_ENST00000548884.1_Missense_Mutation_p.N444S|NR1H4_ENST00000392986.3_Missense_Mutation_p.N448S|NR1H4_ENST00000549996.1_Missense_Mutation_p.N397S|NR1H4_ENST00000188403.7_Missense_Mutation_p.N454S			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	458	Ligand-binding.				bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	CGGACATTCAATCATCACCAC	0.468																																						dbGAP											0													144.0	128.0	134.0					12																	100957179		2203	4300	6503	-	-	-	SO:0001583	missense	0			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.1373A>G	12.37:g.100957179A>G	ENSP00000447149:p.Asn458Ser		A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.N458S	ENST00000551379.1	37	c.1373	CCDS55876.1	12	.	.	.	.	.	.	.	.	.	.	A	12.23	1.876552	0.33162	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000549996;ENST00000551379;ENST00000188403	D;D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58;-3.58	5.59	5.59	0.84812	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.078622	0.85682	D	0.000000	D	0.86883	0.6040	N	0.17872	0.535	0.50313	D	0.999862	B;B;B;B;B	0.27380	0.177;0.052;0.069;0.085;0.113	B;B;B;B;B	0.23574	0.021;0.047;0.021;0.032;0.031	T	0.82500	-0.0426	10	0.08599	T	0.76	.	10.4249	0.44371	0.9271:0.0:0.0729:0.0	.	397;458;454;448;444	F8VYG8;Q96RI1;Q96RI1-4;F1DAL1;B6ZGS9	.;NR1H4_HUMAN;.;.;.	S	444;448;397;458;454	ENSP00000448506:N444S;ENSP00000376712:N448S;ENSP00000448978:N397S;ENSP00000447149:N458S;ENSP00000188403:N454S	ENSP00000188403:N454S	N	+	2	0	NR1H4	99481310	1.000000	0.71417	0.994000	0.49952	0.928000	0.56348	5.259000	0.65485	2.254000	0.74563	0.459000	0.35465	AAT	NR1H4	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000012504		0.468	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	HGNC	protein_coding	OTTHUMT00000409140.1	30	0.00	0	A	NM_005123		100957179	100957179	+1	no_errors	ENST00000551379	ensembl	human	known	69_37n	missense	22	52.17	24	SNP	1.000	G
OR2A14	135941	genome.wustl.edu	37	7	143826250	143826250	+	Silent	SNP	A	A	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:143826250A>T	ENST00000408899.2	+	1	100	c.45A>T	c.(43-45)cgA>cgT	p.R15R		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					CCTTGCCGCGATTCCAGGTTG	0.512																																						dbGAP											0													108.0	106.0	107.0					7																	143826250		2040	4193	6233	-	-	-	SO:0001819	synonymous_variant	0				CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.45A>T	7.37:g.143826250A>T			Q6IF41|Q8NGT8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R15	ENST00000408899.2	37	c.45	CCDS43672.1	7																																																																																			OR2A14	-	NULL	ENSG00000221938		0.512	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A14	HGNC	protein_coding	OTTHUMT00000349980.1	96	0.00	0	A			143826250	143826250	+1	no_errors	ENST00000408899	ensembl	human	known	69_37n	silent	191	21.07	51	SNP	0.203	T
OR6F1	343169	genome.wustl.edu	37	1	247875785	247875785	+	Silent	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:247875785G>T	ENST00000302084.2	-	1	320	c.273C>A	c.(271-273)acC>acA	p.T91T	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TAAATGATATGGTCTGACTTC	0.483																																						dbGAP											0													119.0	118.0	118.0					1																	247875785		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.273C>A	1.37:g.247875785G>T			B2RNV6|Q6IF02|Q96R39	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T91	ENST00000302084.2	37	c.273	CCDS31095.1	1																																																																																			OR6F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169214		0.483	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6F1	HGNC	protein_coding	OTTHUMT00000096870.1	48	0.00	0	G	NM_001005286		247875785	247875785	-1	no_errors	ENST00000302084	ensembl	human	known	69_37n	silent	54	19.40	13	SNP	0.004	T
PASK	23178	genome.wustl.edu	37	2	242076635	242076635	+	Silent	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:242076635G>C	ENST00000405260.1	-	7	1619	c.921C>G	c.(919-921)acC>acG	p.T307T	PASK_ENST00000544142.1_Silent_p.T121T|PASK_ENST00000539818.1_Silent_p.T91T|PASK_ENST00000403638.3_Silent_p.T307T|PASK_ENST00000234040.4_Silent_p.T307T|PASK_ENST00000358649.4_Silent_p.T307T	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	307					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAGGGAAGGTGGTACCGTCCC	0.572																																						dbGAP											0													79.0	77.0	77.0					2																	242076635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.921C>G	2.37:g.242076635G>C			G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	NULL	p.P122R	ENST00000405260.1	37	c.365	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	G	9.858	1.195648	0.22037	.	.	ENSG00000115687	ENST00000433589	.	.	.	5.26	3.46	0.39613	.	.	.	.	.	T	0.47967	0.1474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41142	-0.9525	4	.	.	.	.	4.2885	0.10867	0.1856:0.0:0.6325:0.1818	.	.	.	.	R	122	.	.	P	-	2	0	PASK	241725308	1.000000	0.71417	0.995000	0.50966	0.874000	0.50279	1.350000	0.34010	1.217000	0.43442	0.467000	0.42956	CCA	PASK	-	NULL	ENSG00000115687		0.572	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	64	0.00	0	G	NM_015148		242076635	242076635	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433589	ensembl	human	novel	69_37n	missense	64	36.00	36	SNP	0.966	C
PCDHA6	56142	genome.wustl.edu	37	5	140209511	140209511	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:140209511A>C	ENST00000529310.1	+	1	1949	c.1835A>C	c.(1834-1836)cAg>cCg	p.Q612P	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	612	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATGAGCTGCAGCCCCCGGCA	0.667																																						dbGAP											0													78.0	79.0	79.0					5																	140209511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1835A>C	5.37:g.140209511A>C	ENSP00000433378:p.Gln612Pro		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q612P	ENST00000529310.1	37	c.1835	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	A	2.883	-0.231314	0.05983	.	.	ENSG00000081842	ENST00000529310	T	0.52526	0.66	3.87	-2.6	0.06190	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35189	0.0923	L	0.54908	1.71	0.22017	N	0.999412	B;B	0.21225	0.053;0.01	B;B	0.20767	0.031;0.021	T	0.38415	-0.9662	9	0.49607	T	0.09	.	2.263	0.04071	0.4499:0.1209:0.0755:0.3536	.	612;612	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	P	612	ENSP00000433378:Q612P	ENSP00000433378:Q612P	Q	+	2	0	PCDHA6	140189695	0.000000	0.05858	0.309000	0.25155	0.240000	0.25518	0.070000	0.14573	-0.156000	0.11079	0.254000	0.18369	CAG	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081842		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	121	0.00	0	A	NM_018909		140209511	140209511	+1	no_errors	ENST00000529310	ensembl	human	known	69_37n	missense	151	19.25	36	SNP	0.010	C
PCNXL2	80003	genome.wustl.edu	37	1	233136225	233136225	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:233136225G>C	ENST00000258229.9	-	30	5388	c.5154C>G	c.(5152-5154)atC>atG	p.I1718M	PCNXL2_ENST00000344698.2_Missense_Mutation_p.I370M	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1718						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CGAAGGACTGGATGGCCTCGT	0.627																																						dbGAP											0													62.0	64.0	63.0					1																	233136225		2026	4183	6209	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5154C>G	1.37:g.233136225G>C	ENSP00000258229:p.Ile1718Met		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.I1718M	ENST00000258229.9	37	c.5154	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560904	0.65538	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.58060	0.36;0.36	5.14	2.25	0.28309	.	0.043979	0.85682	D	0.000000	T	0.64360	0.2591	M	0.78285	2.405	0.80722	D	1	D;P	0.56746	0.977;0.947	D;P	0.63381	0.914;0.701	T	0.64402	-0.6416	10	0.87932	D	0	.	5.0258	0.14383	0.2683:0.0:0.5837:0.148	.	1718;370	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	M	370;1718	ENSP00000340759:I370M;ENSP00000258229:I1718M	ENSP00000258229:I1718M	I	-	3	3	PCNXL2	231202848	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.770000	0.38532	0.861000	0.35504	-0.145000	0.13849	ATC	PCNXL2	-	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	ENSG00000135749		0.627	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	28	0.00	0	G	NM_014801		233136225	233136225	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	1.000	C
PCOLCE	5118	genome.wustl.edu	37	7	100201566	100201566	+	Intron	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:100201566C>G	ENST00000223061.5	+	3	484				PCOLCE-AS1_ENST00000442166.2_RNA|PCOLCE-AS1_ENST00000446022.1_RNA|PCOLCE-AS1_ENST00000544873.1_RNA|PCOLCE_ENST00000496269.1_Intron	NM_002593.3	NP_002584.2	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer						multicellular organismal development (GO:0007275)|positive regulation of peptidase activity (GO:0010952)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GTCCCCGCCTCTGTCCCCGCT	0.652																																						dbGAP											0													44.0	48.0	47.0					7																	100201566		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L33799	CCDS5700.1	7q22	2008-07-18			ENSG00000106333	ENSG00000106333			8738	protein-coding gene	gene with protein product	"""procollagen, type 1, COOH-terminal proteinase enhancer"", ""procollagen C-proteinase enhancer 1"""	600270				8824813, 9799793	Standard	NM_002593		Approved	PCPE, PCPE1	uc003uvo.3	Q15113	OTTHUMG00000156675	ENST00000223061.5:c.205-16C>G	7.37:g.100201566C>G			B2R9E1|O14550	RNA	SNP	-	NULL	ENST00000223061.5	37	NULL	CCDS5700.1	7																																																																																			PCOLCE-AS1	-	-	ENSG00000224729		0.652	PCOLCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE-AS1	HGNC	protein_coding	OTTHUMT00000345285.1	57	0.00	0	C	NM_002593		100201566	100201566	-1	no_errors	ENST00000442166	ensembl	human	known	69_37n	rna	63	25.88	22	SNP	0.000	G
PDZRN3	23024	genome.wustl.edu	37	3	73651605	73651605	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:73651605T>C	ENST00000263666.4	-	3	932	c.818A>G	c.(817-819)cAc>cGc	p.H273R	PDZRN3_ENST00000308537.4_Missense_Mutation_p.H273R	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	273	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGATCCATCGTGGTTATCCTT	0.403																																						dbGAP											0													147.0	144.0	145.0					3																	73651605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.818A>G	3.37:g.73651605T>C	ENSP00000263666:p.His273Arg		A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING,pfscan_Znf_TRAF	p.H273R	ENST00000263666.4	37	c.818	CCDS33789.1	3	.	.	.	.	.	.	.	.	.	.	T	13.19	2.164207	0.38217	.	.	ENSG00000121440	ENST00000263666;ENST00000416926;ENST00000308537	T;T	0.23147	2.97;1.92	5.05	5.05	0.67936	PDZ/DHR/GLGF (4);	0.653640	0.15507	N	0.258756	T	0.15739	0.0379	N	0.05351	-0.065	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06075	-1.0847	10	0.39692	T	0.17	.	14.7928	0.69854	0.0:0.0:0.0:1.0	.	273	Q9UPQ7	PZRN3_HUMAN	R	273	ENSP00000263666:H273R;ENSP00000308831:H273R	ENSP00000263666:H273R	H	-	2	0	PDZRN3	73734295	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.264000	0.65513	1.873000	0.54277	0.460000	0.39030	CAC	PDZRN3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000121440		0.403	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	49	0.00	0	T	XM_041363		73651605	73651605	-1	no_errors	ENST00000263666	ensembl	human	known	69_37n	missense	61	18.42	14	SNP	1.000	C
PENK	5179	genome.wustl.edu	37	8	57358343	57358343	+	Intron	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:57358343G>A	ENST00000314922.3	-	1	215				PENK_ENST00000523051.1_Intron|RP11-17A4.2_ENST00000518662.1_RNA|PENK_ENST00000523274.1_5'Flank|PENK_ENST00000451791.2_Intron|PENK_ENST00000518770.1_Missense_Mutation_p.P57L	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin						aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TGTCTCACAAGGTGCGCAACA	0.687																																						dbGAP											0													46.0	47.0	47.0					8																	57358343		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.138+31C>T	8.37:g.57358343G>A			B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_A	p.P57L	ENST00000314922.3	37	c.170	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	G	12.54	1.970115	0.34754	.	.	ENSG00000181195	ENST00000518770	.	.	.	2.72	-0.157	0.13387	.	.	.	.	.	T	0.27419	0.0673	.	.	.	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.24905	-1.0147	7	0.62326	D	0.03	.	3.8835	0.09088	0.2115:0.2323:0.5562:0.0	.	57	E5RJ72	.	L	57	.	ENSP00000430592:P57L	P	-	2	0	PENK	57520897	0.000000	0.05858	0.001000	0.08648	0.166000	0.22503	-1.468000	0.02350	-0.049000	0.13379	0.555000	0.69702	CCT	PENK	-	NULL	ENSG00000181195		0.687	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	HGNC	protein_coding	OTTHUMT00000378645.1	96	0.00	0	G			57358343	57358343	-1	no_errors	ENST00000518770	ensembl	human	putative	69_37n	missense	120	25.77	42	SNP	0.001	A
PHLPP1	23239	genome.wustl.edu	37	18	60572515	60572515	+	Silent	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr18:60572515A>G	ENST00000262719.5	+	8	2940	c.2706A>G	c.(2704-2706)tcA>tcG	p.S902S	PHLPP1_ENST00000400316.4_Silent_p.S390S			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	902					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TGGATGTTTCAAGGTAAGAAG	0.333																																						dbGAP											0													72.0	65.0	67.0					18																	60572515		1799	4073	5872	-	-	-	SO:0001819	synonymous_variant	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2706A>G	18.37:g.60572515A>G			A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K26E	ENST00000262719.5	37	c.76	CCDS45881.2	18																																																																																			PHLPP1	-	pfam_Leu-rich_rpt	ENSG00000081913		0.333	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	54	0.00	0	A	NM_194449		60572515	60572515	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000591386	ensembl	human	novel	69_37n	missense	68	13.92	11	SNP	1.000	G
PIF1	80119	genome.wustl.edu	37	15	65114490	65114490	+	Silent	SNP	C	C	G	rs375999078		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr15:65114490C>G	ENST00000268043.4	-	4	886	c.792G>C	c.(790-792)ggG>ggC	p.G264G	PIF1_ENST00000333425.6_Silent_p.G264G|PIF1_ENST00000559239.1_Silent_p.G264G					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						GGGTGGTGCCCCCGATGTGGC	0.602																																						dbGAP											0													53.0	58.0	56.0					15																	65114490		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.792G>C	15.37:g.65114490C>G				Silent	SNP	pfam_DNA_helicase_PIF1,pfam_DNA_helicase	p.G264	ENST00000268043.4	37	c.792	CCDS10195.2	15																																																																																			PIF1	-	pfam_DNA_helicase_PIF1	ENSG00000140451		0.602	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIF1	HGNC	protein_coding	OTTHUMT00000256533.1	56	0.00	0	C	NM_025049		65114490	65114490	-1	no_errors	ENST00000333425	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	1.000	G
PKD1	5310	genome.wustl.edu	37	16	2161709	2161709	+	Silent	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:2161709C>A	ENST00000262304.4	-	15	3667	c.3459G>T	c.(3457-3459)tcG>tcT	p.S1153S	PKD1_ENST00000423118.1_Silent_p.S1153S|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1153	PKD 6. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CACCCCCAGGCGAGGGCAGCG	0.701																																						dbGAP											0													13.0	15.0	14.0					16																	2161709		2149	4267	6416	-	-	-	SO:0001819	synonymous_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3459G>T	16.37:g.2161709C>A			Q15140|Q15141	Silent	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.S1153	ENST00000262304.4	37	c.3459	CCDS32369.1	16																																																																																			PKD1	-	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom,tigrfam_Polycystin_cat	ENSG00000008710		0.701	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	152	0.00	0	C			2161709	2161709	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	silent	161	27.68	62	SNP	0.000	A
PLS3	5358	genome.wustl.edu	37	X	114879343	114879343	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:114879343G>A	ENST00000420625.2	+	11	1320	c.1186G>A	c.(1186-1188)Gaa>Aaa	p.E396K	PLS3_ENST00000537301.1_Missense_Mutation_p.E383K|PLS3_ENST00000543070.1_5'UTR|PLS3_ENST00000355899.3_Missense_Mutation_p.E396K|PLS3_ENST00000539310.1_Missense_Mutation_p.E351K|PLS3_ENST00000289290.3_Missense_Mutation_p.E360K	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	396	Actin-binding 2.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						CTTAACAGGAGAAACTCGTGA	0.348																																					Colon(160;1047 1864 8490 12969 29601)	dbGAP											0													139.0	119.0	126.0					X																	114879343		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.1186G>A	X.37:g.114879343G>A	ENSP00000398945:p.Glu396Lys		A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.E396K	ENST00000420625.2	37	c.1186	CCDS14568.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.247801|5.247801	0.95305|0.95305	.|.	.|.	ENSG00000102024|ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310|ENST00000497870	D;D;D;D;D|.	0.96011|.	-3.88;-3.88;-3.88;-3.88;-3.88|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Calponin homology domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83335|0.83335	0.5232|0.5232	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.63046|.	0.969;0.992;0.974;0.992|.	P;P;D;D|.	0.70487|.	0.589;0.829;0.969;0.917|.	D|D	0.86197|0.86197	0.1616|0.1616	10|5	0.56958|.	D|.	0.05|.	4.3877|4.3877	16.8331|16.8331	0.85950|0.85950	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	369;383;360;396|.	B4DPW9;B4DGB4;F8W8D8;P13797|.	.;.;.;PLST_HUMAN|.	K|K	396;383;360;396;351|116	ENSP00000348163:E396K;ENSP00000445105:E383K;ENSP00000289290:E360K;ENSP00000398945:E396K;ENSP00000445339:E351K|.	ENSP00000289290:E360K|.	E|R	+|+	1|2	0|0	PLS3|PLS3	114785599|114785599	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.813000|9.813000	0.99286|0.99286	2.372000|2.372000	0.80975|0.80975	0.600000|0.600000	0.82982|0.82982	GAA|AGA	PLS3	-	superfamily_CH-domain	ENSG00000102024		0.348	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	78	0.00	0	G			114879343	114879343	+1	no_errors	ENST00000355899	ensembl	human	known	69_37n	missense	93	26.19	33	SNP	1.000	A
PLXNA3	55558	genome.wustl.edu	37	X	153693508	153693508	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:153693508C>T	ENST00000369682.3	+	11	2366	c.2191C>T	c.(2191-2193)Cgg>Tgg	p.R731W		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	731					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCGGCAGCAGCGGGTGCCTGC	0.662																																						dbGAP											0													30.0	30.0	30.0					X																	153693508		2195	4297	6492	-	-	-	SO:0001583	missense	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2191C>T	X.37:g.153693508C>T	ENSP00000358696:p.Arg731Trp		Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R731W	ENST00000369682.3	37	c.2191	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	C	33	5.283777	0.95489	.	.	ENSG00000130827	ENST00000369682	T	0.01113	5.32	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.07413	0.0187	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.67103	0.949	T	0.01140	-1.1439	10	0.87932	D	0	.	17.1225	0.86705	0.0:1.0:0.0:0.0	.	731	P51805	PLXA3_HUMAN	W	731	ENSP00000358696:R731W	ENSP00000358696:R731W	R	+	1	2	PLXNA3	153346702	0.972000	0.33761	0.998000	0.56505	0.983000	0.72400	2.065000	0.41442	2.395000	0.81488	0.529000	0.55759	CGG	PLXNA3	-	NULL	ENSG00000130827		0.662	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	106	0.00	0	C	NM_017514		153693508	153693508	+1	no_errors	ENST00000369682	ensembl	human	known	69_37n	missense	147	19.67	36	SNP	1.000	T
PNKD	25953	genome.wustl.edu	37	2	219209616	219209616	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:219209616G>C	ENST00000273077.4	+	10	1121	c.1070G>C	c.(1069-1071)gGg>gCg	p.G357A	AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000258362.3_Missense_Mutation_p.G333A|PNKD_ENST00000436005.2_Missense_Mutation_p.G297A	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia	357					glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGGGCCGGGGCCGGGCCCC	0.657																																						dbGAP											0													54.0	66.0	62.0					2																	219209616		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.1070G>C	2.37:g.219209616G>C	ENSP00000273077:p.Gly357Ala		A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	p.G357A	ENST00000273077.4	37	c.1070	CCDS2411.1	2	.	.	.	.	.	.	.	.	.	.	G	8.444	0.851493	0.17034	.	.	ENSG00000127838	ENST00000273077;ENST00000258362;ENST00000436005	D;D;D	0.95412	-3.7;-3.7;-3.7	4.53	2.44	0.29823	.	0.287809	0.33631	N	0.004718	D	0.83321	0.5229	N	0.05124	-0.11	0.22552	N	0.998993	B;B	0.24823	0.112;0.005	B;B	0.17722	0.019;0.004	T	0.71955	-0.4436	10	0.07175	T	0.84	-5.8604	4.4509	0.11619	0.2816:0.0:0.5447:0.1736	.	333;357	Q8N490-3;Q8N490	.;PNKD_HUMAN	A	357;333;297	ENSP00000273077:G357A;ENSP00000258362:G333A;ENSP00000414400:G297A	ENSP00000258362:G333A	G	+	2	0	PNKD	218917860	1.000000	0.71417	0.352000	0.25734	0.833000	0.47200	2.029000	0.41098	0.885000	0.36088	0.313000	0.20887	GGG	PNKD	-	tigrfam_Hydroxyacylglutathione_Hdrlase	ENSG00000127838		0.657	PNKD-001	KNOWN	basic|CCDS	protein_coding	PNKD	HGNC	protein_coding	OTTHUMT00000256775.2	47	0.00	0	G			219209616	219209616	+1	no_errors	ENST00000273077	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	0.606	C
PRDM10	56980	genome.wustl.edu	37	11	129802065	129802065	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:129802065G>A	ENST00000360871.3	-	10	1450	c.1219C>T	c.(1219-1221)Cgt>Tgt	p.R407C	PRDM10_ENST00000528746.1_Missense_Mutation_p.R381C|PRDM10_ENST00000526082.1_Missense_Mutation_p.R321C|PRDM10_ENST00000304538.6_Missense_Mutation_p.R321C|PRDM10_ENST00000358825.5_Missense_Mutation_p.R407C|PRDM10_ENST00000423662.2_Missense_Mutation_p.R321C	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TTTGGAGGACGCCCCGGCCGT	0.577																																						dbGAP											0													126.0	107.0	113.0					11																	129802065		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1219C>T	11.37:g.129802065G>A	ENSP00000354118:p.Arg407Cys		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R407C	ENST00000360871.3	37	c.1219	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	g	22.9	4.349674	0.82132	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.19532	2.14;2.53;2.41;2.15;2.47;2.14;2.54	5.36	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	L	0.32530	0.975	0.80722	D	1	B;D;B;D;B;D;B	0.89917	0.014;1.0;0.025;1.0;0.025;1.0;0.025	B;D;B;D;B;D;B	0.85130	0.005;0.997;0.011;0.993;0.011;0.996;0.011	T	0.06516	-1.0822	10	0.87932	D	0	-21.3694	8.9914	0.36026	0.0756:0.0:0.7778:0.1466	.	321;407;407;407;321;321;321	B7ZL72;Q9NQV6-4;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	C	407;321;407;321;381;321;124	ENSP00000351686:R407C;ENSP00000302669:R321C;ENSP00000354118:R407C;ENSP00000398431:R321C;ENSP00000431262:R381C;ENSP00000432237:R321C;ENSP00000435940:R124C	ENSP00000302669:R321C	R	-	1	0	PRDM10	129307275	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	7.144000	0.77357	1.407000	0.46875	0.586000	0.80456	CGT	PRDM10	-	NULL	ENSG00000170325		0.577	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	72	0.00	0	G	NM_199437		129802065	129802065	-1	no_errors	ENST00000358825	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	1.000	A
PRDX3	10935	genome.wustl.edu	37	10	120928938	120928938	+	Intron	SNP	C	C	T	rs2271362	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr10:120928938C>T	ENST00000298510.2	-	6	594				PRDX3_ENST00000356951.3_Intron|PRDX3_ENST00000494433.1_5'UTR	NM_006793.2	NP_006784.1	P30048	PRDX3_HUMAN	peroxiredoxin 3						cellular response to oxidative stress (GO:0034599)|cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|maternal placenta development (GO:0001893)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of kinase activity (GO:0033673)|peptidyl-cysteine oxidation (GO:0018171)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of mitochondrial membrane potential (GO:0051881)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	alkyl hydroperoxide reductase activity (GO:0008785)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|kinase binding (GO:0019900)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|lung(2)	3		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0245)		GTCTTTAATTCTCCttttaat	0.348													C|||	1582	0.315895	0.3661	0.2161	5008	,	,		19926	0.494		0.2724	False		,,,				2504	0.18				Pancreas(36;562 1096 2447 42526)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D49396	CCDS7611.1	10q25-q26	2010-11-24			ENSG00000165672	ENSG00000165672			9354	protein-coding gene	gene with protein product		604769	"""antioxidant protein 1"""	AOP1		7733872, 9363753	Standard	NM_006793		Approved	MER5, AOP-1, SP-22	uc001lec.3	P30048	OTTHUMG00000019146	ENST00000298510.2:c.552-84G>A	10.37:g.120928938C>T			B2R7Z0|D3DRC9|E9PH29|P35690|Q0D2H1|Q13776|Q5T5V2|Q96HK4	RNA	SNP	-	NULL	ENST00000298510.2	37	NULL	CCDS7611.1	10																																																																																			PRDX3	-	-	ENSG00000165672		0.348	PRDX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX3	HGNC	protein_coding	OTTHUMT00000050639.1	26	0.00	0	C	NM_006793		120928938	120928938	-1	no_errors	ENST00000494433	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.001	T
PRKCZ	5590	genome.wustl.edu	37	1	2103743	2103743	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:2103743G>C	ENST00000400921.2	+	10	1335	c.652G>C	c.(652-654)Ggc>Cgc	p.G218R	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.G218R	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	401					actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	CCCACAGGAAGGCCTGGGCCC	0.642																																						dbGAP											0													65.0	58.0	60.0					1																	2103743		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.652G>C	1.37:g.2103743G>C	ENSP00000383712:p.Gly218Arg		A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_PKC_zeta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.G401R	ENST00000400921.2	37	c.1201	CCDS41229.1	1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834272	0.71373	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000400920	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.21	5.21	0.72293	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74366	0.3707	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.71674	0.977;0.998;0.977;0.977	P;D;P;P	0.70016	0.9;0.967;0.9;0.869	T	0.76564	-0.2913	10	0.87932	D	0	.	16.6546	0.85225	0.0:0.0:1.0:0.0	.	297;225;297;401	E9PCW2;B3KUN5;B7Z2J7;Q05513	.;.;.;KPCZ_HUMAN	R	401;218;297;218	ENSP00000367830:G401R;ENSP00000383712:G218R;ENSP00000426412:G297R;ENSP00000383711:G218R	ENSP00000367830:G401R	G	+	1	0	PRKCZ	2093603	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	8.822000	0.92013	2.599000	0.87857	0.650000	0.86243	GGC	PRKCZ	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_PKC_zeta,pfscan_Prot_kinase_cat_dom	ENSG00000067606		0.642	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	PRKCZ	HGNC	protein_coding	OTTHUMT00000098533.3	47	0.00	0	G	NM_002744		2103743	2103743	+1	no_errors	ENST00000378567	ensembl	human	known	69_37n	missense	22	58.49	31	SNP	1.000	C
PROCR	10544	genome.wustl.edu	37	20	33764193	33764193	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr20:33764193T>G	ENST00000216968.4	+	3	627	c.545T>G	c.(544-546)cTg>cGg	p.L182R	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	182					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	CGGGAATTCCTGGAGGACACC	0.582																																						dbGAP											0													117.0	110.0	112.0					20																	33764193		2203	4300	6503	-	-	-	SO:0001583	missense	0			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.545T>G	20.37:g.33764193T>G	ENSP00000216968:p.Leu182Arg		B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.L182R	ENST00000216968.4	37	c.545	CCDS13248.1	20	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294840	0.81025	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	T	0.01854	4.6	5.62	5.62	0.85841	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.52532	D	0.000067	T	0.13243	0.0321	M	0.83692	2.655	0.47905	D	0.999543	D	0.89917	1.0	D	0.97110	1.0	T	0.00084	-1.2100	10	0.87932	D	0	-2.8729	12.2244	0.54451	0.0:0.0:0.0:1.0	.	182	Q9UNN8	EPCR_HUMAN	R	182	ENSP00000216968:L182R	ENSP00000216968:L182R	L	+	2	0	PROCR	33227854	0.994000	0.37717	1.000000	0.80357	0.995000	0.86356	2.395000	0.44459	2.146000	0.66826	0.460000	0.39030	CTG	PROCR	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000101000		0.582	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROCR	HGNC	protein_coding	OTTHUMT00000078843.3	63	0.00	0	T			33764193	33764193	+1	no_errors	ENST00000216968	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	1.000	G
PTGES2	80142	genome.wustl.edu	37	9	130883327	130883327	+	3'UTR	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:130883327C>T	ENST00000338961.6	-	0	1975				RP11-395P17.3_ENST00000536815.1_RNA|RP11-395P17.3_ENST00000418747.1_RNA|PTGES2_ENST00000483625.1_5'Flank|PTGES2_ENST00000277462.5_3'UTR	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2						cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						CAGAATGATCCTGCCCCCAAC	0.662																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730	ENST00000338961.6:c.*97G>A	9.37:g.130883327C>T			Q53EW9|Q5SYV6|Q96GI0|Q96GL2	RNA	SNP	-	NULL	ENST00000338961.6	37	NULL	CCDS6891.1	9																																																																																			PTGES2	-	-	ENSG00000148334		0.662	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES2	HGNC	protein_coding	OTTHUMT00000054339.1	35	0.00	0	C			130883327	130883327	-1	no_errors	ENST00000476811	ensembl	human	known	69_37n	rna	40	20.00	10	SNP	0.001	T
IPO4	79711	genome.wustl.edu	37	14	24648629	24648629	+	IGR	SNP	G	G	A	rs541776858		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr14:24648629G>A	ENST00000354464.6	-	0	3646				REC8_ENST00000559919.1_Missense_Mutation_p.E426K|REC8_ENST00000311457.3_Missense_Mutation_p.E426K	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		AGCTGAAGAGGAGAAGTCCCG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18099	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													93.0	102.0	99.0					14																	24648629		2019	4178	6197	-	-	-	SO:0001628	intergenic_variant	0			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24648629G>A			B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.E426K	ENST00000354464.6	37	c.1276	CCDS9616.1	14	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953692	0.92660	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.35605	1.3	5.58	5.58	0.84498	.	0.255146	0.37304	N	0.002159	T	0.36496	0.0969	L	0.34521	1.04	0.38158	D	0.938966	P;P	0.49961	0.93;0.884	P;B	0.47915	0.561;0.358	T	0.19549	-1.0302	10	0.44086	T	0.13	-5.8949	15.1379	0.72583	0.0:0.0:1.0:0.0	.	410;427	O95072-2;O95072	.;REC8_HUMAN	K	426;409	ENSP00000308699:E426K	ENSP00000308699:E426K	E	+	1	0	REC8	23718469	1.000000	0.71417	0.996000	0.52242	0.913000	0.54294	4.888000	0.63164	2.641000	0.89580	0.456000	0.33151	GAG	REC8	-	NULL	ENSG00000100918		0.617	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REC8	HGNC	protein_coding	OTTHUMT00000071931.4	47	0.00	0	G	NM_024658		24648629	24648629	+1	no_errors	ENST00000311457	ensembl	human	known	69_37n	missense	24	50.00	24	SNP	1.000	A
RFX5	5993	genome.wustl.edu	37	1	151316744	151316744	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:151316744T>A	ENST00000290524.4	-	8	662	c.484A>T	c.(484-486)Agt>Tgt	p.S162C	RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000368870.2_Missense_Mutation_p.S162C|RFX5_ENST00000452671.2_Missense_Mutation_p.S162C|RFX5_ENST00000452513.2_Missense_Mutation_p.S122C|RP11-126K1.8_ENST00000422153.1_RNA|RP11-126K1.6_ENST00000455503.1_RNA	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	162					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTTATGCCACTGTAGCAATAT	0.493																																						dbGAP											0													105.0	99.0	101.0					1																	151316744		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.484A>T	1.37:g.151316744T>A	ENSP00000290524:p.Ser162Cys		B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.S162C	ENST00000290524.4	37	c.484	CCDS994.1	1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.959176	0.53400	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000436637;ENST00000452671;ENST00000452513;ENST00000392746;ENST00000422595;ENST00000450506;ENST00000458484	D;D;D;D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	5.97	5.97	0.96955	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.125811	0.64402	D	0.000001	D	0.88872	0.6555	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.972;0.99	D	0.88582	0.3137	10	0.41790	T	0.15	-11.9791	15.2848	0.73819	0.0:0.0:0.0:1.0	.	122;162	B7Z848;P48382	.;RFX5_HUMAN	C	162;162;54;162;122;162;162;162;162	ENSP00000290524:S162C;ENSP00000357864:S162C;ENSP00000390769:S54C;ENSP00000389130:S162C;ENSP00000398388:S122C;ENSP00000376502:S162C;ENSP00000399095:S162C;ENSP00000398666:S162C;ENSP00000409187:S162C	ENSP00000290524:S162C	S	-	1	0	RFX5	149583368	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	4.308000	0.59129	2.288000	0.76882	0.533000	0.62120	AGT	RFX5	-	NULL	ENSG00000143390		0.493	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	HGNC	protein_coding	OTTHUMT00000034892.6	42	0.00	0	T	NM_000449		151316744	151316744	-1	no_errors	ENST00000290524	ensembl	human	known	69_37n	missense	54	28.95	22	SNP	1.000	A
RNF145	153830	genome.wustl.edu	37	5	158630600	158630600	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:158630600G>A	ENST00000424310.2	-	2	385	c.26C>T	c.(25-27)gCa>gTa	p.A9V	RNF145_ENST00000274542.2_Missense_Mutation_p.A37V|RNF145_ENST00000519865.1_Missense_Mutation_p.A9V|RNF145_ENST00000520638.1_Missense_Mutation_p.A23V|RNF145_ENST00000521606.2_Missense_Mutation_p.A26V|RNF145_ENST00000518802.1_Missense_Mutation_p.A39V	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	9				A -> V (in Ref. 3; AAH42684). {ECO:0000305}.		integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATTTAACACTGCCTCCAGTTT	0.388																																						dbGAP											0													111.0	102.0	105.0					5																	158630600		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.26C>T	5.37:g.158630600G>A	ENSP00000409064:p.Ala9Val		B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.A37V	ENST00000424310.2	37	c.110	CCDS56390.1	5	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238017	0.58886	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.78003	-1.14;-1.12;-1.12;-1.13;-1.13;-1.14;-1.13	5.76	5.76	0.90799	.	0.093135	0.64402	D	0.000001	T	0.77605	0.4155	N	0.14661	0.345	0.80722	D	1	B;B;B;D;B;D	0.56746	0.023;0.023;0.023;0.977;0.006;0.971	B;B;B;P;B;P	0.59703	0.022;0.022;0.022;0.862;0.009;0.783	T	0.76121	-0.3075	10	0.29301	T	0.29	-13.3153	19.975	0.97300	0.0:0.0:1.0:0.0	.	25;26;23;39;9;37	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;.;RN145_HUMAN;.	V	37;9;9;25;26;39;9;23	ENSP00000274542:A37V;ENSP00000430397:A9V;ENSP00000409064:A9V;ENSP00000430753:A25V;ENSP00000445115:A26V;ENSP00000430955:A39V;ENSP00000429071:A23V	ENSP00000274542:A37V	A	-	2	0	RNF145	158563178	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.414000	0.97362	2.724000	0.93272	0.585000	0.79938	GCA	RNF145	-	NULL	ENSG00000145860		0.388	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1	47	0.00	0	G	NM_144726		158630600	158630600	-1	no_errors	ENST00000274542	ensembl	human	known	69_37n	missense	40	41.10	30	SNP	1.000	A
RNF148	378925	genome.wustl.edu	37	7	122342506	122342506	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:122342506G>T	ENST00000434824.1	-	1	515	c.299C>A	c.(298-300)tCa>tAa	p.S100*	RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	100	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						GGCCAGCCATGAGTCTGCCTG	0.498																																						dbGAP											0													139.0	139.0	139.0					7																	122342506		2049	4200	6249	-	-	-	SO:0001587	stop_gained	0			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.299C>A	7.37:g.122342506G>T	ENSP00000388207:p.Ser100*		A4D0X4|Q8N308	Nonsense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S100*	ENST00000434824.1	37	c.299	CCDS47692.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.256204	0.95336	.	.	ENSG00000235631	ENST00000434824	.	.	.	5.25	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9284	0.70896	0.0:0.1437:0.8562:0.0	.	.	.	.	X	100	.	ENSP00000388207:S100X	S	-	2	0	RNF148	122129742	0.772000	0.28567	0.961000	0.40146	0.811000	0.45836	4.499000	0.60380	2.446000	0.82766	0.555000	0.69702	TCA	RNF148	-	pfam_Protease-assoc_domain	ENSG00000235631		0.498	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF148	HGNC	protein_coding	OTTHUMT00000347424.1	93	0.00	0	G	NM_198085		122342506	122342506	-1	no_errors	ENST00000434824	ensembl	human	known	69_37n	nonsense	136	11.69	18	SNP	0.434	T
RNF214	257160	genome.wustl.edu	37	11	117109606	117109606	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:117109606C>T	ENST00000531452.1	+	3	443	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	RNF214_ENST00000300650.4_Missense_Mutation_p.R133W|RNF214_ENST00000530849.1_Intron|RNF214_ENST00000531287.1_Intron	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	133							zinc ion binding (GO:0008270)	p.R133R(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TCCAGTCACTCGGTCTCTTAA	0.537																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											64.0	67.0	66.0					11																	117109606		1970	4164	6134	-	-	-	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.397C>T	11.37:g.117109606C>T	ENSP00000431643:p.Arg133Trp		B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.R133W	ENST00000531452.1	37	c.397	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207425	0.58343	.	.	ENSG00000167257	ENST00000534428;ENST00000531452;ENST00000300650	T;T	0.39787	1.06;1.06	5.71	5.71	0.89125	.	0.740537	0.12055	N	0.503708	T	0.28566	0.0707	N	0.22421	0.69	0.39641	D	0.970323	P	0.44281	0.831	B	0.31245	0.126	T	0.24440	-1.0160	10	0.46703	T	0.11	-0.5776	15.3634	0.74499	0.0:1.0:0.0:0.0	.	133	Q8ND24	RN214_HUMAN	W	133	ENSP00000431643:R133W;ENSP00000300650:R133W	ENSP00000300650:R133W	R	+	1	2	RNF214	116614816	1.000000	0.71417	0.997000	0.53966	0.818000	0.46254	3.949000	0.56668	2.697000	0.92050	0.591000	0.81541	CGG	RNF214	-	NULL	ENSG00000167257		0.537	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	72	0.00	0	C	NM_001077239		117109606	117109606	+1	no_errors	ENST00000300650	ensembl	human	known	69_37n	missense	79	10.99	10	SNP	0.995	T
RPUSD3	285367	genome.wustl.edu	37	3	9880852	9880852	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:9880852A>T	ENST00000383820.5	-	8	729	c.728T>A	c.(727-729)tTc>tAc	p.F243Y	RPUSD3_ENST00000424438.1_Intron|TTLL3_ENST00000455274.1_Intron|RPUSD3_ENST00000433535.2_Missense_Mutation_p.F228Y|RPUSD3_ENST00000485705.1_5'Flank	NM_173659.3	NP_775930.2	Q6P087	RUSD3_HUMAN	RNA pseudouridylate synthase domain containing 3	243					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			central_nervous_system(2)|endometrium(3)|lung(2)	7	Medulloblastoma(99;0.227)					TTGACTGGAGAACACTGGGCA	0.572																																						dbGAP											0													112.0	86.0	95.0					3																	9880852		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032135	CCDS2586.2, CCDS46744.1	3p25.3	2013-02-11			ENSG00000156990	ENSG00000156990		"""RNA pseudouridylate synthase domain containing"""	28437	protein-coding gene	gene with protein product						12477932	Standard	NM_173659		Approved	MGC29784	uc011atk.2	Q6P087	OTTHUMG00000128441	ENST00000383820.5:c.728T>A	3.37:g.9880852A>T	ENSP00000373331:p.Phe243Tyr		B4DS39|Q6P6A9|Q8N1B2|Q8NAV3	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom	p.F243Y	ENST00000383820.5	37	c.728	CCDS2586.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.22|13.22	2.173088|2.173088	0.38413|0.38413	.|.	.|.	ENSG00000156990|ENSG00000156990	ENST00000433535;ENST00000383820;ENST00000427174|ENST00000423108	T;T|.	0.29142|.	1.58;1.58|.	4.72|4.72	4.72|4.72	0.59763|0.59763	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);|.	0.107090|.	0.64402|.	D|.	0.000005|.	T|T	0.63931|0.63931	0.2553|0.2553	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	B;B|.	0.33940|.	0.433;0.406|.	B;B|.	0.38264|.	0.269;0.146|.	T|T	0.62685|0.62685	-0.6802|-0.6802	10|5	0.18710|.	T|.	0.47|.	.|.	14.023|14.023	0.64568|0.64568	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	228;243|.	Q6P087-2;Q6P087|.	.;RUSD3_HUMAN|.	Y|T	228;243;243|72	ENSP00000398921:F228Y;ENSP00000373331:F243Y|.	ENSP00000373331:F243Y|.	F|S	-|-	2|1	0|0	RPUSD3|RPUSD3	9855852|9855852	1.000000|1.000000	0.71417|0.71417	0.176000|0.176000	0.23000|0.23000	0.083000|0.083000	0.17756|0.17756	5.487000|5.487000	0.66863|0.66863	1.978000|1.978000	0.57642|0.57642	0.459000|0.459000	0.35465|0.35465	TTC|TCT	RPUSD3	-	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom	ENSG00000156990		0.572	RPUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPUSD3	HGNC	protein_coding	OTTHUMT00000250238.1	78	0.00	0	A	NM_173659		9880852	9880852	-1	no_errors	ENST00000383820	ensembl	human	known	69_37n	missense	113	18.12	25	SNP	0.826	T
RYR2	6262	genome.wustl.edu	37	1	237620028	237620028	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:237620028G>T	ENST00000366574.2	+	16	1922	c.1605G>T	c.(1603-1605)gaG>gaT	p.E535D	RYR2_ENST00000542537.1_Missense_Mutation_p.E519D|RYR2_ENST00000360064.6_Missense_Mutation_p.E533D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	535					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCTGTATGAGTTGCTGGGTA	0.443																																						dbGAP											0													166.0	161.0	163.0					1																	237620028		1907	4126	6033	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1605G>T	1.37:g.237620028G>T	ENSP00000355533:p.Glu535Asp		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E533D	ENST00000366574.2	37	c.1599	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360962	0.41801	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95656	-3.77;-3.77;-3.77	4.6	2.71	0.32032	Intracellular calcium-release channel (1);	0.094411	0.42172	U	0.000755	D	0.93969	0.8069	M	0.80982	2.52	0.80722	D	1	P	0.38280	0.625	B	0.37508	0.252	D	0.91059	0.4884	10	0.54805	T	0.06	.	8.4528	0.32882	0.2944:0.0:0.7056:0.0	.	535	Q92736	RYR2_HUMAN	D	535;533;519	ENSP00000355533:E535D;ENSP00000353174:E533D;ENSP00000443798:E519D	ENSP00000353174:E533D	E	+	3	2	RYR2	235686651	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.737000	0.26144	0.469000	0.27268	0.563000	0.77884	GAG	RYR2	-	pfam_Ca-rel_channel	ENSG00000198626		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	24	0.00	0	G	NM_001035		237620028	237620028	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	1.000	T
SCN8A	6334	genome.wustl.edu	37	12	52164368	52164368	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:52164368G>C	ENST00000354534.6	+	19	3724	c.3546G>C	c.(3544-3546)aaG>aaC	p.K1182N	SCN8A_ENST00000545061.1_Missense_Mutation_p.K1182N	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1182					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GGCTAGGCAAGTCTTGGTGGA	0.582																																						dbGAP											0													83.0	88.0	86.0					12																	52164368		2199	4300	6499	-	-	-	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3546G>C	12.37:g.52164368G>C	ENSP00000346534:p.Lys1182Asn		B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.K1182N	ENST00000354534.6	37	c.3546	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936608	0.73442	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.85629	-2.01;-2.01;-2.01	5.17	5.17	0.71159	Sodium ion transport-associated (1);	0.000000	0.85682	D	0.000000	D	0.94122	0.8115	H	0.95611	3.695	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.988	D	0.94839	0.8003	10	0.87932	D	0	.	12.5665	0.56312	0.0757:0.0:0.9243:0.0	.	1182;1182	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	N	1182;1182;1182;1095	ENSP00000346534:K1182N;ENSP00000440360:K1182N;ENSP00000347255:K1182N	ENSP00000346534:K1182N	K	+	3	2	SCN8A	50450635	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	2.036000	0.41165	2.861000	0.98227	0.655000	0.94253	AAG	SCN8A	-	pfam_Na_trans_assoc	ENSG00000196876		0.582	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	73	0.00	0	G	NM_014191		52164368	52164368	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	missense	101	21.09	27	SNP	1.000	C
SELE	6401	genome.wustl.edu	37	1	169700791	169700791	+	Intron	SNP	T	T	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:169700791T>A	ENST00000333360.7	-	4	669				SELE_ENST00000367776.1_Intron|SELE_ENST00000367777.1_Intron|SELE_ENST00000367781.4_Intron|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367775.1_Intron|SELE_ENST00000367779.4_Intron|SELE_ENST00000367782.4_Intron|SELE_ENST00000367774.1_Intron|SELE_ENST00000367780.4_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E						actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	ggtgccaaaataaataactgg	0.413																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.529+184A>T	1.37:g.169700791T>A			A2RRD6|P16111	RNA	SNP	-	NULL	ENST00000333360.7	37	NULL	CCDS1283.1	1																																																																																			SELE	-	-	ENSG00000007908		0.413	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	HGNC	protein_coding	OTTHUMT00000084333.1	8	0.00	0	T	NM_000450		169700791	169700791	-1	no_errors	ENST00000461085	ensembl	human	putative	69_37n	rna	12	25.00	4	SNP	0.000	A
SIGLEC16	400709	genome.wustl.edu	37	19	50474627	50474627	+	RNA	SNP	A	A	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:50474627A>C	ENST00000602139.1	+	0	984							A6NMB1	SIG16_HUMAN	sialic acid binding Ig-like lectin 16 (gene/pseudogene)						cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|lung(6)	10						CGAGCCCTGGACCTCTCTGTG	0.662																																						dbGAP											0																																										-	-	-			0			BC030222		19q13.33	2014-03-20	2008-08-04	2008-08-04	ENSG00000161643	ENSG00000161643		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24851	protein-coding gene	gene with protein product			"""sialic acid binding Ig-like lectin, pseudogene 16"""	SIGLECP16		11986327, 18629938	Standard	NR_002825		Approved	Siglec-P16	uc002prf.3	A6NMB1	OTTHUMG00000183074		19.37:g.50474627A>C				Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D320A	ENST00000602139.1	37	c.959		19	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708505	0.48517	.	.	ENSG00000161643	ENST00000417280;ENST00000456956	.	.	.	1.54	0.452	0.16634	.	1.079610	0.07174	N	0.852842	T	0.35451	0.0932	.	.	.	0.20074	N	0.999932	.	.	.	.	.	.	T	0.39663	-0.9603	6	0.59425	D	0.04	.	3.3776	0.07243	0.7528:0.0:0.2472:0.0	.	.	.	.	A	348;320	.	ENSP00000396157:D348A	D	+	2	0	SIGLEC16	55166439	0.000000	0.05858	0.371000	0.25978	0.525000	0.34531	0.106000	0.15354	0.060000	0.16281	0.164000	0.16699	GAC	SIGLEC16	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000161643		0.662	SIGLEC16-001	KNOWN	basic	processed_transcript	SIGLEC16	HGNC	pseudogene	OTTHUMT00000464979.1	197	0.00	0	A	NR_002825		50474627	50474627	+1	no_errors	ENST00000456956	ensembl	human	known	69_37n	missense	308	13.48	48	SNP	0.427	C
SLC25A32	81034	genome.wustl.edu	37	8	104419955	104419955	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:104419955G>T	ENST00000297578.4	-	2	378	c.212C>A	c.(211-213)aCc>aAc	p.T71N	SLC25A32_ENST00000543107.1_5'UTR	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	71					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TTTCCAAATGGTAGTCAAGCA	0.403																																						dbGAP											0													170.0	169.0	169.0					8																	104419955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.212C>A	8.37:g.104419955G>T	ENSP00000297578:p.Thr71Asn		Q96JZ6|Q96SU7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.T71N	ENST00000297578.4	37	c.212	CCDS6300.1	8	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286185	0.59867	.	.	ENSG00000164933	ENST00000297578;ENST00000424899	T	0.79352	-1.26	6.05	6.05	0.98169	Mitochondrial carrier domain (2);	0.140754	0.64402	D	0.000007	T	0.78323	0.4265	M	0.62723	1.935	0.80722	D	1	B	0.21309	0.054	B	0.27262	0.078	T	0.70974	-0.4726	10	0.23302	T	0.38	-12.1299	20.6013	0.99457	0.0:0.0:1.0:0.0	.	71	Q9H2D1	MFTC_HUMAN	N	71;55	ENSP00000297578:T71N	ENSP00000297578:T71N	T	-	2	0	SLC25A32	104489131	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.348000	0.59379	2.878000	0.98634	0.650000	0.86243	ACC	SLC25A32	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000164933		0.403	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	38	0.00	0	G	NM_030780		104419955	104419955	-1	no_errors	ENST00000297578	ensembl	human	known	69_37n	missense	66	30.53	29	SNP	0.990	T
SLC38A1	81539	genome.wustl.edu	37	12	46662748	46662748	+	5'UTR	DEL	A	A	-			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:46662748delA	ENST00000398637.5	-	0	47				SLC38A1_ENST00000439706.1_5'UTR|SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000546893.1_5'UTR|SLC38A1_ENST00000549049.1_5'UTR|SLC38A1_ENST00000552197.1_5'Flank	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TTTAACGCGGACAGGCCATTC	0.632																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.-648T>-	12.37:g.46662748delA			Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	RNA	DEL	-	NULL	ENST00000398637.5	37	NULL	CCDS41774.1	12																																																																																			SLC38A1	-	-	ENSG00000111371		0.632	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	24	0.00	0	A			46662748	46662748	-1	no_errors	ENST00000549633	ensembl	human	known	69_37n	rna	22	35.29	12	DEL	0.139	-
SLC39A7	7922	genome.wustl.edu	37	6	33169360	33169360	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:33169360G>C	ENST00000374677.3	+	1	711	c.338G>C	c.(337-339)aGc>aCc	p.S113T	RXRB_ENST00000374685.4_5'Flank|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_Missense_Mutation_p.S113T|RXRB_ENST00000374680.3_5'Flank|RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000413614.2_5'Flank	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	113	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CATGAGCATAGCCATGGAGGC	0.547																																						dbGAP											0													76.0	76.0	76.0					6																	33169360		2019	4198	6217	-	-	-	SO:0001583	missense	0			AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.338G>C	6.37:g.33169360G>C	ENSP00000363809:p.Ser113Thr		B0UXF6|Q5STP8|Q9UIQ0	Missense_Mutation	SNP	pfam_ZIP,prints_Kininogen	p.S113T	ENST00000374677.3	37	c.338	CCDS43453.1	6	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891822	0.33442	.	.	ENSG00000112473	ENST00000374675;ENST00000446283;ENST00000374677	T;T	0.60797	0.16;0.16	4.86	3.97	0.46021	.	0.772107	0.12067	N	0.502582	T	0.19005	0.0456	L	0.27053	0.805	0.32247	N	0.571921	P	0.37781	0.608	B	0.27380	0.079	T	0.01218	-1.1415	10	0.14252	T	0.57	-12.4193	9.2441	0.37515	0.1004:0.0:0.8996:0.0	.	113	Q92504	S39A7_HUMAN	T	113;94;113	ENSP00000363807:S113T;ENSP00000363809:S113T	ENSP00000363807:S113T	S	+	2	0	SLC39A7	33277338	0.004000	0.15560	1.000000	0.80357	0.953000	0.61014	0.615000	0.24329	2.559000	0.86315	0.543000	0.68304	AGC	SLC39A7	-	prints_Kininogen	ENSG00000112473		0.547	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A7	HGNC	protein_coding	OTTHUMT00000076499.2	61	0.00	0	G	NM_006979		33169360	33169360	+1	no_errors	ENST00000374675	ensembl	human	known	69_37n	missense	89	10.10	10	SNP	1.000	C
SLCO1B3	28234	genome.wustl.edu	37	12	21036396	21036396	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:21036396C>G	ENST00000381545.3	+	13	1761	c.1542C>G	c.(1540-1542)aaC>aaG	p.N514K	SLCO1B3_ENST00000553473.1_Missense_Mutation_p.N514K|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000540229.1_Missense_Mutation_p.N514K|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.N514K	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	514					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	GTCTCCAGAACAGAAATTACT	0.328																																						dbGAP											0													97.0	97.0	97.0					12																	21036396		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1542C>G	12.37:g.21036396C>G	ENSP00000370956:p.Asn514Lys		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.N514K	ENST00000381545.3	37	c.1542	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	3.648	-0.072122	0.07228	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	3.49	-6.98	0.01611	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.884190	0.09436	N	0.802420	T	0.25306	0.0615	L	0.47016	1.485	0.09310	N	1	B;B;B	0.22003	0.063;0.003;0.003	B;B;B	0.19666	0.026;0.024;0.024	T	0.19778	-1.0295	10	0.37606	T	0.19	.	0.9268	0.01326	0.1949:0.1637:0.309:0.3324	.	514;514;514	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	K	514;514;514;338;514	ENSP00000261196:N514K;ENSP00000370956:N514K;ENSP00000451758:N514K;ENSP00000443225:N338K;ENSP00000441269:N514K	ENSP00000441269:N514K	N	+	3	2	SLCO1B3;RP11-545J16.1	20927663	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.709000	0.01890	-2.111000	0.00836	-2.244000	0.00286	AAC	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.328	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	36	0.00	0	C	NM_019844		21036396	21036396	+1	no_errors	ENST00000553473	ensembl	human	known	69_37n	missense	64	30.43	28	SNP	0.000	G
SMR3B	10879	genome.wustl.edu	37	4	71255410	71255410	+	Missense_Mutation	SNP	C	C	T	rs202025029		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:71255410C>T	ENST00000304915.3	+	3	234	c.85C>T	c.(85-87)Cca>Tca	p.P29S	SMR3B_ENST00000504825.1_Missense_Mutation_p.P29S	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	29	Pro-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				CCCCAGGGGACCATATCCACC	0.488																																						dbGAP											0													78.0	82.0	81.0					4																	71255410		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.85C>T	4.37:g.71255410C>T	ENSP00000302400:p.Pro29Ser		B7ZMG7|Q9UBN0|Q9UCT0	Missense_Mutation	SNP	NULL	p.P29S	ENST00000304915.3	37	c.85	CCDS3540.1	4	.	.	.	.	.	.	.	.	.	.	C	3.682	-0.065243	0.07273	.	.	ENSG00000171201	ENST00000504825;ENST00000304915;ENST00000381030	T;T	0.32515	1.45;1.45	1.14	1.14	0.20703	.	.	.	.	.	T	0.19565	0.0470	.	.	.	0.09310	N	1	B	0.30889	0.299	B	0.24269	0.052	T	0.20672	-1.0268	8	0.87932	D	0	.	5.6367	0.17540	0.0:1.0:0.0:0.0	.	29	P02814	SMR3B_HUMAN	S	29	ENSP00000423138:P29S;ENSP00000302400:P29S	ENSP00000302400:P29S	P	+	1	0	SMR3B	71289999	0.006000	0.16342	0.004000	0.12327	0.193000	0.23685	1.094000	0.30951	0.926000	0.37118	0.205000	0.17691	CCA	SMR3B	-	NULL	ENSG00000171201		0.488	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3B	HGNC	protein_coding	OTTHUMT00000251552.2	58	0.00	0	C	NM_006685		71255410	71255410	+1	no_errors	ENST00000304915	ensembl	human	known	69_37n	missense	62	31.87	29	SNP	0.005	T
SNAPIN	23557	genome.wustl.edu	37	1	153631808	153631808	+	Intron	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr1:153631808T>G	ENST00000368685.5	+	3	280				ILF2_ENST00000480213.1_5'Flank|SNAPIN_ENST00000478558.1_3'UTR	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCTTAAATCTCTAATGGCTG	0.507																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.191-116T>G	1.37:g.153631808T>G			D3DV56|Q5SXU8	RNA	SNP	-	NULL	ENST00000368685.5	37	NULL	CCDS1049.1	1																																																																																			SNAPIN	-	-	ENSG00000143553		0.507	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPIN	HGNC	protein_coding	OTTHUMT00000090036.1	28	0.00	0	T	NM_012437		153631808	153631808	+1	no_errors	ENST00000478558	ensembl	human	known	69_37n	rna	36	34.55	19	SNP	0.001	G
SNTB1	6641	genome.wustl.edu	37	8	121583404	121583404	+	Intron	SNP	C	C	T	rs72680556	byFrequency	TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:121583404C>T	ENST00000395601.3	-	5	1551				SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Intron	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)						muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			AGGCTATGTACGAGGGTAAAT	0.353													C|||	1094	0.21845	0.2973	0.2161	5008	,	,		21331	0.1319		0.174	False		,,,				2504	0.2485					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.1136+3921G>A	8.37:g.121583404C>T			A8K9E0|O14912|Q4KMG8	RNA	SNP	-	NULL	ENST00000395601.3	37	NULL	CCDS6334.1	8																																																																																			SNTB1	-	-	ENSG00000172164		0.353	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTB1	HGNC	protein_coding	OTTHUMT00000381535.1	12	0.00	0	C	NM_021021		121583404	121583404	-1	no_errors	ENST00000519177	ensembl	human	known	69_37n	rna	20	28.57	8	SNP	0.000	T
SNTN	132203	genome.wustl.edu	37	3	63645407	63645407	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:63645407G>A	ENST00000343837.3	+	3	172	c.152G>A	c.(151-153)aGg>aAg	p.R51K	SNTN_ENST00000496807.1_Missense_Mutation_p.R47K	NM_001080537.1	NP_001074006.1	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	51						cilium (GO:0005929)	calcium ion binding (GO:0005509)			endometrium(2)|ovary(1)	3						CTAGCTCTGAGGAAGTGCTCA	0.423																																						dbGAP											0													132.0	131.0	132.0					3																	63645407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126350	CCDS33779.1	3p14.2	2009-03-10	2009-03-10		ENSG00000188817	ENSG00000188817			33706	protein-coding gene	gene with protein product	"""S100A-like protein"""					18829862	Standard	NM_001080537		Approved	FLJ44379, S100AL	uc003dlr.3	A6NMZ2	OTTHUMG00000158766	ENST00000343837.3:c.152G>A	3.37:g.63645407G>A	ENSP00000341442:p.Arg51Lys		B7FF65	Missense_Mutation	SNP	NULL	p.R51K	ENST00000343837.3	37	c.152	CCDS33779.1	3	.	.	.	.	.	.	.	.	.	.	G	0.308	-0.969765	0.02232	.	.	ENSG00000188817	ENST00000343837;ENST00000469440;ENST00000496807	T	0.40225	1.04	5.68	-0.99	0.10238	.	1.430810	0.04023	N	0.300093	T	0.19485	0.0468	N	0.04043	-0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25398	-1.0133	10	0.05721	T	0.95	6.4695	9.7406	0.40416	0.5558:0.0:0.4442:0.0	.	51	A6NMZ2	SNTAN_HUMAN	K	51;51;47	ENSP00000341442:R51K	ENSP00000341442:R51K	R	+	2	0	SNTN	63620447	0.002000	0.14202	0.001000	0.08648	0.543000	0.35085	-0.242000	0.08928	-0.417000	0.07461	-0.469000	0.05056	AGG	SNTN	-	NULL	ENSG00000188817		0.423	SNTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTN	HGNC	protein_coding	OTTHUMT00000352094.1	9	0.00	0	G	NM_001080537		63645407	63645407	+1	no_errors	ENST00000343837	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.034	A
MTCL1	23255	genome.wustl.edu	37	18	8796256	8796256	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr18:8796256G>C	ENST00000306329.11	+	7	2994	c.2994G>C	c.(2992-2994)ttG>ttC	p.L998F	SOGA2_ENST00000359865.3_Missense_Mutation_p.L679F|SOGA2_ENST00000400050.3_Missense_Mutation_p.L638F|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000517570.1_Missense_Mutation_p.L638F|SOGA2_ENST00000518815.1_5'UTR																							TCTATGCCTTGAGGTGGAAAG	0.507																																						dbGAP											0													130.0	118.0	122.0					18																	8796256		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000306329.11:c.2994G>C	18.37:g.8796256G>C	ENSP00000305027:p.Leu998Phe			Missense_Mutation	SNP	pfam_DUF3166	p.L679F	ENST00000306329.11	37	c.2037		18	.	.	.	.	.	.	.	.	.	.	G	12.23	1.876467	0.33162	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.47177	0.85;0.85;0.85	5.76	3.95	0.45737	.	0.000000	0.41712	D	0.000832	T	0.59851	0.2224	L	0.53249	1.67	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.982	T	0.61510	-0.7048	10	0.72032	D	0.01	-15.33	8.4942	0.33119	0.2852:0.0:0.7148:0.0	.	989;679	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	F	700;638;679;638	ENSP00000429556:L638F;ENSP00000352927:L679F;ENSP00000382924:L638F	ENSP00000305027:L700F	L	+	3	2	CCDC165	8786256	0.973000	0.33851	0.720000	0.30636	0.995000	0.86356	1.143000	0.31553	1.413000	0.46997	0.655000	0.94253	TTG	SOGA2	-	NULL	ENSG00000168502		0.507	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	27	0.00	0	G			8796256	8796256	+1	no_errors	ENST00000359865	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	0.970	C
SPATA2	9825	genome.wustl.edu	37	20	48523167	48523167	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr20:48523167C>G	ENST00000422556.1	-	3	901	c.552G>C	c.(550-552)aaG>aaC	p.K184N	SPATA2_ENST00000543716.1_Missense_Mutation_p.K47N|SPATA2_ENST00000289431.5_Missense_Mutation_p.K184N	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	184					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			AGCCCTTGTCCTTCACTTGTG	0.602																																						dbGAP											0													63.0	58.0	60.0					20																	48523167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.552G>C	20.37:g.48523167C>G	ENSP00000416799:p.Lys184Asn		E1P626|O94857	Missense_Mutation	SNP	NULL	p.K184N	ENST00000422556.1	37	c.552	CCDS13422.1	20	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875419	0.51695	.	.	ENSG00000158480	ENST00000289431;ENST00000422556;ENST00000543716	T;T;T	0.66460	-0.21;-0.21;-0.21	5.08	5.08	0.68730	.	0.062014	0.64402	D	0.000009	T	0.76941	0.4058	L	0.57536	1.79	0.46725	D	0.999178	D	0.89917	1.0	D	0.91635	0.999	T	0.76189	-0.3050	10	0.46703	T	0.11	-60.0985	11.6834	0.51472	0.0:0.8741:0.0:0.1259	.	184	Q9UM82	SPAT2_HUMAN	N	184;184;47	ENSP00000289431:K184N;ENSP00000416799:K184N;ENSP00000438855:K47N	ENSP00000289431:K184N	K	-	3	2	SPATA2	47956574	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	1.101000	0.31037	2.632000	0.89209	0.591000	0.81541	AAG	SPATA2	-	NULL	ENSG00000158480		0.602	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA2	HGNC	protein_coding	OTTHUMT00000079658.1	34	0.00	0	C	NM_006038		48523167	48523167	-1	no_errors	ENST00000289431	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	G
SQSTM1	8878	genome.wustl.edu	37	5	179260248	179260248	+	Splice_Site	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:179260248C>G	ENST00000389805.4	+	6	1147		c.e6+2		SQSTM1_ENST00000360718.5_Splice_Site|SQSTM1_ENST00000510187.1_Intron|SQSTM1_ENST00000402874.3_Splice_Site|SQSTM1_ENST00000376929.3_Splice_Site	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1						apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCCTGAGGCAAGCCTGTGC	0.657																																						dbGAP											0													8.0	8.0	8.0					5																	179260248		2178	4266	6444	-	-	-	SO:0001630	splice_region_variant	0			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.969+2C>G	5.37:g.179260248C>G			A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Splice_Site	SNP	-	e6+2	ENST00000389805.4	37	c.969+2	CCDS34317.1	5	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301464	0.23736	.	.	ENSG00000161011	ENST00000376929;ENST00000389805;ENST00000454378;ENST00000402874;ENST00000360718	.	.	.	4.16	0.503	0.16940	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.3573	0.00359	0.1834:0.2636:0.2135:0.3396	.	.	.	.	.	-1	.	.	.	+	.	.	SQSTM1	179192854	1.000000	0.71417	0.953000	0.39169	0.060000	0.15804	0.863000	0.27913	0.305000	0.22832	0.491000	0.48974	.	SQSTM1	-	-	ENSG00000161011		0.657	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQSTM1	HGNC	protein_coding	OTTHUMT00000319344.1	13	0.00	0	C		Intron	179260248	179260248	+1	no_errors	ENST00000389805	ensembl	human	known	69_37n	splice_site	9	40.00	6	SNP	0.965	G
SULF1	23213	genome.wustl.edu	37	8	70571438	70571438	+	3'UTR	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:70571438G>C	ENST00000260128.4	+	0	4001				SULF1_ENST00000419716.3_3'UTR|SULF1_ENST00000402687.4_3'UTR|SULF1_ENST00000458141.2_3'UTR|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1						apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GGCCACCGCAGAACACCGAAG	0.478																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.*668G>C	8.37:g.70571438G>C			Q86YV8|Q8NCA2|Q9UPS5	RNA	SNP	-	NULL	ENST00000260128.4	37	NULL	CCDS6204.1	8																																																																																			SULF1	-	-	ENSG00000137573		0.478	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	25	0.00	0	G	NM_015170		70571438	70571438	+1	no_errors	ENST00000521946	ensembl	human	known	69_37n	rna	37	27.45	14	SNP	0.000	C
SYN1	6853	genome.wustl.edu	37	X	47432351	47432351	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:47432351G>T	ENST00000295987.7	-	13	2154	c.2030C>A	c.(2029-2031)cCg>cAg	p.P677Q	SYN1_ENST00000340666.4_Silent_p.P664P	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	677	E.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GGGCCTGGGCGGGGCTGGCTC	0.602																																						dbGAP											0													84.0	76.0	79.0					X																	47432351		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.2030C>A	X.37:g.47432351G>T	ENSP00000295987:p.Pro677Gln		B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	pfam_Synapsin_ATP-bd_dom,pfam_Synapsin_pre-ATP-grasp_dom,pfam_Synapsin_P_site,pfam_ATP-grasp_RimK-type,superfamily_PreATP-grasp_fold,prints_Synapsin	p.P677Q	ENST00000295987.7	37	c.2030	CCDS14280.1	X	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578236	0.45902	.	.	ENSG00000008056	ENST00000295987	T	0.21932	1.98	4.78	4.78	0.61160	.	0.767173	0.11410	N	0.566861	T	0.34890	0.0913	.	.	.	0.80722	D	1	D	0.61697	0.99	P	0.52267	0.694	T	0.05468	-1.0883	9	0.48119	T	0.1	-7.989	14.6082	0.68495	0.0:0.0:1.0:0.0	.	677	P17600	SYN1_HUMAN	Q	677	ENSP00000295987:P677Q	ENSP00000295987:P677Q	P	-	2	0	SYN1	47317295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.598000	0.46223	2.118000	0.64928	0.538000	0.68166	CCG	SYN1	-	NULL	ENSG00000008056		0.602	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYN1	HGNC	protein_coding	OTTHUMT00000056445.1	104	0.00	0	G	NM_006950		47432351	47432351	-1	no_errors	ENST00000295987	ensembl	human	known	69_37n	missense	89	25.83	31	SNP	1.000	T
SYTL3	94120	genome.wustl.edu	37	6	159084348	159084348	+	Silent	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:159084348G>A	ENST00000297239.9	+	3	242	c.48G>A	c.(46-48)gaG>gaA	p.E16E	SYTL3_ENST00000360448.3_Silent_p.E16E|SYTL3_ENST00000367081.3_5'UTR			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	16	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TAGAACGCGAGGCCATTCTCC	0.537																																						dbGAP											0													87.0	74.0	79.0					6																	159084348		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.48G>A	6.37:g.159084348G>A			Q496J4|Q496J6|Q5U3B9	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain	p.E16	ENST00000297239.9	37	c.48	CCDS56458.1	6																																																																																			SYTL3	-	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000164674		0.537	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	HGNC	protein_coding	OTTHUMT00000042876.1	44	0.00	0	G			159084348	159084348	+1	no_errors	ENST00000297239	ensembl	human	known	69_37n	silent	41	37.88	25	SNP	0.005	A
TASP1	55617	genome.wustl.edu	37	20	13605842	13605842	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr20:13605842G>A	ENST00000337743.4	-	3	323	c.203C>T	c.(202-204)gCt>gTt	p.A68V	TASP1_ENST00000544472.1_Missense_Mutation_p.A68V|TASP1_ENST00000539805.1_Missense_Mutation_p.A68V|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	68					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CTTCTGACAAGCTCGTTTGCA	0.318																																						dbGAP											0													157.0	129.0	138.0					20																	13605842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.203C>T	20.37:g.13605842G>A	ENSP00000338624:p.Ala68Val		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	pfam_Peptidase_T2	p.A68V	ENST00000337743.4	37	c.203	CCDS13116.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.901543|4.901543	0.92035|0.92035	.|.	.|.	ENSG00000089123|ENSG00000089123	ENST00000539805;ENST00000378157;ENST00000337743;ENST00000455532;ENST00000544472|ENST00000434275	D;D|.	0.93811|.	-2.4;-3.29|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75503|0.75503	0.3858|0.3858	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.996;0.999;0.991|.	D;D;D|.	0.73380|.	0.98;0.974;0.971|.	T|T	0.73338|0.73338	-0.4014|-0.4014	10|5	0.51188|.	T|.	0.08|.	-11.3675|-11.3675	19.5522|19.5522	0.95324|0.95324	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	68;68;68|.	B7Z963;Q9H6P5;Q5JWM4|.	.;TASP1_HUMAN;.|.	V|F	68|46	ENSP00000338624:A68V;ENSP00000400580:A68V|.	ENSP00000338624:A68V|.	A|L	-|-	2|1	0|0	TASP1|TASP1	13553842|13553842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.340000|8.340000	0.90044|0.90044	2.639000|2.639000	0.89480|0.89480	0.650000|0.650000	0.86243|0.86243	GCT|CTT	TASP1	-	pfam_Peptidase_T2	ENSG00000089123		0.318	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	62	0.00	0	G	NM_017714		13605842	13605842	-1	no_errors	ENST00000337743	ensembl	human	known	69_37n	missense	87	29.60	37	SNP	1.000	A
TCEB3C	162699	genome.wustl.edu	37	18	44554806	44554806	+	Missense_Mutation	SNP	C	C	G	rs200799485		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr18:44554806C>G	ENST00000330682.2	-	1	1643	c.1408G>C	c.(1408-1410)Gca>Cca	p.A470P	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron	NM_145653.3	NP_663628.2	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide 3C (elongin A3)	470					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(16)|skin(2)	30						GCGGCTCCTGCAGACTTCTCT	0.622																																						dbGAP											0													2.0	2.0	2.0					18																	44554806		429	1013	1442	-	-	-	SO:0001583	missense	0			AB076840	CCDS11931.1	18q21.1	2008-08-13			ENSG00000183791	ENSG00000183791			24617	protein-coding gene	gene with protein product	"""elongin A3"""					11932239, 11994304	Standard	NM_145653		Approved	HsT829, TCEB3L2	uc010xdb.2	Q8NG57	OTTHUMG00000132651	ENST00000330682.2:c.1408G>C	18.37:g.44554806C>G	ENSP00000328232:p.Ala470Pro			Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.A470P	ENST00000330682.2	37	c.1408	CCDS11931.1	18	.	.	.	.	.	.	.	.	.	.	c	13.45	2.239417	0.39598	.	.	ENSG00000183791	ENST00000330682	T	0.12255	2.7	1.37	1.37	0.22104	.	0.328640	0.21328	U	0.076354	T	0.07683	0.0193	N	0.22421	0.69	0.09310	N	1	D	0.59357	0.985	B	0.40659	0.336	T	0.27640	-1.0068	10	0.52906	T	0.07	-0.157	6.2213	0.20683	0.0:1.0:0.0:0.0	.	470	Q8NG57	ELOA3_HUMAN	P	470	ENSP00000328232:A470P	ENSP00000328232:A470P	A	-	1	0	TCEB3C	42808804	0.016000	0.18221	0.002000	0.10522	0.009000	0.06853	1.060000	0.30530	1.095000	0.41419	0.485000	0.47835	GCA	TCEB3C	-	NULL	ENSG00000183791		0.622	TCEB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3C	HGNC	protein_coding	OTTHUMT00000255902.1	31	0.00	0	C	NM_145653		44554806	44554806	-1	no_errors	ENST00000330682	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.004	G
TDRD7	23424	genome.wustl.edu	37	9	100235835	100235835	+	Missense_Mutation	SNP	G	G	T	rs530102296		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:100235835G>T	ENST00000355295.4	+	11	2301	c.2006G>T	c.(2005-2007)tGc>tTc	p.C669F	TDRD7_ENST00000540902.1_Missense_Mutation_p.C18F|TDRD7_ENST00000422139.2_Missense_Mutation_p.C595F	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	669					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				ACACTCTACTGCCAGGTGCCT	0.438																																						dbGAP											0													175.0	157.0	163.0					9																	100235835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2006G>T	9.37:g.100235835G>T	ENSP00000347444:p.Cys669Phe		A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.C669F	ENST00000355295.4	37	c.2006	CCDS6725.1	9	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237942	0.79800	.	.	ENSG00000196116	ENST00000355295;ENST00000422139;ENST00000540902	T;T;T	0.38401	3.02;3.02;1.14	4.27	4.27	0.50696	Maternal tudor protein (1);	0.000000	0.85682	D	0.000000	T	0.59376	0.2189	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.61773	-0.6994	10	0.54805	T	0.06	-14.3383	16.4978	0.84250	0.0:0.0:1.0:0.0	.	18;669	Q8NHU6-3;Q8NHU6	.;TDRD7_HUMAN	F	669;595;18	ENSP00000347444:C669F;ENSP00000413608:C595F;ENSP00000440717:C18F	ENSP00000347444:C669F	C	+	2	0	TDRD7	99275656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.208000	0.95075	2.671000	0.90904	0.650000	0.86243	TGC	TDRD7	-	pfam_Tudor	ENSG00000196116		0.438	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	HGNC	protein_coding	OTTHUMT00000053322.1	78	0.00	0	G	NM_014290		100235835	100235835	+1	no_errors	ENST00000355295	ensembl	human	known	69_37n	missense	53	54.31	63	SNP	1.000	T
TEKT1	83659	genome.wustl.edu	37	17	6704183	6704183	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:6704183T>G	ENST00000338694.2	-	7	1061	c.932A>C	c.(931-933)aAg>aCg	p.K311T	TEKT1_ENST00000535086.1_Missense_Mutation_p.K165T	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	311						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				ATGAGCCACCTTGGCTGGCCC	0.488											OREG0024124	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													189.0	182.0	185.0					17																	6704183		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.932A>C	17.37:g.6704183T>G	ENSP00000341346:p.Lys311Thr	636	D3DTM7	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.K311T	ENST00000338694.2	37	c.932	CCDS11083.1	17	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416231	0.83449	.	.	ENSG00000167858	ENST00000338694;ENST00000535086	T;T	0.03386	3.95;3.95	5.85	5.85	0.93711	.	0.191316	0.53938	D	0.000060	T	0.13586	0.0329	M	0.71581	2.175	0.50467	D	0.999871	B	0.32893	0.389	P	0.48738	0.588	T	0.00518	-1.1693	10	0.52906	T	0.07	.	14.4944	0.67674	0.0:0.0:0.0:1.0	.	311	Q969V4	TEKT1_HUMAN	T	311;165	ENSP00000341346:K311T;ENSP00000444142:K165T	ENSP00000341346:K311T	K	-	2	0	TEKT1	6644907	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	5.675000	0.68123	2.371000	0.80710	0.533000	0.62120	AAG	TEKT1	-	pfam_Tektin,prints_Tektin	ENSG00000167858		0.488	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT1	HGNC	protein_coding	OTTHUMT00000219867.2	97	0.00	0	T	NM_053285		6704183	6704183	-1	no_errors	ENST00000338694	ensembl	human	known	69_37n	missense	44	56.00	56	SNP	1.000	G
TLN1	7094	genome.wustl.edu	37	9	35700198	35700198	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr9:35700198C>T	ENST00000314888.9	-	49	7003	c.6650G>A	c.(6649-6651)cGg>cAg	p.R2217Q	TLN1_ENST00000540444.1_Missense_Mutation_p.R2105Q	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2217					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTTGCAAGCCCGAAGCATATC	0.542																																						dbGAP											0													63.0	62.0	62.0					9																	35700198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6650G>A	9.37:g.35700198C>T	ENSP00000316029:p.Arg2217Gln		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.R2217Q	ENST00000314888.9	37	c.6650	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655015	0.29425	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.67523	-0.26;-0.27	5.58	5.58	0.84498	.	0.186816	0.49305	D	0.000160	T	0.51635	0.1686	L	0.27053	0.805	0.38514	D	0.948551	B	0.14805	0.011	B	0.08055	0.003	T	0.49781	-0.8903	10	0.11794	T	0.64	-22.3985	14.7598	0.69596	0.0:0.8556:0.1444:0.0	.	2217	Q9Y490	TLN1_HUMAN	Q	2217;2105	ENSP00000316029:R2217Q;ENSP00000442981:R2105Q	ENSP00000316029:R2217Q	R	-	2	0	TLN1	35690198	0.092000	0.21681	1.000000	0.80357	0.996000	0.88848	0.560000	0.23500	2.630000	0.89119	0.655000	0.94253	CGG	TLN1	-	NULL	ENSG00000137076		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	66	0.00	0	C	NM_006289		35700198	35700198	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	missense	92	23.33	28	SNP	1.000	T
TMC4	147798	genome.wustl.edu	37	19	54666835	54666835	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:54666835C>A	ENST00000376591.4	-	9	1484	c.1353G>T	c.(1351-1353)caG>caT	p.Q451H	TMC4_ENST00000301187.4_Missense_Mutation_p.Q445H|TMC4_ENST00000416963.1_Missense_Mutation_p.Q33H|TMC4_ENST00000476013.2_5'Flank	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	451					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CACAAGTGATCTGATTCCAGA	0.582																																						dbGAP											0													91.0	83.0	86.0					19																	54666835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.1353G>T	19.37:g.54666835C>A	ENSP00000365776:p.Gln451His		Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	pfam_TMC	p.Q445H	ENST00000376591.4	37	c.1335	CCDS46174.1	19	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848980	0.71603	.	.	ENSG00000167608	ENST00000301187;ENST00000416963;ENST00000376591	T;T;T	0.56103	0.48;0.48;0.48	5.17	1.65	0.23941	.	0.294134	0.38605	N	0.001632	T	0.66557	0.2801	M	0.83012	2.62	0.49213	D	0.999764	P;P;D	0.55800	0.951;0.808;0.973	P;P;P	0.61201	0.694;0.769;0.885	T	0.66846	-0.5820	10	0.56958	D	0.05	-11.4673	7.8015	0.29176	0.131:0.7165:0.0:0.1524	.	451;445;33	Q7Z404;Q7Z404-1;Q7Z404-3	TMC4_HUMAN;.;.	H	445;33;451	ENSP00000301187:Q445H;ENSP00000405023:Q33H;ENSP00000365776:Q451H	ENSP00000301187:Q445H	Q	-	3	2	TMC4	59358647	1.000000	0.71417	0.972000	0.41901	0.888000	0.51559	1.614000	0.36911	0.703000	0.31848	0.556000	0.70494	CAG	TMC4	-	NULL	ENSG00000167608		0.582	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TMC4	HGNC	protein_coding	OTTHUMT00000156164.2	36	0.00	0	C			54666835	54666835	-1	no_errors	ENST00000301187	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	A
MMP19	4327	genome.wustl.edu	37	12	56229140	56229140	+	IGR	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:56229140T>C	ENST00000322569.4	-	0	2229				TMEM198B_ENST00000478241.1_RNA	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	tcatgacaactttgatttccc	0.473																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216		12.37:g.56229140T>C			B4E030|O15278|O95606|Q99580	RNA	SNP	-	NULL	ENST00000322569.4	37	NULL	CCDS8895.1	12																																																																																			TMEM198B	-	-	ENSG00000182796		0.473	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM198B	HGNC	protein_coding	OTTHUMT00000408023.1	30	0.00	0	T	NM_002429		56229140	56229140	+1	no_errors	ENST00000471276	ensembl	human	known	69_37n	rna	21	41.67	15	SNP	0.000	C
TNKS1BP1	85456	genome.wustl.edu	37	11	57080067	57080067	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr11:57080067C>G	ENST00000532437.1	-	4	2406	c.2095G>C	c.(2095-2097)Gca>Cca	p.A699P	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.A699P|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	699	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CCCCGCCTTGCACCGCCACCA	0.617																																						dbGAP											0													51.0	51.0	51.0					11																	57080067		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2095G>C	11.37:g.57080067C>G	ENSP00000437271:p.Ala699Pro		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.A699P	ENST00000532437.1	37	c.2095	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286574	0.23478	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.33865	1.39;1.39	3.17	1.26	0.21427	.	0.743551	0.10962	N	0.614854	T	0.24547	0.0595	N	0.19112	0.55	0.09310	N	1	P	0.47677	0.899	P	0.45099	0.469	T	0.09885	-1.0654	10	0.44086	T	0.13	0.1525	5.3353	0.15955	0.0:0.5236:0.0:0.4764	.	699	Q9C0C2	TB182_HUMAN	P	699	ENSP00000350990:A699P;ENSP00000437271:A699P	ENSP00000350990:A699P	A	-	1	0	TNKS1BP1	56836643	0.000000	0.05858	0.005000	0.12908	0.035000	0.12851	-0.246000	0.08878	0.114000	0.18032	0.455000	0.32223	GCA	TNKS1BP1	-	NULL	ENSG00000149115		0.617	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	34	0.00	0	C	NM_033396		57080067	57080067	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	missense	47	27.69	18	SNP	0.003	G
TP53	7157	genome.wustl.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R342*	ENST00000269305.4	37	c.1024	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	27	0.00	0	G	NM_000546		7574003	7574003	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	17	41.38	12	SNP	0.307	A
TNRC6C	57690	genome.wustl.edu	37	17	76083110	76083110	+	Silent	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:76083110C>A	ENST00000588061.1	+	15	4465	c.3738C>A	c.(3736-3738)ggC>ggA	p.G1246G	TNRC6C_ENST00000588847.1_Silent_p.G1243G|TNRC6C_ENST00000301624.4_Silent_p.G1246G|TNRC6C_ENST00000335749.4_Silent_p.G1243G|TNRC6C_ENST00000544502.1_Silent_p.G1243G|TNRC6C_ENST00000541771.1_Silent_p.G1246G			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1246	Pro-rich.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGACTCCCGGCCTACCTGACC	0.622																																						dbGAP											0													88.0	101.0	97.0					17																	76083110		2145	4250	6395	-	-	-	SO:0001819	synonymous_variant	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3738C>A	17.37:g.76083110C>A			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	pfam_Argonaute_hook_dom,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.G1243	ENST00000588061.1	37	c.3729	CCDS45798.1	17																																																																																			TNRC6C	-	NULL	ENSG00000078687		0.622	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	77	0.00	0	C	NM_018996		76083110	76083110	+1	no_errors	ENST00000335749	ensembl	human	known	69_37n	silent	84	26.32	30	SNP	1.000	A
TPRX1	284355	genome.wustl.edu	37	19	48306017	48306017	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:48306017G>C	ENST00000322175.3	-	2	406	c.251C>G	c.(250-252)gCc>gGc	p.A84G	TPRX1_ENST00000535759.1_Missense_Mutation_p.A181G|TPRX1_ENST00000543508.1_Missense_Mutation_p.A84G	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	84	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GCCCTTCTGGGCTCTGCACCC	0.697																																					Esophageal Squamous(123;175 2281 3051 32395)	dbGAP											0													12.0	14.0	13.0					19																	48306017		2198	4296	6494	-	-	-	SO:0001583	missense	0				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.251C>G	19.37:g.48306017G>C	ENSP00000323455:p.Ala84Gly		A5D8Y3|B2RPL5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A181G	ENST00000322175.3	37	c.542	CCDS33066.1	19	.	.	.	.	.	.	.	.	.	.	-	6.321	0.427256	0.11987	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.92545	-2.61;-3.06	1.79	0.729	0.18266	.	.	.	.	.	D	0.83403	0.5247	N	0.14661	0.345	0.09310	N	1	D	0.58620	0.983	P	0.48598	0.583	T	0.74682	-0.3583	9	0.15499	T	0.54	.	4.2801	0.10829	0.2102:0.0:0.7898:0.0	.	84	Q8N7U7	TPRX1_HUMAN	G	84;181;84	ENSP00000323455:A84G;ENSP00000438832:A181G	ENSP00000323455:A84G	A	-	2	0	TPRX1	52997829	0.011000	0.17503	0.000000	0.03702	0.002000	0.02628	0.063000	0.14410	0.315000	0.23110	0.484000	0.47621	GCC	TPRX1	-	NULL	ENSG00000178928		0.697	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	HGNC	protein_coding	OTTHUMT00000409868.1	101	0.00	0	G	NM_198479		48306017	48306017	-1	no_errors	ENST00000535759	ensembl	human	known	69_37n	missense	89	33.08	44	SNP	0.001	C
TPTE2	93492	genome.wustl.edu	37	13	20049728	20049728	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr13:20049728G>T	ENST00000400230.2	-	5	259	c.215C>A	c.(214-216)tCa>tAa	p.S72*	TPTE2_ENST00000382978.1_Nonsense_Mutation_p.S72*|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000382977.4_Nonsense_Mutation_p.S72*|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382975.4_Nonsense_Mutation_p.S72*			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	72					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S72*(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TGCAAAGGATGATACAATTGA	0.338																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											29.0	30.0	30.0					13																	20049728		2201	4294	6495	-	-	-	SO:0001587	stop_gained	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.215C>A	13.37:g.20049728G>T	ENSP00000383089:p.Ser72*		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Nonsense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S72*	ENST00000400230.2	37	c.215	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	g	19.90	3.913320	0.72983	.	.	ENSG00000132958	ENST00000382978;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000343548	.	.	.	2.29	2.29	0.28610	.	0.376195	0.24717	U	0.036161	.	.	.	.	.	.	0.21184	N	0.999763	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.2474	8.1387	0.31069	0.0:0.0:1.0:0.0	.	.	.	.	X	72	.	.	S	-	2	0	TPTE2	18947728	0.901000	0.30685	0.054000	0.19295	0.169000	0.22640	1.547000	0.36190	1.590000	0.49995	0.467000	0.42956	TCA	TPTE2	-	NULL	ENSG00000132958		0.338	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		48	0.00	0	G	NM_199254		20049728	20049728	-1	no_errors	ENST00000382977	ensembl	human	known	69_37n	nonsense	51	31.08	23	SNP	0.067	T
TRIP6	7205	genome.wustl.edu	37	7	100470343	100470343	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr7:100470343C>T	ENST00000200457.4	+	8	1636	c.1276C>T	c.(1276-1278)Cac>Tac	p.H426Y	SRRT_ENST00000432932.1_5'Flank|SRRT_ENST00000457580.2_5'Flank|SRRT_ENST00000388793.4_5'Flank|SRRT_ENST00000347433.4_5'Flank	NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	426	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					TCGAAGTTTTCACATTGGCTG	0.572																																						dbGAP											0													124.0	95.0	105.0					7																	100470343		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.1276C>T	7.37:g.100470343C>T	ENSP00000200457:p.His426Tyr		A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.H426Y	ENST00000200457.4	37	c.1276	CCDS5708.1	7	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728006	0.89390	.	.	ENSG00000087077	ENST00000200457	D	0.96365	-3.99	4.61	4.61	0.57282	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.98795	0.9594	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99552	1.0966	10	0.87932	D	0	.	14.9368	0.70964	0.0:1.0:0.0:0.0	.	426	Q15654	TRIP6_HUMAN	Y	426	ENSP00000200457:H426Y	ENSP00000200457:H426Y	H	+	1	0	TRIP6	100308279	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.699000	0.84547	2.092000	0.63282	0.563000	0.77884	CAC	TRIP6	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000087077		0.572	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP6	HGNC	protein_coding	OTTHUMT00000347151.2	52	0.00	0	C	NM_003302		100470343	100470343	+1	no_errors	ENST00000200457	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	1.000	T
TRNT1	51095	genome.wustl.edu	37	3	3189339	3189339	+	Silent	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:3189339A>G	ENST00000251607.6	+	7	1110	c.1008A>G	c.(1006-1008)gcA>gcG	p.A336A	TRNT1_ENST00000280591.6_Silent_p.A316A	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	336					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		TAATTAAAGCAACAGATAGTT	0.323																																						dbGAP											0													50.0	56.0	54.0					3																	3189339		2161	4286	6447	-	-	-	SO:0001819	synonymous_variant	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.1008A>G	3.37:g.3189339A>G			A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Silent	SNP	pfam_PolA_pol_head_dom	p.A336	ENST00000251607.6	37	c.1008	CCDS2561.2	3																																																																																			TRNT1	-	NULL	ENSG00000072756		0.323	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	HGNC	protein_coding	OTTHUMT00000337616.1	39	0.00	0	A			3189339	3189339	+1	no_errors	ENST00000251607	ensembl	human	known	69_37n	silent	50	18.03	11	SNP	0.015	G
TSC22D1	8848	genome.wustl.edu	37	13	45149669	45149669	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr13:45149669T>G	ENST00000458659.2	-	1	1032	c.542A>C	c.(541-543)cAg>cCg	p.Q181P	TSC22D1_ENST00000460842.1_5'Flank|TSC22D1_ENST00000501704.2_Missense_Mutation_p.Q181P	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	181					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CTCGGCTTCCTGGAAGTTATT	0.527																																						dbGAP											0													63.0	68.0	66.0					13																	45149669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.542A>C	13.37:g.45149669T>G	ENSP00000397435:p.Gln181Pro		B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.Q181P	ENST00000458659.2	37	c.542	CCDS31966.1	13	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276785	0.59758	.	.	ENSG00000102804	ENST00000458659;ENST00000501704	T;T	0.25749	1.78;1.78	4.5	4.5	0.54988	.	0.000000	0.51477	D	0.000093	T	0.26122	0.0637	N	0.08118	0	0.48395	D	0.999641	D;D	0.71674	0.998;0.996	P;P	0.62649	0.905;0.806	T	0.12142	-1.0559	10	0.33141	T	0.24	.	12.7686	0.57408	0.0:0.0:0.0:1.0	.	181;181	B3KRL7;Q15714	.;T22D1_HUMAN	P	181	ENSP00000397435:Q181P;ENSP00000437414:Q181P	ENSP00000397435:Q181P	Q	-	2	0	TSC22D1	44047669	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	7.818000	0.86416	1.881000	0.54492	0.459000	0.35465	CAG	TSC22D1	-	NULL	ENSG00000102804		0.527	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	TSC22D1	HGNC	protein_coding	OTTHUMT00000044743.2	77	0.00	0	T	NM_006022		45149669	45149669	-1	no_errors	ENST00000458659	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	1.000	G
TSSK1B	83942	genome.wustl.edu	37	5	112769590	112769590	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:112769590C>G	ENST00000390666.3	-	1	1138	c.947G>C	c.(946-948)gGa>gCa	p.G316A	CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000510381.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	316					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		CTGTGCCTCTCCCTCAGGCTC	0.612																																						dbGAP											0													42.0	46.0	45.0					5																	112769590		2043	4207	6250	-	-	-	SO:0001583	missense	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.947G>C	5.37:g.112769590C>G	ENSP00000375081:p.Gly316Ala		B2R8D9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G316A	ENST00000390666.3	37	c.947	CCDS4112.1	5	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502666	0.26949	.	.	ENSG00000212122	ENST00000390666	T	0.66995	-0.24	0.9	-0.217	0.13149	.	0.307106	0.17781	U	0.162256	T	0.33498	0.0865	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13255	-1.0516	10	0.09084	T	0.74	.	2.705	0.05159	0.0:0.5618:0.0:0.4381	.	316	Q9BXA7	TSSK1_HUMAN	A	316	ENSP00000375081:G316A	ENSP00000375081:G316A	G	-	2	0	TSSK1B	112797489	0.001000	0.12720	0.673000	0.29887	0.688000	0.40055	0.101000	0.15251	0.308000	0.22923	0.313000	0.20887	GGA	TSSK1B	-	NULL	ENSG00000212122		0.612	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	HGNC	protein_coding	OTTHUMT00000250774.2	40	0.00	0	C	NM_032028		112769590	112769590	-1	no_errors	ENST00000390666	ensembl	human	known	69_37n	missense	54	12.70	8	SNP	0.000	G
TTN	7273	genome.wustl.edu	37	2	179410772	179410772	+	Missense_Mutation	SNP	G	G	A	rs2857280		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:179410772G>A	ENST00000591111.1	-	293	90492	c.90268C>T	c.(90268-90270)Ctt>Ttt	p.L30090F	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L22666F|TTN_ENST00000589042.1_Missense_Mutation_p.L31731F|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L22858F|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L29163F|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L22791F|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30090	Fibronectin type-III 119. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTGCGGAAGGCTCCAGGCT	0.522																																						dbGAP											0													73.0	72.0	73.0					2																	179410772		2011	4167	6178	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.90268C>T	2.37:g.179410772G>A	ENSP00000465570:p.Leu30090Phe		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L29163F	ENST00000591111.1	37	c.87487		2	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632514	0.46944	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.82	4.04	0.47022	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.43743	0.1261	L	0.49778	1.585	0.32166	N	0.582307	B;B;B;B	0.14012	0.002;0.002;0.009;0.002	B;B;B;B	0.12156	0.003;0.003;0.007;0.003	T	0.51679	-0.8675	9	0.87932	D	0	.	4.657	0.12622	0.1385:0.1136:0.6179:0.13	.	22666;22791;22858;30090	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	29163;22666;22858;22791;22663	ENSP00000343764:L29163F;ENSP00000434586:L22666F;ENSP00000340554:L22858F;ENSP00000352154:L22791F	ENSP00000340554:L22858F	L	-	1	0	TTN	179119018	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.427000	0.34881	0.819000	0.34492	-0.253000	0.11424	CTT	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.522	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	41	0.00	0	G	NM_133378		179410772	179410772	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	60	27.71	23	SNP	0.998	A
UBXN7	26043	genome.wustl.edu	37	3	196088786	196088786	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr3:196088786C>G	ENST00000296328.4	-	10	1311	c.1237G>C	c.(1237-1239)Gca>Cca	p.A413P	UBXN7_ENST00000535858.1_Missense_Mutation_p.A265P|UBXN7_ENST00000428095.1_Missense_Mutation_p.A251P	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	413	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.					Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						ATCAGCTGTGCTTTTGGTCCT	0.363																																						dbGAP											0													138.0	118.0	124.0					3																	196088786		1850	4093	5943	-	-	-	SO:0001583	missense	0			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.1237G>C	3.37:g.196088786C>G	ENSP00000296328:p.Ala413Pro		D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pirsf_UCP037991_UAS/UBX,pfscan_UBX	p.A413P	ENST00000296328.4	37	c.1237	CCDS43191.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367700	0.82463	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	.	.	.	5.39	5.39	0.77823	UBX (3);	0.000000	0.85682	D	0.000000	T	0.78578	0.4305	M	0.71036	2.16	0.80722	D	1	D	0.65815	0.995	D	0.66196	0.942	T	0.79579	-0.1745	9	0.62326	D	0.03	-15.0946	19.5187	0.95176	0.0:1.0:0.0:0.0	.	413	O94888	UBXN7_HUMAN	P	413;251;265	.	ENSP00000296328:A413P	A	-	1	0	UBXN7	197573183	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.254000	0.58798	2.699000	0.92147	0.655000	0.94253	GCA	UBXN7	-	pfam_UBX,smart_UBX,pirsf_UCP037991_UAS/UBX,pfscan_UBX	ENSG00000163960		0.363	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN7	HGNC	protein_coding	OTTHUMT00000340938.2	41	0.00	0	C	XM_087353		196088786	196088786	-1	no_errors	ENST00000296328	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	1.000	G
UGT2B4	7363	genome.wustl.edu	37	4	70351053	70351053	+	Silent	SNP	A	A	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr4:70351053A>G	ENST00000305107.6	-	5	1229	c.1183T>C	c.(1183-1185)Ttg>Ctg	p.L395L	UGT2B4_ENST00000381096.3_Silent_p.L259L|UGT2B4_ENST00000506580.1_Intron|UGT2B4_ENST00000512583.1_Intron	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	395					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	TCTGCAAACAATGGAACGCCC	0.458																																						dbGAP											0													180.0	174.0	176.0					4																	70351053		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1183T>C	4.37:g.70351053A>G			A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L395	ENST00000305107.6	37	c.1183	CCDS43234.1	4																																																																																			UGT2B4	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000156096		0.458	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	HGNC	protein_coding	OTTHUMT00000365526.1	129	0.00	0	A	NM_021139		70351053	70351053	-1	no_errors	ENST00000305107	ensembl	human	known	69_37n	silent	172	17.70	37	SNP	0.555	G
USP49	25862	genome.wustl.edu	37	6	41764309	41764309	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr6:41764309T>G	ENST00000394253.3	-	7	2358	c.2029A>C	c.(2029-2031)Agc>Cgc	p.S677R	USP49_ENST00000373009.3_Missense_Mutation_p.S677R|USP49_ENST00000373010.1_3'UTR			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	677					histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCATTGTTGCTGGACTGCACC	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.2029A>C	6.37:g.41764309T>G	ENSP00000377797:p.Ser677Arg		Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.S677R	ENST00000394253.3	37	c.2029		6	.	.	.	.	.	.	.	.	.	.	T	14.65	2.600186	0.46423	.	.	ENSG00000164663	ENST00000394253;ENST00000373009	T;T	0.03920	3.76;3.76	5.63	0.567	0.17325	.	0.488567	0.20777	N	0.085863	T	0.01124	0.0037	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47169	-0.9138	7	0.11182	T	0.66	-4.687	5.695	0.17851	0.0:0.2132:0.1328:0.6541	.	.	.	.	R	677	ENSP00000377797:S677R;ENSP00000362100:S677R	ENSP00000362100:S677R	S	-	1	0	USP49	41872287	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.163000	0.31798	0.090000	0.17273	0.528000	0.53228	AGC	USP49	-	NULL	ENSG00000164663		0.448	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	USP49	HGNC	protein_coding	OTTHUMT00000316513.3	74	0.00	0	T	NM_018561		41764309	41764309	-1	no_errors	ENST00000373009	ensembl	human	known	69_37n	missense	108	31.21	49	SNP	0.999	G
VCPIP1	80124	genome.wustl.edu	37	8	67547063	67547063	+	Silent	SNP	A	A	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr8:67547063A>C	ENST00000310421.4	-	3	3600	c.3342T>G	c.(3340-3342)tcT>tcG	p.S1114S		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1114					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CCTGAATAGAAGAAACCATTT	0.448																																					NSCLC(179;265 2915 6144 43644)	dbGAP											0													71.0	72.0	72.0					8																	67547063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3342T>G	8.37:g.67547063A>C			Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Silent	SNP	pfam_OTU,pfscan_OTU	p.S1114	ENST00000310421.4	37	c.3342	CCDS6192.1	8																																																																																			VCPIP1	-	NULL	ENSG00000175073		0.448	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	46	0.00	0	A			67547063	67547063	-1	no_errors	ENST00000310421	ensembl	human	known	69_37n	silent	49	38.75	31	SNP	1.000	C
VIL1	7429	genome.wustl.edu	37	2	219301895	219301895	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:219301895G>A	ENST00000248444.5	+	17	2108	c.2020G>A	c.(2020-2022)Gca>Aca	p.A674T	VIL1_ENST00000392114.2_Missense_Mutation_p.A363T	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	674	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGAAGGCCGCAGCAACCAC	0.582																																						dbGAP											0													133.0	126.0	128.0					2																	219301895		2203	4300	6503	-	-	-	SO:0001583	missense	0			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.2020G>A	2.37:g.219301895G>A	ENSP00000248444:p.Ala674Thr		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.A674T	ENST00000248444.5	37	c.2020	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301186	0.60195	.	.	ENSG00000127831	ENST00000248444;ENST00000392114	T;T	0.61742	0.08;0.08	4.86	3.98	0.46160	Gelsolin domain (1);	0.066964	0.64402	N	0.000019	T	0.67249	0.2873	M	0.81341	2.54	0.80722	D	1	P	0.51791	0.948	P	0.50162	0.633	T	0.73104	-0.4088	10	0.56958	D	0.05	-6.9556	13.4192	0.60987	0.076:0.0:0.924:0.0	.	674	P09327	VILI_HUMAN	T	674;363	ENSP00000248444:A674T;ENSP00000375962:A363T	ENSP00000248444:A674T	A	+	1	0	VIL1	219010139	0.906000	0.30813	0.227000	0.23927	0.213000	0.24496	1.981000	0.40628	1.409000	0.46915	0.655000	0.94253	GCA	VIL1	-	pfam_Gelsolin_dom,smart_Gelsolin,prints_Gelsolin	ENSG00000127831		0.582	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3	52	0.00	0	G	NM_007127		219301895	219301895	+1	no_errors	ENST00000248444	ensembl	human	known	69_37n	missense	46	32.35	22	SNP	0.987	A
WDR13	64743	genome.wustl.edu	37	X	48458724	48458724	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:48458724G>A	ENST00000218056.5	+	5	1046	c.541G>A	c.(541-543)Gcc>Acc	p.A181T	WDR13_ENST00000376729.5_Missense_Mutation_p.A181T	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	181						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GGTGCGCTTCGCCAATGATGA	0.597																																						dbGAP											0													80.0	58.0	65.0					X																	48458724		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.541G>A	X.37:g.48458724G>A	ENSP00000218056:p.Ala181Thr		Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A181T	ENST00000218056.5	37	c.541	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195154	0.78902	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.64803	-0.12;-0.12	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.97110	1.0;0.903	T	0.81154	-0.1062	10	0.66056	D	0.02	-0.8444	14.6671	0.68915	0.0:0.0:1.0:0.0	.	59;181	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	T	181	ENSP00000365919:A181T;ENSP00000218056:A181T	ENSP00000218056:A181T	A	+	1	0	WDR13	48343668	1.000000	0.71417	1.000000	0.80357	0.399000	0.30720	8.630000	0.90987	2.044000	0.60594	0.436000	0.28706	GCC	WDR13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000101940		0.597	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	64	0.00	0	G			48458724	48458724	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	1.000	A
WASH6P	653440	genome.wustl.edu	37	X	155253526	155253526	+	RNA	SNP	A	A	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chrX:155253526A>T	ENST00000461007.1	+	0	2442				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGGCTAGCTCAGGGGTCCAGC	0.587																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155253526A>T			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.587	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	15	0.00	0	A	NG_008380		155253526	155253526	+1	no_errors	ENST00000461007	ensembl	human	known	69_37n	rna	21	25.00	7	SNP	0.005	T
DAW1	164781	genome.wustl.edu	37	2	228777092	228777092	+	Intron	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr2:228777092G>T	ENST00000309931.2	+	10	1056				DAW1_ENST00000545118.1_Intron|DAW1_ENST00000373666.2_Missense_Mutation_p.G366C	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1							cilium (GO:0005929)											TCACGTTCTTGGTAATCATGT	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.973+5124G>T	2.37:g.228777092G>T			Q6ZRY1|Q8N776	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G366C	ENST00000309931.2	37	c.1096	CCDS2470.1	2	.	.	.	.	.	.	.	.	.	.	G	9.353	1.065988	0.20067	.	.	ENSG00000123977	ENST00000373666	T	0.53857	0.6	1.22	-1.11	0.09840	.	.	.	.	.	T	0.47078	0.1426	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47935	-0.9078	6	0.72032	D	0.01	.	5.8596	0.18738	0.0:0.5756:0.4244:0.0	.	.	.	.	C	366	ENSP00000362770:G366C	ENSP00000362770:G366C	G	+	1	0	WDR69	228485336	0.001000	0.12720	0.004000	0.12327	0.067000	0.16453	-0.419000	0.07071	-0.333000	0.08476	0.460000	0.39030	GGT	WDR69	-	NULL	ENSG00000123977		0.502	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR69	HGNC	protein_coding	OTTHUMT00000331745.1	72	0.00	0	G	NM_178821		228777092	228777092	+1	no_errors	ENST00000373666	ensembl	human	novel	69_37n	missense	99	29.79	42	SNP	0.005	T
WSB1	26118	genome.wustl.edu	37	17	25630544	25630544	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:25630544G>C	ENST00000262394.2	+	3	677	c.361G>C	c.(361-363)Gaa>Caa	p.E121Q	WSB1_ENST00000583193.1_Intron|WSB1_ENST00000581185.1_Missense_Mutation_p.E121Q|WSB1_ENST00000579733.1_Intron|WSB1_ENST00000427287.2_Missense_Mutation_p.E90Q|WSB1_ENST00000348811.2_Intron	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	121					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		ATCAGTTCCAGAAAAACAGAG	0.398																																						dbGAP											0													154.0	156.0	155.0					17																	25630544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.361G>C	17.37:g.25630544G>C	ENSP00000262394:p.Glu121Gln		Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SOCS_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_SOCS_C,prints_G-protein_beta_WD-40_rep,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E121Q	ENST00000262394.2	37	c.361	CCDS11220.1	17	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235508	0.79800	.	.	ENSG00000109046	ENST00000262394;ENST00000427287	T;T	0.60424	0.19;0.21	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.48286	D	0.000198	T	0.73249	0.3563	L	0.53249	1.67	0.80722	D	1	D;D;P	0.89917	0.999;1.0;0.489	D;D;B	0.83275	0.996;0.979;0.229	T	0.67983	-0.5529	10	0.35671	T	0.21	-13.7663	19.5548	0.95338	0.0:0.0:1.0:0.0	.	90;121;121	B4DGB8;B4DTL1;Q9Y6I7	.;.;WSB1_HUMAN	Q	121;90	ENSP00000262394:E121Q;ENSP00000416112:E90Q	ENSP00000262394:E121Q	E	+	1	0	WSB1	22654671	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.317000	0.96327	2.854000	0.98071	0.655000	0.94253	GAA	WSB1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000109046		0.398	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSB1	HGNC	protein_coding	OTTHUMT00000255391.4	56	0.00	0	G	NM_015626		25630544	25630544	+1	no_errors	ENST00000262394	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	1.000	C
WNT3	7473	genome.wustl.edu	37	17	44851158	44851158	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr17:44851158C>A	ENST00000225512.5	-	2	360	c.198G>T	c.(196-198)atG>atT	p.M66I		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	66					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			CCACGCTGGGCATGATCTCGA	0.637																																						dbGAP											0													53.0	56.0	55.0					17																	44851158		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.198G>T	17.37:g.44851158C>A	ENSP00000225512:p.Met66Ile		Q2M237|Q9H1J9	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt3	p.M66I	ENST00000225512.5	37	c.198	CCDS11505.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.339758	0.95783	.	.	ENSG00000108379	ENST00000225512	T	0.75367	-0.93	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.82623	0.5077	L	0.53249	1.67	0.80722	D	1	D	0.61080	0.989	D	0.75020	0.985	T	0.81376	-0.0961	10	0.33940	T	0.23	.	17.2057	0.86917	0.0:1.0:0.0:0.0	.	66	P56703	WNT3_HUMAN	I	66	ENSP00000225512:M66I	ENSP00000225512:M66I	M	-	3	0	WNT3	42206321	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.564000	0.82326	2.283000	0.76528	0.462000	0.41574	ATG	WNT3	-	pfam_Wnt,smart_Wnt	ENSG00000108379		0.637	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT3	HGNC	protein_coding	OTTHUMT00000440427.1	65	0.00	0	C	NM_030753		44851158	44851158	-1	no_errors	ENST00000225512	ensembl	human	known	69_37n	missense	36	55.00	44	SNP	1.000	A
ZCCHC8	55596	genome.wustl.edu	37	12	122975062	122975062	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr12:122975062C>G	ENST00000336229.4	-	4	500	c.370G>C	c.(370-372)Gag>Cag	p.E124Q	ZCCHC8_ENST00000543897.1_5'UTR|SNORA9_ENST00000516383.1_RNA|ZCCHC8_ENST00000536306.1_5'UTR	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	124					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TGCTGTTCCTCAAATCTTTTT	0.328																																						dbGAP											0													69.0	64.0	66.0					12																	122975062		1804	4070	5874	-	-	-	SO:0001583	missense	0			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.370G>C	12.37:g.122975062C>G	ENSP00000337313:p.Glu124Gln		Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	pfam_PSP,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_PSP,pfscan_Znf_CCHC	p.E124Q	ENST00000336229.4	37	c.370		12	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671266	0.67814	.	.	ENSG00000033030	ENST00000336229	T	0.47869	0.83	5.83	5.83	0.93111	.	0.106385	0.64402	D	0.000004	T	0.51839	0.1698	M	0.69823	2.125	0.44595	D	0.997562	P	0.43909	0.821	B	0.38842	0.283	T	0.58885	-0.7557	10	0.62326	D	0.03	-28.9611	19.7325	0.96188	0.0:1.0:0.0:0.0	.	124	Q6NZY4	ZCHC8_HUMAN	Q	124	ENSP00000337313:E124Q	ENSP00000337313:E124Q	E	-	1	0	ZCCHC8	121541015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.856000	0.69518	2.763000	0.94921	0.563000	0.77884	GAG	ZCCHC8	-	NULL	ENSG00000033030		0.328	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	HGNC	protein_coding		61	0.00	0	C	NM_017612		122975062	122975062	-1	no_errors	ENST00000336229	ensembl	human	known	69_37n	missense	38	44.93	31	SNP	1.000	G
ZFHX2	85446	genome.wustl.edu	37	14	23995602	23995602	+	Silent	SNP	C	C	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr14:23995602C>T	ENST00000419474.3	-	9	3904	c.3549G>A	c.(3547-3549)aaG>aaA	p.K1183K	RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1183					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GGTCGAGAAACTTGTCCAGGG	0.537																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.3549G>A	14.37:g.23995602C>T			Q9UPU6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.K1183	ENST00000419474.3	37	c.3549	CCDS55907.1	14																																																																																			ZFHX2	-	NULL	ENSG00000136367		0.537	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	49	0.00	0	C	NM_014894		23995602	23995602	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	silent	39	36.07	22	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72821415	72821415	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:72821415G>A	ENST00000268489.5	-	10	11432	c.10760C>T	c.(10759-10761)tCg>tTg	p.S3587L	RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.S2673L	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3587					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGCAGACTGCGAGGTAGATGC	0.612																																						dbGAP											0													245.0	192.0	210.0					16																	72821415		2198	4300	6498	-	-	-	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10760C>T	16.37:g.72821415G>A	ENSP00000268489:p.Ser3587Leu		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S3587L	ENST00000268489.5	37	c.10760	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708850	0.48517	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.38401	1.14;1.14	3.95	3.95	0.45737	.	0.000000	0.43747	D	0.000535	T	0.55130	0.1901	L	0.60455	1.87	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	T	0.62039	-0.6938	10	0.87932	D	0	.	16.36	0.83259	0.0:0.0:1.0:0.0	.	3587	Q15911	ZFHX3_HUMAN	L	3587;2673	ENSP00000268489:S3587L;ENSP00000438926:S2673L	ENSP00000268489:S3587L	S	-	2	0	ZFHX3	71378916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.656000	0.98514	1.914000	0.55421	0.557000	0.71058	TCG	ZFHX3	-	NULL	ENSG00000140836		0.612	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	33	0.00	0	G	NM_006885		72821415	72821415	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	missense	50	33.33	25	SNP	1.000	A
ZNF236	7776	genome.wustl.edu	37	18	74536333	74536333	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr18:74536333T>C	ENST00000253159.8	+	1	218	c.20T>C	c.(19-21)cTg>cCg	p.L7P	ZNF236_ENST00000320610.9_Intron|RP11-162A12.2_ENST00000585258.1_5'Flank	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	7					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		tgtgggctgctggagagatgt	0.493																																						dbGAP											0													150.0	155.0	154.0					18																	74536333		2055	4206	6261	-	-	-	SO:0001583	missense	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.20T>C	18.37:g.74536333T>C	ENSP00000253159:p.Leu7Pro		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L7P	ENST00000253159.8	37	c.20	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	T	0.088	-1.171878	0.01646	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11385	2.78;2.93	0.609	-1.22	0.09494	.	1.858790	0.05327	U	0.527654	T	0.05731	0.0150	N	0.14661	0.345	0.09310	N	1	B	0.22003	0.063	B	0.15052	0.012	T	0.35025	-0.9805	9	0.52906	T	0.07	.	.	.	.	.	7	Q9UL36	ZN236_HUMAN	P	7	ENSP00000253159:L7P;ENSP00000444524:L7P	ENSP00000253159:L7P	L	+	2	0	ZNF236	72665321	0.008000	0.16893	0.001000	0.08648	0.008000	0.06430	-0.578000	0.05841	-2.013000	0.00949	-1.028000	0.02416	CTG	ZNF236	-	NULL	ENSG00000130856		0.493	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	85	0.00	0	T			74536333	74536333	+1	no_errors	ENST00000253159	ensembl	human	known	69_37n	missense	118	12.50	17	SNP	0.001	C
ZNF253	56242	genome.wustl.edu	37	19	20003546	20003546	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:20003546G>T	ENST00000589717.1	+	4	1582	c.1490G>T	c.(1489-1491)aGc>aTc	p.S497I	ZNF253_ENST00000355650.4_Missense_Mutation_p.S421I|CTC-559E9.8_ENST00000585571.1_RNA|AC011477.1_ENST00000578823.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	497					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTTTAATTAGCATAAGATAA	0.338																																						dbGAP											0													53.0	61.0	58.0					19																	20003546		2065	4237	6302	-	-	-	SO:0001583	missense	0			AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1490G>T	19.37:g.20003546G>T	ENSP00000468720:p.Ser497Ile		A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S497I	ENST00000589717.1	37	c.1490	CCDS42532.1	19	.	.	.	.	.	.	.	.	.	.	g	5.012	0.187859	0.09547	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.819	-0.512	0.11966	.	.	.	.	.	T	0.14141	0.0342	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.12156	0.007	T	0.26916	-1.0089	7	.	.	.	.	2.6621	0.05029	0.4716:0.0:0.5284:0.0	.	497	O75346	ZN253_HUMAN	I	497	.	.	S	+	2	0	ZNF253	19864546	0.000000	0.05858	0.162000	0.22713	0.161000	0.22273	-1.560000	0.02160	0.191000	0.20236	0.194000	0.17425	AGC	ZNF253	-	NULL	ENSG00000256771		0.338	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF253	HGNC	protein_coding	OTTHUMT00000460802.1	27	0.00	0	G	NM_021047		20003546	20003546	+1	no_errors	ENST00000589717	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.001	T
ZNF423	23090	genome.wustl.edu	37	16	49672766	49672766	+	Silent	SNP	T	T	C	rs376572236		TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr16:49672766T>C	ENST00000561648.1	-	4	350	c.297A>G	c.(295-297)caA>caG	p.Q99Q	ZNF423_ENST00000562871.1_Silent_p.Q39Q|ZNF423_ENST00000535559.1_5'UTR|ZNF423_ENST00000562520.1_Silent_p.Q39Q|ZNF423_ENST00000262383.2_Silent_p.Q99Q|ZNF423_ENST00000567169.1_5'UTR|ZNF423_ENST00000563137.2_Silent_p.Q39Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	99					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCCAGGAGAGTTGTGGGTCGT	0.587																																						dbGAP											0													50.0	46.0	47.0					16																	49672766		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.297A>G	16.37:g.49672766T>C			O94860|Q76N04|Q9NZ13	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q99	ENST00000561648.1	37	c.297	CCDS32445.1	16																																																																																			ZNF423	-	NULL	ENSG00000102935		0.587	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	29	0.00	0	T	NM_015069		49672766	49672766	-1	no_errors	ENST00000262383	ensembl	human	known	69_37n	silent	21	44.74	17	SNP	0.563	C
ZNF799	90576	genome.wustl.edu	37	19	12502700	12502700	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:12502700C>G	ENST00000430385.3	-	4	712	c.512G>C	c.(511-513)tGt>tCt	p.C171S	ZNF799_ENST00000419318.1_Missense_Mutation_p.C139S|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						ACATTCTTTACAATTATATGG	0.428																																						dbGAP											0													133.0	131.0	132.0					19																	12502700		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.512G>C	19.37:g.12502700C>G	ENSP00000411084:p.Cys171Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C171S	ENST00000430385.3	37	c.512	CCDS45989.1	19	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439949	0.43326	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	D;D	0.85171	-1.95;-1.95	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91998	0.7465	H	0.95917	3.74	0.32523	N	0.536053	D	0.60160	0.987	P	0.55545	0.778	D	0.91538	0.5247	9	0.72032	D	0.01	.	8.5098	0.33211	0.0:1.0:0.0:0.0	.	171	Q96GE5	ZN799_HUMAN	S	139;171	ENSP00000415278:C139S;ENSP00000411084:C171S	ENSP00000415278:C139S	C	-	2	0	ZNF799	12363700	0.991000	0.36638	0.019000	0.16419	0.037000	0.13140	4.171000	0.58236	1.021000	0.39600	0.430000	0.28490	TGT	ZNF799	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196466		0.428	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	104	0.00	0	C	NM_001080821		12502700	12502700	-1	no_errors	ENST00000430385	ensembl	human	known	69_37n	missense	154	21.43	42	SNP	0.662	G
ZNF565	147929	genome.wustl.edu	37	19	36673716	36673716	+	Silent	SNP	G	G	C			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr19:36673716G>C	ENST00000355114.5	-	5	1998	c.1272C>G	c.(1270-1272)gtC>gtG	p.V424V	ZNF565_ENST00000392173.2_Silent_p.V384V|ZNF565_ENST00000304116.5_Silent_p.V384V			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			CGCCAGTATGGACTCTCTGAT	0.468																																						dbGAP											0													138.0	114.0	122.0					19																	36673716		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.1272C>G	19.37:g.36673716G>C			B3KQ35|Q6NUS2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V384	ENST00000355114.5	37	c.1152		19																																																																																			ZNF565	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196357		0.468	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	HGNC	protein_coding	OTTHUMT00000451697.1	55	0.00	0	G	NM_152477		36673716	36673716	-1	no_errors	ENST00000304116	ensembl	human	known	69_37n	silent	68	20.00	17	SNP	0.998	C
ZNF879	345462	genome.wustl.edu	37	5	178459848	178459848	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3Y0-01A-11D-A23C-09	TCGA-A2-A3Y0-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8fbb398-d1da-4444-984a-22c8523625da	46e1fd58-c2ea-46ef-bfc9-26d61e7be608	g.chr5:178459848G>A	ENST00000444149.2	+	5	1087	c.899G>A	c.(898-900)aGt>aAt	p.S300N		NM_001136116.1	NP_001129588.1	B4DU55	ZN879_HUMAN	zinc finger protein 879	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|pancreas(1)|stomach(1)	7						TTTAAAGGTAGTTCATCTCTT	0.413																																						dbGAP											0													49.0	43.0	45.0					5																	178459848		692	1591	2283	-	-	-	SO:0001583	missense	0			AK300504	CCDS47352.1	5q35.3	2013-01-08			ENSG00000234284	ENSG00000234284		"""Zinc fingers, C2H2-type"", ""-"""	37273	protein-coding gene	gene with protein product							Standard	NM_001136116		Approved	DKFZp686E2433	uc003mjt.4	B4DU55	OTTHUMG00000163596	ENST00000444149.2:c.899G>A	5.37:g.178459848G>A	ENSP00000414887:p.Ser300Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S300N	ENST00000444149.2	37	c.899	CCDS47352.1	5	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627580	0.28978	.	.	ENSG00000234284	ENST00000444149	T	0.01172	5.23	4.59	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01353	0.0044	L	0.38175	1.15	0.23769	N	0.996898	B	0.33494	0.414	B	0.27887	0.084	T	0.53954	-0.8365	9	0.19147	T	0.46	-14.4874	15.2822	0.73794	0.0:0.0:1.0:0.0	.	300	B4DU55	ZN879_HUMAN	N	300	ENSP00000414887:S300N	ENSP00000414887:S300N	S	+	2	0	ZNF879	178392454	0.000000	0.05858	0.999000	0.59377	0.428000	0.31595	0.580000	0.23803	2.520000	0.84964	0.591000	0.81541	AGT	ZNF879	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000234284		0.413	ZNF879-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF879	HGNC	protein_coding	OTTHUMT00000374447.1	38	0.00	0	G	NM_001136116		178459848	178459848	+1	no_errors	ENST00000444149	ensembl	human	known	69_37n	missense	60	10.29	7	SNP	0.039	A
