#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS1	9510	genome.wustl.edu	37	21	28210246	28210246	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr21:28210246G>C	ENST00000284984.3	-	9	3010	c.2556C>G	c.(2554-2556)atC>atG	p.I852M		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	852					heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		AAAAAGTGGGGATAGCATTGA	0.438																																						dbGAP											0													98.0	97.0	97.0					21																	28210246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.2556C>G	21.37:g.28210246G>C	ENSP00000284984:p.Ile852Met		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS1,prints_Peptidase_M12B_ADAM-TS	p.I852M	ENST00000284984.3	37	c.2556	CCDS33524.1	21	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382068	0.42207	.	.	ENSG00000154734	ENST00000284984	T	0.61980	0.06	5.55	2.39	0.29439	.	.	.	.	.	T	0.73361	0.3577	M	0.81802	2.56	0.43835	D	0.996416	D	0.63880	0.993	D	0.66351	0.943	T	0.71182	-0.4668	9	0.48119	T	0.1	.	5.8059	0.18440	0.251:0.0:0.6036:0.1453	.	852	Q9UHI8	ATS1_HUMAN	M	852	ENSP00000284984:I852M	ENSP00000284984:I852M	I	-	3	3	ADAMTS1	27132117	1.000000	0.71417	0.995000	0.50966	0.562000	0.35680	0.909000	0.28558	0.814000	0.34374	0.585000	0.79938	ATC	ADAMTS1	-	superfamily_Thrombospondin_1_rpt	ENSG00000154734		0.438	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS1	HGNC	protein_coding	OTTHUMT00000171650.2	97	0.00	0	G			28210246	28210246	-1	no_errors	ENST00000284984	ensembl	human	known	69_37n	missense	65	31.58	30	SNP	0.954	C
ADM	133	genome.wustl.edu	37	11	10327891	10327891	+	Silent	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr11:10327891C>G	ENST00000528655.1	+	3	878	c.261C>G	c.(259-261)gcC>gcG	p.A87A	ADM_ENST00000526492.1_Missense_Mutation_p.R98G|ADM_ENST00000278175.5_Silent_p.A87A|ADM_ENST00000530439.1_Silent_p.A19A|ADM_ENST00000534464.1_Silent_p.A40A|ADM_ENST00000525063.1_Silent_p.A87A|RP11-351I24.1_ENST00000526906.1_RNA			P35318	ADML_HUMAN	adrenomedullin	87					aging (GO:0007568)|androgen metabolic process (GO:0008209)|blood circulation (GO:0008015)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cAMP biosynthetic process (GO:0006171)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|developmental growth (GO:0048589)|female pregnancy (GO:0007565)|G-protein coupled receptor internalization (GO:0002031)|heart development (GO:0007507)|hormone secretion (GO:0046879)|negative regulation of cell proliferation (GO:0008285)|negative regulation of vascular permeability (GO:0043116)|negative regulation of vasoconstriction (GO:0045906)|neural tube closure (GO:0001843)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of vasculogenesis (GO:2001214)|positive regulation of vasodilation (GO:0045909)|progesterone biosynthetic process (GO:0006701)|receptor internalization (GO:0031623)|regulation of the force of heart contraction (GO:0002026)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|spongiotrophoblast layer development (GO:0060712)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(1)	6				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		GTCCGGATGCCGCCCGCATCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			D14874	CCDS7801.1	11p15.4	2013-02-25			ENSG00000148926	ENSG00000148926		"""Endogenous ligands"""	259	protein-coding gene	gene with protein product		103275				7688224	Standard	NM_001124		Approved	AM	uc001mil.1	P35318	OTTHUMG00000165907	ENST00000528655.1:c.261C>G	11.37:g.10327891C>G			B2R793|D3DQV3|Q6FGW2	Missense_Mutation	SNP	pfam_Procalcitonin/adrenomedullin,prints_Adrenomedullin	p.R98G	ENST00000528655.1	37	c.292	CCDS7801.1	11	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490711	0.26686	.	.	ENSG00000148926	ENST00000526492	T	0.37584	1.19	5.58	-6.38	0.01957	.	.	.	.	.	T	0.31575	0.0801	.	.	.	0.29825	N	0.830507	.	.	.	.	.	.	T	0.51020	-0.8758	6	0.87932	D	0	-3.4444	6.1387	0.20247	0.4399:0.2752:0.0:0.2849	.	.	.	.	G	98	ENSP00000434354:R98G	ENSP00000434354:R98G	R	+	1	0	ADM	10284467	0.048000	0.20356	0.007000	0.13788	0.278000	0.26855	-1.068000	0.03447	-0.896000	0.03915	-1.355000	0.01225	CGC	ADM	-	NULL	ENSG00000148926		0.642	ADM-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADM	HGNC	protein_coding	OTTHUMT00000387008.1	82	0.00	0	C	NM_001124		10327891	10327891	+1	no_errors	ENST00000526492	ensembl	human	putative	69_37n	missense	51	12.07	7	SNP	0.001	G
ANKFN1	162282	genome.wustl.edu	37	17	54428239	54428239	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr17:54428239T>G	ENST00000318698.2	+	4	345	c.310T>G	c.(310-312)Tct>Gct	p.S104A	ANKFN1_ENST00000566473.2_Missense_Mutation_p.S104A	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	104										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CAGGAACCTCTCTGAGAAACT	0.458																																						dbGAP											0													78.0	76.0	77.0					17																	54428239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.310T>G	17.37:g.54428239T>G	ENSP00000321627:p.Ser104Ala			Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.S104A	ENST00000318698.2	37	c.310	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	T	28.7	4.939094	0.92526	.	.	ENSG00000153930	ENST00000318698	T	0.26373	1.74	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.48095	0.1481	L	0.59436	1.845	0.50039	D	0.999848	D	0.64830	0.994	D	0.70716	0.97	T	0.44205	-0.9343	10	0.62326	D	0.03	-10.2707	16.2167	0.82231	0.0:0.0:0.0:1.0	.	104	Q8N957	ANKF1_HUMAN	A	104	ENSP00000321627:S104A	ENSP00000321627:S104A	S	+	1	0	ANKFN1	51783238	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	8.040000	0.89188	2.231000	0.72958	0.533000	0.62120	TCT	ANKFN1	-	NULL	ENSG00000153930		0.458	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	31	0.00	0	T	NM_153228		54428239	54428239	+1	no_errors	ENST00000318698	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	G
ANKRD30B	374860	genome.wustl.edu	37	18	14850235	14850235	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr18:14850235G>T	ENST00000358984.4	+	35	3241	c.3061G>T	c.(3061-3063)Gag>Tag	p.E1021*		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1021										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TCAAGAAGAAGAGAAGAGAAG	0.299																																						dbGAP											0													33.0	28.0	30.0					18																	14850235		691	1573	2264	-	-	-	SO:0001587	stop_gained	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3061G>T	18.37:g.14850235G>T	ENSP00000351875:p.Glu1021*		B4DGP1|F8WAG3|Q4G175	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1021*	ENST00000358984.4	37	c.3061	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	36	5.859599	0.97036	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	.	.	.	1.48	1.48	0.22813	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	8.9515	0.35792	0.0:0.0:1.0:0.0	.	.	.	.	X	1021;415;441	.	ENSP00000277669:E441X	E	+	1	0	ANKRD30B	14840235	1.000000	0.71417	0.693000	0.30195	0.179000	0.23085	3.413000	0.52686	1.139000	0.42245	0.173000	0.16961	GAG	ANKRD30B	-	NULL	ENSG00000180777		0.299	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	48	0.00	0	G	NM_001145029		14850235	14850235	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	nonsense	30	16.67	6	SNP	0.996	T
ANKRD30B	374860	genome.wustl.edu	37	18	14850242	14850242	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr18:14850242G>T	ENST00000358984.4	+	35	3248	c.3068G>T	c.(3067-3069)aGa>aTa	p.R1023I		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1023										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GAAGAGAAGAGAAGAAATGTC	0.289																																						dbGAP											0													41.0	35.0	37.0					18																	14850242		691	1574	2265	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3068G>T	18.37:g.14850242G>T	ENSP00000351875:p.Arg1023Ile		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R1023I	ENST00000358984.4	37	c.3068	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277929	0.23307	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.19105	2.17	1.48	1.48	0.22813	.	.	.	.	.	T	0.41305	0.1153	M	0.77103	2.36	0.80722	D	1	D;D	0.64830	0.994;0.991	D;D	0.68039	0.937;0.955	T	0.41431	-0.9509	9	0.87932	D	0	.	8.9515	0.35792	0.0:0.0:1.0:0.0	.	1108;1023	Q9BXX2;F8WAG3	AN30B_HUMAN;.	I	1023;417;443	ENSP00000351875:R1023I	ENSP00000277669:R443I	R	+	2	0	ANKRD30B	14840242	1.000000	0.71417	0.530000	0.27963	0.129000	0.20672	1.781000	0.38644	1.139000	0.42245	0.173000	0.16961	AGA	ANKRD30B	-	NULL	ENSG00000180777		0.289	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	50	0.00	0	G	NM_001145029		14850242	14850242	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.999	T
ARGLU1	55082	genome.wustl.edu	37	13	107210040	107210040	+	Intron	SNP	A	A	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr13:107210040A>T	ENST00000400198.3	-	3	818				ARGLU1_ENST00000472226.1_5'UTR|ARGLU1_ENST00000375926.1_Intron	NM_018011.3	NP_060481.3	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(5)|pancreas(1)	7	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AACAACATACAAGGAAGGCTG	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC071587	CCDS41906.1	13q33.3	2011-10-03	2007-11-28		ENSG00000134884	ENSG00000134884			25482	protein-coding gene	gene with protein product		614046				21454576	Standard	NM_018011		Approved	FLJ10154	uc001vqk.4	Q9NWB6	OTTHUMG00000017321	ENST00000400198.3:c.574-561T>A	13.37:g.107210040A>T			B4E0Y3|Q5T257|Q6IQ34	RNA	SNP	-	NULL	ENST00000400198.3	37	NULL	CCDS41906.1	13																																																																																			ARGLU1	-	-	ENSG00000134884		0.373	ARGLU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGLU1	HGNC	protein_coding	OTTHUMT00000045727.1	23	0.00	0	A	NM_018011		107210040	107210040	-1	no_errors	ENST00000472226	ensembl	human	known	69_37n	rna	12	40.00	8	SNP	1.000	T
ARHGEF28	64283	genome.wustl.edu	37	5	73190346	73190346	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr5:73190346G>A	ENST00000426542.2	+	28	3807	c.3787G>A	c.(3787-3789)Gac>Aac	p.D1263N	ARHGEF28_ENST00000512883.1_Missense_Mutation_p.D227N|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.D950N|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.D1263N|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.D1263N|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.D1263N|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.D1263N|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.D1263N			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1263					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TATTAAACCTGACCCAGGCGA	0.507																																						dbGAP											0													60.0	58.0	59.0					5																	73190346		1901	4132	6033	-	-	-	SO:0001583	missense	0				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.3787G>A	5.37:g.73190346G>A	ENSP00000412175:p.Asp1263Asn		B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.D1263N	ENST00000426542.2	37	c.3787	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765166	0.69878	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T;T	0.32515	3.0;3.0;2.99;2.82;3.0;2.99;2.83;1.45	5.88	5.88	0.94601	.	0.000000	0.34245	U	0.004131	T	0.51261	0.1664	L	0.53780	1.695	0.33296	D	0.564239	D;D;P;D;P	0.89917	0.999;0.974;0.614;1.0;0.733	D;P;P;D;P	0.76575	0.962;0.841;0.572;0.988;0.754	T	0.49082	-0.8976	10	0.16420	T	0.52	.	20.2251	0.98340	0.0:0.0:1.0:0.0	.	950;1263;1263;227;1263	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	N	1263;1263;1263;1263;1263;1263;950;227	ENSP00000296794:D1263N;ENSP00000441913:D1263N;ENSP00000441436:D1263N;ENSP00000287898:D1263N;ENSP00000411459:D1263N;ENSP00000412175:D1263N;ENSP00000296799:D950N;ENSP00000421081:D227N	ENSP00000287898:D1263N	D	+	1	0	RP11-428C6.1	73226102	1.000000	0.71417	0.952000	0.39060	0.650000	0.38633	6.002000	0.70693	2.786000	0.95864	0.603000	0.83216	GAC	ARHGEF28	-	NULL	ENSG00000214944		0.507	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	HGNC	protein_coding	OTTHUMT00000368975.1	34	0.00	0	G			73190346	73190346	+1	no_errors	ENST00000545377	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.994	A
URB1	9875	genome.wustl.edu	37	21	33765572	33765572	+	5'Flank	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr21:33765572C>T	ENST00000382751.3	-	0	0				C21orf119_ENST00000534991.2_Missense_Mutation_p.A14V	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)							nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CCGCCCCCGGCTGCAGGGTTT	0.657											OREG0003538	type=REGULATORY REGION|Gene=C21orf108|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													21.0	26.0	24.0					21																	33765572		692	1591	2283	-	-	-	SO:0001631	upstream_gene_variant	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919		21.37:g.33765572C>T	Exception_encountered	842	D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	NULL	p.A14V	ENST00000382751.3	37	c.41	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550297	0.45383	.	.	ENSG00000256073	ENST00000534991	.	.	.	2.97	2.08	0.27032	.	.	.	.	.	T	0.40272	0.1110	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35051	-0.9804	5	0.87932	D	0	.	5.9396	0.19186	0.0:0.8545:0.0:0.1455	.	.	.	.	V	14	.	ENSP00000442411:A14V	A	+	2	0	C21orf119	32687443	0.001000	0.12720	0.003000	0.11579	0.040000	0.13550	-0.093000	0.11111	0.829000	0.34733	0.195000	0.17529	GCT	C21orf119	-	NULL	ENSG00000256073		0.657	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf119	HGNC	protein_coding	OTTHUMT00000139400.2	65	0.00	0	C			33765572	33765572	+1	no_errors	ENST00000534991	ensembl	human	known	69_37n	missense	57	36.67	33	SNP	0.003	T
C7orf72	100130988	genome.wustl.edu	37	7	50135957	50135957	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:50135957T>A	ENST00000297001.6	+	1	326	c.276T>A	c.(274-276)taT>taA	p.Y92*		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	92										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						GGCCACATTATCCATTATTTC	0.433																																						dbGAP											0													128.0	100.0	109.0					7																	50135957		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.276T>A	7.37:g.50135957T>A	ENSP00000297001:p.Tyr92*		A6NDX9	Nonsense_Mutation	SNP	NULL	p.Y92*	ENST00000297001.6	37	c.276	CCDS47585.1	7	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737163	0.89482	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.31	-3.02	0.05446	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.8398	4.0921	0.09973	0.12:0.4371:0.1238:0.319	.	.	.	.	X	92	.	.	Y	+	3	2	C7orf72	50106503	0.005000	0.15991	0.000000	0.03702	0.945000	0.59286	-1.094000	0.03359	-0.728000	0.04882	-0.415000	0.06103	TAT	C7orf72	-	NULL	ENSG00000164500		0.433	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf72	HGNC	protein_coding	OTTHUMT00000342124.1	82	0.00	0	T	NM_001161834		50135957	50135957	+1	no_errors	ENST00000297001	ensembl	human	known	69_37n	nonsense	42	27.59	16	SNP	0.001	A
C7orf62	219557	genome.wustl.edu	37	7	88423580	88423580	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:88423580G>A	ENST00000297203.2	-	2	862	c.677C>T	c.(676-678)cCg>cTg	p.P226L	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	226										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						AAATGTTGCCGGGTCCATGAA	0.433																																						dbGAP											0													123.0	113.0	117.0					7																	88423580		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.677C>T	7.37:g.88423580G>A	ENSP00000297203:p.Pro226Leu			Missense_Mutation	SNP	NULL	p.P226L	ENST00000297203.2	37	c.677	CCDS34678.1	7	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907186	0.72868	.	.	ENSG00000164645	ENST00000297203	T	0.16324	2.35	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.44286	0.1286	M	0.74258	2.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.21348	-1.0248	10	0.87932	D	0	-27.0307	16.3795	0.83443	0.0:0.0:1.0:0.0	.	226	Q8TBZ9	CG062_HUMAN	L	226	ENSP00000297203:P226L	ENSP00000297203:P226L	P	-	2	0	C7orf62	88261516	1.000000	0.71417	0.955000	0.39395	0.676000	0.39594	5.204000	0.65180	2.941000	0.99782	0.655000	0.94253	CCG	C7orf62	-	NULL	ENSG00000164645		0.433	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf62	HGNC	protein_coding	OTTHUMT00000332714.1	60	0.00	0	G	NM_152706		88423580	88423580	-1	no_errors	ENST00000297203	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.977	A
C9orf85	138241	genome.wustl.edu	37	9	74562026	74562026	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr9:74562026G>C	ENST00000377031.3	+	2	397	c.207G>C	c.(205-207)aaG>aaC	p.K69N	C9orf85_ENST00000334731.2_Missense_Mutation_p.K69N|C9orf85_ENST00000486911.2_Missense_Mutation_p.K69N			Q96MD7	CI085_HUMAN	chromosome 9 open reading frame 85	69	Lys-rich.									kidney(2)|large_intestine(1)|lung(4)	7						AACCTAAAAAGTGGTGAGTTA	0.308																																						dbGAP											0													76.0	70.0	72.0					9																	74562026		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010179	CCDS6639.1	9q21.2	2012-03-16			ENSG00000155621	ENSG00000155621			28784	protein-coding gene	gene with protein product						12477932	Standard	NM_182505		Approved	MGC61599	uc004ain.3	Q96MD7	OTTHUMG00000020002	ENST00000377031.3:c.207G>C	9.37:g.74562026G>C	ENSP00000366230:p.Lys69Asn		Q5W0N1|Q5W0N3|Q6PJW9|Q86U95	Missense_Mutation	SNP	pfam_DUF2039	p.K69N	ENST00000377031.3	37	c.207		9	.	.	.	.	.	.	.	.	.	.	A	17.19	3.326436	0.60743	.	.	ENSG00000155621	ENST00000334731;ENST00000377031	T	0.36878	1.23	5.69	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	M	0.72894	2.215	0.43313	D	0.995321	D	0.71674	0.998	D	0.66351	0.943	T	0.45131	-0.9282	10	0.52906	T	0.07	-15.916	9.6228	0.39732	0.7244:0.0:0.2756:0.0	.	69	Q96MD7-1	.	N	69	ENSP00000366230:K69N	ENSP00000334289:K69N	K	+	3	2	C9orf85	73751846	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	1.142000	0.31540	-0.127000	0.11661	-0.381000	0.06696	AAG	C9orf85	-	pfam_DUF2039	ENSG00000155621		0.308	C9orf85-003	KNOWN	basic	protein_coding	C9orf85	HGNC	protein_coding	OTTHUMT00000052628.2	75	0.00	0	G	NM_182505		74562026	74562026	+1	no_errors	ENST00000377031	ensembl	human	known	69_37n	missense	49	28.99	20	SNP	1.000	C
CASK	8573	genome.wustl.edu	37	X	41530686	41530686	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chrX:41530686G>C	ENST00000378163.1	-	6	1001	c.527C>G	c.(526-528)gCt>gGt	p.A176G	CASK_ENST00000378166.4_Missense_Mutation_p.A176G|CASK_ENST00000378154.1_Missense_Mutation_p.A176G|CASK_ENST00000361962.4_Missense_Mutation_p.A176G|CASK_ENST00000442742.2_Missense_Mutation_p.A176G|CASK_ENST00000318588.9_Missense_Mutation_p.A176G|CASK_ENST00000378158.1_Missense_Mutation_p.A176G|CASK_ENST00000421587.2_Missense_Mutation_p.A176G			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						CTTACCTCCAGCTACAAGTCC	0.428																																					NSCLC(42;104 1086 3090 27189 35040)	dbGAP											0													61.0	58.0	59.0					X																	41530686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.527C>G	X.37:g.41530686G>C	ENSP00000367405:p.Ala176Gly		A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.A176G	ENST00000378163.1	37	c.527		X	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711378	0.68730	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	T;T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	5.61	5.61	0.85477	.	0.000000	0.48767	D	0.000163	T	0.72036	0.3411	L	0.49778	1.585	0.80722	D	1	B;B;B	0.26547	0.152;0.152;0.085	B;B;B	0.42343	0.384;0.384;0.011	T	0.68588	-0.5369	10	0.38643	T	0.18	.	18.6393	0.91389	0.0:0.0:1.0:0.0	.	176;176;176	O14936-3;O14936-4;O14936-2	.;.;.	G	176	ENSP00000400526:A176G;ENSP00000322727:A176G;ENSP00000354641:A176G;ENSP00000367405:A176G;ENSP00000367400:A176G;ENSP00000367408:A176G;ENSP00000398007:A176G;ENSP00000367396:A176G	ENSP00000322727:A176G	A	-	2	0	CASK	41415630	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.117000	0.94347	2.345000	0.79718	0.600000	0.82982	GCT	CASK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000147044		0.428	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	140	0.00	0	G	NM_003688		41530686	41530686	-1	no_errors	ENST00000378163	ensembl	human	known	69_37n	missense	73	27.72	28	SNP	1.000	C
CDH23	64072	genome.wustl.edu	37	10	73377107	73377107	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr10:73377107G>C	ENST00000224721.6	+	10	1111	c.1106G>C	c.(1105-1107)gGc>gCc	p.G369A	CDH23_ENST00000461841.3_Missense_Mutation_p.G409A|CDH23_ENST00000398842.3_Missense_Mutation_p.G364A|CDH23_ENST00000299366.7_Missense_Mutation_p.G409A|CDH23_ENST00000398809.4_Missense_Mutation_p.G364A	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	364	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GCACAGGTCGGCTTTGCCCTT	0.567																																						dbGAP											0													64.0	69.0	67.0					10																	73377107		2189	4281	6470	-	-	-	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1106G>C	10.37:g.73377107G>C	ENSP00000224721:p.Gly369Ala		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G369A	ENST00000224721.6	37	c.1106		10	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914000	0.92178	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	T;T	0.69806	-0.43;-0.43	5.15	5.15	0.70609	Cadherin (2);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.87696	0.6242	H	0.95224	3.64	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.974;0.983;0.998	D	0.90985	0.4830	10	0.72032	D	0.01	.	18.8328	0.92148	0.0:0.0:1.0:0.0	.	364;364;364	A5D6V9;Q9H251;Q9H251-5	.;CAD23_HUMAN;.	A	371;364;364;364;364;369;369;281	ENSP00000381789:G364A;ENSP00000381822:G364A	ENSP00000224721:G371A	G	+	2	0	CDH23	73047113	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.126000	0.94411	2.677000	0.91161	0.563000	0.77884	GGC	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000107736		0.567	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	74	0.00	0	G	NM_052836		73377107	73377107	+1	no_errors	ENST00000224721	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	C
CETP	1071	genome.wustl.edu	37	16	57003847	57003847	+	Missense_Mutation	SNP	G	G	A	rs184615182	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr16:57003847G>A	ENST00000566128.1	+	5	533	c.266G>A	c.(265-267)cGg>cAg	p.R89Q	CETP_ENST00000200676.3_Missense_Mutation_p.R154Q|CETP_ENST00000379780.2_Missense_Mutation_p.R154Q|CETP_ENST00000569082.1_3'UTR					cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						GGTAGAGTGCGGACCGATGCC	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		19512	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													137.0	83.0	101.0					16																	57003847		2198	4300	6498	-	-	-	SO:0001583	missense	0			M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.266G>A	16.37:g.57003847G>A	ENSP00000456276:p.Arg89Gln			Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer	p.R154Q	ENST00000566128.1	37	c.461		16	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	9.173	1.021713	0.19433	.	.	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.05786	3.39;3.39	4.05	-1.4	0.08968	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.824610	0.10339	N	0.686590	T	0.03011	0.0089	N	0.12182	0.205	0.09310	N	1	B;B	0.19706	0.038;0.027	B;B	0.08055	0.002;0.003	T	0.46034	-0.9220	10	0.25751	T	0.34	-16.4666	5.1026	0.14768	0.4837:0.1547:0.3616:0.0	.	154;154	P11597-2;P11597	.;CETP_HUMAN	Q	154	ENSP00000200676:R154Q;ENSP00000369106:R154Q	ENSP00000200676:R154Q	R	+	2	0	CETP	55561348	0.014000	0.17966	0.000000	0.03702	0.002000	0.02628	0.262000	0.18460	-0.181000	0.10619	0.655000	0.94253	CGG	CETP	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_Cholesteryl_ester_transfer	ENSG00000087237		0.592	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	CETP	HGNC	protein_coding	OTTHUMT00000432305.1	106	0.00	0	G	NM_000078		57003847	57003847	+1	no_errors	ENST00000200676	ensembl	human	known	69_37n	missense	75	46.81	66	SNP	0.000	A
CHFR	55743	genome.wustl.edu	37	12	133418098	133418098	+	3'UTR	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:133418098C>A	ENST00000432561.2	-	0	2110				CHFR_ENST00000443047.2_3'UTR|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000315585.7_3'UTR|CHFR_ENST00000537522.1_3'UTR|CHFR_ENST00000266880.7_3'UTR|CHFR_ENST00000541341.1_Intron|CHFR_ENST00000450056.2_3'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase						mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		AACACGCTCTCTTCACCTCCA	0.498																																						dbGAP											0													95.0	94.0	95.0					12																	133418098		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.*42G>T	12.37:g.133418098C>A			A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	RNA	SNP	-	NULL	ENST00000432561.2	37	NULL	CCDS53849.1	12																																																																																			CHFR	-	-	ENSG00000072609		0.498	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	31	0.00	0	C			133418098	133418098	-1	no_errors	ENST00000535527	ensembl	human	known	69_37n	rna	11	38.89	7	SNP	0.002	A
COL11A2	1302	genome.wustl.edu	37	6	33130533	33130533	+	3'UTR	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr6:33130533G>A	ENST00000374708.4	-	0	6133				COL11A2_ENST00000374714.1_3'UTR|COL11A2_ENST00000395197.1_3'UTR|COL11A2_ENST00000357486.1_3'UTR|COL11A2_ENST00000374713.1_3'UTR|COL11A2_ENST00000361917.1_3'UTR|COL11A2_ENST00000374712.1_3'UTR|COL11A2_ENST00000341947.2_3'UTR|COL11A2_ENST00000477772.1_5'UTR	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2						cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						cagggtcctgggagtcccttc	0.507																																					Melanoma(1;90 116 3946 5341 17093)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.*922C>T	6.37:g.33130533G>A			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	RNA	SNP	-	NULL	ENST00000374708.4	37	NULL	CCDS43452.1	6																																																																																			COL11A2	-	-	ENSG00000204248		0.507	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	63	0.00	0	G			33130533	33130533	-1	no_errors	ENST00000477772	ensembl	human	known	69_37n	rna	34	32.00	16	SNP	0.003	A
CSNK1G2	1455	genome.wustl.edu	37	19	1978887	1978887	+	Silent	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr19:1978887G>A	ENST00000255641.8	+	6	972	c.477G>A	c.(475-477)aaG>aaA	p.K159K		NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCACACCAAGAGCCTAATCT	0.682																																					Ovarian(91;880 1392 21236 36928 37598)	dbGAP											0													35.0	30.0	32.0					19																	1978887		2192	4276	6468	-	-	-	SO:0001819	synonymous_variant	0			AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.477G>A	19.37:g.1978887G>A			B5BU42|O00704|Q8WUB1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.E174K	ENST00000255641.8	37	c.520	CCDS12077.1	19																																																																																			CSNK1G2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000133275		0.682	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2	HGNC	protein_coding	OTTHUMT00000449287.1	44	0.00	0	G	NM_001319		1978887	1978887	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000589385	ensembl	human	novel	69_37n	missense	38	19.15	9	SNP	1.000	A
CYP2C19	1557	genome.wustl.edu	37	10	96522609	96522609	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr10:96522609T>A	ENST00000371321.3	+	1	229	c.147T>A	c.(145-147)gaT>gaA	p.D49E	CYP2C19_ENST00000464755.1_Intron	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	49					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	ATATTAAGGATGTCAGCAAAT	0.408																																						dbGAP											0													98.0	99.0	98.0					10																	96522609		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.147T>A	10.37:g.96522609T>A	ENSP00000360372:p.Asp49Glu		P33259|Q8WZB1|Q8WZB2|Q9UCD4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.D49E	ENST00000371321.3	37	c.147	CCDS7436.1	10	.	.	.	.	.	.	.	.	.	.	t	2.300	-0.360360	0.05103	.	.	ENSG00000165841	ENST00000371321	T	0.66099	-0.19	4.16	-2.08	0.07254	.	34.007800	0.02253	U	0.066762	T	0.55940	0.1952	L	0.50333	1.59	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.33266	-0.9875	10	0.26408	T	0.33	.	10.0897	0.42439	0.0:0.4406:0.0:0.5594	.	49	P33261	CP2CJ_HUMAN	E	49	ENSP00000360372:D49E	ENSP00000360372:D49E	D	+	3	2	CYP2C19	96512599	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-1.059000	0.03479	-0.683000	0.05190	-2.224000	0.00294	GAT	CYP2C19	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000165841		0.408	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C19	HGNC	protein_coding	OTTHUMT00000049490.1	76	0.00	0	T	NM_000769		96522609	96522609	+1	no_errors	ENST00000371321	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	0.000	A
DKFZp434L192	222029	genome.wustl.edu	37	7	56562268	56562268	+	lincRNA	SNP	G	G	A	rs10242906	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:56562268G>A	ENST00000566570.1	+	0	1452					NR_026929.1																						CCCAGCCCCAGCCGTGTGATG	0.637													G|||	1234	0.246406	0.4599	0.3098	5008	,	,		17780	0.0109		0.2525	False		,,,				2504	0.1493					dbGAP											0																																										-	-	-			0																															7.37:g.56562268G>A				RNA	SNP	-	NULL	ENST00000566570.1	37	NULL		7																																																																																			RP11-760D2.11	-	-	ENSG00000261275		0.637	RP11-760D2.11-001	KNOWN	basic	lincRNA	DKFZp434L192	Clone_based_vega_gene	lincRNA	OTTHUMT00000422602.1	9	0.00	0	G			56562268	56562268	+1	no_errors	ENST00000566570	ensembl	human	known	69_37n	rna	14	33.33	7	SNP	0.404	A
DLG1	1739	genome.wustl.edu	37	3	197009567	197009567	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:197009567G>T	ENST00000419354.1	-	4	587	c.301C>A	c.(301-303)Ctt>Att	p.L101I	DLG1_ENST00000422288.1_Missense_Mutation_p.L101I|DLG1_ENST00000357674.4_Missense_Mutation_p.L101I|DLG1_ENST00000392382.2_Missense_Mutation_p.L101I|DLG1_ENST00000346964.2_Missense_Mutation_p.L101I|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000450955.1_Missense_Mutation_p.L101I|DLG1_ENST00000448528.2_Missense_Mutation_p.L101I|DLG1_ENST00000314062.3_Missense_Mutation_p.L101I			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	101					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CTAGGGCTAAGGCTGCTTGGC	0.373																																						dbGAP											0													116.0	111.0	113.0					3																	197009567		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.301C>A	3.37:g.197009567G>T	ENSP00000407531:p.Leu101Ile		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.L101I	ENST00000419354.1	37	c.301	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400950	0.62177	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364	T;T;T;T;T;T;T;T;T;T;T	0.52057	2.56;2.43;2.44;2.56;2.44;2.56;2.44;2.43;0.74;0.68;0.74	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000001	T	0.44540	0.1298	N	0.14661	0.345	0.58432	D	0.999999	P;B;B;D	0.53619	0.666;0.43;0.309;0.961	B;B;B;P	0.52066	0.149;0.212;0.049;0.689	T	0.28299	-1.0048	10	0.27082	T	0.32	.	18.9017	0.92444	0.0:0.0:1.0:0.0	.	101;101;101;101	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	I	101	ENSP00000345731:L101I;ENSP00000350303:L101I;ENSP00000321087:L101I;ENSP00000407531:L101I;ENSP00000413238:L101I;ENSP00000391732:L101I;ENSP00000376187:L101I;ENSP00000411278:L101I;ENSP00000396474:L101I;ENSP00000376185:L101I;ENSP00000414189:L101I	ENSP00000321087:L101I	L	-	1	0	DLG1	198493964	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.536000	0.67180	2.711000	0.92665	0.591000	0.81541	CTT	DLG1	-	pirsf_M-assoc_guanylate_kinase	ENSG00000075711		0.373	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	50	0.00	0	G	NM_004087		197009567	197009567	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	T
DNAH14	127602	genome.wustl.edu	37	1	225492634	225492634	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr1:225492634A>G	ENST00000445597.2	+	38	6610	c.6610A>G	c.(6610-6612)Aca>Gca	p.T2204A	DNAH14_ENST00000430092.1_Missense_Mutation_p.T2857A|DNAH14_ENST00000439375.2_Missense_Mutation_p.T2857A			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2204					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ACTTGCCCCAACATGTGTCCA	0.303																																						dbGAP											0													34.0	29.0	31.0					1																	225492634		692	1591	2283	-	-	-	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.6610A>G	1.37:g.225492634A>G	ENSP00000409472:p.Thr2204Ala		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.T2857A	ENST00000445597.2	37	c.8569		1	.	.	.	.	.	.	.	.	.	.	A	8.885	0.952534	0.18431	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.40756	1.02;1.02;1.02	5.9	3.59	0.41128	.	.	.	.	.	T	0.25606	0.0623	N	0.25380	0.74	0.09310	N	1	B	0.30281	0.275	B	0.26202	0.067	T	0.18681	-1.0329	9	0.16896	T	0.51	.	7.3511	0.26691	0.755:0.0:0.245:0.0	.	2857	Q0VDD8-4	.	A	2204;2857;2857	ENSP00000409472:T2204A;ENSP00000414402:T2857A;ENSP00000392061:T2857A	ENSP00000414402:T2857A	T	+	1	0	DNAH14	223559257	0.000000	0.05858	0.118000	0.21660	0.735000	0.41995	-0.362000	0.07602	0.490000	0.27771	0.416000	0.27883	ACA	DNAH14	-	NULL	ENSG00000185842		0.303	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	32	0.00	0	A	XM_059166		225492634	225492634	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.066	G
DTWD2	285605	genome.wustl.edu	37	5	118176659	118176659	+	Missense_Mutation	SNP	G	G	A	rs200315964		TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr5:118176659G>A	ENST00000510708.1	-	6	883	c.850C>T	c.(850-852)Cgc>Tgc	p.R284C	DTWD2_ENST00000515439.3_Missense_Mutation_p.R188C|DTWD2_ENST00000304058.4_Missense_Mutation_p.R218C	NM_173666.2	NP_775937.1	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2	284										breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)	13		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		CTGAGTTTGCGTTTGTTCTTT	0.353																																						dbGAP											0													141.0	125.0	130.0					5																	118176659		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS34216.1	5q23.1	2008-02-05			ENSG00000169570	ENSG00000169570			19334	protein-coding gene	gene with protein product							Standard	NM_173666		Approved	FLJ33977	uc003ksa.3	Q8NBA8	OTTHUMG00000162956	ENST00000510708.1:c.850C>T	5.37:g.118176659G>A	ENSP00000425048:p.Arg284Cys			Missense_Mutation	SNP	pfam_DTW	p.R284C	ENST00000510708.1	37	c.850	CCDS34216.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106249	0.77096	.	.	ENSG00000169570	ENST00000304058;ENST00000510708;ENST00000515439	.	.	.	5.4	4.52	0.55395	.	0.052885	0.85682	D	0.000000	T	0.46946	0.1419	L	0.36672	1.1	0.80722	D	1	B	0.26041	0.14	B	0.16289	0.015	T	0.48375	-0.9041	9	0.52906	T	0.07	-19.7136	14.1753	0.65537	0.0744:0.0:0.9256:0.0	.	284	Q8NBA8	DTWD2_HUMAN	C	218;284;188	.	ENSP00000302892:R218C	R	-	1	0	DTWD2	118204558	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.064000	0.71169	2.527000	0.85204	0.555000	0.69702	CGC	DTWD2	-	NULL	ENSG00000169570		0.353	DTWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD2	HGNC	protein_coding	OTTHUMT00000371167.2	112	0.00	0	G	NM_173666		118176659	118176659	-1	no_errors	ENST00000510708	ensembl	human	known	69_37n	missense	112	11.11	14	SNP	1.000	A
EML6	400954	genome.wustl.edu	37	2	55118197	55118198	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:55118197_55118198insA	ENST00000356458.6	+	17	2965_2966	c.2445_2446insA	c.(2446-2448)aaafs	p.K816fs		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	816						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						ACAGAGGACATAAAGATAAGAT	0.351																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.2448dupA	2.37:g.55118200_55118200dupA	ENSP00000348842:p.Lys816fs		A8MUB5|B6ZDG7	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D816fs	ENST00000356458.6	37	c.2445_2446	CCDS46286.1	2																																																																																			EML6	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000214595		0.351	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	77	0.00	0	-	XM_001725002		55118197	55118198	+1	no_errors	ENST00000356458	ensembl	human	novel	69_37n	frame_shift_ins	45	23.73	14	INS	0.996:1.000	A
EXOC6B	23233	genome.wustl.edu	37	2	72692351	72692351	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:72692351C>T	ENST00000272427.6	-	18	2048	c.1918G>A	c.(1918-1920)Gat>Aat	p.D640N	EXOC6B_ENST00000410104.1_Missense_Mutation_p.D640N	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	640					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						ACCAGGTAATCACTAGCTTTG	0.418																																						dbGAP											0													135.0	135.0	135.0					2																	72692351		1978	4160	6138	-	-	-	SO:0001583	missense	0			AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1918G>A	2.37:g.72692351C>T	ENSP00000272427:p.Asp640Asn		B8ZZY3	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.D640N	ENST00000272427.6	37	c.1918	CCDS46333.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394884	0.83011	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.29142	1.58;1.58	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	L	0.28400	0.85	0.80722	D	1	D;P	0.69078	0.997;0.696	D;P	0.79108	0.992;0.535	T	0.06917	-1.0800	10	0.11485	T	0.65	.	17.938	0.89018	0.0:1.0:0.0:0.0	.	640;640	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	N	640	ENSP00000272427:D640N;ENSP00000386698:D640N	ENSP00000272427:D640N	D	-	1	0	EXOC6B	72545859	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.694000	0.84235	2.648000	0.89879	0.591000	0.81541	GAT	EXOC6B	-	pfam_Sec15,pirsf_Sec15	ENSG00000144036		0.418	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6B	HGNC	protein_coding	OTTHUMT00000327558.1	75	0.00	0	C	XM_039570		72692351	72692351	-1	no_errors	ENST00000272427	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	1.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84609127	84609127	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr9:84609127G>C	ENST00000344803.2	+	4	3789	c.3742G>C	c.(3742-3744)Gac>Cac	p.D1248H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1248					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTCGAGTGGGGACATGGGAAC	0.522																																						dbGAP											0													180.0	174.0	176.0					9																	84609127		1987	4172	6159	-	-	-	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3742G>C	9.37:g.84609127G>C	ENSP00000341988:p.Asp1248His			Missense_Mutation	SNP	NULL	p.D1248H	ENST00000344803.2	37	c.3742	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	6.747	0.506555	0.12883	.	.	ENSG00000214929	ENST00000344803	T	0.15256	2.44	3.26	-6.52	0.01872	.	.	.	.	.	T	0.10637	0.0260	L	0.32530	0.975	0.09310	N	1	B	0.31859	0.343	B	0.33890	0.172	T	0.22591	-1.0212	9	0.42905	T	0.14	0.3261	6.0614	0.19841	0.6692:0.0:0.182:0.1488	.	1248	Q6ZQQ2	F75D1_HUMAN	H	1248	ENSP00000341988:D1248H	ENSP00000341988:D1248H	D	+	1	0	FAM75D1	83798947	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.044000	0.03532	-1.791000	0.01261	-1.910000	0.00522	GAC	FAM75D1	-	NULL	ENSG00000214929		0.522	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75D1	HGNC	protein_coding	OTTHUMT00000402325.1	112	0.00	0	G	NM_001001670		84609127	84609127	+1	no_errors	ENST00000344803	ensembl	human	known	69_37n	missense	51	46.39	45	SNP	0.000	C
FER1L6	654463	genome.wustl.edu	37	8	125072506	125072506	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr8:125072506C>T	ENST00000522917.1	+	23	3166	c.2960C>T	c.(2959-2961)cCg>cTg	p.P987L	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.P987L|FER1L6-AS2_ENST00000601180.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	987						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AACATTCGGCCGGTGCTGAGC	0.592																																						dbGAP											0													87.0	96.0	93.0					8																	125072506		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2960C>T	8.37:g.125072506C>T	ENSP00000428280:p.Pro987Leu			Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.P987L	ENST00000522917.1	37	c.2960	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.218390	0.95104	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.83837	-1.77;-1.77	5.65	5.65	0.86999	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.93275	0.7857	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93741	0.7050	10	0.56958	D	0.05	-6.5529	19.3172	0.94220	0.0:1.0:0.0:0.0	.	987	Q2WGJ9	FR1L6_HUMAN	L	987	ENSP00000428280:P987L;ENSP00000381982:P987L	ENSP00000381982:P987L	P	+	2	0	FER1L6	125141687	1.000000	0.71417	0.999000	0.59377	0.822000	0.46500	7.320000	0.79064	2.679000	0.91253	0.655000	0.94253	CCG	FER1L6	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000214814		0.592	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	110	0.00	0	C	NM_001039112		125072506	125072506	+1	no_errors	ENST00000399018	ensembl	human	known	69_37n	missense	84	17.65	18	SNP	1.000	T
FEZF2	55079	genome.wustl.edu	37	3	62355985	62355985	+	Missense_Mutation	SNP	C	C	G	rs372862486		TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:62355985C>G	ENST00000283268.3	-	5	1447	c.1153G>C	c.(1153-1155)Ggc>Cgc	p.G385R	FEZF2_ENST00000475839.1_Missense_Mutation_p.G385R|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000486811.1_Missense_Mutation_p.G385R	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	385					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		TGCTTCTCGCCGCTGTGGGTC	0.507																																					NSCLC(170;1772 2053 12525 15604 23984)	dbGAP											0													247.0	230.0	236.0					3																	62355985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1153G>C	3.37:g.62355985C>G	ENSP00000283268:p.Gly385Arg		A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G385R	ENST00000283268.3	37	c.1153	CCDS2897.1	3	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479309	0.84747	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.26223	1.75;1.75;1.75	5.86	5.86	0.93980	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57528	-0.7796	10	0.87932	D	0	-17.0299	20.1772	0.98182	0.0:1.0:0.0:0.0	.	385	Q8TBJ5	FEZF2_HUMAN	R	385	ENSP00000418589:G385R;ENSP00000283268:G385R;ENSP00000418804:G385R	ENSP00000283268:G385R	G	-	1	0	FEZF2	62331025	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.778000	0.95560	0.655000	0.94253	GGC	FEZF2	-	pfscan_Znf_C2H2	ENSG00000153266		0.507	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	HGNC	protein_coding	OTTHUMT00000351813.1	170	0.00	0	C	NM_018008		62355985	62355985	-1	no_errors	ENST00000283268	ensembl	human	known	69_37n	missense	85	18.27	19	SNP	1.000	G
FUNDC1	139341	genome.wustl.edu	37	X	44386524	44386524	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chrX:44386524C>A	ENST00000378045.4	-	4	517	c.349G>T	c.(349-351)Gcg>Tcg	p.A117S	FUNDC1_ENST00000483115.1_5'UTR	NM_173794.3	NP_776155.1	Q8IVP5	FUND1_HUMAN	FUN14 domain containing 1	117					mitochondrion degradation (GO:0000422)|response to hypoxia (GO:0001666)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)				breast(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	6						GCTTTGTTCGCTCGTTTCTTA	0.299																																						dbGAP											0													143.0	114.0	124.0					X																	44386524		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC042813	CCDS14263.1	Xp11.4	2005-09-22			ENSG00000069509	ENSG00000069509			28746	protein-coding gene	gene with protein product		300871				12477932	Standard	NM_173794		Approved	MGC51029	uc004dgc.3	Q8IVP5	OTTHUMG00000021399	ENST00000378045.4:c.349G>T	X.37:g.44386524C>A	ENSP00000367284:p.Ala117Ser			Missense_Mutation	SNP	pfam_FUN14	p.A117S	ENST00000378045.4	37	c.349	CCDS14263.1	X	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498495	0.26861	.	.	ENSG00000069509	ENST00000378045	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.44871	0.1314	N	0.13327	0.33	0.80722	D	1	B	0.25850	0.136	B	0.27076	0.076	T	0.31138	-0.9954	9	0.30854	T	0.27	-7.0721	18.9452	0.92620	0.0:1.0:0.0:0.0	.	117	Q8IVP5	FUND1_HUMAN	S	117	.	ENSP00000367284:A117S	A	-	1	0	FUNDC1	44271468	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.532000	0.60608	2.421000	0.82119	0.594000	0.82650	GCG	FUNDC1	-	pfam_FUN14	ENSG00000069509		0.299	FUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUNDC1	HGNC	protein_coding	OTTHUMT00000056320.1	67	0.00	0	C	NM_173794		44386524	44386524	-1	no_errors	ENST00000378045	ensembl	human	known	69_37n	missense	38	32.14	18	SNP	1.000	A
GFPT1	2673	genome.wustl.edu	37	2	69554198	69554198	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:69554198C>A	ENST00000357308.4	-	19	2081	c.1903G>T	c.(1903-1905)Gtg>Ttg	p.V635L	GFPT1_ENST00000361060.5_Missense_Mutation_p.V617L	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	635	Isomerase.|SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						CAAATTACCACAGGCCGCCCC	0.463																																						dbGAP											0													115.0	93.0	101.0					2																	69554198		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1903G>T	2.37:g.69554198C>A	ENSP00000349860:p.Val635Leu		Q53QE6|Q9BXF8	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.V635L	ENST00000357308.4	37	c.1903	CCDS58713.1	2	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105134	0.56291	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.63580	-0.05;-0.05	5.11	5.11	0.69529	.	0.056107	0.64402	D	0.000001	T	0.48314	0.1493	N	0.12471	0.22	0.58432	D	0.999999	B	0.14012	0.009	B	0.21360	0.034	T	0.46679	-0.9174	10	0.62326	D	0.03	-15.105	17.7079	0.88313	0.0:1.0:0.0:0.0	.	617	Q06210-2	.	L	635;617	ENSP00000349860:V635L;ENSP00000354347:V617L	ENSP00000349860:V635L	V	-	1	0	GFPT1	69407702	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.463000	0.66712	2.645000	0.89757	0.563000	0.77884	GTG	GFPT1	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000198380		0.463	GFPT1-201	KNOWN	basic|CCDS	protein_coding	GFPT1	HGNC	protein_coding		74	0.00	0	C			69554198	69554198	-1	no_errors	ENST00000357308	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	1.000	A
NDUFS1	4719	genome.wustl.edu	37	2	206981103	206981103	+	3'UTR	SNP	A	A	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:206981103A>G	ENST00000233190.6	-	0	10256				AC007383.4_ENST00000453039.1_RNA	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)						apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGCAGATTACAGTAACCAGAC	0.557																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.*7806T>C	2.37:g.206981103A>G			B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	RNA	SNP	-	NULL	ENST00000233190.6	37	NULL	CCDS2366.1	2																																																																																			AC007383.4	-	-	ENSG00000231955		0.557	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCSHP3	Clone_based_vega_gene	protein_coding	OTTHUMT00000256391.4	23	0.00	0	A	NM_005006		206981103	206981103	+1	no_errors	ENST00000453039	ensembl	human	putative	69_37n	rna	7	46.15	6	SNP	1.000	G
GPRIN2	9721	genome.wustl.edu	37	10	46999522	46999522	+	Silent	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr10:46999522G>A	ENST00000374317.1	+	3	915	c.642G>A	c.(640-642)gaG>gaA	p.E214E	GPRIN2_ENST00000374314.4_Silent_p.E214E	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	214										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CCCAGGCTGAGCCCAAAGCTG	0.622																																						dbGAP											0													36.0	36.0	36.0					10																	46999522		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.642G>A	10.37:g.46999522G>A			Q5SVF0	Silent	SNP	NULL	p.E214	ENST00000374317.1	37	c.642	CCDS31192.1	10																																																																																			GPRIN2	-	NULL	ENSG00000204175		0.622	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	96	0.00	0	G	NM_014696		46999522	46999522	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	silent	62	16.00	12	SNP	0.003	A
GREB1	9687	genome.wustl.edu	37	2	11725303	11725303	+	Silent	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:11725303C>A	ENST00000381486.2	+	8	1218	c.918C>A	c.(916-918)tcC>tcA	p.S306S	GREB1_ENST00000381483.2_Silent_p.S306S|GREB1_ENST00000263834.5_Silent_p.S306S|RN7SL674P_ENST00000463397.2_RNA|GREB1_ENST00000234142.5_Silent_p.S306S	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	306						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGTCAAACTCCGGGCCCCCCA	0.493																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													55.0	54.0	54.0					2																	11725303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.918C>A	2.37:g.11725303C>A			A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	NULL	p.S306	ENST00000381486.2	37	c.918	CCDS42655.1	2																																																																																			GREB1	-	NULL	ENSG00000196208		0.493	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	48	0.00	0	C	NM_014668		11725303	11725303	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	silent	35	27.08	13	SNP	0.492	A
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72657755	72657755	+	RNA	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:72657755G>A	ENST00000425256.1	-	0	2156									GTF2I repeat domain containing 2 pseudogene 1																		attattcctcgtcaagtgagt	0.488																																						dbGAP											0																																										-	-	-			0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72657755G>A				RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	136	0.00	0	G	NR_002164		72657755	72657755	-1	no_errors	ENST00000425256	ensembl	human	known	69_37n	rna	73	29.13	30	SNP	0.892	A
GTPBP3	84705	genome.wustl.edu	37	19	17448867	17448867	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr19:17448867C>A	ENST00000324894.8	+	2	172	c.104C>A	c.(103-105)aCc>aAc	p.T35N	GTPBP3_ENST00000358792.7_Missense_Mutation_p.T35N|GTPBP3_ENST00000600625.1_Missense_Mutation_p.T35N|GTPBP3_ENST00000361619.5_Missense_Mutation_p.T57N|GTPBP3_ENST00000598038.1_3'UTR	NM_032620.3|NM_133644.3	NP_116009.2|NP_598399.2	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial)	35					tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	18						TCCGGCGCCACCATCTTCGCG	0.711																																						dbGAP											0													12.0	16.0	15.0					19																	17448867		2081	4079	6160	-	-	-	SO:0001583	missense	0			AF360742	CCDS32950.1, CCDS32951.1, CCDS56088.1, CCDS59364.1	19p13.2	2008-02-05				ENSG00000130299			14880	protein-coding gene	gene with protein product		608536				1290633	Standard	NM_001128855		Approved	MSS1, THDF1, GTPBG3, MTGP1, FLJ14700	uc010xpo.2	Q969Y2		ENST00000324894.8:c.104C>A	19.37:g.17448867C>A	ENSP00000313818:p.Thr35Asn		A6NFH1|A6NIG5|A6NKR4|A8K7B4|B7Z4V8|Q8TCY6|Q8WUW9|Q969G4|Q9BX61	Missense_Mutation	SNP	pfam_GTP-bd_TrmE_N,pfam_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.T35N	ENST00000324894.8	37	c.104	CCDS32951.1	19	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403759	0.83230	.	.	ENSG00000130299	ENST00000361619;ENST00000324894;ENST00000358792;ENST00000546035	T;T;T	0.54071	0.59;0.65;0.74	5.29	5.29	0.74685	GTP-binding protein TrmE, N-terminal (2);	0.096332	0.64402	D	0.000001	T	0.80253	0.4589	H	0.94925	3.6	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.81914	0.988;0.994;0.995;0.993	D	0.85980	0.1482	10	0.87932	D	0	-37.4799	16.4201	0.83755	0.0:1.0:0.0:0.0	.	57;35;35;35	A6NIG5;Q969Y2;Q969Y2-3;Q969Y2-2	.;GTPB3_HUMAN;.;.	N	57;35;35;35	ENSP00000354598:T57N;ENSP00000313818:T35N;ENSP00000351644:T35N	ENSP00000313818:T35N	T	+	2	0	GTPBP3	17309867	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	5.466000	0.66731	2.481000	0.83766	0.484000	0.47621	ACC	GTPBP3	-	pfam_GTP-bd_TrmE_N	ENSG00000130299		0.711	GTPBP3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP3	HGNC	protein_coding	OTTHUMT00000463624.1	29	0.00	0	C	NM_032620		17448867	17448867	+1	no_errors	ENST00000358792	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	A
GUCA1C	9626	genome.wustl.edu	37	3	108626879	108626879	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:108626879T>C	ENST00000261047.3	-	4	752	c.620A>G	c.(619-621)aAa>aGa	p.K207R	GUCA1C_ENST00000393963.3_3'UTR	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	207					phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						CTACTTCATTTTCACCTTCCC	0.443																																					NSCLC(157;1360 1999 30631 40189 44208)	dbGAP											0													91.0	84.0	87.0					3																	108626879		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.620A>G	3.37:g.108626879T>C	ENSP00000261047:p.Lys207Arg		O95844|Q9UNM0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.K207R	ENST00000261047.3	37	c.620	CCDS2954.1	3	.	.	.	.	.	.	.	.	.	.	T	13.91	2.378463	0.42207	.	.	ENSG00000138472	ENST00000261047	T	0.70749	-0.51	4.37	-1.0	0.10196	.	.	.	.	.	T	0.43077	0.1231	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.29427	-1.0012	9	0.87932	D	0	.	0.892	0.01256	0.1574:0.2815:0.1622:0.3989	.	207	O95843	GUC1C_HUMAN	R	207	ENSP00000261047:K207R	ENSP00000261047:K207R	K	-	2	0	GUCA1C	110109569	0.001000	0.12720	0.000000	0.03702	0.594000	0.36715	0.221000	0.17680	-0.326000	0.08564	0.460000	0.39030	AAA	GUCA1C	-	NULL	ENSG00000138472		0.443	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	HGNC	protein_coding	OTTHUMT00000353819.1	75	0.00	0	T	NM_005459		108626879	108626879	-1	no_errors	ENST00000261047	ensembl	human	known	69_37n	missense	40	37.50	24	SNP	0.000	C
HOOK3	84376	genome.wustl.edu	37	8	42823321	42823321	+	Missense_Mutation	SNP	C	C	G	rs147428323	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr8:42823321C>G	ENST00000307602.4	+	11	1286	c.1086C>G	c.(1084-1086)aaC>aaG	p.N362K		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	362					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GAAAGGCCAACGCAGCGCGAA	0.418			T	RET	papillary thyroid																																	dbGAP		Dom	yes		8	8p11.21	84376	hook homolog 3		E	0													81.0	77.0	78.0					8																	42823321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1086C>G	8.37:g.42823321C>G	ENSP00000305699:p.Asn362Lys		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	pfam_HOOK,superfamily_t-SNARE	p.N362K	ENST00000307602.4	37	c.1086	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817662	0.50633	.	.	ENSG00000168172	ENST00000307602	T	0.19669	2.13	5.37	3.03	0.35002	.	0.043605	0.85682	D	0.000000	T	0.32556	0.0833	L	0.58101	1.795	0.46437	D	0.999049	D;P	0.89917	1.0;0.949	D;P	0.87578	0.998;0.793	T	0.40794	-0.9544	10	0.06099	T	0.92	-27.1148	8.3799	0.32466	0.0:0.1717:0.0:0.8283	.	362;362	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	K	362	ENSP00000305699:N362K	ENSP00000305699:N362K	N	+	3	2	HOOK3	42942478	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	0.541000	0.23207	0.440000	0.26502	-0.302000	0.09304	AAC	HOOK3	-	pfam_HOOK	ENSG00000168172		0.418	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	HGNC	protein_coding	OTTHUMT00000383172.2	24	0.00	0	C	NM_032410		42823321	42823321	+1	no_errors	ENST00000307602	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	G
IGHV3-35	28432	genome.wustl.edu	37	14	106845422	106845422	+	RNA	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr14:106845422C>G	ENST00000390617.2	-	0	266									immunoglobulin heavy variable 3-35 (non-functional)																		TGAATCGGCCCTTCACAGAGT	0.527																																						dbGAP											0													145.0	139.0	141.0					14																	106845422		1955	4132	6087	-	-	-			0			M99666		14q32.33	2012-02-08	2008-08-22		ENSG00000211957	ENSG00000211957		"""Immunoglobulins / IGH locus"""	5598	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-35"""				Standard	NG_001019		Approved				OTTHUMG00000152079		14.37:g.106845422C>G				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.K84N	ENST00000390617.2	37	c.252		14																																																																																			IGHV3-35	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211957		0.527	IGHV3-35-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-35	HGNC	IG_V_gene	OTTHUMT00000325174.1	130	0.00	0	C	NG_001019		106845422	106845422	-1	no_stop_codon	ENST00000390617	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	0.999	G
IGSF1	3547	genome.wustl.edu	37	X	130409477	130409477	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chrX:130409477G>T	ENST00000361420.3	-	16	3238	c.3159C>A	c.(3157-3159)agC>agA	p.S1053R	IGSF1_ENST00000370903.3_Missense_Mutation_p.S1058R|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.S1044R|IGSF1_ENST00000370904.1_Missense_Mutation_p.S1044R			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1053	Ig-like C2-type 10.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CCAGGGTGTTGCTAGGTTGTA	0.502																																						dbGAP											0													150.0	129.0	136.0					X																	130409477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3159C>A	X.37:g.130409477G>T	ENSP00000355010:p.Ser1053Arg		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S1058R	ENST00000361420.3	37	c.3174	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693273	0.48202	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.01484	4.84;4.84;4.84;4.84	5.32	4.46	0.54185	Immunoglobulin-like fold (1);	0.157867	0.46145	D	0.000315	T	0.13713	0.0332	H	0.94698	3.57	0.37641	D	0.922057	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.79784	0.988;0.99;0.993	T	0.01879	-1.1255	10	0.87932	D	0	.	9.2717	0.37675	0.1036:0.0:0.8964:0.0	.	1044;497;1053	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	R	1044;1053;1044;1058	ENSP00000359947:S1044R;ENSP00000355010:S1053R;ENSP00000359941:S1044R;ENSP00000359940:S1058R	ENSP00000355010:S1053R	S	-	3	2	IGSF1	130237158	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	2.245000	0.43133	1.300000	0.44818	0.600000	0.82982	AGC	IGSF1	-	smart_Ig_sub	ENSG00000147255		0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	98	0.00	0	G			130409477	130409477	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	missense	69	16.87	14	SNP	1.000	T
IL6	3569	genome.wustl.edu	37	7	22767176	22767176	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:22767176C>A	ENST00000404625.1	+	3	592	c.133C>A	c.(133-135)Cag>Aag	p.Q45K	IL6_ENST00000407492.1_Intron|IL6_ENST00000401651.1_Intron|IL6_ENST00000420258.2_Missense_Mutation_p.Q99K|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000258743.5_Missense_Mutation_p.Q45K|IL6_ENST00000406575.1_Missense_Mutation_p.Q45K|IL6_ENST00000401630.3_Missense_Mutation_p.Q22K			P05231	IL6_HUMAN	interleukin 6	45					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	CCCACACAGACAGCCACTCAC	0.572																																					Esophageal Squamous(47;342 1214 13936 33513)	dbGAP											0													102.0	99.0	100.0					7																	22767176		2203	4300	6503	-	-	-	SO:0001583	missense	0			M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.133C>A	7.37:g.22767176C>A	ENSP00000385675:p.Gln45Lys		Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,prints_Interleukin_6,prints_IL6_MGF_GCSF	p.Q99K	ENST00000404625.1	37	c.295	CCDS5375.1	7	.	.	.	.	.	.	.	.	.	.	C	5.160	0.215031	0.09810	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000401630;ENST00000406575	T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;0.98;2.02;-0.84	4.86	1.94	0.25998	Four-helical cytokine, core (1);	0.692032	0.15409	N	0.263918	T	0.50718	0.1632	N	0.22421	0.69	0.09310	N	1	P;B;B	0.41643	0.758;0.324;0.192	B;B;B	0.30401	0.115;0.081;0.033	T	0.38693	-0.9649	10	0.38643	T	0.18	0.0179	5.7413	0.18096	0.3413:0.5667:0.0:0.092	.	99;45;45	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	K	45;45;45;99;22;45	ENSP00000385675:Q45K;ENSP00000405150:Q45K;ENSP00000258743:Q45K;ENSP00000405994:Q99K;ENSP00000384928:Q22K;ENSP00000385227:Q45K	ENSP00000258743:Q45K	Q	+	1	0	IL6	22733701	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.294000	0.19047	0.301000	0.22738	0.555000	0.69702	CAG	IL6	-	NULL	ENSG00000136244		0.572	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6	HGNC	protein_coding	OTTHUMT00000250225.2	90	0.00	0	C	NM_000600		22767176	22767176	+1	no_errors	ENST00000420258	ensembl	human	known	69_37n	missense	51	27.78	20	SNP	0.000	A
ITGB6	3694	genome.wustl.edu	37	2	160983046	160983046	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:160983046C>A	ENST00000283249.2	-	11	1964	c.1727G>T	c.(1726-1728)tGc>tTc	p.C576F	ITGB6_ENST00000428609.2_Missense_Mutation_p.C534F|ITGB6_ENST00000409967.2_Intron|ITGB6_ENST00000409872.1_Missense_Mutation_p.C576F	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	576	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GCTGGTGGTGCAGTTGCAGTA	0.572																																						dbGAP											0													89.0	80.0	83.0					2																	160983046		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1727G>T	2.37:g.160983046C>A	ENSP00000283249:p.Cys576Phe		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.C576F	ENST00000283249.2	37	c.1727	CCDS2212.1	2	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967490	0.92855	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409872	D;D;D	0.96554	-4.05;-4.05;-4.05	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	H	0.98996	4.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98951	1.0794	10	0.87932	D	0	.	19.6764	0.95936	0.0:1.0:0.0:0.0	.	534;576	E9PEE8;P18564	.;ITB6_HUMAN	F	576;534;576	ENSP00000283249:C576F;ENSP00000408024:C534F;ENSP00000386367:C576F	ENSP00000283249:C576F	C	-	2	0	ITGB6	160691292	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.660000	0.90430	0.655000	0.94253	TGC	ITGB6	-	pirsf_Integrin_bsu	ENSG00000115221		0.572	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	HGNC	protein_coding	OTTHUMT00000255036.1	31	0.00	0	C	NM_000888		160983046	160983046	-1	no_errors	ENST00000283249	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	A
KDR	3791	genome.wustl.edu	37	4	55976929	55976929	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr4:55976929G>T	ENST00000263923.4	-	8	1278	c.983C>A	c.(982-984)cCt>cAt	p.P328H		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	328	Ig-like C2-type 4.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGCAACAAAAGGTTTTTCTGG	0.418			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												dbGAP		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													44.0	49.0	47.0					4																	55976929		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.983C>A	4.37:g.55976929G>T	ENSP00000263923:p.Pro328His		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR2_rcpt,prints_Tyr_kinase_VEGFR_rcpt_N	p.P328H	ENST00000263923.4	37	c.983	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213802	0.79352	.	.	ENSG00000128052	ENST00000263923	T	0.69435	-0.4	5.65	5.65	0.86999	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83815	0.5336	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.947;0.99	D	0.84932	0.0860	10	0.52906	T	0.07	.	17.8994	0.88899	0.0:0.0:1.0:0.0	.	328;328	P35968-2;P35968	.;VGFR2_HUMAN	H	328	ENSP00000263923:P328H	ENSP00000263923:P328H	P	-	2	0	KDR	55671686	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.841000	0.86834	2.665000	0.90641	0.563000	0.77884	CCT	KDR	-	pfscan_Ig-like	ENSG00000128052		0.418	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	38	0.00	0	G			55976929	55976929	-1	no_errors	ENST00000263923	ensembl	human	known	69_37n	missense	35	30.00	15	SNP	1.000	T
KDR	3791	genome.wustl.edu	37	4	55981116	55981116	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr4:55981116C>A	ENST00000263923.4	-	5	878	c.583G>T	c.(583-585)Gct>Tct	p.A195S		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	195	Ig-like C2-type 2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACCATGCCAGCATAGCTGATC	0.398			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												dbGAP		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													82.0	82.0	82.0					4																	55981116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.583G>T	4.37:g.55981116C>A	ENSP00000263923:p.Ala195Ser		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR2_rcpt,prints_Tyr_kinase_VEGFR_rcpt_N	p.A195S	ENST00000263923.4	37	c.583	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.171369	0.94807	.	.	ENSG00000128052	ENST00000263923	T	0.04654	3.58	5.9	5.9	0.94986	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.15435	0.0372	L	0.46614	1.455	0.80722	D	1	D;D	0.61697	0.99;0.984	D;P	0.68943	0.961;0.824	T	0.14392	-1.0474	10	0.12766	T	0.61	.	20.2631	0.98458	0.0:1.0:0.0:0.0	.	195;195	P35968-2;P35968	.;VGFR2_HUMAN	S	195	ENSP00000263923:A195S	ENSP00000263923:A195S	A	-	1	0	KDR	55675873	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.160000	0.77495	2.788000	0.95919	0.655000	0.94253	GCT	KDR	-	smart_Ig_sub,prints_Tyr_kinase_VEGFR2_rcpt	ENSG00000128052		0.398	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	59	0.00	0	C			55981116	55981116	-1	no_errors	ENST00000263923	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	A
KIR3DL2	3812	genome.wustl.edu	37	19	55365320	55365320	+	Missense_Mutation	SNP	G	G	T	rs145326846	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr19:55365320G>T	ENST00000326321.3	+	4	507	c.474G>T	c.(472-474)gaG>gaT	p.E158D	KIR3DL1_ENST00000402254.2_Intron|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.E158D	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	158	Ig-like C2-type 2.		E -> D (in dbSNP:rs1048270). {ECO:0000269|PubMed:8760804, ECO:0000269|PubMed:9430221, ECO:0000269|Ref.5}.		cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		TGCACAGAGAGGGGATCTCTG	0.562													.|||	1326	0.264776	0.0825	0.3473	5008	,	,		11289	0.5863		0.2167	False		,,,				2504	0.1708					dbGAP											0													2.0	2.0	2.0					19																	55365320		952	1970	2922	-	-	-	SO:0001583	missense	0			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.474G>T	19.37:g.55365320G>T	ENSP00000325525:p.Glu158Asp		Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.E158D	ENST00000326321.3	37	c.474	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	g	8.388	0.839113	0.16891	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.00705	5.81;5.81	2.06	-3.24	0.05094	Immunoglobulin-like fold (1);	0.648587	0.11169	U	0.592182	T	0.01029	0.0034	M	0.74467	2.265	0.80722	P	0.0	B;B	0.16802	0.019;0.004	B;B	0.23852	0.049;0.01	T	0.48559	-0.9025	9	0.66056	D	0.02	.	0.5675	0.00689	0.1813:0.2413:0.3341:0.2433	rs1048270;rs3175740;rs3745895;rs35194582	158;158	Q95366;P43630	.;KI3L2_HUMAN	D	158	ENSP00000325525:E158D;ENSP00000270442:E158D	ENSP00000270442:E158D	E	+	3	2	KIR3DL2	60057132	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.353000	0.07691	-0.223000	0.09943	0.195000	0.17529	GAG	KIR3DL2	-	smart_Ig_sub	ENSG00000240403		0.562	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	HGNC	protein_coding	OTTHUMT00000141241.1	17	0.00	0	G			55365320	55365320	+1	no_errors	ENST00000326321	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	0.000	T
KRT86	3892	genome.wustl.edu	37	12	52647411	52647411	+	Intron	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:52647411C>G	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GACTCGGCCTCGGCCCGGCTG	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4199C>G	12.37:g.52647411C>G			P78387	RNA	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			KRT121P	-	-	ENSG00000135477		0.557	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		102	0.00	0	C	NM_002284		52647411	52647411	-1	no_errors	ENST00000529785	ensembl	human	known	69_37n	rna	76	19.15	18	SNP	1.000	G
LAMC3	10319	genome.wustl.edu	37	9	133967273	133967273	+	3'UTR	SNP	G	G	C	rs562703308	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr9:133967273G>C	ENST00000361069.4	+	0	4960				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GACATTCCCCGGAGCCGGCTG	0.627																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*99G>C	9.37:g.133967273G>C			B1APX9|B1APY0|Q59H72	RNA	SNP	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9																																																																																			LAMC3	-	-	ENSG00000050555		0.627	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	21	0.00	0	G	NM_006059		133967273	133967273	+1	no_errors	ENST00000462567	ensembl	human	known	69_37n	rna	5	44.44	4	SNP	0.003	C
LDHAL6CP	121498	genome.wustl.edu	37	12	63397682	63397682	+	lincRNA	SNP	A	A	G	rs1250159	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:63397682A>G	ENST00000552996.1	-	0	1070				LDHAL6CP_ENST00000550738.1_RNA																							CTTCAACATGACAGCCCTTTC	0.423													G|||	4109	0.820487	0.6959	0.7349	5008	,	,		21122	0.9137		0.8797	False		,,,				2504	0.8926					dbGAP											0																																										-	-	-			0																															12.37:g.63397682A>G				RNA	SNP	-	NULL	ENST00000552996.1	37	NULL		12																																																																																			LDHAL6CP	-	-	ENSG00000250517		0.423	RP11-848D3.5-001	KNOWN	basic	lincRNA	LDHAL6CP	HGNC	lincRNA	OTTHUMT00000406731.1	83	0.00	0	A			63397682	63397682	+1	no_errors	ENST00000550738	ensembl	human	known	69_37n	rna	44	10.20	5	SNP	0.935	G
LGR4	55366	genome.wustl.edu	37	11	27390453	27390453	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr11:27390453G>A	ENST00000379214.4	-	18	2260	c.1817C>T	c.(1816-1818)gCt>gTt	p.A606V	LGR4_ENST00000389858.4_Missense_Mutation_p.A582V	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	606					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						GCCAAATTCAGCGAATCTGCC	0.413																																						dbGAP											0													73.0	79.0	77.0					11																	27390453		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.1817C>T	11.37:g.27390453G>A	ENSP00000368516:p.Ala606Val		A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.A606V	ENST00000379214.4	37	c.1817	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842020	0.91197	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	D;D	0.93019	-3.15;-3.15	5.81	5.81	0.92471	GPCR, rhodopsin-like superfamily (1);	0.050365	0.85682	D	0.000000	D	0.95971	0.8688	M	0.66297	2.02	0.80722	D	1	D;D	0.65815	0.995;0.977	P;P	0.61800	0.894;0.756	D	0.95385	0.8476	10	0.52906	T	0.07	.	20.0896	0.97814	0.0:0.0:1.0:0.0	.	582;606	G5E9B3;Q9BXB1	.;LGR4_HUMAN	V	606;582	ENSP00000368516:A606V;ENSP00000374508:A582V	ENSP00000368516:A606V	A	-	2	0	LGR4	27347029	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	6.550000	0.73905	2.741000	0.93983	0.650000	0.86243	GCT	LGR4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt	ENSG00000205213		0.413	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	HGNC	protein_coding	OTTHUMT00000257467.1	50	0.00	0	G	NM_018490		27390453	27390453	-1	no_errors	ENST00000379214	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	A
LHX5	64211	genome.wustl.edu	37	12	113909155	113909155	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:113909155delA	ENST00000261731.3	-	1	722	c.149delT	c.(148-150)ctcfs	p.L50fs	LHX5_ENST00000557836.1_5'Flank|RP11-82C23.2_ENST00000551357.2_RNA	NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	50	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						TTTGCAGTAGAGCTTGCCCTC	0.617																																						dbGAP											0													47.0	42.0	43.0					12																	113909155		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.149delT	12.37:g.113909155delA	ENSP00000261731:p.Leu50fs		Q32MA4	Frame_Shift_Del	DEL	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.L50fs	ENST00000261731.3	37	c.149	CCDS9171.1	12																																																																																			LHX5	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000089116		0.617	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX5	HGNC	protein_coding	OTTHUMT00000404788.3	93	0.00	0	A	NM_022363		113909155	113909155	-1	no_errors	ENST00000261731	ensembl	human	known	69_37n	frame_shift_del	50	13.56	8	DEL	1.000	-
LRP1B	53353	genome.wustl.edu	37	2	141773300	141773300	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr2:141773300T>A	ENST00000389484.3	-	13	3126	c.2155A>T	c.(2155-2157)Att>Ttt	p.I719F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	719					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTTTTTCAATATGATCGTAA	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													72.0	69.0	70.0					2																	141773300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2155A>T	2.37:g.141773300T>A	ENSP00000374135:p.Ile719Phe		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.I719F	ENST00000389484.3	37	c.2155	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	19.09	3.759919	0.69763	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94687	-3.49	5.75	5.75	0.90469	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000001	D	0.98343	0.9450	H	0.97315	3.98	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.99737	1.1014	10	0.87932	D	0	.	16.3534	0.83225	0.0:0.0:0.0:1.0	.	719	Q9NZR2	LRP1B_HUMAN	F	719;657	ENSP00000374135:I719F	ENSP00000374135:I719F	I	-	1	0	LRP1B	141489770	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.897000	0.87356	2.311000	0.77944	0.528000	0.53228	ATT	LRP1B	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000168702		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	54	0.00	0	T	NM_018557		141773300	141773300	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	A
MAGED1	9500	genome.wustl.edu	37	X	51644929	51644929	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chrX:51644929C>T	ENST00000375722.1	+	12	2492	c.2240C>T	c.(2239-2241)cCt>cTt	p.P747L	MAGED1_ENST00000375772.3_Missense_Mutation_p.P747L|MAGED1_ENST00000375695.2_Missense_Mutation_p.P803L|MAGED1_ENST00000326587.7_Missense_Mutation_p.P747L|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	747					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					TCCAGATTCCCTCAGACCTTT	0.527										Multiple Myeloma(10;0.10)																												dbGAP											0													86.0	80.0	82.0					X																	51644929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.2240C>T	X.37:g.51644929C>T	ENSP00000364874:p.Pro747Leu		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.P803L	ENST00000375722.1	37	c.2408	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	C	6.995	0.553780	0.13374	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.04275	3.74;3.74;3.74;3.66	4.09	3.22	0.36961	.	0.000000	0.44483	D	0.000444	T	0.06508	0.0167	N	0.08118	0	0.45284	D	0.998286	D;D	0.71674	0.998;0.995	D;P	0.66351	0.943;0.827	T	0.48422	-0.9037	10	0.49607	T	0.09	.	8.1565	0.31171	0.2387:0.7613:0.0:0.0	.	803;747	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	L	747;747;747;803	ENSP00000364927:P747L;ENSP00000364874:P747L;ENSP00000325333:P747L;ENSP00000364847:P803L	ENSP00000325333:P747L	P	+	2	0	MAGED1	51661669	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	2.833000	0.48159	1.062000	0.40625	-0.364000	0.07487	CCT	MAGED1	-	NULL	ENSG00000179222		0.527	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	73	0.00	0	C	NM_001005332		51644929	51644929	+1	no_errors	ENST00000375695	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	T
MAGOH	4116	genome.wustl.edu	37	1	53699120	53699120	+	Intron	SNP	G	G	T	rs192624549	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr1:53699120G>T	ENST00000371470.3	-	3	420				MAGOH_ENST00000371466.4_Intron|MAGOH_ENST00000462941.1_5'UTR	NM_002370.3	NP_002361.1	P61326	MGN_HUMAN	mago-nashi homolog, proliferation-associated (Drosophila)						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	6						TAGTTAGTAAGTGAGATAGGC	0.358																																					Colon(150;521 2416 7674 18129)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF035940	CCDS577.1	1p32.3	2010-04-16	2001-11-28		ENSG00000162385	ENSG00000162385			6815	protein-coding gene	gene with protein product		602603	"""mago-nashi (Drosophila) homolog, proliferation-associated"""			9479507	Standard	NM_002370		Approved	MAGOHA, MAGOH1	uc001cvf.2	P61326	OTTHUMG00000008932	ENST00000371470.3:c.258+93C>A	1.37:g.53699120G>T			B1ARP8|B2R5A2|O35169|P50606|Q5SW69	RNA	SNP	-	NULL	ENST00000371470.3	37	NULL	CCDS577.1	1																																																																																			MAGOH	-	-	ENSG00000162385		0.358	MAGOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGOH	HGNC	protein_coding	OTTHUMT00000024730.1	42	0.00	0	G	NM_002370		53699120	53699120	-1	no_errors	ENST00000462941	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.007	T
MRE11A	4361	genome.wustl.edu	37	11	94219175	94219175	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr11:94219175C>T	ENST00000323929.3	-	4	451	c.229G>A	c.(229-231)Gag>Aag	p.E77K	MRE11A_ENST00000323977.3_Missense_Mutation_p.E77K|MRE11A_ENST00000393241.4_Missense_Mutation_p.E77K|MRE11A_ENST00000536144.1_5'UTR|MRE11A_ENST00000540013.1_Missense_Mutation_p.E77K|MRE11A_ENST00000407439.3_Missense_Mutation_p.E80K	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	77					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.E77K(2)		breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				CTTAATAACTCGAGGCAGGTA	0.338								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																													dbGAP											2	Substitution - Missense(2)	large_intestine(2)											95.0	95.0	95.0					11																	94219175		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.229G>A	11.37:g.94219175C>T	ENSP00000325863:p.Glu77Lys		O43475	Missense_Mutation	SNP	pfam_Mre11_DNA-bd,pfam_Metallo_PEstase_dom,pirsf_DNA_repair_Mre11,tigrfam_DNA_repair_Mre11	p.E77K	ENST00000323929.3	37	c.229	CCDS8299.1	11	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997199	0.54147	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241;ENST00000540013;ENST00000536754;ENST00000538923	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.51	5.51	0.81932	Metallophosphoesterase domain (1);	0.101211	0.64402	D	0.000003	T	0.74809	0.3765	N	0.21282	0.65	0.80722	D	1	B;B;B	0.13145	0.007;0.003;0.007	B;B;B	0.20384	0.029;0.017;0.013	T	0.68187	-0.5475	10	0.16896	T	0.51	-22.5762	19.4186	0.94712	0.0:1.0:0.0:0.0	.	80;77;77	B3KTC7;P49959-2;P49959	.;.;MRE11_HUMAN	K	77;80;77;77;77;77;77	ENSP00000325863:E77K;ENSP00000385614:E80K;ENSP00000326094:E77K;ENSP00000376933:E77K;ENSP00000440986:E77K;ENSP00000439511:E77K;ENSP00000442809:E77K	ENSP00000325863:E77K	E	-	1	0	MRE11A	93858823	0.999000	0.42202	0.977000	0.42913	0.993000	0.82548	3.928000	0.56506	2.577000	0.86979	0.585000	0.79938	GAG	MRE11A	-	pfam_Metallo_PEstase_dom,pirsf_DNA_repair_Mre11,tigrfam_DNA_repair_Mre11	ENSG00000020922		0.338	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MRE11A	HGNC	protein_coding	OTTHUMT00000396237.3	29	0.00	0	C	NM_005591		94219175	94219175	-1	no_errors	ENST00000323929	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.994	T
NCOR2	9612	genome.wustl.edu	37	12	124816871	124816871	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:124816871C>A	ENST00000405201.1	-	43	6898	c.6898G>T	c.(6898-6900)Gaa>Taa	p.E2300*	NCOR2_ENST00000429285.2_Nonsense_Mutation_p.E2290*|NCOR2_ENST00000404121.2_Nonsense_Mutation_p.E1861*|NCOR2_ENST00000356219.3_Nonsense_Mutation_p.E2307*|NCOR2_ENST00000397355.1_Nonsense_Mutation_p.E2291*|NCOR2_ENST00000404621.1_Nonsense_Mutation_p.E2290*			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2311					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTACTGTATTCAGGCTCATTC	0.607											OREG0022237	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													111.0	108.0	109.0					12																	124816871		1949	4145	6094	-	-	-	SO:0001587	stop_gained	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6898G>T	12.37:g.124816871C>A	ENSP00000384018:p.Glu2300*	1537	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E2307*	ENST00000405201.1	37	c.6919	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	C	50	16.300242	0.99860	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285	.	.	.	4.4	4.4	0.53042	.	0.060990	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.5949	16.9755	0.86312	0.0:1.0:0.0:0.0	.	.	.	.	X	2300;2290;2307;2291;2299;1861;392;2290	.	ENSP00000348551:E2307X	E	-	1	0	NCOR2	123382824	1.000000	0.71417	0.882000	0.34594	0.830000	0.47004	7.422000	0.80217	1.981000	0.57761	0.462000	0.41574	GAA	NCOR2	-	NULL	ENSG00000196498		0.607	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	122	0.00	0	C	NM_006312		124816871	124816871	-1	no_errors	ENST00000356219	ensembl	human	known	69_37n	nonsense	52	17.46	11	SNP	1.000	A
NLRP5	126206	genome.wustl.edu	37	19	56565030	56565030	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr19:56565030C>T	ENST00000390649.3	+	13	3155	c.3155C>T	c.(3154-3156)gCg>gTg	p.A1052V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1052					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTCACCGCCGCGTGCTGTGAG	0.582																																						dbGAP											0													69.0	68.0	68.0					19																	56565030		2051	4195	6246	-	-	-	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3155C>T	19.37:g.56565030C>T	ENSP00000375063:p.Ala1052Val		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A1052V	ENST00000390649.3	37	c.3155	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	C	8.520	0.868560	0.17322	.	.	ENSG00000171487	ENST00000390649	T	0.13778	2.56	3.5	-0.105	0.13601	.	1.717960	0.03712	N	0.250495	T	0.09379	0.0231	L	0.31371	0.925	0.09310	N	1	P	0.34462	0.454	B	0.27380	0.079	T	0.30504	-0.9976	10	0.27785	T	0.31	.	5.9809	0.19407	0.3865:0.4252:0.1882:0.0	.	1052	P59047	NALP5_HUMAN	V	1052	ENSP00000375063:A1052V	ENSP00000375063:A1052V	A	+	2	0	NLRP5	61256842	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.289000	0.08365	0.074000	0.16767	-0.158000	0.13435	GCG	NLRP5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000171487		0.582	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	68	0.00	0	C	NM_153447		56565030	56565030	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	missense	29	55.38	36	SNP	0.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91456404	91456404	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chrX:91456404C>A	ENST00000373094.1	+	3	3909	c.3064C>A	c.(3064-3066)Ccc>Acc	p.P1022T	PCDH11X_ENST00000361655.2_Missense_Mutation_p.P1022T|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000406881.1_Missense_Mutation_p.P1022T|PCDH11X_ENST00000504220.2_Missense_Mutation_p.P1022T|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000373097.1_Missense_Mutation_p.P1022T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1022					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ATCTTGCACCCCCATGAAAGA	0.383																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													84.0	74.0	78.0					X																	91456404		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3064C>A	X.37:g.91456404C>A	ENSP00000362186:p.Pro1022Thr		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1022T	ENST00000373094.1	37	c.3064	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	c	9.870	1.198791	0.22121	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934	T;T;T;T;T	0.52754	0.73;0.68;0.73;0.65;0.74	4.18	4.18	0.49190	.	0.109084	0.36374	U	0.002627	T	0.45013	0.1321	L	0.29908	0.895	0.44373	D	0.997272	P;P;P;P;P	0.48503	0.634;0.911;0.911;0.828;0.839	B;P;P;B;B	0.50231	0.234;0.635;0.635;0.371;0.205	T	0.48603	-0.9021	10	0.87932	D	0	.	11.4498	0.50145	0.0:1.0:0.0:0.0	.	1022;1022;1022;1022;1022	Q9BZA7-6;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	T	1022	ENSP00000362186:P1022T;ENSP00000362189:P1022T;ENSP00000423762:P1022T;ENSP00000355105:P1022T;ENSP00000384758:P1022T	ENSP00000349408:P1022T	P	+	1	0	PCDH11X	91343060	0.140000	0.22579	0.293000	0.24932	0.156000	0.22039	3.240000	0.51368	1.822000	0.53115	0.502000	0.49764	CCC	PCDH11X	-	NULL	ENSG00000102290		0.383	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	97	0.00	0	C	NM_032969		91456404	91456404	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	80	13.04	12	SNP	0.182	A
PITPNB	23760	genome.wustl.edu	37	22	28315170	28315170	+	Missense_Mutation	SNP	T	T	A	rs551428878		TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr22:28315170T>A	ENST00000335272.5	-	1	86	c.10A>T	c.(10-12)Atc>Ttc	p.I4F	TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|PITPNB_ENST00000455418.3_5'Flank|TTC28-AS1_ENST00000417381.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|MIR3199-2_ENST00000582434.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000437713.1_RNA|PITPNB_ENST00000320996.10_Missense_Mutation_p.I4F|TTC28-AS1_ENST00000428818.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000454741.1_RNA	NM_012399.3	NP_036531.1	P48739	PIPNB_HUMAN	phosphatidylinositol transfer protein, beta	4					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|lipid metabolic process (GO:0006629)|phospholipid metabolic process (GO:0006644)|phospholipid transport (GO:0015914)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	lipid binding (GO:0008289)			large_intestine(4)|lung(3)|skin(1)	8						AATTCCTTGATCAGCACCATC	0.642																																						dbGAP											0													156.0	134.0	141.0					22																	28315170		2203	4300	6503	-	-	-	SO:0001583	missense	0			D30037	CCDS13842.1, CCDS63433.1	22q12.1	2006-12-15			ENSG00000180957	ENSG00000180957			9002	protein-coding gene	gene with protein product		606876				10591208	Standard	NM_012399		Approved	VIB1B	uc003adk.3	P48739	OTTHUMG00000150976	ENST00000335272.5:c.10A>T	22.37:g.28315170T>A	ENSP00000334738:p.Ile4Phe		B3KYB8|B7Z7Q0|Q8N5W1	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.I4F	ENST00000335272.5	37	c.10	CCDS13842.1	22	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103396	0.76983	.	.	ENSG00000180957	ENST00000335272;ENST00000320996	T;T	0.54279	0.58;0.58	4.7	4.7	0.59300	START-like domain (1);	0.347761	0.29424	N	0.012200	T	0.63838	0.2545	M	0.84846	2.72	0.80722	D	1	B;P	0.43578	0.419;0.811	B;P	0.46850	0.102;0.529	T	0.71328	-0.4626	10	0.87932	D	0	-13.875	12.1719	0.54163	0.0:0.0:0.0:1.0	.	4;4	P48739-2;P48739	.;PIPNB_HUMAN	F	4	ENSP00000334738:I4F;ENSP00000321266:I4F	ENSP00000321266:I4F	I	-	1	0	PITPNB	26645170	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.410000	0.52664	1.968000	0.57251	0.533000	0.62120	ATC	PITPNB	-	pfam_PI_transfer	ENSG00000180957		0.642	PITPNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITPNB	HGNC	protein_coding	OTTHUMT00000320740.1	62	0.00	0	T			28315170	28315170	-1	no_errors	ENST00000320996	ensembl	human	known	69_37n	missense	30	45.45	25	SNP	1.000	A
POMT2	29954	genome.wustl.edu	37	14	77762553	77762553	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr14:77762553G>A	ENST00000261534.4	-	9	1272	c.1070C>T	c.(1069-1071)tCc>tTc	p.S357F		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	357	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		GTGCCTGTGGGAGTGCAGATA	0.597																																						dbGAP											0													95.0	63.0	74.0					14																	77762553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1070C>T	14.37:g.77762553G>A	ENSP00000261534:p.Ser357Phe		Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.S357F	ENST00000261534.4	37	c.1070	CCDS9857.1	14	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952151	0.73787	.	.	ENSG00000009830	ENST00000261534	D	0.91295	-2.82	4.98	4.98	0.66077	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	D	0.97031	0.9030	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98496	1.0612	10	0.87932	D	0	-5.8804	18.2397	0.89963	0.0:0.0:1.0:0.0	.	357	Q9UKY4	POMT2_HUMAN	F	357	ENSP00000261534:S357F	ENSP00000261534:S357F	S	-	2	0	POMT2	76832306	1.000000	0.71417	0.999000	0.59377	0.274000	0.26718	9.697000	0.98697	2.295000	0.77249	0.462000	0.41574	TCC	POMT2	-	pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	ENSG00000009830		0.597	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	69	0.00	0	G	NM_013382		77762553	77762553	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	1.000	A
RASGRP4	115727	genome.wustl.edu	37	19	38911597	38911597	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr19:38911597T>G	ENST00000587738.1	-	4	398	c.328A>C	c.(328-330)Aca>Cca	p.T110P	RASGRP4_ENST00000426920.2_Missense_Mutation_p.T110P|RASGRP4_ENST00000587753.1_Missense_Mutation_p.T110P|RASGRP4_ENST00000454404.2_Missense_Mutation_p.T110P|RASGRP4_ENST00000293062.9_Missense_Mutation_p.T110P|RASGRP4_ENST00000586305.1_Missense_Mutation_p.T110P|RASGRP4_ENST00000433821.2_Missense_Mutation_p.T110P			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	110	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTGTCCCCTGTGGCCTTCTGG	0.592																																						dbGAP											0													106.0	116.0	113.0					19																	38911597		2003	4178	6181	-	-	-	SO:0001583	missense	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.328A>C	19.37:g.38911597T>G	ENSP00000465772:p.Thr110Pro		A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.T110P	ENST00000587738.1	37	c.328	CCDS46068.1	19	.	.	.	.	.	.	.	.	.	.	T	9.545	1.114465	0.20795	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	3.89	0.467	0.16721	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.671863	0.14981	N	0.287241	T	0.13970	0.0338	N	0.19112	0.55	0.21984	N	0.999432	B;B;B;B;B;B;B	0.31730	0.0;0.0;0.016;0.337;0.016;0.0;0.167	B;B;B;B;B;B;B	0.23419	0.001;0.0;0.032;0.046;0.032;0.003;0.046	T	0.13548	-1.0505	10	0.44086	T	0.13	-0.0425	3.0536	0.06177	0.1922:0.3393:0.0:0.4685	.	110;110;110;110;110;110;110	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	P	110	ENSP00000411878:T110P;ENSP00000293062:T110P;ENSP00000445966:T110P;ENSP00000416463:T110P	ENSP00000293062:T110P	T	-	1	0	RASGRP4	43603437	0.908000	0.30866	0.463000	0.27130	0.448000	0.32197	0.052000	0.14163	-0.077000	0.12752	-0.376000	0.06991	ACA	RASGRP4	-	superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000171777		0.592	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	102	0.00	0	T	NM_170604		38911597	38911597	-1	no_errors	ENST00000587738	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	0.547	G
RBMS3	27303	genome.wustl.edu	37	3	29938890	29938890	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:29938890G>C	ENST00000383767.2	+	9	1148	c.812G>C	c.(811-813)aGt>aCt	p.S271T	RBMS3_ENST00000396583.3_Missense_Mutation_p.S284T|RBMS3_ENST00000456853.1_Missense_Mutation_p.S284T|RBMS3_ENST00000452462.1_Missense_Mutation_p.S271T|RBMS3_ENST00000434693.2_Missense_Mutation_p.S270T|RBMS3_ENST00000383766.2_Missense_Mutation_p.S270T|RBMS3_ENST00000273139.9_Missense_Mutation_p.S271T			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	271					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				TCACCGTACAGTATTGCAACC	0.433																																						dbGAP											0													265.0	242.0	250.0					3																	29938890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.812G>C	3.37:g.29938890G>C	ENSP00000373277:p.Ser271Thr		A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,prints_Hud_Sxl_RNA,pfscan_RRM_dom	p.S271T	ENST00000383767.2	37	c.812	CCDS33724.1	3	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083938	0.76642	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.27104	1.69;1.77;1.72;1.73;1.81;1.72;1.78	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.80982	2.52	0.58432	D	0.999993	P;P;P;B	0.46327	0.876;0.758;0.876;0.424	P;P;P;B	0.51415	0.596;0.467;0.669;0.109	T	0.36504	-0.9745	9	.	.	.	.	12.143	0.54008	0.0783:0.0:0.9217:0.0	.	271;284;270;271	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	T	270;284;271;271;270;271;284	ENSP00000395592:S270T;ENSP00000379828:S284T;ENSP00000373277:S271T;ENSP00000273139:S271T;ENSP00000373276:S270T;ENSP00000397926:S271T;ENSP00000400519:S284T	.	S	+	2	0	RBMS3	29913894	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.061000	0.89467	2.433000	0.82419	0.655000	0.94253	AGT	RBMS3	-	NULL	ENSG00000144642		0.433	RBMS3-001	KNOWN	basic|CCDS	protein_coding	RBMS3	HGNC	protein_coding	OTTHUMT00000341306.1	43	0.00	0	G	NM_001003792		29938890	29938890	+1	no_errors	ENST00000383767	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	C
RIMS3	9783	genome.wustl.edu	37	1	41107465	41107465	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr1:41107465G>A	ENST00000372684.3	-	3	602	c.133C>T	c.(133-135)Cgg>Tgg	p.R45W	RIMS3_ENST00000372683.1_Missense_Mutation_p.R45W	NM_014747.2	NP_055562.2	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	45					calcium ion-dependent exocytosis (GO:0017156)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			CTGCTCCGCCGCTTCTTGGCG	0.662																																						dbGAP											0													41.0	40.0	40.0					1																	41107465		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC003103	CCDS30687.1	1p34.2	2013-09-19			ENSG00000117016	ENSG00000117016			21292	protein-coding gene	gene with protein product		611600				12620390, 10748113	Standard	NM_014747		Approved	RIM3, NIM3	uc001cfu.1	Q9UJD0	OTTHUMG00000007453	ENST00000372684.3:c.133C>T	1.37:g.41107465G>A	ENSP00000361769:p.Arg45Trp		D3DPV8|Q92511|X5D7U7	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R45W	ENST00000372684.3	37	c.133	CCDS30687.1	1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852049	0.71719	.	.	ENSG00000117016	ENST00000372684;ENST00000372683	T;T	0.51325	0.71;0.71	5.52	2.48	0.30137	.	0.114264	0.64402	D	0.000015	T	0.64853	0.2636	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.66188	-0.5986	10	0.87932	D	0	-22.5391	12.592	0.56447	0.0:0.0:0.4206:0.5794	.	45	Q9UJD0	RIMS3_HUMAN	W	45	ENSP00000361769:R45W;ENSP00000361768:R45W	ENSP00000361768:R45W	R	-	1	2	RIMS3	40880052	1.000000	0.71417	0.996000	0.52242	0.866000	0.49608	0.981000	0.29526	0.231000	0.21079	-0.182000	0.12963	CGG	RIMS3	-	NULL	ENSG00000117016		0.662	RIMS3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RIMS3	HGNC	protein_coding	OTTHUMT00000019585.1	65	0.00	0	G	NM_014747		41107465	41107465	-1	no_errors	ENST00000372683	ensembl	human	known	69_37n	missense	37	48.61	35	SNP	1.000	A
RRN3P1	730092	genome.wustl.edu	37	16	21817530	21817530	+	RNA	SNP	T	T	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr16:21817530T>C	ENST00000546471.1	-	0	1528							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		TAATCCTTAGTAAGTTATGAA	0.289																																						dbGAP											0																																										-	-	-			0					16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21817530T>C			A8K6T4|B3KWX9|O75704	RNA	SNP	-	NULL	ENST00000546471.1	37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124		0.289	RRN3P1-002	KNOWN	basic	processed_transcript	RRN3P1	HGNC	pseudogene	OTTHUMT00000409035.1	98	0.00	0	T	NR_003370		21817530	21817530	-1	no_errors	ENST00000546471	ensembl	human	known	69_37n	rna	81	42.96	61	SNP	1.000	C
SEH1L	81929	genome.wustl.edu	37	18	12984155	12984155	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr18:12984155C>T	ENST00000262124.11	+	8	1163	c.1036C>T	c.(1036-1038)Ctt>Ttt	p.L346F	SEH1L_ENST00000399892.2_Missense_Mutation_p.L346F|SEH1L_ENST00000592582.1_3'UTR|RP11-773H22.4_ENST00000588211.1_RNA	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	346					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						TATTCCAAGTCTTCAGAATTC	0.413																																						dbGAP											0													106.0	116.0	112.0					18																	12984155		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.1036C>T	18.37:g.12984155C>T	ENSP00000262124:p.Leu346Phe		A8K5B1|Q8NFU6|Q96MH3|Q9C069	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L346F	ENST00000262124.11	37	c.1036	CCDS45832.1	18	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206758	0.58343	.	.	ENSG00000085415	ENST00000399892;ENST00000262124	T;T	0.70749	-0.35;-0.51	6.04	6.04	0.98038	.	0.134097	0.53938	D	0.000041	T	0.66147	0.2760	L	0.60455	1.87	0.42653	D	0.993454	B;P	0.48503	0.255;0.911	B;B	0.42282	0.07;0.382	T	0.63211	-0.6688	10	0.16420	T	0.52	-21.2568	13.7479	0.62887	0.0:0.9302:0.0:0.0698	.	346;346	Q96EE3;Q96EE3-1	SEH1_HUMAN;.	F	346	ENSP00000382779:L346F;ENSP00000262124:L346F	ENSP00000262124:L346F	L	+	1	0	SEH1L	12974155	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.474000	0.45154	2.873000	0.98535	0.563000	0.77884	CTT	SEH1L	-	NULL	ENSG00000085415		0.413	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	64	0.00	0	C	NM_031216		12984155	12984155	+1	no_errors	ENST00000399892	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	T
SEH1L	81929	genome.wustl.edu	37	18	12984180	12984180	+	Missense_Mutation	SNP	C	C	T	rs374251437		TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr18:12984180C>T	ENST00000262124.11	+	8	1188	c.1061C>T	c.(1060-1062)tCt>tTt	p.S354F	SEH1L_ENST00000399892.2_Missense_Mutation_p.S354F|SEH1L_ENST00000592582.1_3'UTR|RP11-773H22.4_ENST00000588211.1_RNA	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	354					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						AATGGATCTTCTGCTGGCAGG	0.413																																						dbGAP											0													109.0	118.0	115.0					18																	12984180		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.1061C>T	18.37:g.12984180C>T	ENSP00000262124:p.Ser354Phe		A8K5B1|Q8NFU6|Q96MH3|Q9C069	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S354F	ENST00000262124.11	37	c.1061	CCDS45832.1	18	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172341	0.78452	.	.	ENSG00000085415	ENST00000399892;ENST00000262124	T;T	0.71341	-0.46;-0.56	6.04	6.04	0.98038	.	0.531595	0.22663	N	0.057180	T	0.78110	0.4232	L	0.57536	1.79	0.58432	D	0.999999	B;D	0.53151	0.38;0.958	B;P	0.51135	0.265;0.66	T	0.79032	-0.1969	10	0.87932	D	0	-11.541	20.5948	0.99439	0.0:1.0:0.0:0.0	.	354;354	Q96EE3;Q96EE3-1	SEH1_HUMAN;.	F	354	ENSP00000382779:S354F;ENSP00000262124:S354F	ENSP00000262124:S354F	S	+	2	0	SEH1L	12974180	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.580000	0.67464	2.873000	0.98535	0.563000	0.77884	TCT	SEH1L	-	NULL	ENSG00000085415		0.413	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	62	0.00	0	C	NM_031216		12984180	12984180	+1	no_errors	ENST00000399892	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	1.000	T
SETD5	55209	genome.wustl.edu	37	3	9482144	9482144	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:9482144C>G	ENST00000406341.1	+	7	762	c.572C>G	c.(571-573)tCt>tGt	p.S191C	SETD5_ENST00000402466.1_Missense_Mutation_p.S93C|SETD5_ENST00000302463.6_Missense_Mutation_p.S93C|SETD5_ENST00000402198.1_Missense_Mutation_p.S191C|SETD5_ENST00000407969.1_Missense_Mutation_p.S210C			Q9C0A6	SETD5_HUMAN	SET domain containing 5	191										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CTACAGAATTCTCCCTCTGAA	0.423																																						dbGAP											0													43.0	40.0	41.0					3																	9482144		1818	4068	5886	-	-	-	SO:0001583	missense	0			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.572C>G	3.37:g.9482144C>G	ENSP00000383939:p.Ser191Cys		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.S191C	ENST00000406341.1	37	c.572	CCDS46741.1	3	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789763	0.90367	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000442373;ENST00000302463	D;D;D;D;T;D	0.93763	-2.87;-3.28;-2.87;-2.86;0.64;-3.28	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.96219	0.8767	M	0.62723	1.935	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.993;0.991	D	0.96493	0.9365	10	0.87932	D	0	-4.4581	19.1894	0.93658	0.0:1.0:0.0:0.0	.	93;191;210	Q9C0A6-3;Q9C0A6;E7EWN3	.;SETD5_HUMAN;.	C	191;93;191;210;80;93	ENSP00000385852:S191C;ENSP00000384429:S93C;ENSP00000383939:S191C;ENSP00000384114:S210C;ENSP00000408837:S80C;ENSP00000302028:S93C	ENSP00000302028:S93C	S	+	2	0	SETD5	9457144	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.628000	0.89032	0.563000	0.77884	TCT	SETD5	-	NULL	ENSG00000168137		0.423	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1	55	0.00	0	C	XM_371614		9482144	9482144	+1	no_errors	ENST00000402198	ensembl	human	known	69_37n	missense	35	38.60	22	SNP	1.000	G
SLIT2	9353	genome.wustl.edu	37	4	20530616	20530616	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr4:20530616G>T	ENST00000504154.1	+	16	1759	c.1507G>T	c.(1507-1509)Gat>Tat	p.D503Y	SLIT2_ENST00000503837.1_Missense_Mutation_p.D499Y|MIR218-1_ENST00000384999.1_RNA|SLIT2_ENST00000503823.1_Missense_Mutation_p.D495Y|SLIT2_ENST00000273739.5_Missense_Mutation_p.D507Y	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	503	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CTGCTTTGCGGATCTGGCTTG	0.398																																						dbGAP											0													120.0	122.0	121.0					4																	20530616		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1507G>T	4.37:g.20530616G>T	ENSP00000422591:p.Asp503Tyr		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.D503Y	ENST00000504154.1	37	c.1507	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083966	0.76642	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.73708	0.981;0.947	T	0.60692	-0.7213	10	0.87932	D	0	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	495;503	O94813-3;O94813	.;SLIT2_HUMAN	Y	495;503;507;499;499	ENSP00000427548:D495Y;ENSP00000422591:D503Y;ENSP00000273739:D507Y;ENSP00000422261:D499Y	ENSP00000273739:D507Y	D	+	1	0	SLIT2	20139714	1.000000	0.71417	0.987000	0.45799	0.974000	0.67602	9.467000	0.97671	2.798000	0.96311	0.655000	0.94253	GAT	SLIT2	-	NULL	ENSG00000145147		0.398	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	50	0.00	0	G			20530616	20530616	+1	no_errors	ENST00000504154	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	1.000	T
SLC25A4	291	genome.wustl.edu	37	4	186066173	186066173	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr4:186066173G>A	ENST00000281456.6	+	2	499	c.367G>A	c.(367-369)Gct>Act	p.A123T		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	123			A -> D (in hypertrophic cardiomyopathy; sporadic patient with mild myopathy, exercise intolerance and lactic acidosis but no ophthalmoplegia). {ECO:0000269|PubMed:16155110}.		adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	CGGTGGGGCCGCTGGGGCCAC	0.607																																						dbGAP											0													56.0	56.0	56.0					4																	186066173		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.367G>A	4.37:g.186066173G>A	ENSP00000281456:p.Ala123Thr		D3DP59	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor,prints_Mit_uncoupling	p.A123T	ENST00000281456.6	37	c.367	CCDS34114.1	4	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018746	0.93404	.	.	ENSG00000151729	ENST00000281456	D	0.87650	-2.28	5.5	4.66	0.58398	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.93769	0.8008	M	0.92784	3.345	0.80722	D	1	D	0.67145	0.996	P	0.58454	0.839	D	0.95175	0.8294	10	0.87932	D	0	-13.601	14.7348	0.69409	0.0692:0.0:0.9308:0.0	.	123	P12235	ADT1_HUMAN	T	123	ENSP00000281456:A123T	ENSP00000281456:A123T	A	+	1	0	SLC25A4	186303167	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.827000	0.86722	1.558000	0.49541	0.655000	0.94253	GCT	SLC25A4	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Aden_trnslctor	ENSG00000151729		0.607	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A4	HGNC	protein_coding	OTTHUMT00000259170.3	61	0.00	0	G	NM_001151		186066173	186066173	+1	no_errors	ENST00000281456	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	A
SOX8	30812	genome.wustl.edu	37	16	1034797	1034797	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr16:1034797C>T	ENST00000293894.3	+	3	867	c.752C>T	c.(751-753)cCg>cTg	p.P251L		NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	251					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				GGACGCCGGCCGGTGGACAGC	0.697																																						dbGAP											0													23.0	22.0	23.0					16																	1034797		2196	4293	6489	-	-	-	SO:0001583	missense	0			AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.752C>T	16.37:g.1034797C>T	ENSP00000293894:p.Pro251Leu		Q9NZW2	Missense_Mutation	SNP	pfam_HMG_superfamily,pfam_Sox_N,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.P251L	ENST00000293894.3	37	c.752	CCDS10428.1	16	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.127365	0.00342	.	.	ENSG00000005513	ENST00000293894	D	0.96587	-4.06	3.95	2.86	0.33363	.	0.165132	0.40818	N	0.001009	T	0.73218	0.3559	N	0.00021	-2.75	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.74662	-0.3590	10	0.02654	T	1	.	7.9049	0.29757	0.0:0.1027:0.0:0.8973	.	251	P57073	SOX8_HUMAN	L	251	ENSP00000293894:P251L	ENSP00000293894:P251L	P	+	2	0	SOX8	974798	0.001000	0.12720	0.979000	0.43373	0.219000	0.24729	0.630000	0.24553	0.595000	0.29777	-0.312000	0.09012	CCG	SOX8	-	NULL	ENSG00000005513		0.697	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX8	HGNC	protein_coding	OTTHUMT00000242867.1	72	0.00	0	C			1034797	1034797	+1	no_errors	ENST00000293894	ensembl	human	known	69_37n	missense	98	16.10	19	SNP	0.011	T
SRRM2-AS1	100128788	genome.wustl.edu	37	16	2790163	2790163	+	RNA	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr16:2790163C>G	ENST00000382313.2	-	0	642				SRRM2-AS1_ENST00000571305.1_RNA|SRRM2-AS1_ENST00000577055.1_RNA|SRRM2-AS1_ENST00000573802.1_RNA					SRRM2 antisense RNA 1																		AAACAGCTGTCAGTCCCCCAA	0.652																																						dbGAP											0																																										-	-	-			0			AK056063		16p13.3	2012-10-12	2012-08-15		ENSG00000205913	ENSG00000205913		"""Long non-coding RNAs"""	44162	non-coding RNA	RNA, long non-coding			"""SRRM2 antisense RNA 1 (non-protein coding)"""				Standard	NR_027274		Approved		uc010uwg.1		OTTHUMG00000177357		16.37:g.2790163C>G				RNA	SNP	-	NULL	ENST00000382313.2	37	NULL		16																																																																																			SRRM2-AS1	-	-	ENSG00000205913		0.652	SRRM2-AS1-003	KNOWN	basic	antisense	SRRM2-AS1	HGNC	antisense	OTTHUMT00000436407.1	50	0.00	0	C	NR_027274		2790163	2790163	-1	no_errors	ENST00000382313	ensembl	human	known	69_37n	rna	37	26.00	13	SNP	0.001	G
SSH2	85464	genome.wustl.edu	37	17	28022491	28022491	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr17:28022491C>A	ENST00000269033.3	-	4	413	c.262G>T	c.(262-264)Gac>Tac	p.D88Y	SSH2_ENST00000540801.1_Missense_Mutation_p.D115Y|SSH2_ENST00000324677.7_5'UTR|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	88					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTGATGTTGTCTTCTGGGCGG	0.373																																						dbGAP											0													175.0	145.0	155.0					17																	28022491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.262G>T	17.37:g.28022491C>A	ENSP00000269033:p.Asp88Tyr		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.D88Y	ENST00000269033.3	37	c.262	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560580	0.45590	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848;ENST00000324677	T;T	0.37915	1.17;1.17	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.66218	0.2767	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.997;0.998;0.988;0.995	T	0.71576	-0.4551	10	0.87932	D	0	-17.9086	18.171	0.89745	0.0:1.0:0.0:0.0	.	115;88;95;88;88	F5H527;Q76I76-3;G5E957;Q76I76-4;Q76I76	.;.;.;.;SSH2_HUMAN	Y	88;115;88;95	ENSP00000269033:D88Y;ENSP00000444743:D115Y	ENSP00000269033:D88Y	D	-	1	0	SSH2	25046617	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.958000	0.76025	2.576000	0.86940	0.650000	0.86243	GAC	SSH2	-	NULL	ENSG00000141298		0.373	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	39	0.00	0	C	NM_033389		28022491	28022491	-1	no_errors	ENST00000269033	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	1.000	A
TC2N	123036	genome.wustl.edu	37	14	92264128	92264128	+	Splice_Site	SNP	C	C	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr14:92264128C>A	ENST00000435962.2	-	8	1179		c.e8+1		TC2N_ENST00000360594.5_Splice_Site|TC2N_ENST00000556018.1_Splice_Site|TC2N_ENST00000340892.5_Splice_Site	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear						regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		CAGCCACTTACGTTGGAACCT	0.338																																						dbGAP											0													78.0	78.0	78.0					14																	92264128		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.855+1G>T	14.37:g.92264128C>A				Splice_Site	SNP	-	e7+1	ENST00000435962.2	37	c.855+1	CCDS9897.1	14	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308484	0.60305	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018	.	.	.	5.59	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.655	0.68825	0.0:0.9297:0.0:0.0703	.	.	.	.	.	-1	.	.	.	-	.	.	TC2N	91333881	1.000000	0.71417	0.974000	0.42286	0.956000	0.61745	5.616000	0.67709	1.345000	0.45676	0.655000	0.94253	.	TC2N	-	-	ENSG00000165929		0.338	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1	67	0.00	0	C	NM_152332	Intron	92264128	92264128	-1	no_errors	ENST00000340892	ensembl	human	known	69_37n	splice_site	38	11.63	5	SNP	0.996	A
TMEM19	55266	genome.wustl.edu	37	12	72091146	72091146	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:72091146delG	ENST00000266673.5	+	4	1063	c.469delG	c.(469-471)gggfs	p.G157fs	RP11-293I14.2_ENST00000548802.1_3'UTR|TMEM19_ENST00000549735.1_Frame_Shift_Del_p.G157fs	NM_018279.3	NP_060749.2	Q96HH6	TMM19_HUMAN	transmembrane protein 19	157						integral component of membrane (GO:0016021)				large_intestine(1)|lung(8)	9		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		AAATGGCCCCGGGGAAATCCC	0.522																																						dbGAP											0													86.0	91.0	89.0					12																	72091146		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC008596	CCDS9002.1	12q15	2004-03-04				ENSG00000139291			25605	protein-coding gene	gene with protein product						12477932	Standard	NM_018279		Approved	FLJ10936	uc001sws.3	Q96HH6	OTTHUMG00000169558	ENST00000266673.5:c.469delG	12.37:g.72091146delG	ENSP00000266673:p.Gly157fs		B2RDL2|Q53FY3|Q9NV41	Frame_Shift_Del	DEL	pfam_DUF92_TMEM19	p.E158fs	ENST00000266673.5	37	c.469	CCDS9002.1	12																																																																																			TMEM19	-	pfam_DUF92_TMEM19	ENSG00000139291		0.522	TMEM19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM19	HGNC	protein_coding	OTTHUMT00000404801.1	80	0.00	0	G	NM_018279		72091146	72091146	+1	no_errors	ENST00000266673	ensembl	human	known	69_37n	frame_shift_del	41	24.07	13	DEL	1.000	-
TMEM132D	121256	genome.wustl.edu	37	12	129569157	129569157	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr12:129569157T>C	ENST00000422113.2	-	6	1860	c.1534A>G	c.(1534-1536)Agc>Ggc	p.S512G	TMEM132D_ENST00000389441.4_Missense_Mutation_p.S50G	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	512					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGGGGCTGCTCAGGTGCTGG	0.547																																						dbGAP											0													118.0	87.0	98.0					12																	129569157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1534A>G	12.37:g.129569157T>C	ENSP00000408581:p.Ser512Gly		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.S512G	ENST00000422113.2	37	c.1534	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	t	17.62	3.434110	0.62955	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.50548	0.74;0.74	4.78	-5.36	0.02689	.	0.992372	0.08201	N	0.982291	T	0.49457	0.1558	M	0.83603	2.65	0.21697	N	0.999587	B;B	0.25955	0.082;0.138	B;B	0.31614	0.036;0.133	T	0.49143	-0.8970	9	.	.	.	-0.3127	11.2154	0.48823	0.0:0.0654:0.5774:0.3572	.	512;50	Q14C87;Q14C87-2	T132D_HUMAN;.	G	50;512	ENSP00000374092:S50G;ENSP00000408581:S512G	.	S	-	1	0	TMEM132D	128135110	0.777000	0.28628	0.003000	0.11579	0.894000	0.52154	1.264000	0.33015	-1.408000	0.02040	0.454000	0.30748	AGC	TMEM132D	-	NULL	ENSG00000151952		0.547	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	81	0.00	0	T	NM_133448		129569157	129569157	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	0.057	C
TP53	7157	genome.wustl.edu	37	17	7577098	7577098	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr17:7577098T>G	ENST00000269305.4	-	8	1029	c.840A>C	c.(838-840)agA>agC	p.R280S	TP53_ENST00000455263.2_Missense_Mutation_p.R280S|TP53_ENST00000420246.2_Missense_Mutation_p.R280S|TP53_ENST00000359597.4_Missense_Mutation_p.R280S|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R280S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280S(15)|p.0?(8)|p.R280R(3)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCGCCGGTCTCTCCCAGGAC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	43	Substitution - Missense(15)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - coding silent(3)|Unknown(2)	upper_aerodigestive_tract(8)|urinary_tract(8)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|lung(2)|ovary(2)|liver(2)|large_intestine(1)											79.0	68.0	72.0					17																	7577098		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.840A>C	17.37:g.7577098T>G	ENSP00000269305:p.Arg280Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R280S	ENST00000269305.4	37	c.840	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178831	0.78564	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	5.13	2.88	0.33553	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.92649	3.33	0.58432	D	0.999997	P;D;D;P	0.89917	0.953;1.0;0.984;0.837	P;D;P;P	0.97110	0.876;1.0;0.875;0.877	D	0.98376	1.0556	10	0.87932	D	0	-21.0303	6.3042	0.21129	0.0:0.3109:0.0:0.6891	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	280;280;280;280;280;269;148	ENSP00000352610:R280S;ENSP00000269305:R280S;ENSP00000398846:R280S;ENSP00000391127:R280S;ENSP00000391478:R280S;ENSP00000425104:R148S	ENSP00000269305:R280S	R	-	3	2	TP53	7517823	0.663000	0.27448	1.000000	0.80357	0.977000	0.68977	-0.234000	0.09028	0.415000	0.25817	0.379000	0.24179	AGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	63	0.00	0	T	NM_000546		7577098	7577098	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	23	45.24	19	SNP	0.998	G
TP53BP1	7158	genome.wustl.edu	37	15	43772084	43772084	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr15:43772084T>A	ENST00000263801.3	-	6	868	c.616A>T	c.(616-618)Agg>Tgg	p.R206W	TP53BP1_ENST00000450115.2_Missense_Mutation_p.R211W|TP53BP1_ENST00000382039.3_Missense_Mutation_p.R211W|TP53BP1_ENST00000382044.4_Missense_Mutation_p.R211W	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	206					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TCAGACAGCCTGGTATAACCA	0.413								Other conserved DNA damage response genes																														dbGAP											0													184.0	155.0	165.0					15																	43772084		2201	4298	6499	-	-	-	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.616A>T	15.37:g.43772084T>A	ENSP00000263801:p.Arg206Trp		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.R211W	ENST00000263801.3	37	c.631	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	T	18.00	3.526195	0.64860	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.10573	3.67;3.67;3.67;3.67;2.86	4.83	-1.88	0.07713	.	0.752361	0.12838	N	0.435071	T	0.12944	0.0314	L	0.51422	1.61	0.09310	N	1	D;D;D;D	0.59357	0.985;0.973;0.984;0.984	P;B;P;P	0.50192	0.527;0.43;0.634;0.634	T	0.11767	-1.0574	10	0.66056	D	0.02	-0.4597	5.7803	0.18301	0.0:0.1798:0.479:0.3412	.	211;206;211;211	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	W	206;211;211;211;211	ENSP00000263801:R206W;ENSP00000371475:R211W;ENSP00000371470:R211W;ENSP00000393497:R211W;ENSP00000388028:R211W	ENSP00000263801:R206W	R	-	1	2	TP53BP1	41559376	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	0.028000	0.13644	-0.529000	0.06358	0.528000	0.53228	AGG	TP53BP1	-	NULL	ENSG00000067369		0.413	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	151	0.00	0	T			43772084	43772084	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	missense	154	22.89	46	SNP	0.000	A
TRIM21	6737	genome.wustl.edu	37	11	4406636	4406636	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr11:4406636C>G	ENST00000254436.7	-	7	1419	c.1307G>C	c.(1306-1308)tGt>tCt	p.C436S	TRIM21_ENST00000543625.1_Missense_Mutation_p.C436S	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	436	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		TGTAAAGGCACATTCAGAGAA	0.498																																						dbGAP											0													76.0	76.0	76.0					11																	4406636		1966	4159	6125	-	-	-	SO:0001583	missense	0			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.1307G>C	11.37:g.4406636C>G	ENSP00000254436:p.Cys436Ser		Q5XPV5|Q96RF8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Ubox_domain,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.C436S	ENST00000254436.7	37	c.1307	CCDS44525.1	11	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568619	0.65651	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.68181	-0.31;-0.31	4.32	4.32	0.51571	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.51477	D	0.000091	T	0.75302	0.3831	L	0.42744	1.35	0.36730	D	0.88164	D	0.76494	0.999	D	0.80764	0.994	T	0.80346	-0.1421	10	0.66056	D	0.02	.	15.0955	0.72232	0.0:1.0:0.0:0.0	.	436	P19474	RO52_HUMAN	S	436	ENSP00000254436:C436S;ENSP00000444045:C436S	ENSP00000254436:C436S	C	-	2	0	TRIM21	4363212	0.098000	0.21812	0.999000	0.59377	0.976000	0.68499	1.975000	0.40569	2.674000	0.91012	0.655000	0.94253	TGT	TRIM21	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000132109		0.498	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM21	HGNC	protein_coding	OTTHUMT00000385842.1	58	0.00	0	C	NM_003141		4406636	4406636	-1	no_errors	ENST00000254436	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	G
TRAF6	7189	genome.wustl.edu	37	11	36511783	36511783	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr11:36511783G>A	ENST00000526995.1	-	7	1420	c.1174C>T	c.(1174-1176)Cgc>Tgc	p.R392C	TRAF6_ENST00000348124.5_Missense_Mutation_p.R392C|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	392	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				AGGTGCAAGCGCATGCACAGT	0.473																																						dbGAP											0													121.0	117.0	118.0					11																	36511783		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1174C>T	11.37:g.36511783G>A	ENSP00000433623:p.Arg392Cys		A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.R392C	ENST00000526995.1	37	c.1174	CCDS7901.1	11	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305424	0.81247	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	T;T	0.50001	0.76;0.76	5.46	5.46	0.80206	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.72170	0.3427	M	0.88377	2.95	0.80722	D	1	D	0.71674	0.998	D	0.68192	0.956	T	0.77419	-0.2595	10	0.87932	D	0	-24.005	14.4901	0.67645	0.0:0.0:0.8531:0.1469	.	392	Q9Y4K3	TRAF6_HUMAN	C	392	ENSP00000433623:R392C;ENSP00000337853:R392C	ENSP00000337853:R392C	R	-	1	0	TRAF6	36468359	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.813000	0.86123	2.716000	0.92895	0.555000	0.69702	CGC	TRAF6	-	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	ENSG00000175104		0.473	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF6	HGNC	protein_coding	OTTHUMT00000389530.1	106	0.00	0	G	NM_145803		36511783	36511783	-1	no_errors	ENST00000348124	ensembl	human	known	69_37n	missense	60	16.44	12	SNP	1.000	A
TSPAN5	10098	genome.wustl.edu	37	4	99399882	99399882	+	Missense_Mutation	SNP	C	C	A	rs373765263		TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr4:99399882C>A	ENST00000305798.3	-	5	932	c.530G>T	c.(529-531)cGa>cTa	p.R177L	TSPAN5_ENST00000509168.1_5'UTR|TSPAN5_ENST00000505184.1_Missense_Mutation_p.R106L	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	177					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)			kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		ACATCGCTCTCGACTTGCATT	0.468																																						dbGAP											0													125.0	111.0	115.0					4																	99399882		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.530G>T	4.37:g.99399882C>A	ENSP00000307701:p.Arg177Leu		B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Nonsense_Mutation	SNP	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	p.E156*	ENST00000305798.3	37	c.466	CCDS3646.1	4	.	.	.	.	.	.	.	.	.	.	C	38	7.002964	0.97994	.	.	ENSG00000168785	ENST00000305798;ENST00000505184;ENST00000515287	T;T;T	0.28069	1.63;2.95;3.62	5.13	5.13	0.70059	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	M	0.67569	2.06	0.80722	D	1	P	0.41188	0.741	P	0.58454	0.839	T	0.54728	-0.8250	10	0.62326	D	0.03	.	18.6095	0.91279	0.0:1.0:0.0:0.0	.	177	P62079	TSN5_HUMAN	L	177;106;106	ENSP00000307701:R177L;ENSP00000423916:R106L;ENSP00000423504:R106L	ENSP00000307701:R177L	R	-	2	0	TSPAN5	99618905	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.662000	0.83803	2.387000	0.81309	0.555000	0.69702	CGA	TSPAN5	-	NULL	ENSG00000168785		0.468	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN5	HGNC	protein_coding	OTTHUMT00000253641.2	50	0.00	0	C	NM_005723		99399882	99399882	-1	no_errors	ENST00000508798	ensembl	human	known	69_37n	nonsense	29	32.56	14	SNP	1.000	A
XRN1	54464	genome.wustl.edu	37	3	142131500	142131500	+	Silent	SNP	C	C	T			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr3:142131500C>T	ENST00000264951.4	-	15	1716	c.1599G>A	c.(1597-1599)ttG>ttA	p.L533L	XRN1_ENST00000392981.2_Silent_p.L533L	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	533					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CATTGGTCATCAAATGCTGTG	0.284																																						dbGAP											0													74.0	77.0	76.0					3																	142131500		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1599G>A	3.37:g.142131500C>T			Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.L533	ENST00000264951.4	37	c.1599	CCDS3123.1	3																																																																																			XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.284	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	82	0.00	0	C	NM_019001		142131500	142131500	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	silent	64	17.95	14	SNP	1.000	T
ZNF107	51427	genome.wustl.edu	37	7	64167462	64167462	+	Silent	SNP	T	T	C			TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr7:64167462T>C	ENST00000395391.1	+	4	2155	c.780T>C	c.(778-780)acT>acC	p.T260T	ZNF107_ENST00000423627.1_Silent_p.T260T|ZNF107_ENST00000344930.3_Silent_p.T260T			Q9UII5	ZN107_HUMAN	zinc finger protein 107	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				CAAATCTTACTAACCATAAGA	0.363																																						dbGAP											0													35.0	39.0	38.0					7																	64167462		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.780T>C	7.37:g.64167462T>C				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T260	ENST00000395391.1	37	c.780	CCDS5527.1	7																																																																																			ZNF107	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196247		0.363	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF107	HGNC	protein_coding	OTTHUMT00000251593.1	33	0.00	0	T	NM_016220		64167462	64167462	+1	no_errors	ENST00000344930	ensembl	human	known	69_37n	silent	28	28.21	11	SNP	0.000	C
ZNF252P	286101	genome.wustl.edu	37	8	146202386	146202386	+	RNA	SNP	A	A	C	rs3866997	byFrequency	TCGA-A2-A4S1-01A-21D-A25Q-09	TCGA-A2-A4S1-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	3a3dd048-d442-48aa-a6fe-40fcfbe48c7a	413a32b3-920e-41ae-b24d-321a0796645a	g.chr8:146202386A>C	ENST00000426361.2	-	0	1798					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						GAAGAAAGCAAACTGAAGGCT	0.398													C|||	1421	0.283746	0.4743	0.3343	5008	,	,		23582	0.3145		0.0984	False		,,,				2504	0.1493					dbGAP											0																																										-	-	-			0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146202386A>C				RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8	608	0.2783882783882784	236	0.4796747967479675	105	0.2900552486187845	187	0.3269230769230769	80	0.10554089709762533	C	0.011	-1.728687	0.00694	.	.	ENSG00000196922	ENST00000355436	.	.	.	2.97	-0.731	0.11151	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46925	-0.9156	4	0.15066	T	0.55	.	7.7854	0.29089	0.2638:0.229:0.5071:0.0	rs3866997;rs57320357;rs3866997	.	.	.	V	488	.	ENSP00000347611:L488V	L	-	1	2	ZNF252	146173190	0.000000	0.05858	0.061000	0.19648	0.449000	0.32228	-1.893000	0.01609	-0.354000	0.08212	-0.281000	0.10026	TTG	ZNF252P	-	-	ENSG00000196922		0.398	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	42	0.00	0	A	NR_023392		146202386	146202386	-1	no_errors	ENST00000426361	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	C
