#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABAT	18	genome.wustl.edu	37	16	8858630	8858630	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:8858630G>T	ENST00000396600.2	+	8	1421	c.483G>T	c.(481-483)atG>atT	p.M161I	ABAT_ENST00000567812.1_Missense_Mutation_p.M176I|ABAT_ENST00000569156.1_Missense_Mutation_p.M161I|ABAT_ENST00000425191.2_Missense_Mutation_p.M161I|ABAT_ENST00000268251.8_Missense_Mutation_p.M161I	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	161				MSQLITMACGSCSNENA -> CPSSSPWPACPAPMKTT (in Ref. 2; AAB38510). {ECO:0000305}.	behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	TCATCACCATGGCCTGCGGCT	0.592																																						dbGAP											0													134.0	109.0	117.0					16																	8858630		2197	4300	6497	-	-	-	SO:0001583	missense	0			L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.483G>T	16.37:g.8858630G>T	ENSP00000379845:p.Met161Ile		A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	p.M161I	ENST00000396600.2	37	c.483	CCDS10534.1	16	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895312	0.72639	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	D;D;D	0.86097	-2.07;-2.07;-2.07	5.63	5.63	0.86233	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	L	0.58302	1.8	0.80722	D	1	P	0.34462	0.454	B	0.36418	0.224	D	0.84365	0.0540	10	0.51188	T	0.08	-13.0732	18.7245	0.91710	0.0:0.0:1.0:0.0	.	161	P80404	GABT_HUMAN	I	161	ENSP00000268251:M161I;ENSP00000379845:M161I;ENSP00000411916:M161I	ENSP00000268251:M161I	M	+	3	0	ABAT	8766131	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.661000	0.90470	0.650000	0.86243	ATG	ABAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4NH2But_aminotransferase_euk	ENSG00000183044		0.592	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	HGNC	protein_coding	OTTHUMT00000433620.2	108	0.00	0	G	NM_020686		8858630	8858630	+1	no_errors	ENST00000268251	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	T
ZNF721	170960	genome.wustl.edu	37	4	420491	420491	+	IGR	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:420491C>A	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						CTTTTTAACACAAAACGAAAC	0.378																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.420491C>A			Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.378	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	108	0.00	0	C	NM_133474		420491	420491	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	61	29.07	25	SNP	0.996	A
ZNF721	170960	genome.wustl.edu	37	4	420491	420491	+	IGR	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr4:420491C>A	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						CTTTTTAACACAAAACGAAAC	0.378																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.420491C>A			Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.378	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	159	0.00	0	C	NM_133474		420491	420491	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	85	30.33	37	SNP	0.996	A
ZNF721	170960	genome.wustl.edu	37	4	420491	420491	+	IGR	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:420491C>A	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						CTTTTTAACACAAAACGAAAC	0.378																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.420491C>A			Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.378	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	108	0.00	0	C	NM_133474		420491	420491	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	66	33.33	33	SNP	0.996	A
ABCA8	10351	genome.wustl.edu	37	17	66871785	66871785	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:66871785C>T	ENST00000269080.2	-	34	4477	c.4340G>A	c.(4339-4341)cGa>cAa	p.R1447Q	ABCA8_ENST00000586539.1_Missense_Mutation_p.R1487Q|ABCA8_ENST00000430352.2_Missense_Mutation_p.R1487Q	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1447	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GATGGCCACTCGGTCACACAC	0.562																																						dbGAP											0													91.0	72.0	78.0					17																	66871785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4340G>A	17.37:g.66871785C>T	ENSP00000269080:p.Arg1447Gln		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1487Q	ENST00000269080.2	37	c.4460	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797580	0.90538	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.99129	-5.46;-5.46	4.36	3.39	0.38822	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.133037	0.34178	N	0.004194	D	0.98940	0.9640	M	0.71581	2.175	0.49483	D	0.999797	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.949;0.977;0.965	D	0.99418	1.0932	10	0.87932	D	0	.	11.5112	0.50494	0.0:0.9124:0.0:0.0876	.	1487;1487;1447	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	Q	1447;1487	ENSP00000269080:R1447Q;ENSP00000402814:R1487Q	ENSP00000269080:R1447Q	R	-	2	0	ABCA8	64383380	0.997000	0.39634	0.943000	0.38184	0.998000	0.95712	3.662000	0.54510	1.204000	0.43247	0.650000	0.86243	CGA	ABCA8	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000141338		0.562	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	87	0.00	0	C	NM_007168		66871785	66871785	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	0.997	T
ABCA8	10351	genome.wustl.edu	37	17	66871785	66871785	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr17:66871785C>T	ENST00000269080.2	-	34	4477	c.4340G>A	c.(4339-4341)cGa>cAa	p.R1447Q	ABCA8_ENST00000586539.1_Missense_Mutation_p.R1487Q|ABCA8_ENST00000430352.2_Missense_Mutation_p.R1487Q	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1447	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GATGGCCACTCGGTCACACAC	0.562																																						dbGAP											0													91.0	72.0	78.0					17																	66871785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4340G>A	17.37:g.66871785C>T	ENSP00000269080:p.Arg1447Gln		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1487Q	ENST00000269080.2	37	c.4460	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797580	0.90538	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.99129	-5.46;-5.46	4.36	3.39	0.38822	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.133037	0.34178	N	0.004194	D	0.98940	0.9640	M	0.71581	2.175	0.49483	D	0.999797	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.949;0.977;0.965	D	0.99418	1.0932	10	0.87932	D	0	.	11.5112	0.50494	0.0:0.9124:0.0:0.0876	.	1487;1487;1447	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	Q	1447;1487	ENSP00000269080:R1447Q;ENSP00000402814:R1487Q	ENSP00000269080:R1447Q	R	-	2	0	ABCA8	64383380	0.997000	0.39634	0.943000	0.38184	0.998000	0.95712	3.662000	0.54510	1.204000	0.43247	0.650000	0.86243	CGA	ABCA8	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000141338		0.562	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	61	0.00	0	C	NM_007168		66871785	66871785	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	0.997	T
ABCA8	10351	genome.wustl.edu	37	17	66871785	66871785	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:66871785C>T	ENST00000269080.2	-	34	4477	c.4340G>A	c.(4339-4341)cGa>cAa	p.R1447Q	ABCA8_ENST00000586539.1_Missense_Mutation_p.R1487Q|ABCA8_ENST00000430352.2_Missense_Mutation_p.R1487Q	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1447	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GATGGCCACTCGGTCACACAC	0.562																																						dbGAP											0													91.0	72.0	78.0					17																	66871785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4340G>A	17.37:g.66871785C>T	ENSP00000269080:p.Arg1447Gln		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1487Q	ENST00000269080.2	37	c.4460	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797580	0.90538	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.99129	-5.46;-5.46	4.36	3.39	0.38822	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.133037	0.34178	N	0.004194	D	0.98940	0.9640	M	0.71581	2.175	0.49483	D	0.999797	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.949;0.977;0.965	D	0.99418	1.0932	10	0.87932	D	0	.	11.5112	0.50494	0.0:0.9124:0.0:0.0876	.	1487;1487;1447	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	Q	1447;1487	ENSP00000269080:R1447Q;ENSP00000402814:R1487Q	ENSP00000269080:R1447Q	R	-	2	0	ABCA8	64383380	0.997000	0.39634	0.943000	0.38184	0.998000	0.95712	3.662000	0.54510	1.204000	0.43247	0.650000	0.86243	CGA	ABCA8	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000141338		0.562	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	87	0.00	0	C	NM_007168		66871785	66871785	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	46	29.23	19	SNP	0.997	T
ABCC1	4363	genome.wustl.edu	37	16	16165583	16165583	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:16165583G>T	ENST00000399410.3	+	14	2084	c.1909G>T	c.(1909-1911)Gac>Tac	p.D637Y	ABCC1_ENST00000345148.5_Missense_Mutation_p.D637Y|ABCC1_ENST00000346370.5_Missense_Mutation_p.D637Y|ABCC1_ENST00000351154.5_Missense_Mutation_p.D637Y|ABCC1_ENST00000399408.2_Missense_Mutation_p.D637Y|ABCC1_ENST00000349029.5_Missense_Mutation_p.D637Y	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	637					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GCCTGTCAAAGACGGTGTGTG	0.567																																						dbGAP											0													64.0	67.0	66.0					16																	16165583		2031	4189	6220	-	-	-	SO:0001583	missense	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1909G>T	16.37:g.16165583G>T	ENSP00000382342:p.Asp637Tyr		A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.D637Y	ENST00000399410.3	37	c.1909	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037132	0.35893	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.91237	-2.79;-2.81;-2.46;-2.61;-2.74;-2.68	4.64	2.61	0.31194	.	0.517985	0.19739	N	0.107169	D	0.90321	0.6972	L	0.52759	1.655	0.09310	N	0.999997	P;P;P;D;P;P	0.58620	0.785;0.937;0.937;0.983;0.897;0.937	B;P;P;P;B;P	0.56823	0.264;0.785;0.694;0.807;0.396;0.601	T	0.82074	-0.0637	10	0.72032	D	0.01	-16.4761	6.1083	0.20086	0.296:0.0:0.704:0.0	.	637;637;637;637;637;637	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	Y	637;637;637;637;637;637;311	ENSP00000382342:D637Y;ENSP00000382340:D637Y;ENSP00000263019:D637Y;ENSP00000263017:D637Y;ENSP00000263014:D637Y;ENSP00000263016:D637Y	ENSP00000263014:D637Y	D	+	1	0	ABCC1	16073084	1.000000	0.71417	0.963000	0.40424	0.231000	0.25187	2.389000	0.44407	0.903000	0.36546	0.561000	0.74099	GAC	ABCC1	-	tigrfam_Multidrug-R_assoc	ENSG00000103222		0.567	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	64	0.00	0	G	NM_004996		16165583	16165583	+1	no_errors	ENST00000399408	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.709	T
ABCC3	8714	genome.wustl.edu	37	17	48753778	48753779	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:48753778_48753779delGA	ENST00000285238.8	+	23	3287_3288	c.3207_3208delGA	c.(3205-3210)ctgaacfs	p.N1070fs		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1070	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GCCGCATCCTGAACTGCTTCTC	0.545																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3207_3208delGA	17.37:g.48753778_48753779delGA	ENSP00000285238:p.Asn1070fs		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Frame_Shift_Del	DEL	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.N1070fs	ENST00000285238.8	37	c.3207_3208	CCDS32681.1	17																																																																																			ABCC3	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.545	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	70	0.00	0	GA	NM_020038		48753778	48753779	+1	no_errors	ENST00000285238	ensembl	human	known	69_37n	frame_shift_del	16	10.53	2	DEL	1.000:1.000	-
ACACA	31	genome.wustl.edu	37	17	35486354	35486354	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:35486354C>A	ENST00000394406.2	-	47	5960	c.5770G>T	c.(5770-5772)Gag>Tag	p.E1924*	ACACA_ENST00000353139.5_Nonsense_Mutation_p.E1961*|ACACA_ENST00000335166.5_Nonsense_Mutation_p.E1846*|ACACA_ENST00000360679.3_Nonsense_Mutation_p.E1866*|ACACA_ENST00000361253.5_Nonsense_Mutation_p.E50*	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1924	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GGAACAAACTCGATGATTCTG	0.483																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	dbGAP											0													144.0	123.0	130.0					17																	35486354		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5770G>T	17.37:g.35486354C>A	ENSP00000377928:p.Glu1924*		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Nonsense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.E1961*	ENST00000394406.2	37	c.5881	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	C	49	15.843622	0.99846	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330;ENST00000361253	.	.	.	5.24	5.24	0.73138	.	0.049482	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-5.7786	18.8136	0.92068	0.0:1.0:0.0:0.0	.	.	.	.	X	1961;1866;1924;1948;1846;623;50	.	ENSP00000335323:E1846X	E	-	1	0	ACACA	32560467	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.625000	0.83145	2.443000	0.82685	0.591000	0.81541	GAG	ACACA	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000132142		0.483	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	48	0.00	0	C	NM_198836		35486354	35486354	-1	no_errors	ENST00000353139	ensembl	human	known	69_37n	nonsense	16	15.79	3	SNP	0.948	A
ADAD2	161931	genome.wustl.edu	37	16	84228721	84228721	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:84228721C>A	ENST00000315906.5	+	4	706	c.654C>A	c.(652-654)gcC>gcA	p.A218A	ADAD2_ENST00000268624.3_Silent_p.A290A|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	218					RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						TGGTGAGCGCCGGCTTTGACC	0.657																																						dbGAP											0													42.0	43.0	43.0					16																	84228721		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.654C>A	16.37:g.84228721C>A			B2RCL6|Q8NA94	Missense_Mutation	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.P127Q	ENST00000315906.5	37	c.380	CCDS45536.1	16																																																																																			ADAD2	-	NULL	ENSG00000140955		0.657	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	HGNC	protein_coding	OTTHUMT00000433385.1	156	0.00	0	C	NM_139174		84228721	84228721	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000567685	ensembl	human	novel	69_37n	missense	43	10.42	5	SNP	0.252	A
ADAM10	102	genome.wustl.edu	37	15	58902642	58902642	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:58902642G>T	ENST00000260408.3	-	14	2322	c.1879C>A	c.(1879-1881)Caa>Aaa	p.Q627K	ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000396140.2_Missense_Mutation_p.Q326K|ADAM10_ENST00000561288.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	627	Cys-rich.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		GATCCAGGTTGCAGGGTGATG	0.473																																						dbGAP											0													106.0	97.0	100.0					15																	58902642		2192	4292	6484	-	-	-	SO:0001583	missense	0			AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1879C>A	15.37:g.58902642G>T	ENSP00000260408:p.Gln627Lys		B4DU28|Q10742|Q92650	Missense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.Q627K	ENST00000260408.3	37	c.1879	CCDS10167.1	15	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159919	0.38119	.	.	ENSG00000137845	ENST00000260408;ENST00000396136;ENST00000396140	T;T	0.23754	1.89;3.19	5.37	5.37	0.77165	.	0.103406	0.64402	D	0.000003	T	0.22859	0.0552	L	0.39633	1.23	0.80722	D	1	B;B;B	0.15719	0.005;0.014;0.013	B;B;B	0.14578	0.005;0.011;0.005	T	0.09640	-1.0665	10	0.08179	T	0.78	-16.7513	19.4747	0.94982	0.0:0.0:1.0:0.0	.	326;446;627	B4DU28;A8MY20;O14672	.;.;ADA10_HUMAN	K	627;446;326	ENSP00000260408:Q627K;ENSP00000379444:Q326K	ENSP00000260408:Q627K	Q	-	1	0	ADAM10	56689934	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.420000	0.97426	2.666000	0.90696	0.655000	0.94253	CAA	ADAM10	-	NULL	ENSG00000137845		0.473	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM10	HGNC	protein_coding	OTTHUMT00000255880.2	79	0.00	0	G	NM_001110		58902642	58902642	-1	no_errors	ENST00000260408	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	T
ADAMTS16	170690	genome.wustl.edu	37	5	5319177	5319177	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:5319177C>T	ENST00000274181.7	+	23	3739	c.3601C>T	c.(3601-3603)Ccc>Tcc	p.P1201S		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1201	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CTACCTGGTACCCCAGCACGG	0.537																																						dbGAP											0													48.0	50.0	49.0					5																	5319177		2005	4173	6178	-	-	-	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3601C>T	5.37:g.5319177C>T	ENSP00000274181:p.Pro1201Ser		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1201S	ENST00000274181.7	37	c.3601	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117735	0.77323	.	.	ENSG00000145536	ENST00000274181	T	0.41065	1.01	4.54	4.54	0.55810	PLAC (2);	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57271	-0.7840	10	0.25106	T	0.35	.	15.1459	0.72650	0.0:1.0:0.0:0.0	.	1201	Q8TE57	ATS16_HUMAN	S	1201	ENSP00000274181:P1201S	ENSP00000274181:P1201S	P	+	1	0	ADAMTS16	5372177	1.000000	0.71417	0.947000	0.38551	0.679000	0.39708	7.145000	0.77365	2.233000	0.73108	0.467000	0.42956	CCC	ADAMTS16	-	pfam_PLAC,pfscan_PLAC	ENSG00000145536		0.537	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	39	0.00	0	C	NM_139056		5319177	5319177	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	T
ADAMTS2	9509	genome.wustl.edu	37	5	178557077	178557077	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:178557077G>T	ENST00000251582.7	-	16	2414	c.2313C>A	c.(2311-2313)ggC>ggA	p.G771G		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	771	Spacer.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGATGAACTTGCCTGTCTCCA	0.567																																						dbGAP											0													100.0	88.0	92.0					5																	178557077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2313C>A	5.37:g.178557077G>T				Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.G771	ENST00000251582.7	37	c.2313	CCDS4444.1	5																																																																																			ADAMTS2	-	pfam_ADAM_spacer1	ENSG00000087116		0.567	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	58	0.00	0	G	NM_014244		178557077	178557077	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.998	T
ADAMTS7	11173	genome.wustl.edu	37	15	79051766	79051766	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:79051766G>T	ENST00000388820.4	-	24	5268	c.5058C>A	c.(5056-5058)cgC>cgA	p.R1686R		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1686					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GGCGCAGTCAGCGGCGGGCAA	0.726																																						dbGAP											0													8.0	9.0	9.0					15																	79051766		2100	4165	6265	-	-	-	SO:0001819	synonymous_variant	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.5058C>A	15.37:g.79051766G>T			Q14F51|Q6P7J9	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1686	ENST00000388820.4	37	c.5058	CCDS32303.1	15																																																																																			ADAMTS7	-	NULL	ENSG00000136378		0.726	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	25	0.00	0	G	NM_014272		79051766	79051766	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	silent	11	21.43	3	SNP	0.906	T
ADCK1	57143	genome.wustl.edu	37	14	78398044	78398044	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:78398044G>T	ENST00000238561.5	+	10	1489	c.1390G>T	c.(1390-1392)Gcg>Tcg	p.A464S	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Missense_Mutation_p.A396S	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	471	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		CTGCATCAGAGCGCTAGCTGA	0.637																																						dbGAP											0													85.0	73.0	77.0					14																	78398044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1390G>T	14.37:g.78398044G>T	ENSP00000238561:p.Ala464Ser		B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	pfam_UbiB_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	p.A464S	ENST00000238561.5	37	c.1390	CCDS9869.1	14	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621881	0.66787	.	.	ENSG00000063761	ENST00000238561;ENST00000341211	T;T	0.68479	-0.33;1.05	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.70535	0.3235	M	0.68952	2.095	0.80722	D	1	P;B;P	0.43701	0.719;0.244;0.815	B;B;P	0.47573	0.348;0.264;0.55	T	0.66862	-0.5816	10	0.11485	T	0.65	-22.1723	18.5888	0.91200	0.0:0.0:1.0:0.0	.	471;396;464	Q86TW2;Q9UIE6;Q86TW2-2	ADCK1_HUMAN;.;.	S	464;396	ENSP00000238561:A464S;ENSP00000339663:A396S	ENSP00000238561:A464S	A	+	1	0	ADCK1	77467797	1.000000	0.71417	0.376000	0.26042	0.572000	0.35998	7.680000	0.84062	2.454000	0.82982	0.549000	0.68633	GCG	ADCK1	-	NULL	ENSG00000063761		0.637	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK1	HGNC	protein_coding	OTTHUMT00000413864.1	45	0.00	0	G	NM_020421		78398044	78398044	+1	no_errors	ENST00000238561	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	1.000	T
ADCY6	112	genome.wustl.edu	37	12	49176977	49176977	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:49176977delC	ENST00000307885.4	-	1	935	c.241delG	c.(241-243)gagfs	p.E81fs	ADCY6_ENST00000357869.3_Frame_Shift_Del_p.E81fs|ADCY6_ENST00000550422.1_Frame_Shift_Del_p.E81fs	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	81					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						AGCCCCAGCTCCTTGCCCTTG	0.741																																						dbGAP											0													28.0	32.0	31.0					12																	49176977		2195	4272	6467	-	-	-	SO:0001589	frameshift_variant	0				CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.241delG	12.37:g.49176977delC	ENSP00000311405:p.Glu81fs		Q9NR75|Q9UDB0	Frame_Shift_Del	DEL	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E81fs	ENST00000307885.4	37	c.241	CCDS8767.1	12																																																																																			ADCY6	-	NULL	ENSG00000174233		0.741	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY6	HGNC	protein_coding	OTTHUMT00000408863.1	48	0.00	0	C	NM_020983		49176977	49176977	-1	no_errors	ENST00000307885	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	1.000	-
ADD3	120	genome.wustl.edu	37	10	111893205	111893205	+	Missense_Mutation	SNP	C	C	A	rs75685464		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:111893205C>A	ENST00000356080.4	+	15	2317	c.1950C>A	c.(1948-1950)agC>agA	p.S650R	ADD3_ENST00000360162.3_Missense_Mutation_p.S618R|ADD3_ENST00000277900.8_Missense_Mutation_p.S618R	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	650						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GTAGGTTAAGCACAAGTACAA	0.433																																						dbGAP											0													149.0	139.0	142.0					10																	111893205		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1950C>A	10.37:g.111893205C>A	ENSP00000348381:p.Ser650Arg		D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.S650R	ENST00000356080.4	37	c.1950	CCDS7561.1	10	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199611	0.58126	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.42513	0.97;0.97;0.97	5.71	-8.17	0.01057	.	0.094628	0.64402	D	0.000001	T	0.24547	0.0595	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.28552	0.215;0.178	B;B	0.35470	0.135;0.203	T	0.16276	-1.0408	10	0.45353	T	0.12	-13.2941	6.9846	0.24721	0.0995:0.5103:0.1017:0.2885	.	650;618	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	R	618;650;618	ENSP00000353286:S618R;ENSP00000348381:S650R;ENSP00000277900:S618R	ENSP00000277900:S618R	S	+	3	2	ADD3	111883195	0.040000	0.19996	0.861000	0.33841	0.931000	0.56810	-0.856000	0.04290	-0.973000	0.03555	-0.300000	0.09419	AGC	ADD3	-	NULL	ENSG00000148700		0.433	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD3	HGNC	protein_coding	OTTHUMT00000050289.1	38	0.00	0	C	NM_019903		111893205	111893205	+1	no_errors	ENST00000356080	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.890	A
ALPK3	57538	genome.wustl.edu	37	15	85383885	85383885	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:85383885G>A	ENST00000258888.5	+	5	2148	c.1981G>A	c.(1981-1983)Gtg>Atg	p.V661M		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	661					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGCGAGGGGGTGCCTGGCGC	0.647																																						dbGAP											0													33.0	34.0	34.0					15																	85383885		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1981G>A	15.37:g.85383885G>A	ENSP00000258888:p.Val661Met		Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.V661M	ENST00000258888.5	37	c.1981	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474447	0.26423	.	.	ENSG00000136383	ENST00000258888	T	0.60920	0.15	4.71	0.379	0.16213	.	17.393200	0.00166	N	0.000000	T	0.42337	0.1198	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.25117	-1.0141	10	0.46703	T	0.11	0.0757	3.0999	0.06322	0.314:0.0:0.4825:0.2035	.	661	Q96L96	ALPK3_HUMAN	M	661	ENSP00000258888:V661M	ENSP00000258888:V661M	V	+	1	0	ALPK3	83184889	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.261000	0.08694	0.232000	0.21100	0.557000	0.71058	GTG	ALPK3	-	NULL	ENSG00000136383		0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	28	0.00	0	G	NM_020778		85383885	85383885	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.000	A
ALS2	57679	genome.wustl.edu	37	2	202580403	202580403	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:202580403G>A	ENST00000264276.6	-	25	4368	c.3996C>T	c.(3994-3996)caC>caT	p.H1332H	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1332					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						ACCTGTCTCTGTGCTGGCGCC	0.502																																						dbGAP											0													90.0	88.0	89.0					2																	202580403		1925	4121	6046	-	-	-	SO:0001819	synonymous_variant	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3996C>T	2.37:g.202580403G>A			Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_DH-domain,smart_MORN,prints_Reg_chr_condens,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain	p.H1332	ENST00000264276.6	37	c.3996	CCDS42800.1	2																																																																																			ALS2	-	NULL	ENSG00000003393		0.502	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	26	0.00	0	G	NM_020919		202580403	202580403	-1	no_errors	ENST00000264276	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	1.000	A
ALS2	57679	genome.wustl.edu	37	2	202622362	202622362	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:202622362C>T	ENST00000264276.6	-	5	1606	c.1234G>A	c.(1234-1236)Gaa>Aaa	p.E412K		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	412					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						GCACCAGCTTCATAAGTAGCA	0.517																																						dbGAP											0													68.0	69.0	69.0					2																	202622362		1973	4173	6146	-	-	-	SO:0001583	missense	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1234G>A	2.37:g.202622362C>T	ENSP00000264276:p.Glu412Lys		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_DH-domain,smart_MORN,prints_Reg_chr_condens,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain	p.E412K	ENST00000264276.6	37	c.1234	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964299	0.92791	.	.	ENSG00000003393	ENST00000264276	T	0.58060	0.36	5.45	5.45	0.79879	.	0.050600	0.85682	D	0.000000	T	0.66426	0.2788	L	0.43923	1.385	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.981	D;D;P	0.80764	0.994;0.952;0.718	T	0.60281	-0.7294	10	0.30078	T	0.28	.	19.6467	0.95778	0.0:1.0:0.0:0.0	.	412;412;412	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	K	412	ENSP00000264276:E412K	ENSP00000264276:E412K	E	-	1	0	ALS2	202330607	1.000000	0.71417	0.998000	0.56505	0.819000	0.46315	7.100000	0.76989	2.710000	0.92621	0.563000	0.77884	GAA	ALS2	-	NULL	ENSG00000003393		0.517	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	64	0.00	0	C	NM_020919		202622362	202622362	-1	no_errors	ENST00000264276	ensembl	human	known	69_37n	missense	44	37.14	26	SNP	1.000	T
ALS2	57679	genome.wustl.edu	37	2	202622362	202622362	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:202622362C>T	ENST00000264276.6	-	5	1606	c.1234G>A	c.(1234-1236)Gaa>Aaa	p.E412K		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	412					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						GCACCAGCTTCATAAGTAGCA	0.517																																						dbGAP											0													68.0	69.0	69.0					2																	202622362		1973	4173	6146	-	-	-	SO:0001583	missense	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1234G>A	2.37:g.202622362C>T	ENSP00000264276:p.Glu412Lys		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_DH-domain,smart_MORN,prints_Reg_chr_condens,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain	p.E412K	ENST00000264276.6	37	c.1234	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964299	0.92791	.	.	ENSG00000003393	ENST00000264276	T	0.58060	0.36	5.45	5.45	0.79879	.	0.050600	0.85682	D	0.000000	T	0.66426	0.2788	L	0.43923	1.385	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.981	D;D;P	0.80764	0.994;0.952;0.718	T	0.60281	-0.7294	10	0.30078	T	0.28	.	19.6467	0.95778	0.0:1.0:0.0:0.0	.	412;412;412	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	K	412	ENSP00000264276:E412K	ENSP00000264276:E412K	E	-	1	0	ALS2	202330607	1.000000	0.71417	0.998000	0.56505	0.819000	0.46315	7.100000	0.76989	2.710000	0.92621	0.563000	0.77884	GAA	ALS2	-	NULL	ENSG00000003393		0.517	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	49	0.00	0	C	NM_020919		202622362	202622362	-1	no_errors	ENST00000264276	ensembl	human	known	69_37n	missense	32	48.39	30	SNP	1.000	T
ALS2	57679	genome.wustl.edu	37	2	202622362	202622362	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:202622362C>T	ENST00000264276.6	-	5	1606	c.1234G>A	c.(1234-1236)Gaa>Aaa	p.E412K		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	412					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						GCACCAGCTTCATAAGTAGCA	0.517																																						dbGAP											0													68.0	69.0	69.0					2																	202622362		1973	4173	6146	-	-	-	SO:0001583	missense	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1234G>A	2.37:g.202622362C>T	ENSP00000264276:p.Glu412Lys		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_DH-domain,smart_MORN,prints_Reg_chr_condens,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain	p.E412K	ENST00000264276.6	37	c.1234	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964299	0.92791	.	.	ENSG00000003393	ENST00000264276	T	0.58060	0.36	5.45	5.45	0.79879	.	0.050600	0.85682	D	0.000000	T	0.66426	0.2788	L	0.43923	1.385	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.981	D;D;P	0.80764	0.994;0.952;0.718	T	0.60281	-0.7294	10	0.30078	T	0.28	.	19.6467	0.95778	0.0:1.0:0.0:0.0	.	412;412;412	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	K	412	ENSP00000264276:E412K	ENSP00000264276:E412K	E	-	1	0	ALS2	202330607	1.000000	0.71417	0.998000	0.56505	0.819000	0.46315	7.100000	0.76989	2.710000	0.92621	0.563000	0.77884	GAA	ALS2	-	NULL	ENSG00000003393		0.517	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	64	0.00	0	C	NM_020919		202622362	202622362	-1	no_errors	ENST00000264276	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	1.000	T
AMPD3	272	genome.wustl.edu	37	11	10483206	10483206	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:10483206G>T	ENST00000396554.3	+	2	508	c.167G>T	c.(166-168)tGc>tTc	p.C56F	AMPD3_ENST00000444303.2_5'UTR	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	47					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CCAGAGGACTGCCCCATCGGG	0.567																																						dbGAP											0													58.0	57.0	58.0					11																	10483206		2201	4294	6495	-	-	-	SO:0001583	missense	0			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.167G>T	11.37:g.10483206G>T	ENSP00000379802:p.Cys56Phe		A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.C47F	ENST00000396554.3	37	c.140	CCDS7802.1	11	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652364	0.88056	.	.	ENSG00000133805	ENST00000532250;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06;0.06	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.77785	0.4182	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.75020	0.985;0.985;0.985	T	0.70288	-0.4913	10	0.16420	T	0.52	-23.0399	20.2602	0.98440	0.0:0.0:1.0:0.0	.	54;47;56	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	F	47;56;47;47;54;47	ENSP00000432707:C47F;ENSP00000379802:C56F;ENSP00000433284:C47F;ENSP00000379801:C47F;ENSP00000436987:C54F;ENSP00000431648:C47F	ENSP00000379801:C47F	C	+	2	0	AMPD3	10439782	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.508000	0.81686	2.861000	0.98227	0.655000	0.94253	TGC	AMPD3	-	pirsf_AMP_deaminase	ENSG00000133805		0.567	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	AMPD3	HGNC	protein_coding	OTTHUMT00000385783.2	72	0.00	0	G	NM_000480		10483206	10483206	+1	no_errors	ENST00000396553	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
AP2B1	163	genome.wustl.edu	37	17	33935294	33935294	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:33935294G>A	ENST00000262325.7	+	5	966	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	AP2B1_ENST00000312678.8_Missense_Mutation_p.R138Q|AP2B1_ENST00000592545.1_Missense_Mutation_p.R100Q|AP2B1_ENST00000538556.1_Missense_Mutation_p.R81Q|AP2B1_ENST00000589344.1_Missense_Mutation_p.R138Q|AP2B1_ENST00000537622.2_Missense_Mutation_p.R138Q	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	138					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCCTATGTTCGGAAAACAGCA	0.483																																						dbGAP											0													91.0	92.0	92.0					17																	33935294		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.413G>A	17.37:g.33935294G>A	ENSP00000262325:p.Arg138Gln		A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.R138Q	ENST00000262325.7	37	c.413	CCDS32622.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.820805	0.96989	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	5.41	5.41	0.78517	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	H	0.97186	3.955	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.997	D;P;P	0.78314	0.991;0.888;0.655	T	0.79361	-0.1835	10	0.87932	D	0	-11.133	18.2435	0.89977	0.0:0.0:1.0:0.0	.	100;138;138	B4DWG4;P63010;P63010-2	.;AP2B1_HUMAN;.	Q	138;138;81;138	ENSP00000262325:R138Q;ENSP00000314414:R138Q;ENSP00000440563:R81Q;ENSP00000437413:R138Q	ENSP00000262325:R138Q	R	+	2	0	AP2B1	30959407	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.911000	0.87458	2.548000	0.85928	0.650000	0.86243	CGG	AP2B1	-	pfam_Clathrin/coatomer_adapt-like_N,pfam_HEAT,superfamily_ARM-type_fold,pirsf_AP_complex_bsu	ENSG00000006125		0.483	AP2B1-001	KNOWN	basic|CCDS	protein_coding	AP2B1	HGNC	protein_coding	OTTHUMT00000448969.1	46	0.00	0	G			33935294	33935294	+1	no_errors	ENST00000312678	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.995	A
APBA3	9546	genome.wustl.edu	37	19	3751493	3751493	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:3751493G>T	ENST00000316757.3	-	9	1654	c.1454C>A	c.(1453-1455)aCc>aAc	p.T485N	AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	485	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGATGGCGGTGGTGACGGG	0.721																																						dbGAP											0													33.0	33.0	33.0					19																	3751493		2192	4288	6480	-	-	-	SO:0001583	missense	0			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1454C>A	19.37:g.3751493G>T	ENSP00000315136:p.Thr485Asn		O60483|Q9UPZ2	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.T485N	ENST00000316757.3	37	c.1454	CCDS12110.1	19	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284673	0.59867	.	.	ENSG00000011132	ENST00000316757	T	0.46063	0.88	4.7	4.7	0.59300	PDZ/DHR/GLGF (3);	0.062472	0.64402	D	0.000006	T	0.57710	0.2072	M	0.63428	1.95	0.43263	D	0.995207	D	0.69078	0.997	D	0.64237	0.923	T	0.59188	-0.7501	10	0.49607	T	0.09	.	13.2348	0.59963	0.0:0.1732:0.8268:0.0	.	485	O96018	APBA3_HUMAN	N	485	ENSP00000315136:T485N	ENSP00000315136:T485N	T	-	2	0	APBA3	3702493	1.000000	0.71417	0.997000	0.53966	0.658000	0.38924	3.479000	0.53165	2.165000	0.68154	0.555000	0.69702	ACC	APBA3	-	superfamily_PDZ,pfscan_PDZ	ENSG00000011132		0.721	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	HGNC	protein_coding	OTTHUMT00000453634.2	32	0.00	0	G			3751493	3751493	-1	no_errors	ENST00000316757	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.992	T
APLP1	333	genome.wustl.edu	37	19	36365733	36365733	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:36365733G>A	ENST00000221891.4	+	10	1498	c.1306G>A	c.(1306-1308)Gcc>Acc	p.A436T	APLP1_ENST00000586861.1_Missense_Mutation_p.A430T|APLP1_ENST00000589298.2_3'UTR|APLP1_ENST00000537454.2_Missense_Mutation_p.A397T	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	436	Heparin-binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCATGTGGCCGCCGTGGATCC	0.652																																						dbGAP											0													55.0	48.0	51.0					19																	36365733		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1306G>A	19.37:g.36365733G>A	ENSP00000221891:p.Ala436Thr		O00113|Q96A92	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.A436T	ENST00000221891.4	37	c.1306	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071732	0.36566	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	T;T	0.44881	0.91;0.91	4.72	4.72	0.59763	Amyloidogenic glycoprotein, E2 domain (2);	0.563380	0.16080	N	0.230566	T	0.36303	0.0962	L	0.28458	0.855	0.36282	D	0.85586	D;B;P;P	0.54601	0.967;0.175;0.702;0.746	P;B;B;B	0.49665	0.618;0.016;0.071;0.117	T	0.21930	-1.0231	10	0.22706	T	0.39	-5.1892	8.9215	0.35615	0.1024:0.0:0.8975:0.0	.	430;397;436;436	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	T	397;436	ENSP00000441501:A397T;ENSP00000221891:A436T	ENSP00000221891:A436T	A	+	1	0	APLP1	41057573	0.998000	0.40836	0.922000	0.36590	0.312000	0.27988	3.142000	0.50601	2.171000	0.68590	0.555000	0.69702	GCC	APLP1	-	superfamily_Amyloid_glyco_E2_domain	ENSG00000105290		0.652	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1	63	0.00	0	G	NM_001024807		36365733	36365733	+1	no_errors	ENST00000221891	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	0.899	A
APOL5	80831	genome.wustl.edu	37	22	36123120	36123120	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:36123120G>T	ENST00000249044.2	+	3	1005	c.1005G>T	c.(1003-1005)aaG>aaT	p.K335N		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	335					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						TTGCTAAGAAGCTGGAGCAGG	0.607																																						dbGAP											0													29.0	30.0	30.0					22																	36123120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.1005G>T	22.37:g.36123120G>T	ENSP00000249044:p.Lys335Asn		Q5TFL9|Q9UGW5	Missense_Mutation	SNP	pfam_ApoL	p.K335N	ENST00000249044.2	37	c.1005	CCDS13920.1	22	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316573	0.40996	.	.	ENSG00000128313	ENST00000249044	T	0.03358	3.96	4.02	-1.23	0.09465	.	2.245190	0.02404	U	0.080960	T	0.02455	0.0075	N	0.08118	0	0.09310	N	1	B	0.21905	0.062	B	0.21360	0.034	T	0.43940	-0.9360	10	0.62326	D	0.03	.	4.363	0.11211	0.2261:0.3624:0.4115:0.0	.	335	Q9BWW9	APOL5_HUMAN	N	335	ENSP00000249044:K335N	ENSP00000249044:K335N	K	+	3	2	APOL5	34453066	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.702000	0.25631	0.180000	0.19960	-0.136000	0.14681	AAG	APOL5	-	pfam_ApoL	ENSG00000128313		0.607	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL5	HGNC	protein_coding	OTTHUMT00000318979.1	48	0.00	0	G	NM_030642		36123120	36123120	+1	no_errors	ENST00000249044	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.000	T
APOL5	80831	genome.wustl.edu	37	22	36124823	36124823	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:36124823C>A	ENST00000249044.2	+	4	1180	c.1180C>A	c.(1180-1182)Cct>Act	p.P394T		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	394					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						TAGGCTGGGCCCTGGCGTGGC	0.602																																						dbGAP											0													73.0	69.0	71.0					22																	36124823		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.1180C>A	22.37:g.36124823C>A	ENSP00000249044:p.Pro394Thr		Q5TFL9|Q9UGW5	Missense_Mutation	SNP	pfam_ApoL	p.P394T	ENST00000249044.2	37	c.1180	CCDS13920.1	22	.	.	.	.	.	.	.	.	.	.	C	5.626	0.300270	0.10678	.	.	ENSG00000128313	ENST00000249044	T	0.06294	3.32	1.66	0.615	0.17608	.	.	.	.	.	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.17433	0.018	T	0.42068	-0.9473	9	0.87932	D	0	.	3.9927	0.09545	0.0:0.7718:0.0:0.2282	.	394	Q9BWW9	APOL5_HUMAN	T	394	ENSP00000249044:P394T	ENSP00000249044:P394T	P	+	1	0	APOL5	34454769	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-0.126000	0.10563	0.270000	0.21984	-0.450000	0.05554	CCT	APOL5	-	NULL	ENSG00000128313		0.602	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL5	HGNC	protein_coding	OTTHUMT00000318979.1	59	0.00	0	C	NM_030642		36124823	36124823	+1	no_errors	ENST00000249044	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.004	A
ARFIP2	23647	genome.wustl.edu	37	11	6500114	6500114	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:6500114C>A	ENST00000254584.2	-	5	474	c.391G>T	c.(391-393)Gag>Tag	p.E131*	ARFIP2_ENST00000525235.1_Nonsense_Mutation_p.E131*|ARFIP2_ENST00000423813.2_Nonsense_Mutation_p.E93*|TIMM10B_ENST00000530751.1_5'Flank|ARFIP2_ENST00000445086.2_Nonsense_Mutation_p.E46*|TIMM10B_ENST00000254616.6_5'Flank|ARFIP2_ENST00000396777.3_Nonsense_Mutation_p.E131*|TIMM10B_ENST00000472836.1_5'Flank	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	131	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGCAGCAACTCAATCTGCAGC	0.547																																					Melanoma(119;796 1674 9049 20480 24794)	dbGAP											0													92.0	67.0	75.0					11																	6500114		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.391G>T	11.37:g.6500114C>A	ENSP00000254584:p.Glu131*		B4DX86|B4E306|D3DQT5	Nonsense_Mutation	SNP	pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.E131*	ENST00000254584.2	37	c.391	CCDS7765.1	11	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721343	0.89205	.	.	ENSG00000132254	ENST00000254584;ENST00000396777;ENST00000445086;ENST00000423813;ENST00000525235	.	.	.	5.85	4.94	0.65067	.	0.046055	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	14.5303	0.67920	0.0:0.9292:0.0:0.0708	.	.	.	.	X	131;131;46;93;131	.	ENSP00000254584:E131X	E	-	1	0	ARFIP2	6456690	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.796000	0.85898	1.494000	0.48533	0.491000	0.48974	GAG	ARFIP2	-	pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	ENSG00000132254		0.547	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARFIP2	HGNC	protein_coding	OTTHUMT00000387044.1	51	0.00	0	C	NM_012402		6500114	6500114	-1	no_errors	ENST00000254584	ensembl	human	known	69_37n	nonsense	14	22.22	4	SNP	1.000	A
ARHGAP28	79822	genome.wustl.edu	37	18	6890051	6890051	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:6890051C>A	ENST00000383472.4	+	13	1805	c.1701C>A	c.(1699-1701)cgC>cgA	p.R567R	ARHGAP28_ENST00000418986.1_Silent_p.R408R|ARHGAP28_ENST00000314319.3_Silent_p.R408R|ARHGAP28_ENST00000532996.1_Silent_p.R390R|ARHGAP28_ENST00000262227.3_Silent_p.R515R|ARHGAP28_ENST00000531294.1_Silent_p.R403R|ARHGAP28_ENST00000400091.2_Silent_p.R567R|ARHGAP28_ENST00000419673.2_Silent_p.R408R			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	567	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				ACATCATCCGCCTAATGCTTA	0.443																																						dbGAP											0													118.0	113.0	115.0					18																	6890051		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1701C>A	18.37:g.6890051C>A			A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R567	ENST00000383472.4	37	c.1701		18																																																																																			ARHGAP28	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000088756		0.443	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	73	0.00	0	C	XM_371108		6890051	6890051	+1	no_errors	ENST00000400091	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.993	A
ARHGAP28	79822	genome.wustl.edu	37	18	6890051	6890051	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr18:6890051C>A	ENST00000383472.4	+	13	1805	c.1701C>A	c.(1699-1701)cgC>cgA	p.R567R	ARHGAP28_ENST00000418986.1_Silent_p.R408R|ARHGAP28_ENST00000314319.3_Silent_p.R408R|ARHGAP28_ENST00000532996.1_Silent_p.R390R|ARHGAP28_ENST00000262227.3_Silent_p.R515R|ARHGAP28_ENST00000531294.1_Silent_p.R403R|ARHGAP28_ENST00000400091.2_Silent_p.R567R|ARHGAP28_ENST00000419673.2_Silent_p.R408R			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	567	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				ACATCATCCGCCTAATGCTTA	0.443																																						dbGAP											0													118.0	113.0	115.0					18																	6890051		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1701C>A	18.37:g.6890051C>A			A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R567	ENST00000383472.4	37	c.1701		18																																																																																			ARHGAP28	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000088756		0.443	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	78	0.00	0	C	XM_371108		6890051	6890051	+1	no_errors	ENST00000400091	ensembl	human	known	69_37n	silent	50	18.03	11	SNP	0.993	A
ARHGAP31	57514	genome.wustl.edu	37	3	119134094	119134094	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:119134094C>A	ENST00000264245.4	+	12	3850	c.3318C>A	c.(3316-3318)tcC>tcA	p.S1106S		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1106					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGCCTTCTTCCCTCAACTTGG	0.547																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											0													133.0	135.0	135.0					3																	119134094		2009	4173	6182	-	-	-	SO:0001819	synonymous_variant	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.3318C>A	3.37:g.119134094C>A			Q9ULL6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S1106	ENST00000264245.4	37	c.3318	CCDS43135.1	3																																																																																			ARHGAP31	-	NULL	ENSG00000031081		0.547	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	52	0.00	0	C			119134094	119134094	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.991	A
ARHGEF5	7984	genome.wustl.edu	37	7	144062632	144062632	+	Nonsense_Mutation	SNP	C	C	G	rs202036368		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:144062632C>G	ENST00000056217.5	+	2	3044	c.2870C>G	c.(2869-2871)tCa>tGa	p.S957*	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	957					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GCAGGGGTCTCAGAACACCCT	0.597																																						dbGAP											0													2.0	2.0	2.0					7																	144062632		723	1763	2486	-	-	-	SO:0001587	stop_gained	0			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2870C>G	7.37:g.144062632C>G	ENSP00000056217:p.Ser957*		A6NNJ2|Q6ZML7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S957*	ENST00000056217.5	37	c.2870	CCDS34771.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.577225|6.577225	0.97676|0.97676	.|.	.|.	ENSG00000050327|ENSG00000050327	ENST00000474817|ENST00000056217	.|.	.|.	.|.	4.06|4.06	2.22|2.22	0.28083|0.28083	.|.	.|0.258318	.|0.20430	.|N	.|0.092497	T|.	0.37237|.	0.0996|.	.|.	.|.	.|.	0.21020|0.21020	N|N	0.99981|0.99981	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.20940|.	-1.0260|.	4|.	.|0.48119	.|T	.|0.1	-0.0888|-0.0888	6.3968|6.3968	0.21616|0.21616	0.0:0.7685:0.0:0.2315|0.0:0.7685:0.0:0.2315	.|.	.|.	.|.	.|.	E|X	211|957	.|.	.|ENSP00000056217:S957X	Q|S	+|+	1|2	0|0	ARHGEF5|ARHGEF5	143693565|143693565	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.014000|0.014000	0.08584|0.08584	0.795000|0.795000	0.26972|0.26972	0.369000|0.369000	0.24510|0.24510	0.555000|0.555000	0.69702|0.69702	CAG|TCA	ARHGEF5	-	NULL	ENSG00000050327		0.597	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	17	0.00	0	C	NM_005435		144062632	144062632	+1	no_errors	ENST00000056217	ensembl	human	known	69_37n	nonsense	9	25.00	3	SNP	0.005	G
ASXL3	80816	genome.wustl.edu	37	18	31323717	31323717	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:31323717G>A	ENST00000269197.5	+	12	3905	c.3905G>A	c.(3904-3906)aGc>aAc	p.S1302N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1302	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1302I(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGTATTGAAAGCACTCCCATT	0.408																																						dbGAP											1	Substitution - Missense(1)	lung(1)											107.0	106.0	107.0					18																	31323717		1957	4162	6119	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3905G>A	18.37:g.31323717G>A	ENSP00000269197:p.Ser1302Asn		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.S1302N	ENST00000269197.5	37	c.3905	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	0.712	-0.786806	0.02907	.	.	ENSG00000141431	ENST00000269197	T	0.12039	2.72	5.92	1.73	0.24493	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.21579	N	0.999634	B	0.02656	0.0	B	0.01281	0.0	T	0.43572	-0.9383	9	0.06494	T	0.89	.	8.5099	0.33211	0.7853:0.0:0.2147:0.0	.	1302	Q9C0F0	ASXL3_HUMAN	N	1302	ENSP00000269197:S1302N	ENSP00000269197:S1302N	S	+	2	0	ASXL3	29577715	1.000000	0.71417	0.088000	0.20740	0.887000	0.51463	2.680000	0.46918	0.078000	0.16900	-0.136000	0.14681	AGC	ASXL3	-	NULL	ENSG00000141431		0.408	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	30	0.00	0	G			31323717	31323717	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	0.822	A
ATG9B	285973	genome.wustl.edu	37	7	150713034	150713034	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:150713034C>T	ENST00000377974.2	-	14	2797	c.2722G>A	c.(2722-2724)Gtg>Atg	p.V908M	ATG9B_ENST00000605938.1_3'UTR|ATG9B_ENST00000444312.1_Missense_Mutation_p.V394M|ATG9B_ENST00000494791.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	909					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTGTGGTCACCTGAAACCCT	0.597																																						dbGAP											0													78.0	82.0	81.0					7																	150713034		692	1591	2283	-	-	-	SO:0001583	missense	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.2722G>A	7.37:g.150713034C>T	ENSP00000475005:p.Val908Met		A1A5D3|Q6JRW5|Q8N8I8	RNA	SNP	-	NULL	ENST00000377974.2	37	NULL		7	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711901	0.15306	.	.	ENSG00000248602	ENST00000377974;ENST00000444312	.	.	.	4.96	4.96	0.65561	.	0.529195	0.16060	N	0.231559	T	0.45418	0.1341	.	.	.	.	.	.	B	0.31519	0.327	B	0.31191	0.125	T	0.58758	-0.7580	7	0.45353	T	0.12	-3.9019	13.7194	0.62717	0.0:1.0:0.0:0.0	.	909	Q674R7	ATG9B_HUMAN	M	908;394	.	ENSP00000444232:V908M	V	-	1	0	AC010973.1	150343967	0.198000	0.23374	0.950000	0.38849	0.185000	0.23345	0.753000	0.26376	2.268000	0.75426	0.563000	0.77884	GTG	ATG9B	-	-	ENSG00000181652		0.597	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		50	0.00	0	C	NM_173681		150713034	150713034	-1	no_errors	ENST00000377974	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.975	T
DPH6	89978	genome.wustl.edu	37	15	35834641	35834641	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:35834641C>A	ENST00000256538.4	-	2	117	c.91G>T	c.(91-93)Gca>Tca	p.A31S	DPH6_ENST00000440392.2_Missense_Mutation_p.A31S	NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	31					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										CTTAGATTTGCTAAAGCAACG	0.388																																						dbGAP											0													155.0	143.0	147.0					15																	35834641		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.91G>T	15.37:g.35834641C>A	ENSP00000256538:p.Ala31Ser		B3KWG1|Q96HJ6	Missense_Mutation	SNP	pfam_DUF71_ATP-bd_dom,tigrfam_DUF71_ATP-bd_dom	p.A31S	ENST00000256538.4	37	c.91	CCDS10043.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.394725	0.96009	.	.	ENSG00000134146	ENST00000256538;ENST00000440392	T;T	0.42513	0.97;0.97	5.68	5.68	0.88126	Domain of unknown function DUF71, ATP-binding domain (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.73737	0.3625	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.995	T	0.78802	-0.2061	10	0.62326	D	0.03	-17.451	19.7881	0.96446	0.0:1.0:0.0:0.0	.	31;31	B3KWG1;Q7L8W6	.;ATBD4_HUMAN	S	31	ENSP00000256538:A31S;ENSP00000406976:A31S	ENSP00000256538:A31S	A	-	1	0	ATPBD4	33621933	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.071000	0.76770	2.671000	0.90904	0.650000	0.86243	GCA	ATPBD4	-	pfam_DUF71_ATP-bd_dom,tigrfam_DUF71_ATP-bd_dom	ENSG00000134146		0.388	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPBD4	HGNC	protein_coding	OTTHUMT00000251973.1	25	0.00	0	C	NM_080650		35834641	35834641	-1	no_errors	ENST00000256538	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	1.000	A
AVIL	10677	genome.wustl.edu	37	12	58200213	58200213	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:58200213G>A	ENST00000257861.3	-	13	2031	c.1601C>T	c.(1600-1602)gCc>gTc	p.A534V	RP11-571M6.17_ENST00000602802.1_lincRNA|TSFM_ENST00000548851.1_Intron|AVIL_ENST00000537081.1_Missense_Mutation_p.A527V|RNU6-1083P_ENST00000384022.1_RNA|AVIL_ENST00000550083.1_5'UTR	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	534	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TAGGGAGGAGGCAAAGGCTGG	0.522																																						dbGAP											0													163.0	139.0	147.0					12																	58200213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1601C>T	12.37:g.58200213G>A	ENSP00000257861:p.Ala534Val		B2RAU7|Q2NKM9	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.A534V	ENST00000257861.3	37	c.1601	CCDS8959.1	12	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723573	0.89298	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.54675	0.56;0.56	5.16	4.24	0.50183	Gelsolin domain (1);	0.359234	0.31071	N	0.008312	T	0.69682	0.3138	M	0.84156	2.68	0.45118	D	0.998137	P;P	0.44816	0.844;0.796	P;P	0.55965	0.746;0.788	T	0.74902	-0.3506	10	0.87932	D	0	-3.9641	13.1136	0.59288	0.0:0.308:0.692:0.0	.	527;534	O75366-2;O75366	.;AVIL_HUMAN	V	527;534	ENSP00000443207:A527V;ENSP00000257861:A534V	ENSP00000257861:A534V	A	-	2	0	AVIL	56486480	1.000000	0.71417	0.916000	0.36221	0.997000	0.91878	6.338000	0.72963	1.343000	0.45638	0.561000	0.74099	GCC	AVIL	-	pfam_Gelsolin_dom,smart_Gelsolin,prints_Gelsolin	ENSG00000135407		0.522	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	47	0.00	0	G	NM_006576		58200213	58200213	-1	no_errors	ENST00000257861	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	A
B4GALNT4	338707	genome.wustl.edu	37	11	380191	380191	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:380191G>A	ENST00000329962.6	+	17	2704	c.2704G>A	c.(2704-2706)Gac>Aac	p.D902N		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	902					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCGGGAGTGGACGCGGTAGA	0.721																																						dbGAP											0													18.0	23.0	21.0					11																	380191		2199	4297	6496	-	-	-	SO:0001583	missense	0			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2704G>A	11.37:g.380191G>A	ENSP00000328277:p.Asp902Asn		Q96LV2	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.D902N	ENST00000329962.6	37	c.2704	CCDS7694.1	11	.	.	.	.	.	.	.	.	.	.	g	18.71	3.681425	0.68042	.	.	ENSG00000182272	ENST00000329962	T	0.15487	2.42	4.45	4.45	0.53987	.	0.181515	0.49305	D	0.000144	T	0.24547	0.0595	M	0.67517	2.055	0.51767	D	0.999933	B	0.29301	0.241	B	0.31290	0.127	T	0.11397	-1.0589	10	0.66056	D	0.02	-22.2956	17.4821	0.87675	0.0:0.0:1.0:0.0	.	902	Q76KP1	B4GN4_HUMAN	N	902	ENSP00000328277:D902N	ENSP00000328277:D902N	D	+	1	0	B4GALNT4	370191	1.000000	0.71417	0.831000	0.32960	0.500000	0.33767	6.122000	0.71608	2.179000	0.69175	0.561000	0.74099	GAC	B4GALNT4	-	pfam_Chond_GalNAc	ENSG00000182272		0.721	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	71	0.00	0	G	NM_178537		380191	380191	+1	no_errors	ENST00000329962	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	A
BCL2L10	10017	genome.wustl.edu	37	15	52402026	52402026	+	Missense_Mutation	SNP	G	G	A	rs200554368		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:52402026G>A	ENST00000561198.1	-	2	745	c.704C>T	c.(703-705)cCg>cTg	p.P235L	BCL2L10_ENST00000260442.3_3'UTR			Q9HD36	B2L10_HUMAN	BCL2-like 10 (apoptosis facilitator)	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female gamete generation (GO:0007292)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2				all cancers(107;0.0148)		AGGTAGAAGCGGGTTAAAAGT	0.428																																						dbGAP											0													178.0	202.0	194.0					15																	52402026		2195	4293	6488	-	-	-	SO:0001583	missense	0			AF285092	CCDS10148.1	15q21	2007-03-02			ENSG00000137875	ENSG00000137875			993	protein-coding gene	gene with protein product		606910				9829980, 9878060	Standard	NM_020396		Approved	Diva, Boo, BCL-B	uc002abq.3	Q9HD36	OTTHUMG00000131893	ENST00000561198.1:c.704C>T	15.37:g.52402026G>A	ENSP00000453562:p.Pro235Leu		Q3SX80|Q52LQ9|Q8TCS9	Missense_Mutation	SNP	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis	p.P235L	ENST00000561198.1	37	c.704		15																																																																																			BCL2L10	-	NULL	ENSG00000137875		0.428	BCL2L10-002	PUTATIVE	basic|exp_conf	protein_coding	BCL2L10	HGNC	protein_coding	OTTHUMT00000419386.1	32	0.00	0	G			52402026	52402026	-1	no_errors	ENST00000561198	ensembl	human	putative	69_37n	missense	15	16.67	3	SNP	0.001	A
BCR	613	genome.wustl.edu	37	22	23658668	23658669	+	3'UTR	INS	-	-	TT			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:23658668_23658669insTT	ENST00000305877.8	+	0	5526_5527				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TGTTTTAAAACTTTCATCCTAA	0.366			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*960->TT	22.37:g.23658669_23658670dupTT			P78501|Q12842|Q4LE80|Q6NZI3	RNA	INS	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.366	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	54	0.00	0	-	NM_004327		23658668	23658669	+1	no_errors	ENST00000436990	ensembl	human	known	69_37n	rna	16	11.11	2	INS	1.000:1.000	TT
BEST4	266675	genome.wustl.edu	37	1	45250931	45250931	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:45250931C>A	ENST00000372207.3	-	6	760	c.761G>T	c.(760-762)gGc>gTc	p.G254V		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	254						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					AAACTGGCGGCCAACCAGGGA	0.607																																						dbGAP											0													33.0	41.0	38.0					1																	45250931		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.761G>T	1.37:g.45250931C>A	ENSP00000361281:p.Gly254Val		Q5JR93	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.G254V	ENST00000372207.3	37	c.761	CCDS514.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802008	0.90538	.	.	ENSG00000142959	ENST00000372207	D	0.98947	-5.26	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.99438	0.9801	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98385	1.0560	10	0.87932	D	0	-26.0375	17.1809	0.86855	0.0:1.0:0.0:0.0	.	254	Q8NFU0	BEST4_HUMAN	V	254	ENSP00000361281:G254V	ENSP00000361281:G254V	G	-	2	0	BEST4	45023518	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.632000	0.83247	2.636000	0.89361	0.655000	0.94253	GGC	BEST4	-	pfam_Bestrophin/UPF0187	ENSG00000142959		0.607	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST4	HGNC	protein_coding	OTTHUMT00000023425.1	44	0.00	0	C	NM_153274		45250931	45250931	-1	no_errors	ENST00000372207	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
ACAD10	80724	genome.wustl.edu	37	12	112121094	112121094	+	5'Flank	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:112121094C>T	ENST00000313698.4	+	0	0				ACAD10_ENST00000549590.1_5'Flank|BRAP_ENST00000419234.4_Missense_Mutation_p.E34K|BRAP_ENST00000327551.6_Missense_Mutation_p.E4K|BRAP_ENST00000539060.1_5'Flank|ACAD10_ENST00000392636.2_5'Flank|ACAD10_ENST00000455480.2_5'Flank	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10							mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TTTATCTCCTCATCAGACATT	0.428																																						dbGAP											0													185.0	164.0	171.0					12																	112121094		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602		12.37:g.112121094C>T	Exception_encountered		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.E34K	ENST00000313698.4	37	c.100	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034992	0.75617	.	.	ENSG00000089234	ENST00000419234;ENST00000327551	T;T	0.47869	0.87;0.83	5.44	5.44	0.79542	.	0.129265	0.56097	D	0.000038	T	0.44993	0.1320	L	0.48362	1.52	0.80722	D	1	B	0.27498	0.18	B	0.19391	0.025	T	0.40421	-0.9564	10	0.59425	D	0.04	-9.604	18.8407	0.92183	0.0:1.0:0.0:0.0	.	34	Q7Z569	BRAP_HUMAN	K	34;4	ENSP00000403524:E34K;ENSP00000330813:E4K	ENSP00000330813:E4K	E	-	1	0	BRAP	110605477	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.563000	0.60823	2.551000	0.86045	0.491000	0.48974	GAG	BRAP	-	NULL	ENSG00000089234		0.428	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000368307.1	127	0.00	0	C	NM_025247		112121094	112121094	-1	no_errors	ENST00000419234	ensembl	human	known	69_37n	missense	49	40.24	33	SNP	1.000	T
ACAD10	80724	genome.wustl.edu	37	12	112121094	112121094	+	5'Flank	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr12:112121094C>T	ENST00000313698.4	+	0	0				ACAD10_ENST00000549590.1_5'Flank|BRAP_ENST00000419234.4_Missense_Mutation_p.E34K|BRAP_ENST00000327551.6_Missense_Mutation_p.E4K|BRAP_ENST00000539060.1_5'Flank|ACAD10_ENST00000392636.2_5'Flank|ACAD10_ENST00000455480.2_5'Flank	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10							mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TTTATCTCCTCATCAGACATT	0.428																																						dbGAP											0													185.0	164.0	171.0					12																	112121094		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602		12.37:g.112121094C>T	Exception_encountered		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.E34K	ENST00000313698.4	37	c.100	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034992	0.75617	.	.	ENSG00000089234	ENST00000419234;ENST00000327551	T;T	0.47869	0.87;0.83	5.44	5.44	0.79542	.	0.129265	0.56097	D	0.000038	T	0.44993	0.1320	L	0.48362	1.52	0.80722	D	1	B	0.27498	0.18	B	0.19391	0.025	T	0.40421	-0.9564	10	0.59425	D	0.04	-9.604	18.8407	0.92183	0.0:1.0:0.0:0.0	.	34	Q7Z569	BRAP_HUMAN	K	34;4	ENSP00000403524:E34K;ENSP00000330813:E4K	ENSP00000330813:E4K	E	-	1	0	BRAP	110605477	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.563000	0.60823	2.551000	0.86045	0.491000	0.48974	GAG	BRAP	-	NULL	ENSG00000089234		0.428	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000368307.1	86	0.00	0	C	NM_025247		112121094	112121094	-1	no_errors	ENST00000419234	ensembl	human	known	69_37n	missense	59	27.16	22	SNP	1.000	T
ACAD10	80724	genome.wustl.edu	37	12	112121094	112121094	+	5'Flank	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:112121094C>T	ENST00000313698.4	+	0	0				ACAD10_ENST00000549590.1_5'Flank|BRAP_ENST00000419234.4_Missense_Mutation_p.E34K|BRAP_ENST00000327551.6_Missense_Mutation_p.E4K|BRAP_ENST00000539060.1_5'Flank|ACAD10_ENST00000392636.2_5'Flank|ACAD10_ENST00000455480.2_5'Flank	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10							mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TTTATCTCCTCATCAGACATT	0.428																																						dbGAP											0													185.0	164.0	171.0					12																	112121094		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602		12.37:g.112121094C>T	Exception_encountered		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.E34K	ENST00000313698.4	37	c.100	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034992	0.75617	.	.	ENSG00000089234	ENST00000419234;ENST00000327551	T;T	0.47869	0.87;0.83	5.44	5.44	0.79542	.	0.129265	0.56097	D	0.000038	T	0.44993	0.1320	L	0.48362	1.52	0.80722	D	1	B	0.27498	0.18	B	0.19391	0.025	T	0.40421	-0.9564	10	0.59425	D	0.04	-9.604	18.8407	0.92183	0.0:1.0:0.0:0.0	.	34	Q7Z569	BRAP_HUMAN	K	34;4	ENSP00000403524:E34K;ENSP00000330813:E4K	ENSP00000330813:E4K	E	-	1	0	BRAP	110605477	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.563000	0.60823	2.551000	0.86045	0.491000	0.48974	GAG	BRAP	-	NULL	ENSG00000089234		0.428	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000368307.1	127	0.00	0	C	NM_025247		112121094	112121094	-1	no_errors	ENST00000419234	ensembl	human	known	69_37n	missense	57	32.94	28	SNP	1.000	T
BRD2	6046	genome.wustl.edu	37	6	32947839	32947839	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:32947839G>T	ENST00000374825.4	+	11	3777	c.2076G>T	c.(2074-2076)aaG>aaT	p.K692N	BRD2_ENST00000443797.2_Missense_Mutation_p.K572N|BRD2_ENST00000395289.2_Missense_Mutation_p.K727N|BRD2_ENST00000395287.1_Missense_Mutation_p.K727N|BRD2_ENST00000374831.4_Missense_Mutation_p.K692N|BRD2_ENST00000449085.2_Missense_Mutation_p.K645N	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	692	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						AAACACTCAAGCCATCCACAC	0.478																																						dbGAP											0													74.0	74.0	74.0					6																	32947839		1510	2708	4218	-	-	-	SO:0001583	missense	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2076G>T	6.37:g.32947839G>T	ENSP00000363958:p.Lys692Asn		A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.K727N	ENST00000374825.4	37	c.2181	CCDS4762.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.807815|2.807815	0.50421|0.50421	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085|ENST00000449025	T;T;T;T;T;T|.	0.24350|.	1.86;1.86;1.86;1.86;1.86;1.86|.	5.51|5.51	1.57|1.57	0.23409|0.23409	.|.	0.000000|.	0.52532|.	D|.	0.000065|.	T|T	0.50137|0.50137	0.1598|0.1598	M|M	0.73962|0.73962	2.25|2.25	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.76494|.	0.999;0.998|.	D;D|.	0.78314|.	0.991;0.981|.	T|T	0.50701|0.50701	-0.8797|-0.8797	10|5	0.54805|.	T|.	0.06|.	-20.7951|-20.7951	6.6584|6.6584	0.23000|0.23000	0.4574:0.0:0.5426:0.0|0.4574:0.0:0.5426:0.0	.|.	727;692|.	A2AAU0;P25440|.	.;BRD2_HUMAN|.	N|I	692;692;727;572;727;645|698	ENSP00000363958:K692N;ENSP00000363964:K692N;ENSP00000378704:K727N;ENSP00000413495:K572N;ENSP00000378702:K727N;ENSP00000409145:K645N|.	ENSP00000363958:K692N|.	K|S	+|+	3|2	2|0	BRD2|BRD2	33055817|33055817	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.422000|0.422000	0.21296|0.21296	0.464000|0.464000	0.27142|0.27142	0.643000|0.643000	0.83706|0.83706	AAG|AGC	BRD2	-	NULL	ENSG00000204256		0.478	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	HGNC	protein_coding	OTTHUMT00000076503.2	43	0.00	0	G			32947839	32947839	+1	no_errors	ENST00000395289	ensembl	human	known	69_37n	missense	21	21.43	6	SNP	1.000	T
C1QTNF6	114904	genome.wustl.edu	37	22	37584370	37584371	+	5'UTR	INS	-	-	A	rs185370929	byFrequency	TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:37584370_37584371insA	ENST00000470655.1	-	0	3196_3197				C1QTNF6_ENST00000337843.2_5'Flank|C1QTNF6_ENST00000397110.2_5'Flank			Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6						protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						gagggagggcggagggagAGGG	0.634																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000470655.1:c.-1807->T	22.37:g.37584370_37584371insA			Q5H9G8|Q6ZRM7	RNA	INS	-	NULL	ENST00000470655.1	37	NULL		22																																																																																			C1QTNF6	-	-	ENSG00000133466		0.634	C1QTNF6-002	KNOWN	basic	processed_transcript	C1QTNF6	HGNC	protein_coding	OTTHUMT00000318805.1	19	0.00	0	-	NM_182486		37584370	37584371	-1	no_errors	ENST00000470655	ensembl	human	known	69_37n	rna	12	25.00	4	INS	0.991:0.985	A
C1orf110	339512	genome.wustl.edu	37	1	162794590	162794590	+	5'UTR	SNP	G	G	A	rs6673431	byFrequency	TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:162794590G>A	ENST00000524691.1	-	0	533							Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110											endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						CTGCCCTCCCGGTGGCATTGA	0.483													G|||	238	0.047524	0.1392	0.036	5008	,	,		18915	0.0		0.0239	False		,,,				2504	0.0051					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000524691.1:c.-343C>T	1.37:g.162794590G>A			Q5JSG1|Q6ZW57	RNA	SNP	-	NULL	ENST00000524691.1	37	NULL		1																																																																																			C1orf110	-	-	ENSG00000185860		0.483	C1orf110-004	KNOWN	basic	processed_transcript	C1orf110	HGNC	protein_coding	OTTHUMT00000386391.1	48	0.00	0	G	NM_178550		162794590	162794590	-1	no_errors	ENST00000524691	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.797	A
C20orf194	25943	genome.wustl.edu	37	20	3251163	3251163	+	Missense_Mutation	SNP	C	C	A	rs151271545		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:3251163C>A	ENST00000252032.9	-	30	2763	c.2696G>T	c.(2695-2697)cGg>cTg	p.R899L	C20orf194_ENST00000453730.2_3'UTR	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	899										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						GAGAGGGTGCCGCTGCTCCGT	0.522																																						dbGAP											0													54.0	59.0	58.0					20																	3251163		2158	4266	6424	-	-	-	SO:0001583	missense	0			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.2696G>T	20.37:g.3251163C>A	ENSP00000252032:p.Arg899Leu		Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	NULL	p.R899L	ENST00000252032.9	37	c.2696	CCDS42851.1	20	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643453	0.67244	.	.	ENSG00000088854	ENST00000252032	T	0.18657	2.2	5.26	4.3	0.51218	.	0.224065	0.46145	D	0.000303	T	0.23846	0.0577	L	0.44542	1.39	0.80722	D	1	P;P	0.44690	0.785;0.841	B;B	0.44108	0.348;0.441	T	0.02179	-1.1200	10	0.66056	D	0.02	.	14.2818	0.66219	0.0:0.9269:0.0:0.0731	.	638;899	Q0IIP3;Q5TEA3	.;CT194_HUMAN	L	899	ENSP00000252032:R899L	ENSP00000252032:R899L	R	-	2	0	C20orf194	3199163	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.589000	0.36644	1.175000	0.42826	0.643000	0.83706	CGG	C20orf194	-	NULL	ENSG00000088854		0.522	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	HGNC	protein_coding	OTTHUMT00000077734.1	55	0.00	0	C	NM_001009984		3251163	3251163	-1	no_errors	ENST00000252032	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	A
B3GALT5	10317	genome.wustl.edu	37	21	40978267	40978267	+	Intron	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:40978267C>T	ENST00000380620.4	+	2	201				C21orf88_ENST00000380612.4_Intron|C21orf88_ENST00000329618.6_Missense_Mutation_p.A54T|C21orf88_ENST00000380604.3_Intron			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				ACACGAAAAGCTGCCATGCTG	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-392+1115C>T	21.37:g.40978267C>T			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	NULL	p.A54T	ENST00000380620.4	37	c.160	CCDS13667.1	21	.	.	.	.	.	.	.	.	.	.	C	2.453	-0.325997	0.05350	.	.	ENSG00000184809	ENST00000329618	.	.	.	1.81	0.896	0.19253	.	.	.	.	.	T	0.30885	0.0779	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	.	6.1258	0.20177	0.0:0.6774:0.3226:0.0	.	.	.	.	T	54	.	.	A	-	1	0	C21orf88	39900137	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	-0.429000	0.06982	0.309000	0.22966	-0.257000	0.10917	GCT	C21orf88	-	NULL	ENSG00000184809		0.418	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	54	0.00	0	C	NM_033170		40978267	40978267	-1	no_errors	ENST00000329618	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.011	T
C9orf69	90120	genome.wustl.edu	37	9	139008444	139008446	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:139008444_139008446delCAG	ENST00000418388.1	-	2	803_805	c.301_303delCTG	c.(301-303)ctgdel	p.L101del	C9orf69_ENST00000561457.1_In_Frame_Del_p.C125del			H0YL14	CI069_HUMAN	chromosome 9 open reading frame 69	101					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of viral process (GO:0048524)|viral process (GO:0016032)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)			endometrium(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.58e-07)|Epithelial(140;6.42e-06)		GCCGGCGGCCCAGCAGCAGCAGC	0.685																																						dbGAP											0										105,3965		8,89,1938						5.1	1.0			23	180,7946		12,156,3895	no	coding	C9orf69	NM_152833.2		20,245,5833	A1A1,A1R,RR		2.2151,2.5799,2.3368				285,11911				-	-	-	SO:0001651	inframe_deletion	0				CCDS59155.1	9q34.3	2012-11-26	2012-07-05	2012-07-05	ENSG00000238227	ENSG00000238227			31009	protein-coding gene	gene with protein product						21667337	Standard	NM_152833		Approved	bA83N9.1	uc004cgx.5	H0YL14	OTTHUMG00000020922	ENST00000418388.1:c.301_303delCTG	9.37:g.139008453_139008455delCAG	ENSP00000453019:p.Leu101del			In_Frame_Del	DEL	NULL	p.L101in_frame_del	ENST00000418388.1	37	c.303_301	CCDS59155.1	9																																																																																			C9orf69	-	NULL	ENSG00000238227		0.685	C9orf69-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C9orf69	HGNC	protein_coding	OTTHUMT00000055043.3	66	0.00	0	CAG	NM_152833		139008444	139008446	-1	no_errors	ENST00000557985	ensembl	human	known	69_37n	in_frame_del	25	10.71	3	DEL	1.000:1.000:1.000	-
CADPS	8618	genome.wustl.edu	37	3	62739399	62739399	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:62739399C>T	ENST00000383710.4	-	3	954	c.605G>A	c.(604-606)tGt>tAt	p.C202Y	CADPS_ENST00000283269.9_Missense_Mutation_p.C202Y|CADPS_ENST00000490353.2_Missense_Mutation_p.C202Y|CADPS_ENST00000357948.3_Missense_Mutation_p.C202Y	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	202					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTTGGCGGAACAGCCTCCACT	0.567																																						dbGAP											0													42.0	36.0	38.0					3																	62739399		2203	4300	6503	-	-	-	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.605G>A	3.37:g.62739399C>T	ENSP00000373215:p.Cys202Tyr		A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.C202Y	ENST00000383710.4	37	c.605	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	C	11.22	1.575803	0.28092	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.71	5.71	0.89125	.	0.099835	0.64402	D	0.000001	D	0.89983	0.6873	M	0.77103	2.36	0.48341	D	0.999635	B;B;B	0.30763	0.036;0.16;0.294	B;B;B	0.24701	0.044;0.055;0.026	D	0.88385	0.3004	10	0.48119	T	0.1	.	15.4596	0.75342	0.1393:0.8607:0.0:0.0	.	202;202;202	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	Y	202	ENSP00000373215:C202Y;ENSP00000350632:C202Y;ENSP00000283269:C202Y;ENSP00000418736:C202Y	ENSP00000283269:C202Y	C	-	2	0	CADPS	62714439	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	2.906000	0.48735	2.707000	0.92482	0.655000	0.94253	TGT	CADPS	-	NULL	ENSG00000163618		0.567	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	43	0.00	0	C	NM_003716, NM_183393, NM_183394		62739399	62739399	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	T
CAMK2G	818	genome.wustl.edu	37	10	75587868	75587868	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:75587868C>A	ENST00000322635.3	-	15	1183	c.1065G>T	c.(1063-1065)tcG>tcT	p.S355S	CAMK2G_ENST00000444854.2_Intron|CAMK2G_ENST00000394762.2_Intron|CAMK2G_ENST00000351293.3_Intron|CAMK2G_ENST00000322680.3_Intron|CAMK2G_ENST00000372765.1_Intron|CAMK2G_ENST00000472912.1_Intron|CAMK2G_ENST00000305762.7_Silent_p.S334S|CAMK2G_ENST00000423381.1_Silent_p.S355S	NM_172169.2	NP_751909.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	334					calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	CGCTGGAACTCGACTTCCTTT	0.582																																						dbGAP											0													159.0	114.0	129.0					10																	75587868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000322635.3:c.1065G>T	10.37:g.75587868C>A			O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S355	ENST00000322635.3	37	c.1065	CCDS7337.1	10																																																																																			CAMK2G	-	superfamily_Kinase-like_dom	ENSG00000148660		0.582	CAMK2G-001	KNOWN	basic|CCDS	protein_coding	CAMK2G	HGNC	protein_coding	OTTHUMT00000048714.1	57	0.00	0	C	NM_172169		75587868	75587868	-1	no_errors	ENST00000423381	ensembl	human	known	69_37n	silent	20	13.04	3	SNP	1.000	A
CASC5	57082	genome.wustl.edu	37	15	40913336	40913336	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:40913336C>T	ENST00000346991.5	+	11	1342	c.952C>T	c.(952-954)Cag>Tag	p.Q318*	CASC5_ENST00000399668.2_Nonsense_Mutation_p.Q292*|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	318	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGCCAATATTCAGACATTGAT	0.353																																						dbGAP											0													67.0	63.0	64.0					15																	40913336		1850	4106	5956	-	-	-	SO:0001587	stop_gained	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.952C>T	15.37:g.40913336C>T	ENSP00000335463:p.Gln318*		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Nonsense_Mutation	SNP	NULL	p.Q318*	ENST00000346991.5	37	c.952	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.628109	0.97718	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	.	.	.	5.8	3.89	0.44902	.	0.376195	0.23234	N	0.050435	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	10.3972	0.44207	0.3725:0.5059:0.1216:0.0	.	.	.	.	X	318;292;292	.	ENSP00000260369:Q292X	Q	+	1	0	CASC5	38700628	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	1.083000	0.30815	0.757000	0.33036	0.467000	0.42956	CAG	CASC5	-	NULL	ENSG00000137812		0.353	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	38	0.00	0	C	NM_144508		40913336	40913336	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	nonsense	18	33.33	9	SNP	1.000	T
CASC5	57082	genome.wustl.edu	37	15	40913336	40913336	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr15:40913336C>T	ENST00000346991.5	+	11	1342	c.952C>T	c.(952-954)Cag>Tag	p.Q318*	CASC5_ENST00000399668.2_Nonsense_Mutation_p.Q292*|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	318	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGCCAATATTCAGACATTGAT	0.353																																						dbGAP											0													67.0	63.0	64.0					15																	40913336		1850	4106	5956	-	-	-	SO:0001587	stop_gained	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.952C>T	15.37:g.40913336C>T	ENSP00000335463:p.Gln318*		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Nonsense_Mutation	SNP	NULL	p.Q318*	ENST00000346991.5	37	c.952	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.628109	0.97718	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	.	.	.	5.8	3.89	0.44902	.	0.376195	0.23234	N	0.050435	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	10.3972	0.44207	0.3725:0.5059:0.1216:0.0	.	.	.	.	X	318;292;292	.	ENSP00000260369:Q292X	Q	+	1	0	CASC5	38700628	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	1.083000	0.30815	0.757000	0.33036	0.467000	0.42956	CAG	CASC5	-	NULL	ENSG00000137812		0.353	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	52	0.00	0	C	NM_144508		40913336	40913336	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	nonsense	15	54.55	18	SNP	1.000	T
CASC5	57082	genome.wustl.edu	37	15	40913336	40913336	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:40913336C>T	ENST00000346991.5	+	11	1342	c.952C>T	c.(952-954)Cag>Tag	p.Q318*	CASC5_ENST00000399668.2_Nonsense_Mutation_p.Q292*|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	318	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGCCAATATTCAGACATTGAT	0.353																																						dbGAP											0													67.0	63.0	64.0					15																	40913336		1850	4106	5956	-	-	-	SO:0001587	stop_gained	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.952C>T	15.37:g.40913336C>T	ENSP00000335463:p.Gln318*		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Nonsense_Mutation	SNP	NULL	p.Q318*	ENST00000346991.5	37	c.952	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.628109	0.97718	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	.	.	.	5.8	3.89	0.44902	.	0.376195	0.23234	N	0.050435	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	10.3972	0.44207	0.3725:0.5059:0.1216:0.0	.	.	.	.	X	318;292;292	.	ENSP00000260369:Q292X	Q	+	1	0	CASC5	38700628	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	1.083000	0.30815	0.757000	0.33036	0.467000	0.42956	CAG	CASC5	-	NULL	ENSG00000137812		0.353	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	38	0.00	0	C	NM_144508		40913336	40913336	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	nonsense	9	55.00	11	SNP	1.000	T
CCNL2	81669	genome.wustl.edu	37	1	1325935	1325935	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:1325935C>A	ENST00000400809.3	-	7	773	c.768G>T	c.(766-768)ttG>ttT	p.L256F	CCNL2_ENST00000408952.5_Missense_Mutation_p.L34F|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	256	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GACGATTGGGCAAAGGGATCT	0.408																																						dbGAP											0													92.0	91.0	91.0					1																	1325935		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.768G>T	1.37:g.1325935C>A	ENSP00000383611:p.Leu256Phe		A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.L256F	ENST00000400809.3	37	c.768	CCDS30557.1	1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954548	0.34471	.	.	ENSG00000221978	ENST00000400809;ENST00000408952	T;T	0.24723	1.84;1.84	5.72	2.49	0.30216	Cyclin, C-terminal (1);Cyclin-like (3);	0.000000	0.64402	D	0.000019	T	0.51534	0.1680	M	0.89163	3.01	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	T	0.52881	-0.8516	10	0.54805	T	0.06	.	8.1381	0.31067	0.1626:0.6716:0.0:0.1658	.	256	Q96S94	CCNL2_HUMAN	F	256;34	ENSP00000383611:L256F;ENSP00000386132:L34F	ENSP00000383611:L256F	L	-	3	2	CCNL2	1315798	0.999000	0.42202	0.999000	0.59377	0.937000	0.57800	0.661000	0.25023	0.765000	0.33221	0.650000	0.86243	TTG	CCNL2	-	pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	ENSG00000221978		0.408	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	24	0.00	0	C	NM_030937		1325935	1325935	-1	no_errors	ENST00000400809	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.968	A
CD151	977	genome.wustl.edu	37	11	838275	838275	+	3'UTR	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:838275C>T	ENST00000397420.3	+	0	1094				CD151_ENST00000397421.1_3'UTR|CD151_ENST00000525181.1_3'UTR|CD151_ENST00000322008.4_3'UTR|CD151_ENST00000528011.1_3'UTR			P48509	CD151_HUMAN	CD151 molecule (Raph blood group)						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|T cell proliferation (GO:0042098)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGATGACACCCACCCTGTG	0.612																																					Esophageal Squamous(14;501 559 15826 37823 38305)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL161965, BC013302, D29963	CCDS7719.1	11p15.5	2014-07-18	2006-03-28		ENSG00000177697	ENSG00000177697		"""CD molecules"", ""Blood group antigens"", ""Tetraspanins"""	1630	protein-coding gene	gene with protein product		602243	"""CD151 antigen"", ""CD151 antigen (Raph blood group)"""			9070943	Standard	NM_004357		Approved	SFA-1, PETA-3, TSPAN24, RAPH	uc001lsb.3	P48509	OTTHUMG00000133311	ENST00000397420.3:c.*83C>T	11.37:g.838275C>T			A8KAK8|E9PI15|Q14826|Q86U54|Q96TE3	RNA	SNP	-	NULL	ENST00000397420.3	37	NULL	CCDS7719.1	11																																																																																			CD151	-	-	ENSG00000177697		0.612	CD151-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD151	HGNC	protein_coding	OTTHUMT00000257108.1	94	0.00	0	C	NM_004357		838275	838275	+1	no_errors	ENST00000525181	ensembl	human	putative	69_37n	rna	28	12.50	4	SNP	0.000	T
CDC42BPG	55561	genome.wustl.edu	37	11	64603235	64603235	+	Splice_Site	DEL	T	T	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:64603235delT	ENST00000342711.5	-	14	1756	c.1757delA	c.(1756-1758)aag>ag	p.K586fs		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CTTGACTACCTTGGCCTGGGA	0.667																																						dbGAP											0													66.0	56.0	60.0					11																	64603235		2201	4297	6498	-	-	-	SO:0001630	splice_region_variant	0			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.1758+1A>-	11.37:g.64603235delT				Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.K586fs	ENST00000342711.5	37	c.1757	CCDS31601.1	11																																																																																			CDC42BPG	-	NULL	ENSG00000171219		0.667	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPG	HGNC	protein_coding	OTTHUMT00000105352.4	51	0.00	0	T	XM_290516	Frame_Shift_Del	64603235	64603235	-1	no_errors	ENST00000342711	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.996	-
CDH5	1003	genome.wustl.edu	37	16	66420810	66420810	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:66420810C>T	ENST00000341529.3	+	3	457	c.309C>T	c.(307-309)ttC>ttT	p.F103F	CDH5_ENST00000563425.2_Silent_p.F103F	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	103	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GAGACGTGTTCGCCATTGAGA	0.527																																						dbGAP											0													100.0	86.0	91.0					16																	66420810		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.309C>T	16.37:g.66420810C>T			Q4VAI5|Q4VAI6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F103	ENST00000341529.3	37	c.309	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	C	5.416	0.261859	0.10239	.	.	ENSG00000179776	ENST00000539262	.	.	.	5.79	-2.0	0.07433	.	.	.	.	.	T	0.62036	0.2395	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62431	-0.6856	5	0.87932	D	0	.	8.9486	0.35773	0.0:0.5046:0.1307:0.3647	.	.	.	.	L	25	.	ENSP00000437691:S25L	S	+	2	0	CDH5	64978311	0.627000	0.27129	0.350000	0.25708	0.410000	0.31052	-0.128000	0.10531	-0.685000	0.05177	-1.021000	0.02439	TCG	CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000179776		0.527	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1	79	0.00	0	C	NM_001795		66420810	66420810	+1	no_errors	ENST00000341529	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	0.971	T
CDH6	1004	genome.wustl.edu	37	5	31313557	31313558	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:31313557_31313558insT	ENST00000265071.2	+	8	1651_1652	c.1386_1387insT	c.(1387-1389)atcfs	p.I463fs	CDH6_ENST00000514738.1_Frame_Shift_Ins_p.I408fs	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	463	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TAGCAACAGAGATCAGTAAGTC	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	Exception_encountered	5.37:g.31313557_31313558insT	ENSP00000265071:p.Ile463fs		A8K5H5|Q9BWS0	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I462fs	ENST00000265071.2	37	c.1386_1387	CCDS3894.1	5																																																																																			CDH6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113361		0.431	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	18	0.00	0	-	NM_004932		31313557	31313558	+1	no_errors	ENST00000265071	ensembl	human	known	69_37n	frame_shift_ins	7	30.00	3	INS	0.992:1.000	T
CELSR1	9620	genome.wustl.edu	37	22	46930967	46930967	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:46930967C>A	ENST00000262738.3	-	1	2100	c.2101G>T	c.(2101-2103)Gcc>Tcc	p.A701S	CELSR1_ENST00000395964.1_Missense_Mutation_p.A701S|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	701	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CTCCCCACGGCCGCATCCTCA	0.632																																						dbGAP											0													45.0	29.0	35.0					22																	46930967		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2101G>T	22.37:g.46930967C>A	ENSP00000262738:p.Ala701Ser		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.A701S	ENST00000262738.3	37	c.2101	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378306	0.24944	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.01725	4.67;4.67	4.51	4.51	0.55191	Cadherin (3);Cadherin-like (1);	0.187141	0.33834	U	0.004512	T	0.03390	0.0098	L	0.41632	1.29	0.21020	N	0.999806	P	0.38148	0.62	B	0.42692	0.395	T	0.35226	-0.9797	10	0.51188	T	0.08	.	16.8582	0.86011	0.0:1.0:0.0:0.0	.	701	Q9NYQ6	CELR1_HUMAN	S	701	ENSP00000262738:A701S;ENSP00000379293:A701S	ENSP00000262738:A701S	A	-	1	0	CELSR1	45309631	0.986000	0.35501	0.661000	0.29709	0.103000	0.19146	3.049000	0.49869	2.067000	0.61834	0.305000	0.20034	GCC	CELSR1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000075275		0.632	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	62	0.00	0	C	NM_014246		46930967	46930967	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.422	A
CEP55	55165	genome.wustl.edu	37	10	95279501	95279501	+	Silent	SNP	A	A	G			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:95279501A>G	ENST00000371485.3	+	8	1432	c.1128A>G	c.(1126-1128)caA>caG	p.Q376Q	CEP55_ENST00000496302.1_3'UTR	NM_001127182.1|NM_018131.4	NP_001120654|NP_060601	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	376	Required for localization to the interphase centrosome and to the midbody during cytokinesis.				establishment of protein localization (GO:0045184)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|midbody (GO:0030496)				kidney(1)|large_intestine(5)|lung(6)|stomach(1)	13		Colorectal(252;0.207)				TGCAGCATCAATTGCATGTAA	0.388																																						dbGAP											0													111.0	98.0	102.0					10																	95279501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001402	CCDS7428.1	10q24.1	2014-02-20	2005-12-01	2005-12-01	ENSG00000138180	ENSG00000138180			1161	protein-coding gene	gene with protein product	"""cancer/testis antigen 111"""	610000	"""chromosome 10 open reading frame 3"""	C10orf3		16198290	Standard	NM_018131		Approved	FLJ10540, CT111	uc009xug.3	Q53EZ4	OTTHUMG00000018774	ENST00000371485.3:c.1128A>G	10.37:g.95279501A>G			B2RDG8|Q32WF5|Q3MV20|Q5VY28|Q6N034|Q96H32|Q9NVS7	Silent	SNP	pfam_EABR	p.Q376	ENST00000371485.3	37	c.1128	CCDS7428.1	10																																																																																			CEP55	-	NULL	ENSG00000138180		0.388	CEP55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP55	HGNC	protein_coding	OTTHUMT00000049434.1	66	0.00	0	A	NM_018131		95279501	95279501	+1	no_errors	ENST00000371485	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.945	G
CEP55	55165	genome.wustl.edu	37	10	95279501	95279501	+	Silent	SNP	A	A	G			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr10:95279501A>G	ENST00000371485.3	+	8	1432	c.1128A>G	c.(1126-1128)caA>caG	p.Q376Q	CEP55_ENST00000496302.1_3'UTR	NM_001127182.1|NM_018131.4	NP_001120654|NP_060601	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	376	Required for localization to the interphase centrosome and to the midbody during cytokinesis.				establishment of protein localization (GO:0045184)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|midbody (GO:0030496)				kidney(1)|large_intestine(5)|lung(6)|stomach(1)	13		Colorectal(252;0.207)				TGCAGCATCAATTGCATGTAA	0.388																																						dbGAP											0													111.0	98.0	102.0					10																	95279501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001402	CCDS7428.1	10q24.1	2014-02-20	2005-12-01	2005-12-01	ENSG00000138180	ENSG00000138180			1161	protein-coding gene	gene with protein product	"""cancer/testis antigen 111"""	610000	"""chromosome 10 open reading frame 3"""	C10orf3		16198290	Standard	NM_018131		Approved	FLJ10540, CT111	uc009xug.3	Q53EZ4	OTTHUMG00000018774	ENST00000371485.3:c.1128A>G	10.37:g.95279501A>G			B2RDG8|Q32WF5|Q3MV20|Q5VY28|Q6N034|Q96H32|Q9NVS7	Silent	SNP	pfam_EABR	p.Q376	ENST00000371485.3	37	c.1128	CCDS7428.1	10																																																																																			CEP55	-	NULL	ENSG00000138180		0.388	CEP55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP55	HGNC	protein_coding	OTTHUMT00000049434.1	61	0.00	0	A	NM_018131		95279501	95279501	+1	no_errors	ENST00000371485	ensembl	human	known	69_37n	silent	37	22.92	11	SNP	0.945	G
CEP55	55165	genome.wustl.edu	37	10	95279501	95279501	+	Silent	SNP	A	A	G			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:95279501A>G	ENST00000371485.3	+	8	1432	c.1128A>G	c.(1126-1128)caA>caG	p.Q376Q	CEP55_ENST00000496302.1_3'UTR	NM_001127182.1|NM_018131.4	NP_001120654|NP_060601	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	376	Required for localization to the interphase centrosome and to the midbody during cytokinesis.				establishment of protein localization (GO:0045184)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|midbody (GO:0030496)				kidney(1)|large_intestine(5)|lung(6)|stomach(1)	13		Colorectal(252;0.207)				TGCAGCATCAATTGCATGTAA	0.388																																						dbGAP											0													111.0	98.0	102.0					10																	95279501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001402	CCDS7428.1	10q24.1	2014-02-20	2005-12-01	2005-12-01	ENSG00000138180	ENSG00000138180			1161	protein-coding gene	gene with protein product	"""cancer/testis antigen 111"""	610000	"""chromosome 10 open reading frame 3"""	C10orf3		16198290	Standard	NM_018131		Approved	FLJ10540, CT111	uc009xug.3	Q53EZ4	OTTHUMG00000018774	ENST00000371485.3:c.1128A>G	10.37:g.95279501A>G			B2RDG8|Q32WF5|Q3MV20|Q5VY28|Q6N034|Q96H32|Q9NVS7	Silent	SNP	pfam_EABR	p.Q376	ENST00000371485.3	37	c.1128	CCDS7428.1	10																																																																																			CEP55	-	NULL	ENSG00000138180		0.388	CEP55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP55	HGNC	protein_coding	OTTHUMT00000049434.1	66	0.00	0	A	NM_018131		95279501	95279501	+1	no_errors	ENST00000371485	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.945	G
CHD7	55636	genome.wustl.edu	37	8	61654374	61654374	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:61654374G>T	ENST00000423902.2	+	2	862	c.383G>T	c.(382-384)gGc>gTc	p.G128V	CHD7_ENST00000525508.1_Missense_Mutation_p.G128V|CHD7_ENST00000524602.1_Missense_Mutation_p.G128V	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	128					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTCTACCCTGGCATGCAGAAT	0.622																																						dbGAP											0													41.0	48.0	46.0					8																	61654374		2150	4255	6405	-	-	-	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.383G>T	8.37:g.61654374G>T	ENSP00000392028:p.Gly128Val		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G128V	ENST00000423902.2	37	c.383	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356666	0.41801	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	T;T;T	0.60797	0.16;0.16;0.16	5.14	5.14	0.70334	.	0.000000	0.40469	N	0.001100	T	0.51873	0.1700	L	0.40543	1.245	0.80722	D	1	P	0.34780	0.468	B	0.34418	0.182	T	0.52586	-0.8556	10	0.40728	T	0.16	-5.8951	18.5949	0.91226	0.0:0.0:1.0:0.0	.	128	Q9P2D1	CHD7_HUMAN	V	128	ENSP00000392028:G128V;ENSP00000437061:G128V;ENSP00000436027:G128V	ENSP00000307304:G128V	G	+	2	0	CHD7	61816928	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.163000	0.89659	2.419000	0.82065	0.585000	0.79938	GGC	CHD7	-	NULL	ENSG00000171316		0.622	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	67	0.00	0	G	XM_098762		61654374	61654374	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
CIT	11113	genome.wustl.edu	37	12	120168341	120168341	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:120168341G>T	ENST00000261833.7	-	26	3371	c.3319C>A	c.(3319-3321)Ctc>Atc	p.L1107I	CIT_ENST00000392521.2_Missense_Mutation_p.L1149I|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1107	Interaction with Rho/Rac.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TGCTCTTTGAGAGCCTGCTGC	0.557																																						dbGAP											0													51.0	47.0	48.0					12																	120168341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.3319C>A	12.37:g.120168341G>T	ENSP00000261833:p.Leu1107Ile		Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L1107I	ENST00000261833.7	37	c.3319	CCDS9192.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059847	0.76074	.	.	ENSG00000122966	ENST00000392521;ENST00000261833;ENST00000546026	T;T;T	0.67345	-0.2;-0.26;1.14	5.72	4.83	0.62350	.	0.000000	0.64402	D	0.000003	T	0.72145	0.3424	L	0.32530	0.975	0.47737	D	0.999502	D;P;P	0.69078	0.997;0.89;0.77	D;B;B	0.78314	0.991;0.272;0.384	T	0.69771	-0.5055	10	0.29301	T	0.29	.	14.3775	0.66889	0.0702:0.0:0.9298:0.0	.	1149;1107;640	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	I	1149;1107;149	ENSP00000376306:L1149I;ENSP00000261833:L1107I;ENSP00000446105:L149I	ENSP00000261833:L1107I	L	-	1	0	CIT	118652724	1.000000	0.71417	0.969000	0.41365	0.992000	0.81027	5.350000	0.66016	1.416000	0.47057	0.655000	0.94253	CTC	CIT	-	pirsf_Citron_Rho-interacting_kinase	ENSG00000122966		0.557	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	67	0.00	0	G	NM_007174		120168341	120168341	-1	no_errors	ENST00000261833	ensembl	human	known	69_37n	missense	26	12.90	4	SNP	0.994	T
CORO7	79585	genome.wustl.edu	37	16	4405324	4405324	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:4405324G>T	ENST00000251166.4	-	27	2880	c.2735C>A	c.(2734-2736)cCc>cAc	p.P912H	CORO7_ENST00000574025.1_Missense_Mutation_p.P827H|CORO7_ENST00000539968.1_Missense_Mutation_p.P692H|CORO7_ENST00000537233.2_Missense_Mutation_p.P894H|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.P912H|CORO7-PAM16_ENST00000572274.1_5'UTR|PAM16_ENST00000576217.1_Intron	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	912					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						GGAGTCCTGGGGGAGTGGGTC	0.617																																						dbGAP											0													51.0	42.0	45.0					16																	4405324		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2735C>A	16.37:g.4405324G>T	ENSP00000251166:p.Pro912His		B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	pfam_DUF1900,pfam_Protein_transpt,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P912H	ENST00000251166.4	37	c.2735	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646681	0.87958	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.66995	-0.23;-0.24	4.96	4.96	0.65561	.	2.284100	0.02304	N	0.071494	D	0.84538	0.5494	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.68872	-0.5294	10	0.62326	D	0.03	-16.8637	17.7949	0.88567	0.0:0.0:1.0:0.0	.	827;894;912;893	P57737-2;B4DFD6;P57737;B4DKU9	.;.;CORO7_HUMAN;.	H	912;827;692	ENSP00000251166:P912H;ENSP00000446221:P692H	ENSP00000251166:P912H	P	-	2	0	CORO7	4345325	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	9.129000	0.94430	2.297000	0.77311	0.591000	0.81541	CCC	CORO7	-	NULL	ENSG00000103426		0.617	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7	HGNC	protein_coding	OTTHUMT00000251628.2	59	0.00	0	G	NM_024535		4405324	4405324	-1	no_errors	ENST00000572467	ensembl	human	known	69_37n	missense	20	16.00	4	SNP	1.000	T
CSPG4	1464	genome.wustl.edu	37	15	75967903	75967903	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:75967903C>G	ENST00000308508.5	-	10	7049	c.6957G>C	c.(6955-6957)caG>caC	p.Q2319H	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2319					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ACACCCAGTACTGGCCATTCT	0.662																																						dbGAP											0													20.0	19.0	19.0					15																	75967903		2194	4294	6488	-	-	-	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6957G>C	15.37:g.75967903C>G	ENSP00000312506:p.Gln2319His		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.Q2319H	ENST00000308508.5	37	c.6957	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137214	0.77775	.	.	ENSG00000173546	ENST00000308508	T	0.32753	1.44	4.93	4.93	0.64822	.	0.000000	0.53938	D	0.000047	T	0.57460	0.2055	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62576	-0.6825	10	0.87932	D	0	.	17.4828	0.87679	0.0:1.0:0.0:0.0	.	2319	Q6UVK1	CSPG4_HUMAN	H	2319	ENSP00000312506:Q2319H	ENSP00000312506:Q2319H	Q	-	3	2	CSPG4	73754958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.551000	0.45820	2.444000	0.82710	0.591000	0.81541	CAG	CSPG4	-	NULL	ENSG00000173546		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	71	0.00	0	C	NM_001897		75967903	75967903	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	G
CSPG4	1464	genome.wustl.edu	37	15	75967903	75967903	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr15:75967903C>G	ENST00000308508.5	-	10	7049	c.6957G>C	c.(6955-6957)caG>caC	p.Q2319H	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2319					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ACACCCAGTACTGGCCATTCT	0.662																																						dbGAP											0													20.0	19.0	19.0					15																	75967903		2194	4294	6488	-	-	-	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6957G>C	15.37:g.75967903C>G	ENSP00000312506:p.Gln2319His		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.Q2319H	ENST00000308508.5	37	c.6957	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137214	0.77775	.	.	ENSG00000173546	ENST00000308508	T	0.32753	1.44	4.93	4.93	0.64822	.	0.000000	0.53938	D	0.000047	T	0.57460	0.2055	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62576	-0.6825	10	0.87932	D	0	.	17.4828	0.87679	0.0:1.0:0.0:0.0	.	2319	Q6UVK1	CSPG4_HUMAN	H	2319	ENSP00000312506:Q2319H	ENSP00000312506:Q2319H	Q	-	3	2	CSPG4	73754958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.551000	0.45820	2.444000	0.82710	0.591000	0.81541	CAG	CSPG4	-	NULL	ENSG00000173546		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	10	0.00	0	C	NM_001897		75967903	75967903	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	G
CSPG4	1464	genome.wustl.edu	37	15	75967903	75967903	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:75967903C>G	ENST00000308508.5	-	10	7049	c.6957G>C	c.(6955-6957)caG>caC	p.Q2319H	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2319					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ACACCCAGTACTGGCCATTCT	0.662																																						dbGAP											0													20.0	19.0	19.0					15																	75967903		2194	4294	6488	-	-	-	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6957G>C	15.37:g.75967903C>G	ENSP00000312506:p.Gln2319His		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.Q2319H	ENST00000308508.5	37	c.6957	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137214	0.77775	.	.	ENSG00000173546	ENST00000308508	T	0.32753	1.44	4.93	4.93	0.64822	.	0.000000	0.53938	D	0.000047	T	0.57460	0.2055	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62576	-0.6825	10	0.87932	D	0	.	17.4828	0.87679	0.0:1.0:0.0:0.0	.	2319	Q6UVK1	CSPG4_HUMAN	H	2319	ENSP00000312506:Q2319H	ENSP00000312506:Q2319H	Q	-	3	2	CSPG4	73754958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.551000	0.45820	2.444000	0.82710	0.591000	0.81541	CAG	CSPG4	-	NULL	ENSG00000173546		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	71	0.00	0	C	NM_001897		75967903	75967903	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	missense	47	46.59	41	SNP	1.000	G
CUBN	8029	genome.wustl.edu	37	10	16979645	16979645	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:16979645G>T	ENST00000377833.4	-	39	5937	c.5872C>A	c.(5872-5874)Ctg>Atg	p.L1958M		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1958	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AACCACTCCAGAAGGAATCCC	0.423																																						dbGAP											0													61.0	63.0	62.0					10																	16979645		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5872C>A	10.37:g.16979645G>T	ENSP00000367064:p.Leu1958Met		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.L1958M	ENST00000377833.4	37	c.5872	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142857	0.37825	.	.	ENSG00000107611	ENST00000377833	T	0.38077	1.16	5.24	2.33	0.28932	CUB (5);	0.000000	0.30791	N	0.008874	T	0.56426	0.1984	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.54899	-0.8224	10	0.41790	T	0.15	.	9.0047	0.36104	0.3487:0.0:0.6513:0.0	.	1958	O60494	CUBN_HUMAN	M	1958	ENSP00000367064:L1958M	ENSP00000367064:L1958M	L	-	1	2	CUBN	17019651	0.835000	0.29415	0.984000	0.44739	0.365000	0.29674	0.488000	0.22371	0.702000	0.31825	0.591000	0.81541	CTG	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.423	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	45	0.00	0	G	NM_001081		16979645	16979645	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	24	11.11	3	SNP	0.837	T
CUX2	23316	genome.wustl.edu	37	12	111757929	111757929	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:111757929G>A	ENST00000261726.6	+	17	2270	c.2116G>A	c.(2116-2118)Gcg>Acg	p.A706T		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	706					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TGAGATGCAGGCGCAACAGCA	0.721																																						dbGAP											0													3.0	4.0	4.0					12																	111757929		1858	3870	5728	-	-	-	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2116G>A	12.37:g.111757929G>A	ENSP00000261726:p.Ala706Thr		A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.A706T	ENST00000261726.6	37	c.2116	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134999	0.77662	.	.	ENSG00000111249	ENST00000261726	T	0.61274	0.12	4.45	4.45	0.53987	.	0.106429	0.64402	D	0.000005	T	0.73016	0.3533	M	0.69185	2.1	0.53688	D	0.999979	D	0.76494	0.999	D	0.65987	0.94	T	0.76340	-0.2995	10	0.54805	T	0.06	-7.5706	17.1659	0.86816	0.0:0.0:1.0:0.0	.	706	O14529	CUX2_HUMAN	T	706	ENSP00000261726:A706T	ENSP00000261726:A706T	A	+	1	0	CUX2	110242312	1.000000	0.71417	0.983000	0.44433	0.109000	0.19521	9.435000	0.97529	2.049000	0.60858	0.485000	0.47835	GCG	CUX2	-	NULL	ENSG00000111249		0.721	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	50	0.00	0	G	NM_015267		111757929	111757929	+1	no_errors	ENST00000261726	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	1.000	A
CWC27	10283	genome.wustl.edu	37	5	64267547	64267547	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:64267547G>A	ENST00000381070.3	+	12	1277	c.1060G>A	c.(1060-1062)Gat>Aat	p.D354N	CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	354					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						AGCCCCTCCAGATGGTGCTGT	0.403																																						dbGAP											0													56.0	61.0	59.0					5																	64267547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1060G>A	5.37:g.64267547G>A	ENSP00000370460:p.Asp354Asn		O60529|O60530|Q96EM3	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.D354N	ENST00000381070.3	37	c.1060	CCDS3982.2	5	.	.	.	.	.	.	.	.	.	.	G	4.545	0.101247	0.08731	.	.	ENSG00000153015	ENST00000381070;ENST00000538793	T	0.21361	2.01	6.01	5.14	0.70334	.	0.214035	0.47093	D	0.000242	T	0.05960	0.0155	N	0.01482	-0.84	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.20874	-1.0262	10	0.05721	T	0.95	.	7.1861	0.25801	0.2787:0.0:0.7213:0.0	.	354;354	Q6UX04-2;Q6UX04	.;CWC27_HUMAN	N	354	ENSP00000370460:D354N	ENSP00000370460:D354N	D	+	1	0	CWC27	64303303	0.998000	0.40836	0.996000	0.52242	0.987000	0.75469	3.117000	0.50407	1.552000	0.49463	0.650000	0.86243	GAT	CWC27	-	NULL	ENSG00000153015		0.403	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC27	HGNC	protein_coding	OTTHUMT00000157247.4	53	0.00	0	G	NM_005869		64267547	64267547	+1	no_errors	ENST00000381070	ensembl	human	known	69_37n	missense	20	52.38	22	SNP	0.998	A
CWC27	10283	genome.wustl.edu	37	5	64267547	64267547	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr5:64267547G>A	ENST00000381070.3	+	12	1277	c.1060G>A	c.(1060-1062)Gat>Aat	p.D354N	CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	354					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						AGCCCCTCCAGATGGTGCTGT	0.403																																						dbGAP											0													56.0	61.0	59.0					5																	64267547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1060G>A	5.37:g.64267547G>A	ENSP00000370460:p.Asp354Asn		O60529|O60530|Q96EM3	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.D354N	ENST00000381070.3	37	c.1060	CCDS3982.2	5	.	.	.	.	.	.	.	.	.	.	G	4.545	0.101247	0.08731	.	.	ENSG00000153015	ENST00000381070;ENST00000538793	T	0.21361	2.01	6.01	5.14	0.70334	.	0.214035	0.47093	D	0.000242	T	0.05960	0.0155	N	0.01482	-0.84	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.20874	-1.0262	10	0.05721	T	0.95	.	7.1861	0.25801	0.2787:0.0:0.7213:0.0	.	354;354	Q6UX04-2;Q6UX04	.;CWC27_HUMAN	N	354	ENSP00000370460:D354N	ENSP00000370460:D354N	D	+	1	0	CWC27	64303303	0.998000	0.40836	0.996000	0.52242	0.987000	0.75469	3.117000	0.50407	1.552000	0.49463	0.650000	0.86243	GAT	CWC27	-	NULL	ENSG00000153015		0.403	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC27	HGNC	protein_coding	OTTHUMT00000157247.4	43	0.00	0	G	NM_005869		64267547	64267547	+1	no_errors	ENST00000381070	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.998	A
CWC27	10283	genome.wustl.edu	37	5	64267547	64267547	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:64267547G>A	ENST00000381070.3	+	12	1277	c.1060G>A	c.(1060-1062)Gat>Aat	p.D354N	CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	354					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						AGCCCCTCCAGATGGTGCTGT	0.403																																						dbGAP											0													56.0	61.0	59.0					5																	64267547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1060G>A	5.37:g.64267547G>A	ENSP00000370460:p.Asp354Asn		O60529|O60530|Q96EM3	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.D354N	ENST00000381070.3	37	c.1060	CCDS3982.2	5	.	.	.	.	.	.	.	.	.	.	G	4.545	0.101247	0.08731	.	.	ENSG00000153015	ENST00000381070;ENST00000538793	T	0.21361	2.01	6.01	5.14	0.70334	.	0.214035	0.47093	D	0.000242	T	0.05960	0.0155	N	0.01482	-0.84	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.20874	-1.0262	10	0.05721	T	0.95	.	7.1861	0.25801	0.2787:0.0:0.7213:0.0	.	354;354	Q6UX04-2;Q6UX04	.;CWC27_HUMAN	N	354	ENSP00000370460:D354N	ENSP00000370460:D354N	D	+	1	0	CWC27	64303303	0.998000	0.40836	0.996000	0.52242	0.987000	0.75469	3.117000	0.50407	1.552000	0.49463	0.650000	0.86243	GAT	CWC27	-	NULL	ENSG00000153015		0.403	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC27	HGNC	protein_coding	OTTHUMT00000157247.4	53	0.00	0	G	NM_005869		64267547	64267547	+1	no_errors	ENST00000381070	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	0.998	A
DAGLA	747	genome.wustl.edu	37	11	61498911	61498911	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:61498911C>A	ENST00000257215.5	+	9	1088	c.972C>A	c.(970-972)tgC>tgA	p.C324*		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	324					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CTCGGTCCTGCTCGTGAGTAC	0.637																																						dbGAP											0													105.0	103.0	104.0					11																	61498911		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.972C>A	11.37:g.61498911C>A	ENSP00000257215:p.Cys324*		A7E233|Q6WQJ0	Nonsense_Mutation	SNP	pfam_Lipase_3	p.C324*	ENST00000257215.5	37	c.972	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928485	0.92389	.	.	ENSG00000134780	ENST00000257215	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-39.6142	18.3218	0.90241	0.0:1.0:0.0:0.0	.	.	.	.	X	324	.	ENSP00000257215:C324X	C	+	3	2	DAGLA	61255487	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	4.392000	0.59659	2.420000	0.82092	0.561000	0.74099	TGC	DAGLA	-	NULL	ENSG00000134780		0.637	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	91	0.00	0	C	NM_006133		61498911	61498911	+1	no_errors	ENST00000257215	ensembl	human	known	69_37n	nonsense	36	10.00	4	SNP	1.000	A
DAPK1	1612	genome.wustl.edu	37	9	90283406	90283406	+	Intron	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:90283406C>A	ENST00000408954.3	+	19	2258				DAPK1_ENST00000358077.5_Intron|DAPK1_ENST00000491893.1_Intron|DAPK1_ENST00000472284.1_Intron|DAPK1_ENST00000466188.1_Intron|DAPK1_ENST00000469640.2_Intron	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GCTTGCTTCTCACACCTGCTA	0.478									Chronic Lymphocytic Leukemia, Familial Clustering of																													dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1924-106C>A	9.37:g.90283406C>A			B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	RNA	SNP	-	NULL	ENST00000408954.3	37	NULL	CCDS43842.1	9																																																																																			DAPK1	-	-	ENSG00000196730		0.478	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	18	0.00	0	C	NM_004938		90283406	90283406	+1	no_errors	ENST00000497743	ensembl	human	known	69_37n	rna	10	23.08	3	SNP	0.036	A
DAPK3	1613	genome.wustl.edu	37	19	3960085	3960085	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:3960085G>T	ENST00000545797.2	-	8	1043	c.800C>A	c.(799-801)gCc>gAc	p.A267D	DAPK3_ENST00000301264.3_Missense_Mutation_p.A267D|MIR637_ENST00000385000.1_RNA			O43293	DAPK3_HUMAN	death-associated protein kinase 3	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|chromatin modification (GO:0016568)|cytokinesis (GO:0000910)|intracellular signal transduction (GO:0035556)|negative regulation of translation (GO:0017148)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of cell motility (GO:2000145)|regulation of focal adhesion assembly (GO:0051893)|regulation of mitosis (GO:0007088)|regulation of mitotic cell cycle (GO:0007346)|regulation of smooth muscle contraction (GO:0006940)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|leucine zipper domain binding (GO:0043522)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGCTCTGGGCAATGGTCAT	0.632																																						dbGAP											0													197.0	182.0	187.0					19																	3960085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007144	CCDS12116.1	19p13.3	2008-02-05				ENSG00000167657			2676	protein-coding gene	gene with protein product		603289				9488481	Standard	XM_005259508		Approved	ZIP, ZIPK	uc002lzc.1	O43293		ENST00000545797.2:c.800C>A	19.37:g.3960085G>T	ENSP00000442973:p.Ala267Asp		A0AVN4|B3KQE2|Q05JY4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A267D	ENST00000545797.2	37	c.800	CCDS12116.1	19	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909107	0.33721	.	.	ENSG00000167657	ENST00000301264;ENST00000545797;ENST00000442766	T;T	0.65916	-0.18;-0.18	4.76	3.64	0.41730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.125152	0.50627	D	0.000106	T	0.42063	0.1186	N	0.17082	0.46	0.40210	D	0.977618	B	0.02656	0.0	B	0.08055	0.003	T	0.29579	-1.0007	10	0.17369	T	0.5	.	11.8449	0.52378	0.0:0.0:0.7144:0.2856	.	267	O43293	DAPK3_HUMAN	D	267;267;122	ENSP00000301264:A267D;ENSP00000442973:A267D	ENSP00000301264:A267D	A	-	2	0	DAPK3	3911085	0.984000	0.35163	1.000000	0.80357	0.925000	0.55904	2.568000	0.45965	2.353000	0.79882	0.462000	0.41574	GCC	DAPK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000167657		0.632	DAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK3	HGNC	protein_coding	OTTHUMT00000457817.2	74	0.00	0	G	NM_001348		3960085	3960085	-1	no_errors	ENST00000301264	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
DBNDD1	79007	genome.wustl.edu	37	16	90075864	90075864	+	Intron	DEL	T	T	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:90075864delT	ENST00000002501.6	-	2	163				DBNDD1_ENST00000304733.3_Intron|DBNDD1_ENST00000568838.1_Intron|DBNDD1_ENST00000392973.3_Frame_Shift_Del_p.Q8fs	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1							cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		CAGTGTCACCTTGAGATCCAC	0.622																																						dbGAP											0													57.0	66.0	63.0					16																	90075864		2068	4188	6256	-	-	-	SO:0001627	intron_variant	0			AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.32-26A>-	16.37:g.90075864delT			B4DQS3|Q69YT2|Q9BW25	Frame_Shift_Del	DEL	pfam_Dysbindin	p.G9fs	ENST00000002501.6	37	c.24	CCDS42223.1	16																																																																																			DBNDD1	-	NULL	ENSG00000003249		0.622	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBNDD1	HGNC	protein_coding	OTTHUMT00000272872.1	64	0.00	0	T	NM_024043		90075864	90075864	-1	no_errors	ENST00000392973	ensembl	human	putative	69_37n	frame_shift_del	18	10.00	2	DEL	0.000	-
DCAF4L1	285429	genome.wustl.edu	37	4	41984238	41984238	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:41984238G>A	ENST00000333141.5	+	1	526	c.429G>A	c.(427-429)ctG>ctA	p.L143L		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	143										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						CTCACGTTCTGCTGTGCTTCG	0.562																																						dbGAP											0													107.0	100.0	102.0					4																	41984238		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.429G>A	4.37:g.41984238G>A			B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L143	ENST00000333141.5	37	c.429	CCDS33978.1	4																																																																																			DCAF4L1	-	superfamily_WD40_repeat_dom	ENSG00000182308		0.562	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	32	0.00	0	G	NM_001029955		41984238	41984238	+1	no_errors	ENST00000333141	ensembl	human	known	69_37n	silent	34	12.82	5	SNP	0.996	A
DDOST	1650	genome.wustl.edu	37	1	20982189	20982189	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:20982189C>A	ENST00000375048.3	-	4	592	c.487G>T	c.(487-489)Gac>Tac	p.D163Y	DDOST_ENST00000602624.2_Missense_Mutation_p.D146Y|DDOST_ENST00000415136.2_Missense_Mutation_p.D126Y	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	163					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCTGAGATGTCATAGTTGTGA	0.532																																						dbGAP											0													207.0	203.0	205.0					1																	20982189		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.487G>T	1.37:g.20982189C>A	ENSP00000364188:p.Asp163Tyr		B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Missense_Mutation	SNP	pfam_OligosaccharylTrfase_su_Wbp1	p.D163Y	ENST00000375048.3	37	c.487	CCDS212.1	1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885599	0.91814	.	.	ENSG00000244038	ENST00000375048;ENST00000415136	T;T	0.79749	-1.3;-1.3	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.92397	0.7587	M	0.92691	3.335	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.85130	0.997;0.997;0.977	D	0.93972	0.7250	10	0.87932	D	0	-31.5577	19.0657	0.93108	0.0:1.0:0.0:0.0	.	126;145;163	E7EWT1;B4DLI2;P39656	.;.;OST48_HUMAN	Y	163;126	ENSP00000364188:D163Y;ENSP00000399457:D126Y	ENSP00000364188:D163Y	D	-	1	0	DDOST	20854776	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.689000	0.84165	2.572000	0.86782	0.585000	0.79938	GAC	DDOST	-	pfam_OligosaccharylTrfase_su_Wbp1	ENSG00000244038		0.532	DDOST-001	KNOWN	basic|CCDS	protein_coding	DDOST	HGNC	protein_coding	OTTHUMT00000007961.2	37	0.00	0	C	NM_005216		20982189	20982189	-1	no_errors	ENST00000375048	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	A
DGCR2	9993	genome.wustl.edu	37	22	19028688	19028688	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:19028688delG	ENST00000263196.7	-	9	1526	c.1279delC	c.(1279-1281)cacfs	p.H427fs	DGCR2_ENST00000537045.1_Frame_Shift_Del_p.H386fs|DGCR2_ENST00000545799.1_3'UTR	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	427					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GGAGGGTCGTGGAAATGGAAA	0.642																																						dbGAP											0													115.0	90.0	99.0					22																	19028688		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1279delC	22.37:g.19028688delG	ENSP00000263196:p.His427fs		A6NIB5|A8K6K5|B5TY34|B7Z935	Frame_Shift_Del	DEL	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.H427fs	ENST00000263196.7	37	c.1279	CCDS33598.1	22																																																																																			DGCR2	-	NULL	ENSG00000070413		0.642	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	HGNC	protein_coding	OTTHUMT00000316504.1	82	0.00	0	G	NM_005137		19028688	19028688	-1	no_errors	ENST00000263196	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	1.000	-
DGCR8	54487	genome.wustl.edu	37	22	20073697	20073697	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:20073697G>T	ENST00000351989.3	+	2	640	c.211G>T	c.(211-213)Gga>Tga	p.G71*	MIR1306_ENST00000408439.1_RNA|MIR3618_ENST00000580330.1_RNA|DGCR8_ENST00000407755.1_Nonsense_Mutation_p.G71*|DGCR8_ENST00000383024.2_Nonsense_Mutation_p.G71*	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	71	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					CAACTTCTACGGAGCTTCTCT	0.602																																						dbGAP											0													70.0	73.0	72.0					22																	20073697		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.211G>T	22.37:g.20073697G>T	ENSP00000263209:p.Gly71*		B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Nonsense_Mutation	SNP	pfam_Ds-RNA-bd,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Ds-RNA-bd,pfscan_WW_Rsp5_WWP,pfscan_Ds-RNA-bd	p.G71*	ENST00000351989.3	37	c.211	CCDS13773.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.946903	0.97956	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000457069;ENST00000407755	.	.	.	5.42	5.42	0.78866	.	0.079413	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-10.6298	13.6408	0.62249	0.0757:0.0:0.9242:0.0	.	.	.	.	X	71	.	ENSP00000263209:G71X	G	+	1	0	DGCR8	18453697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.638000	0.54332	2.826000	0.97356	0.491000	0.48974	GGA	DGCR8	-	NULL	ENSG00000128191		0.602	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR8	HGNC	protein_coding	OTTHUMT00000318654.1	53	0.00	0	G			20073697	20073697	+1	no_errors	ENST00000351989	ensembl	human	known	69_37n	nonsense	21	14.81	4	SNP	1.000	T
DEPDC5	9681	genome.wustl.edu	37	22	32211125	32211125	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:32211125C>A	ENST00000382112.3	+	20	1663	c.1593C>A	c.(1591-1593)aaC>aaA	p.N531K	DEPDC5_ENST00000535622.1_Missense_Mutation_p.N531K|DEPDC5_ENST00000266091.3_Missense_Mutation_p.N531K|DEPDC5_ENST00000400249.2_Missense_Mutation_p.N531K|DEPDC5_ENST00000382105.2_Missense_Mutation_p.N531K|DEPDC5_ENST00000382111.2_Missense_Mutation_p.N531K|DEPDC5_ENST00000536766.1_Missense_Mutation_p.N503K|DEPDC5_ENST00000400248.2_Missense_Mutation_p.N531K|DEPDC5_ENST00000400246.1_Missense_Mutation_p.N531K|DEPDC5_ENST00000400242.3_Missense_Mutation_p.N531K	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	531					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGAGTGCCAACATCCTGATGA	0.567																																						dbGAP											0													102.0	101.0	102.0					22																	32211125		2070	4211	6281	-	-	-	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1593C>A	22.37:g.32211125C>A	ENSP00000371546:p.Asn531Lys		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.N531K	ENST00000382112.3	37	c.1593	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900575	0.72754	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.46451	1.44;1.41;0.87;1.8;1.8;1.77;1.41;1.79;1.77;1.8	6.01	1.69	0.24217	.	0.087576	0.85682	D	0.000000	T	0.28830	0.0715	L	0.51422	1.61	0.80722	D	1	P;B;P;B;P;B	0.35433	0.501;0.277;0.501;0.19;0.501;0.096	B;B;B;B;B;B	0.30646	0.118;0.116;0.118;0.05;0.081;0.033	T	0.08932	-1.0698	10	0.08837	T	0.75	.	10.0716	0.42337	0.0:0.7393:0.0:0.2607	.	531;503;531;531;531;531	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	K	531;503;531;531;531;531;531;531;531;531;531	ENSP00000440210:N531K;ENSP00000441358:N503K;ENSP00000383101:N531K;ENSP00000266091:N531K;ENSP00000383108:N531K;ENSP00000383105:N531K;ENSP00000371539:N531K;ENSP00000371546:N531K;ENSP00000371545:N531K;ENSP00000383107:N531K	ENSP00000266091:N531K	N	+	3	2	DEPDC5	30541125	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	2.544000	0.45761	0.162000	0.19483	0.558000	0.71614	AAC	DEPDC5	-	NULL	ENSG00000100150		0.567	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	74	0.00	0	C	NM_014662		32211125	32211125	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	35	10.00	4	SNP	1.000	A
DLEC1	9940	genome.wustl.edu	37	3	38153821	38153821	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:38153821G>T	ENST00000308059.6	+	25	3656	c.3635G>T	c.(3634-3636)tGg>tTg	p.W1212L	DLEC1_ENST00000346219.3_Missense_Mutation_p.W1212L|DLEC1_ENST00000452631.2_Missense_Mutation_p.W1215L					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GCCAACATGTGGGGCGAGTAC	0.607																																						dbGAP											0													101.0	106.0	105.0					3																	38153821		2072	4208	6280	-	-	-	SO:0001583	missense	0			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.3635G>T	3.37:g.38153821G>T	ENSP00000308597:p.Trp1212Leu			Missense_Mutation	SNP	superfamily_PapD-like	p.W1212L	ENST00000308059.6	37	c.3635	CCDS2672.2	3	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658961	0.88154	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.08102	3.15;3.13;3.38	4.78	4.78	0.61160	.	0.000000	0.64402	D	0.000001	T	0.28499	0.0705	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.998;1.0	T	0.02208	-1.1195	10	0.29301	T	0.29	-14.9366	16.603	0.84821	0.0:0.0:1.0:0.0	.	1215;1212;1212;1212	F8W6T4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	L	1212;1212;1215	ENSP00000308597:W1212L;ENSP00000315914:W1212L;ENSP00000410427:W1215L	ENSP00000308597:W1212L	W	+	2	0	DLEC1	38128825	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.166000	0.89665	2.205000	0.71048	0.511000	0.50034	TGG	DLEC1	-	NULL	ENSG00000008226		0.607	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	51	0.00	0	G	NM_007337		38153821	38153821	+1	no_errors	ENST00000346219	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124283880	124283880	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:124283880G>T	ENST00000409039.3	+	13	1922	c.1897G>T	c.(1897-1899)Gtg>Ttg	p.V633L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	633	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GACGGAGCAGGTGCTGCCAGC	0.493																																						dbGAP											0													162.0	126.0	138.0					12																	124283880		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1897G>T	12.37:g.124283880G>T	ENSP00000386770:p.Val633Leu		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.V633L	ENST00000409039.3	37	c.1897	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	0.920	-0.716123	0.03206	.	.	ENSG00000197653	ENST00000409039	T	0.55930	0.49	5.64	-8.42	0.00957	Dynein heavy chain, domain-1 (1);	2.632140	0.01405	N	0.013768	T	0.42177	0.1191	L	0.40543	1.245	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.005;0.002	T	0.19257	-1.0311	10	0.26408	T	0.33	.	13.3118	0.60384	0.7843:0.0754:0.1403:0.0	.	633;508;633	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	L	633	ENSP00000386770:V633L	ENSP00000386770:V633L	V	+	1	0	DNAH10	122849833	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.124000	0.15728	-1.676000	0.01457	-0.781000	0.03364	GTG	DNAH10	-	pfam_Dynein_heavy_dom-1	ENSG00000197653		0.493	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	50	0.00	0	G			124283880	124283880	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.002	T
DNAJB13	374407	genome.wustl.edu	37	11	73681140	73681140	+	Missense_Mutation	SNP	G	G	T	rs369971791		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:73681140G>T	ENST00000339764.1	+	8	1683	c.932G>T	c.(931-933)cGc>cTc	p.R311L	DNAJB13_ENST00000543947.1_Missense_Mutation_p.R136L|RP11-167N4.2_ENST00000537019.1_RNA|DNAJB13_ENST00000537753.1_Missense_Mutation_p.R136L	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	311					protein folding (GO:0006457)			p.R311L(1)		large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					CAGATGCTGCGCCAGGCATTG	0.617																																						dbGAP											1	Substitution - Missense(1)	lung(1)											109.0	101.0	104.0					11																	73681140		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.932G>T	11.37:g.73681140G>T	ENSP00000344431:p.Arg311Leu		B3LEP4|Q8IZW5	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.R311L	ENST00000339764.1	37	c.932	CCDS8227.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383482	0.82792	.	.	ENSG00000187726	ENST00000339764;ENST00000537753;ENST00000543947	T;T;T	0.59224	0.28;0.73;0.73	5.54	4.43	0.53597	HSP40/DnaJ peptide-binding (1);	0.107964	0.64402	D	0.000012	T	0.64918	0.2642	M	0.70787	2.145	0.43808	D	0.996363	D	0.54772	0.968	P	0.52217	0.693	T	0.66296	-0.5959	9	.	.	.	.	12.154	0.54066	0.0954:0.0:0.9046:0.0	.	311	P59910	DJB13_HUMAN	L	311;136;136	ENSP00000344431:R311L;ENSP00000439711:R136L;ENSP00000438576:R136L	.	R	+	2	0	DNAJB13	73358788	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.532000	0.45659	2.619000	0.88677	0.644000	0.83932	CGC	DNAJB13	-	superfamily_HSP40/DnaJ_pept-bd	ENSG00000187726		0.617	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB13	HGNC	protein_coding	OTTHUMT00000398100.1	68	0.00	0	G	NM_153614		73681140	73681140	+1	no_errors	ENST00000339764	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	T
DNMT1	1786	genome.wustl.edu	37	19	10262429	10262429	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:10262429C>T	ENST00000340748.4	-	22	2301	c.2066G>A	c.(2065-2067)cGg>cAg	p.R689Q	DNMT1_ENST00000540357.1_Missense_Mutation_p.R689Q|DNMT1_ENST00000359526.4_Missense_Mutation_p.R705Q			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	689	Required for activity.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GACCTACCTCCGCTCTTGGCA	0.567																																						dbGAP											0													106.0	96.0	100.0					19																	10262429		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2066G>A	19.37:g.10262429C>T	ENSP00000345739:p.Arg689Gln		A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.R705Q	ENST00000340748.4	37	c.2114	CCDS12228.1	19	.	.	.	.	.	.	.	.	.	.	C	27.7	4.859333	0.91433	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.51574	0.7;1.42;1.42	5.31	5.31	0.75309	Zinc finger, CXXC-type (2);	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.94063	3.49	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.83084	-0.0136	10	0.72032	D	0.01	.	15.9063	0.79433	0.0:1.0:0.0:0.0	.	689;705;689	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	Q	705;689;689;557	ENSP00000352516:R705Q;ENSP00000440457:R689Q;ENSP00000345739:R689Q	ENSP00000345739:R689Q	R	-	2	0	DNMT1	10123429	1.000000	0.71417	0.980000	0.43619	0.495000	0.33615	7.239000	0.78182	2.472000	0.83506	0.462000	0.41574	CGG	DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_Znf_CXXC,pfscan_Znf_CXXC	ENSG00000130816		0.567	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	36	0.00	0	C	NM_001379		10262429	10262429	-1	no_errors	ENST00000359526	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	T
DOCK3	1795	genome.wustl.edu	37	3	51265412	51265412	+	Splice_Site	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:51265412G>A	ENST00000266037.9	+	17	1563		c.e17-1			NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3						small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCTGATTACAGCAAAGGACAA	0.438																																						dbGAP											0													112.0	105.0	108.0					3																	51265412		1970	4153	6123	-	-	-	SO:0001630	splice_region_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1541-1G>A	3.37:g.51265412G>A			O15017	Splice_Site	SNP	-	e17-1	ENST00000266037.9	37	c.1541-1	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.307471	0.95629	.	.	ENSG00000088538	ENST00000266037	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK3	51240452	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	.	DOCK3	-	-	ENSG00000088538		0.438	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	62	0.00	0	G	NM_004947	Intron	51265412	51265412	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	splice_site	29	12.12	4	SNP	1.000	A
DRG2	1819	genome.wustl.edu	37	17	18002972	18002972	+	Silent	SNP	C	C	T	rs372923569		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:18002972C>T	ENST00000225729.3	+	5	540	c.402C>T	c.(400-402)atC>atT	p.I134I	DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Silent_p.I134I	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	134	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					GGCAGGTGATCGCTGTGGCGC	0.627																																						dbGAP											0													58.0	39.0	46.0					17																	18002972		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.402C>T	17.37:g.18002972C>T			B2R8G5|Q53Y50|Q9BWB2	Silent	SNP	pfam_TGS,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_TGS-like,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.I134	ENST00000225729.3	37	c.402	CCDS11191.1	17																																																																																			DRG2	-	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	ENSG00000108591		0.627	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRG2	HGNC	protein_coding	OTTHUMT00000132075.3	57	0.00	0	C	NM_001388		18002972	18002972	+1	no_errors	ENST00000225729	ensembl	human	known	69_37n	silent	17	15.00	3	SNP	0.940	T
DUSP13	51207	genome.wustl.edu	37	10	76865446	76865446	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:76865446C>A	ENST00000372702.3	-	3	611	c.548G>T	c.(547-549)cGg>cTg	p.R183L	DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000607131.1_Intron|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000491677.2_Silent_p.A20A			Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	0	Tyrosine-protein phosphatase.				meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCCGGCACCCCGCAGTTGCTG	0.667																																					NSCLC(174;1655 2059 12324 40663 42963)	dbGAP											0													7.0	9.0	8.0					10																	76865446		1946	4056	6002	-	-	-	SO:0001583	missense	0			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000372702.3:c.548G>T	10.37:g.76865446C>A	ENSP00000361787:p.Arg183Leu		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.R183L	ENST00000372702.3	37	c.548	CCDS53542.1	10	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729786	0.48833	.	.	ENSG00000079393	ENST00000372702	T	0.58940	0.3	4.81	3.83	0.44106	Dual specificity phosphatase, subgroup, catalytic domain (1);	.	.	.	.	T	0.49338	0.1551	M	0.64260	1.97	0.49915	D	0.99983	B	0.25809	0.135	B	0.21917	0.037	T	0.39313	-0.9620	9	0.09084	T	0.74	.	12.1301	0.53938	0.0:0.9014:0.0:0.0986	.	183	Q6B8I1	MDSP_HUMAN	L	183	ENSP00000361787:R183L	ENSP00000361787:R183L	R	-	2	0	DUSP13	76535452	0.002000	0.14202	0.989000	0.46669	0.903000	0.53119	0.524000	0.22940	2.490000	0.84030	0.462000	0.41574	CGG	DUSP13	-	pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000079393		0.667	DUSP13-012	KNOWN	NMD_exception|basic|CCDS	protein_coding	DUSP13	HGNC	protein_coding	OTTHUMT00000401503.3	61	0.00	0	C			76865446	76865446	-1	no_errors	ENST00000372702	ensembl	human	known	69_37n	missense	21	15.38	4	SNP	0.731	A
DUSP7	1849	genome.wustl.edu	37	3	52090059	52090059	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:52090059G>T	ENST00000495880.1	-	1	507	c.324C>A	c.(322-324)aaC>aaA	p.N108K	DUSP7_ENST00000296483.6_Missense_Mutation_p.N57K			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	108	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGATGGGCAGGTTGCCCTTGC	0.687																																						dbGAP											0													23.0	23.0	23.0					3																	52090059		2189	4292	6481	-	-	-	SO:0001583	missense	0			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.324C>A	3.37:g.52090059G>T	ENSP00000417183:p.Asn108Lys		Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.N57K	ENST00000495880.1	37	c.171	CCDS33766.2	3	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771571	0.69992	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.23950	1.88;1.88;1.88	5.02	5.02	0.67125	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.20820	0.0501	N	0.12182	0.205	0.80722	D	1	B;P	0.37612	0.127;0.602	B;P	0.49047	0.33;0.599	T	0.05022	-1.0911	10	0.07482	T	0.82	.	12.7672	0.57399	0.0815:0.0:0.9185:0.0	.	57;108	Q16829-2;Q16829	.;DUS7_HUMAN	K	108;57;41	ENSP00000417183:N108K;ENSP00000296483:N57K;ENSP00000418566:N41K	ENSP00000296483:N57K	N	-	3	2	DUSP7	52065099	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.301000	0.72782	2.337000	0.79520	0.655000	0.94253	AAC	DUSP7	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom	ENSG00000164086		0.687	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	HGNC	protein_coding	OTTHUMT00000349697.1	43	0.00	0	G	NM_001947		52090059	52090059	-1	no_errors	ENST00000296483	ensembl	human	known	69_37n	missense	14	21.05	4	SNP	1.000	T
DYNC1LI2	1783	genome.wustl.edu	37	16	66759819	66759821	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:66759819_66759821delGGC	ENST00000258198.2	-	12	1494_1496	c.1288_1290delGCC	c.(1288-1290)gccdel	p.A430del	RP11-63M22.2_ENST00000569274.1_RNA|DYNC1LI2_ENST00000379482.2_Intron|DYNC1LI2_ENST00000443351.2_In_Frame_Del_p.A353del	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	430					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TGAAGAAGCTGGCCAACACCCCT	0.443																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.1288_1290delGCC	16.37:g.66759819_66759821delGGC	ENSP00000258198:p.Ala430del		A8K6V1|B4DZP4|Q8TAT3	In_Frame_Del	DEL	pfam_Dynein_light_int_chain	p.A430in_frame_del	ENST00000258198.2	37	c.1290_1288	CCDS10818.1	16																																																																																			DYNC1LI2	-	pfam_Dynein_light_int_chain	ENSG00000135720		0.443	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI2	HGNC	protein_coding	OTTHUMT00000268846.1	43	0.00	0	GGC	NM_006141		66759819	66759821	-1	no_errors	ENST00000258198	ensembl	human	known	69_37n	in_frame_del	12	14.29	2	DEL	1.000:1.000:1.000	-
E2F8	79733	genome.wustl.edu	37	11	19256462	19256462	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:19256462C>T	ENST00000527884.1	-	5	827	c.595G>A	c.(595-597)Gag>Aag	p.E199K	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Missense_Mutation_p.E199K	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	199					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TACTTATTCTCCTCCCCGATG	0.428																																						dbGAP											0													135.0	111.0	119.0					11																	19256462		2199	4293	6492	-	-	-	SO:0001583	missense	0				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.595G>A	11.37:g.19256462C>T	ENSP00000434199:p.Glu199Lys		A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	pfam_E2F_TDP	p.E199K	ENST00000527884.1	37	c.595	CCDS7849.1	11	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032858	0.54790	.	.	ENSG00000129173	ENST00000527884;ENST00000531809;ENST00000396159;ENST00000250024	T;T	0.21191	2.02;2.02	5.67	4.76	0.60689	.	0.099202	0.64402	N	0.000002	T	0.19565	0.0470	L	0.43152	1.355	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.02893	-1.1097	10	0.25751	T	0.34	-13.4263	14.3024	0.66362	0.0:0.9284:0.0:0.0715	.	199	A0AVK6	E2F8_HUMAN	K	199	ENSP00000434199:E199K;ENSP00000250024:E199K	ENSP00000250024:E199K	E	-	1	0	E2F8	19213038	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.675000	0.61619	1.413000	0.46997	0.655000	0.94253	GAG	E2F8	-	NULL	ENSG00000129173		0.428	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	HGNC	protein_coding	OTTHUMT00000387830.1	142	0.00	0	C	NM_024680		19256462	19256462	-1	no_errors	ENST00000250024	ensembl	human	known	69_37n	missense	35	50.00	36	SNP	1.000	T
E2F8	79733	genome.wustl.edu	37	11	19256462	19256462	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr11:19256462C>T	ENST00000527884.1	-	5	827	c.595G>A	c.(595-597)Gag>Aag	p.E199K	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Missense_Mutation_p.E199K	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	199					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TACTTATTCTCCTCCCCGATG	0.428																																						dbGAP											0													135.0	111.0	119.0					11																	19256462		2199	4293	6492	-	-	-	SO:0001583	missense	0				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.595G>A	11.37:g.19256462C>T	ENSP00000434199:p.Glu199Lys		A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	pfam_E2F_TDP	p.E199K	ENST00000527884.1	37	c.595	CCDS7849.1	11	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032858	0.54790	.	.	ENSG00000129173	ENST00000527884;ENST00000531809;ENST00000396159;ENST00000250024	T;T	0.21191	2.02;2.02	5.67	4.76	0.60689	.	0.099202	0.64402	N	0.000002	T	0.19565	0.0470	L	0.43152	1.355	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.02893	-1.1097	10	0.25751	T	0.34	-13.4263	14.3024	0.66362	0.0:0.9284:0.0:0.0715	.	199	A0AVK6	E2F8_HUMAN	K	199	ENSP00000434199:E199K;ENSP00000250024:E199K	ENSP00000250024:E199K	E	-	1	0	E2F8	19213038	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.675000	0.61619	1.413000	0.46997	0.655000	0.94253	GAG	E2F8	-	NULL	ENSG00000129173		0.428	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	HGNC	protein_coding	OTTHUMT00000387830.1	89	0.00	0	C	NM_024680		19256462	19256462	-1	no_errors	ENST00000250024	ensembl	human	known	69_37n	missense	23	54.00	27	SNP	1.000	T
E2F8	79733	genome.wustl.edu	37	11	19256462	19256462	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:19256462C>T	ENST00000527884.1	-	5	827	c.595G>A	c.(595-597)Gag>Aag	p.E199K	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Missense_Mutation_p.E199K	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	199					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TACTTATTCTCCTCCCCGATG	0.428																																						dbGAP											0													135.0	111.0	119.0					11																	19256462		2199	4293	6492	-	-	-	SO:0001583	missense	0				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.595G>A	11.37:g.19256462C>T	ENSP00000434199:p.Glu199Lys		A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	pfam_E2F_TDP	p.E199K	ENST00000527884.1	37	c.595	CCDS7849.1	11	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032858	0.54790	.	.	ENSG00000129173	ENST00000527884;ENST00000531809;ENST00000396159;ENST00000250024	T;T	0.21191	2.02;2.02	5.67	4.76	0.60689	.	0.099202	0.64402	N	0.000002	T	0.19565	0.0470	L	0.43152	1.355	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.02893	-1.1097	10	0.25751	T	0.34	-13.4263	14.3024	0.66362	0.0:0.9284:0.0:0.0715	.	199	A0AVK6	E2F8_HUMAN	K	199	ENSP00000434199:E199K;ENSP00000250024:E199K	ENSP00000250024:E199K	E	-	1	0	E2F8	19213038	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.675000	0.61619	1.413000	0.46997	0.655000	0.94253	GAG	E2F8	-	NULL	ENSG00000129173		0.428	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	HGNC	protein_coding	OTTHUMT00000387830.1	142	0.00	0	C	NM_024680		19256462	19256462	-1	no_errors	ENST00000250024	ensembl	human	known	69_37n	missense	33	52.86	37	SNP	1.000	T
EHBP1	23301	genome.wustl.edu	37	2	63101518	63101518	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:63101518C>A	ENST00000263991.5	+	11	1623	c.1141C>A	c.(1141-1143)Cca>Aca	p.P381T	EHBP1_ENST00000354487.3_Missense_Mutation_p.P346T|EHBP1_ENST00000405289.1_Missense_Mutation_p.P346T|EHBP1_ENST00000431489.1_Missense_Mutation_p.P346T|EHBP1_ENST00000405015.3_Missense_Mutation_p.P346T	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	381						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AACTCCTCCTCCAAATAATTT	0.353																																						dbGAP											0													85.0	93.0	90.0					2																	63101518		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1141C>A	2.37:g.63101518C>A	ENSP00000263991:p.Pro381Thr		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P381T	ENST00000263991.5	37	c.1141	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	C	9.142	1.014108	0.19277	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.73789	-0.77;-0.77;-0.78;-0.76;-0.76	4.29	2.4	0.29515	.	0.567104	0.18353	N	0.143827	T	0.61763	0.2373	L	0.47716	1.5	0.27813	N	0.942084	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.002	T	0.54879	-0.8227	10	0.52906	T	0.07	.	3.2133	0.06690	0.201:0.531:0.0:0.2681	.	346;346;381	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	T	346;346;381;346;346	ENSP00000384143:P346T;ENSP00000403783:P346T;ENSP00000263991:P381T;ENSP00000346482:P346T;ENSP00000385524:P346T	ENSP00000263991:P381T	P	+	1	0	EHBP1	62955022	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	0.540000	0.23191	0.346000	0.23899	-0.225000	0.12378	CCA	EHBP1	-	NULL	ENSG00000115504		0.353	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	38	0.00	0	C	NM_015252		63101518	63101518	+1	no_errors	ENST00000263991	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	1.000	A
EIF3A	8661	genome.wustl.edu	37	10	120801902	120801902	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:120801902C>A	ENST00000369144.3	-	19	3257	c.3130G>T	c.(3130-3132)Gat>Tat	p.D1044Y	EIF3A_ENST00000541549.1_Missense_Mutation_p.D1010Y	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCCCGGTCATCATCCATCCCA	0.587																																						dbGAP											0													317.0	240.0	266.0					10																	120801902		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3130G>T	10.37:g.120801902C>A	ENSP00000358140:p.Asp1044Tyr		B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.D1044Y	ENST00000369144.3	37	c.3130	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475118	0.84640	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.25579	1.79;1.79	5.41	5.41	0.78517	.	0.374044	0.18726	N	0.132881	T	0.54046	0.1834	M	0.79926	2.475	0.80722	D	1	D;P	0.71674	0.998;0.739	D;B	0.63192	0.912;0.394	T	0.56147	-0.8027	10	0.66056	D	0.02	-10.8776	19.3887	0.94570	0.0:1.0:0.0:0.0	.	1010;1044	F5H335;Q14152	.;EIF3A_HUMAN	Y	1044;1010	ENSP00000358140:D1044Y;ENSP00000438178:D1010Y	ENSP00000358140:D1044Y	D	-	1	0	EIF3A	120791892	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.130000	0.77235	2.826000	0.97356	0.655000	0.94253	GAT	EIF3A	-	NULL	ENSG00000107581		0.587	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	44	0.00	0	C	NM_003750		120801902	120801902	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
EIF4G1	1981	genome.wustl.edu	37	3	184045691	184045691	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:184045691C>A	ENST00000346169.2	+	26	4125	c.3854C>A	c.(3853-3855)tCt>tAt	p.S1285Y	EIF4G1_ENST00000424196.1_Missense_Mutation_p.S1292Y|EIF4G1_ENST00000427845.1_Missense_Mutation_p.S1199Y|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000441154.1_Missense_Mutation_p.S1122Y|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Missense_Mutation_p.S1198Y|EIF4G1_ENST00000352767.3_Missense_Mutation_p.S1292Y|EIF4G1_ENST00000414031.1_Missense_Mutation_p.S1245Y|EIF4G1_ENST00000350481.5_Missense_Mutation_p.S1121Y|EIF4G1_ENST00000342981.4_Missense_Mutation_p.S1286Y|EIF4G1_ENST00000382330.3_Missense_Mutation_p.S1292Y|EIF4G1_ENST00000411531.1_Missense_Mutation_p.S1246Y|EIF4G1_ENST00000434061.2_Missense_Mutation_p.S1090Y|EIF4G1_ENST00000319274.6_Missense_Mutation_p.S1285Y|EIF4G1_ENST00000435046.2_Missense_Mutation_p.S1089Y	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1285	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTGTCGAGTCTACGCTGGAG	0.602																																						dbGAP											0													95.0	80.0	85.0					3																	184045691		2203	4300	6503	-	-	-	SO:0001583	missense	0			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3854C>A	3.37:g.184045691C>A	ENSP00000316879:p.Ser1285Tyr		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.S1292Y	ENST00000346169.2	37	c.3875	CCDS3259.1	3	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722146	0.89298	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	6.07	5.2	0.72013	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.103303	0.64402	D	0.000002	T	0.33411	0.0862	L	0.42744	1.35	0.58432	D	0.999998	P;P;P	0.51057	0.941;0.941;0.941	P;P;P	0.50136	0.632;0.632;0.632	T	0.11036	-1.0604	10	0.02654	T	1	-15.6537	17.6032	0.88031	0.0:0.8768:0.1232:0.0	.	1292;1286;1285	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	Y	1285;1245;1198;1292;1121;1292;1199;1286;1285;1292;1246;1122;1090;1089	ENSP00000316879:S1285Y;ENSP00000391935:S1245Y;ENSP00000376320:S1198Y;ENSP00000371767:S1292Y;ENSP00000317600:S1121Y;ENSP00000338020:S1292Y;ENSP00000407682:S1199Y;ENSP00000343450:S1286Y;ENSP00000323737:S1285Y;ENSP00000416255:S1292Y;ENSP00000395974:S1246Y;ENSP00000399858:S1122Y;ENSP00000411826:S1090Y;ENSP00000404754:S1089Y	ENSP00000323737:S1285Y	S	+	2	0	EIF4G1	185528385	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.747000	0.68689	1.573000	0.49748	0.655000	0.94253	TCT	EIF4G1	-	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	ENSG00000114867		0.602	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	HGNC	protein_coding	OTTHUMT00000345733.1	41	0.00	0	C	NM_182917		184045691	184045691	+1	no_errors	ENST00000352767	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	A
EIF4G2	1982	genome.wustl.edu	37	11	10825497	10825497	+	Silent	SNP	A	A	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:10825497A>T	ENST00000526148.1	-	8	1161	c.651T>A	c.(649-651)ctT>ctA	p.L217L	EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000525681.1_Silent_p.L217L|EIF4G2_ENST00000339995.5_Silent_p.L217L|SNORD97_ENST00000459187.1_RNA|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000396525.2_Silent_p.L217L	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CAAGCTTGCCAAGCTCTCCAA	0.438																																						dbGAP											0													141.0	135.0	137.0					11																	10825497		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.651T>A	11.37:g.10825497A>T				Silent	SNP	pfam_MIF4G-like_typ-3,pfam_W2_domain,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.L217	ENST00000526148.1	37	c.651	CCDS31428.1	11																																																																																			EIF4G2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000110321		0.438	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386603.1	81	0.00	0	A	NM_001418		10825497	10825497	-1	no_start_codon	ENST00000339995	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	T
ELP4	26610	genome.wustl.edu	37	11	31531366	31531366	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:31531366C>A	ENST00000350638.5	+	1	70	c.35C>A	c.(34-36)gCg>gAg	p.A12E	IMMP1L_ENST00000533642.1_5'Flank|IMMP1L_ENST00000528161.1_5'Flank|ELP4_ENST00000379163.5_Missense_Mutation_p.A12E|ELP4_ENST00000395934.2_Missense_Mutation_p.A12E|IMMP1L_ENST00000278200.1_5'Flank|IMMP1L_ENST00000534812.1_5'Flank|IMMP1L_ENST00000532287.1_5'Flank|IMMP1L_ENST00000526776.1_5'Flank	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	12					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					AGTGTTGCCGCGAGTACTGGG	0.587																																						dbGAP											0													41.0	47.0	45.0					11																	31531366		2104	4236	6340	-	-	-	SO:0001583	missense	0			AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.35C>A	11.37:g.31531366C>A	ENSP00000298937:p.Ala12Glu		B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	pfam_Elongator_complex_protein_4	p.A12E	ENST00000350638.5	37	c.35	CCDS7875.2	11	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727080	0.30593	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.45276	0.93;0.9;1.48	5.32	-9.24	0.00669	.	2.177890	0.01881	N	0.037883	T	0.15869	0.0382	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.10450	0.0;0.005;0.0	T	0.12760	-1.0535	10	0.22109	T	0.4	-8.3628	0.4017	0.00427	0.2722:0.2812:0.1509:0.2957	.	12;12;12	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	E	12	ENSP00000298937:A12E;ENSP00000368461:A12E;ENSP00000379267:A12E	ENSP00000298937:A12E	A	+	2	0	ELP4	31487942	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.825000	0.04433	-1.747000	0.01333	-1.242000	0.01536	GCG	ELP4	-	NULL	ENSG00000109911		0.587	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP4	HGNC	protein_coding	OTTHUMT00000286640.1	56	0.00	0	C	NM_019040		31531366	31531366	+1	no_errors	ENST00000395934	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.000	A
GFOD1	54438	genome.wustl.edu	37	6	13470378	13470378	+	Intron	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:13470378G>T	ENST00000379287.3	-	1	918				GFOD1_ENST00000379278.3_5'UTR|GFOD1_ENST00000603223.1_3'UTR|AL583828.1_ENST00000558378.1_Silent_p.G45G	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			GGTGAATGTAGCCAGTGATGT	0.478																																						dbGAP											0													66.0	60.0	62.0					6																	13470378		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.253+16491C>A	6.37:g.13470378G>T			A8E4L6|Q5T058|Q96JD4|Q9H5K2	Silent	SNP	NULL	p.G45	ENST00000379287.3	37	c.135	CCDS4524.1	6																																																																																			AL583828.1	-	NULL	ENSG00000187461		0.478	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000187461	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000039902.1	28	0.00	0	G	NM_018988		13470378	13470378	-1	no_errors	ENST00000558378	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.000	T
NVL	4931	genome.wustl.edu	37	1	224415230	224415230	+	3'UTR	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:224415230C>T	ENST00000281701.6	-	0	2928				NVL_ENST00000482491.1_3'UTR|NVL_ENST00000340871.4_3'UTR|NVL_ENST00000469075.1_3'UTR|NVL_ENST00000391875.2_3'UTR|RP11-365O16.6_ENST00000420350.1_RNA	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like							membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TTACATGAGGCCGCGCCTGTG	0.517																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.*98G>A	1.37:g.224415230C>T			B4DMC4|B4DP98|Q96EM7	RNA	SNP	-	NULL	ENST00000281701.6	37	NULL	CCDS1541.1	1																																																																																			RP11-365O16.6	-	-	ENSG00000237101		0.517	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000237101	Clone_based_vega_gene	protein_coding	OTTHUMT00000091453.2	29	0.00	0	C	NM_002533		224415230	224415230	+1	no_errors	ENST00000420350	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.000	T
QPRT	23475	genome.wustl.edu	37	16	29690477	29690477	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:29690477C>A	ENST00000395384.4	+	0	120				QPRT_ENST00000562473.1_5'Flank|QPRT_ENST00000219771.7_3'UTR	NM_014298.3	NP_055113.2	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase						NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|protein oligomerization (GO:0051259)|quinolinate catabolic process (GO:0034213)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9					Niacin(DB00627)	GAGCCTTGGTCCTGAGCAGCC	0.657																																						dbGAP											0													99.0	80.0	86.0					16																	29690477		2197	4300	6497	-	-	-			0			D78177	CCDS10651.1	16p11.2	2008-07-31	2008-07-31		ENSG00000103485	ENSG00000103485	2.4.2.19		9755	protein-coding gene	gene with protein product	"""nicotinate-nucleotide pyrophosphorylase (carboxylating)"""	606248				9473669	Standard	NM_014298		Approved	QPRTase	uc002dto.3	Q15274	OTTHUMG00000097770	ENST00000395384.4:c.-42C>A	16.37:g.29690477C>A			Q53XW7|Q96G22|Q9BSG6	Silent	SNP	NULL	p.V25	ENST00000395384.4	37	c.75	CCDS10651.1	16																																																																																			AC009133.19	-	NULL	ENSG00000262323		0.657	QPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262323	Clone_based_vega_gene	protein_coding	OTTHUMT00000215011.2	62	0.00	0	C	NM_014298		29690477	29690477	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449759	ensembl	human	putative	69_37n	silent	33	10.81	4	SNP	0.000	A
EPB41L1	2036	genome.wustl.edu	37	20	34761742	34761743	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:34761742_34761743delCA	ENST00000338074.2	+	2	204_205	c.43_44delCA	c.(43-45)cagfs	p.Q15fs	EPB41L1_ENST00000441639.1_Intron|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000373950.2_Intron|EPB41L1_ENST00000373941.1_Frame_Shift_Del_p.Q15fs|EPB41L1_ENST00000202028.5_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	15					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GAAGAAAGCTCAGGAGGAGGCC	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.43_44delCA	20.37:g.34761742_34761743delCA	ENSP00000337168:p.Gln15fs		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Frame_Shift_Del	DEL	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.Q15fs	ENST00000338074.2	37	c.43_44	CCDS13271.1	20																																																																																			EPB41L1	-	pirsf_Band_41_protein	ENSG00000088367		0.619	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	62	0.00	0	CA	NM_012156		34761742	34761743	+1	no_errors	ENST00000338074	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	1.000:1.000	-
EPB41L3	23136	genome.wustl.edu	37	18	5434102	5434102	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:5434102C>A	ENST00000341928.2	-	7	964	c.624G>T	c.(622-624)caG>caT	p.Q208H	EPB41L3_ENST00000540638.2_Missense_Mutation_p.Q208H|EPB41L3_ENST00000544123.1_Missense_Mutation_p.Q208H|EPB41L3_ENST00000400111.3_Missense_Mutation_p.Q208H|EPB41L3_ENST00000342933.3_Missense_Mutation_p.Q208H|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	208	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CATCTCGCAACTGCAAGCAGA	0.537																																						dbGAP											0													79.0	64.0	69.0					18																	5434102		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.624G>T	18.37:g.5434102C>A	ENSP00000343158:p.Gln208His		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.Q208H	ENST00000341928.2	37	c.624	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510996	0.64522	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111;ENST00000542652	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	6.02	-2.11	0.07187	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.099931	0.64402	D	0.000001	D	0.94660	0.8278	M	0.93638	3.44	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.999	D	0.93019	0.6438	10	0.87932	D	0	.	11.8995	0.52675	0.0:0.5691:0.0:0.4309	.	208;208;99;208;208	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	H	208;99;208;99;208;208;289	ENSP00000343158:Q208H;ENSP00000441174:Q208H;ENSP00000341138:Q208H;ENSP00000382981:Q208H	ENSP00000343158:Q208H	Q	-	3	2	EPB41L3	5424102	0.995000	0.38212	0.005000	0.12908	0.939000	0.58152	1.015000	0.29963	-0.834000	0.04239	-0.142000	0.14014	CAG	EPB41L3	-	pirsf_Band_41_protein,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000082397		0.537	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	58	0.00	0	C	NM_012307		5434102	5434102	-1	no_errors	ENST00000341928	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.734	A
EPS8L2	64787	genome.wustl.edu	37	11	722444	722445	+	Frame_Shift_Del	DEL	CC	CC	-	rs369792948		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:722444_722445delCC	ENST00000533256.1	+	14	1478_1479	c.1103_1104delCC	c.(1102-1104)tccfs	p.S368fs	EPS8L2_ENST00000318562.8_Frame_Shift_Del_p.S368fs|EPS8L2_ENST00000526198.1_Frame_Shift_Del_p.S384fs|EPS8L2_ENST00000530636.1_Frame_Shift_Del_p.S368fs|AP006621.9_ENST00000527021.2_RNA			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	368					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGCTCCGTCTCCTGCCCACTGC	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1103_1104delCC	11.37:g.722444_722445delCC	ENSP00000435585:p.Ser368fs		B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Frame_Shift_Del	DEL	pfam_PTB,pfam_SH3_domain,pfam_PTyr_interaction_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_PTyr_interaction_dom,pfscan_SH3_domain	p.S368fs	ENST00000533256.1	37	c.1103_1104	CCDS31328.1	11																																																																																			EPS8L2	-	NULL	ENSG00000177106		0.653	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPS8L2	HGNC	protein_coding	OTTHUMT00000382344.1	56	0.00	0	CC	NM_022772		722444	722445	+1	no_errors	ENST00000318562	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.409:0.978	-
FADS1	3992	genome.wustl.edu	37	11	61570511	61570511	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:61570511C>A	ENST00000350997.7	-	10	1553	c.1321G>T	c.(1321-1323)Gag>Tag	p.E441*	FADS1_ENST00000460649.1_Nonsense_Mutation_p.E86*|FADS1_ENST00000542506.1_Nonsense_Mutation_p.E300*|FADS1_ENST00000536991.1_Nonsense_Mutation_p.E132*|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000433932.1_Nonsense_Mutation_p.E300*	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	384					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CACTGGTGCTCAATCTGGAAG	0.577																																						dbGAP											0													105.0	107.0	106.0					11																	61570511		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.1321G>T	11.37:g.61570511C>A	ENSP00000322229:p.Glu441*		A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Nonsense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5,prints_Cyt_B5	p.E441*	ENST00000350997.7	37	c.1321	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	C	42	9.431802	0.99169	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000536991;ENST00000433932;ENST00000460649;ENST00000542506	.	.	.	4.88	4.88	0.63580	.	0.000000	0.48767	U	0.000170	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.1434	18.0334	0.89292	0.0:1.0:0.0:0.0	.	.	.	.	X	316;441;300;132;300;86;300	.	ENSP00000322229:E441X	E	-	1	0	FADS1	61327087	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.170000	0.77587	2.436000	0.82500	0.655000	0.94253	GAG	FADS1	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000149485		0.577	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	37	0.00	0	C	NM_013402		61570511	61570511	-1	no_errors	ENST00000350997	ensembl	human	known	69_37n	nonsense	13	18.75	3	SNP	1.000	A
FAM134A	79137	genome.wustl.edu	37	2	220045923	220045923	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:220045923G>A	ENST00000430297.2	+	6	916	c.780G>A	c.(778-780)aaG>aaA	p.K260K		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	260						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACACGACAAGAGGAGTAAGG	0.557																																						dbGAP											0													71.0	73.0	72.0					2																	220045923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.780G>A	2.37:g.220045923G>A			Q6P1P5|Q9H0K7	Silent	SNP	pfam_Reticulon	p.K260	ENST00000430297.2	37	c.780	CCDS2434.1	2																																																																																			FAM134A	-	NULL	ENSG00000144567		0.557	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM134A	HGNC	protein_coding	OTTHUMT00000336147.2	131	0.00	0	G	NM_024293		220045923	220045923	+1	no_errors	ENST00000430297	ensembl	human	known	69_37n	silent	68	28.42	27	SNP	1.000	A
FAM134A	79137	genome.wustl.edu	37	2	220045923	220045923	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:220045923G>A	ENST00000430297.2	+	6	916	c.780G>A	c.(778-780)aaG>aaA	p.K260K		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	260						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACACGACAAGAGGAGTAAGG	0.557																																						dbGAP											0													71.0	73.0	72.0					2																	220045923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.780G>A	2.37:g.220045923G>A			Q6P1P5|Q9H0K7	Silent	SNP	pfam_Reticulon	p.K260	ENST00000430297.2	37	c.780	CCDS2434.1	2																																																																																			FAM134A	-	NULL	ENSG00000144567		0.557	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM134A	HGNC	protein_coding	OTTHUMT00000336147.2	52	0.00	0	G	NM_024293		220045923	220045923	+1	no_errors	ENST00000430297	ensembl	human	known	69_37n	silent	26	42.22	19	SNP	1.000	A
FAM134A	79137	genome.wustl.edu	37	2	220045923	220045923	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:220045923G>A	ENST00000430297.2	+	6	916	c.780G>A	c.(778-780)aaG>aaA	p.K260K		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	260						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACACGACAAGAGGAGTAAGG	0.557																																						dbGAP											0													71.0	73.0	72.0					2																	220045923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.780G>A	2.37:g.220045923G>A			Q6P1P5|Q9H0K7	Silent	SNP	pfam_Reticulon	p.K260	ENST00000430297.2	37	c.780	CCDS2434.1	2																																																																																			FAM134A	-	NULL	ENSG00000144567		0.557	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM134A	HGNC	protein_coding	OTTHUMT00000336147.2	131	0.00	0	G	NM_024293		220045923	220045923	+1	no_errors	ENST00000430297	ensembl	human	known	69_37n	silent	81	30.51	36	SNP	1.000	A
FAM179B	23116	genome.wustl.edu	37	14	45513889	45513889	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:45513889G>A	ENST00000361577.3	+	13	4184	c.3970G>A	c.(3970-3972)Gat>Aat	p.D1324N	FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.D1324N	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1324										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGTTTAAGTGATCTTTTCAC	0.328																																						dbGAP											0													92.0	91.0	92.0					14																	45513889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3970G>A	14.37:g.45513889G>A	ENSP00000355045:p.Asp1324Asn		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1324N	ENST00000361577.3	37	c.3970	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793323	0.90453	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.56776	0.44;0.44	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.159285	0.56097	D	0.000040	T	0.74291	0.3697	M	0.76838	2.35	0.80722	D	1	D;D	0.76494	0.978;0.999	D;D	0.70716	0.924;0.97	T	0.76408	-0.2970	10	0.66056	D	0.02	-20.5435	19.29	0.94095	0.0:0.0:1.0:0.0	.	1324;1324	G3XAE9;Q9Y4F4	.;F179B_HUMAN	N	1324	ENSP00000355045:D1324N;ENSP00000354917:D1324N	ENSP00000354917:D1324N	D	+	1	0	FAM179B	44583639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.649000	0.89929	0.650000	0.86243	GAT	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.328	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	54	0.00	0	G	XM_113781		45513889	45513889	+1	no_errors	ENST00000361577	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	1.000	A
FAM179B	23116	genome.wustl.edu	37	14	45513889	45513889	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr14:45513889G>A	ENST00000361577.3	+	13	4184	c.3970G>A	c.(3970-3972)Gat>Aat	p.D1324N	FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.D1324N	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1324										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGTTTAAGTGATCTTTTCAC	0.328																																						dbGAP											0													92.0	91.0	92.0					14																	45513889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3970G>A	14.37:g.45513889G>A	ENSP00000355045:p.Asp1324Asn		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1324N	ENST00000361577.3	37	c.3970	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793323	0.90453	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.56776	0.44;0.44	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.159285	0.56097	D	0.000040	T	0.74291	0.3697	M	0.76838	2.35	0.80722	D	1	D;D	0.76494	0.978;0.999	D;D	0.70716	0.924;0.97	T	0.76408	-0.2970	10	0.66056	D	0.02	-20.5435	19.29	0.94095	0.0:0.0:1.0:0.0	.	1324;1324	G3XAE9;Q9Y4F4	.;F179B_HUMAN	N	1324	ENSP00000355045:D1324N;ENSP00000354917:D1324N	ENSP00000354917:D1324N	D	+	1	0	FAM179B	44583639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.649000	0.89929	0.650000	0.86243	GAT	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.328	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	115	0.00	0	G	XM_113781		45513889	45513889	+1	no_errors	ENST00000361577	ensembl	human	known	69_37n	missense	62	23.46	19	SNP	1.000	A
FAM179B	23116	genome.wustl.edu	37	14	45513889	45513889	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:45513889G>A	ENST00000361577.3	+	13	4184	c.3970G>A	c.(3970-3972)Gat>Aat	p.D1324N	FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.D1324N	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1324										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CTGTTTAAGTGATCTTTTCAC	0.328																																						dbGAP											0													92.0	91.0	92.0					14																	45513889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3970G>A	14.37:g.45513889G>A	ENSP00000355045:p.Asp1324Asn		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1324N	ENST00000361577.3	37	c.3970	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793323	0.90453	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.56776	0.44;0.44	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.159285	0.56097	D	0.000040	T	0.74291	0.3697	M	0.76838	2.35	0.80722	D	1	D;D	0.76494	0.978;0.999	D;D	0.70716	0.924;0.97	T	0.76408	-0.2970	10	0.66056	D	0.02	-20.5435	19.29	0.94095	0.0:0.0:1.0:0.0	.	1324;1324	G3XAE9;Q9Y4F4	.;F179B_HUMAN	N	1324	ENSP00000355045:D1324N;ENSP00000354917:D1324N	ENSP00000354917:D1324N	D	+	1	0	FAM179B	44583639	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.649000	0.89929	0.650000	0.86243	GAT	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.328	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	54	0.00	0	G	XM_113781		45513889	45513889	+1	no_errors	ENST00000361577	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	1.000	A
FAM3A	60343	genome.wustl.edu	37	X	153736169	153736169	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:153736169C>T	ENST00000447601.2	-	6	824	c.358G>A	c.(358-360)Gcc>Acc	p.A120T	FAM3A_ENST00000393572.1_Missense_Mutation_p.A82T|FAM3A_ENST00000369641.3_Missense_Mutation_p.A127T|FAM3A_ENST00000492763.1_5'Flank|FAM3A_ENST00000359889.5_Missense_Mutation_p.A120T|FAM3A_ENST00000369643.1_Missense_Mutation_p.A120T|FAM3A_ENST00000434658.2_Intron	NM_021806.2	NP_068578.2	P98173	FAM3A_HUMAN	family with sequence similarity 3, member A	120						extracellular region (GO:0005576)				kidney(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGGCCCGGGCCTCGATGAGC	0.657																																						dbGAP											0													13.0	11.0	12.0					X																	153736169		2183	4277	6460	-	-	-	SO:0001583	missense	0			X74610	CCDS35453.1, CCDS55542.1, CCDS55543.1, CCDS76060.1	Xq28	2008-07-29			ENSG00000071889	ENSG00000071889			13749	protein-coding gene	gene with protein product		300492				8733135, 8281148	Standard	NM_021806		Approved	DXS560S, 2-19, XAP-7	uc004fls.2	P98173	OTTHUMG00000013418	ENST00000447601.2:c.358G>A	X.37:g.153736169C>T	ENSP00000416146:p.Ala120Thr		A6QRH6|B2RBI7|B4DFI8|D3DWX4|Q5HY76|Q96H51	Missense_Mutation	SNP	NULL	p.A120T	ENST00000447601.2	37	c.358	CCDS35453.1	X	.	.	.	.	.	.	.	.	.	.	C	9.091	1.001704	0.19121	.	.	ENSG00000071889	ENST00000359889;ENST00000369643;ENST00000447601;ENST00000369641;ENST00000393572;ENST00000426266	T;T;T;T;T;T	0.57273	0.77;0.77;0.77;1.98;0.41;2.1	5.19	5.19	0.71726	.	0.228496	0.44688	D	0.000431	T	0.24122	0.0584	N	0.01522	-0.82	0.80722	D	1	B;B	0.17268	0.021;0.004	B;B	0.17433	0.018;0.006	T	0.30822	-0.9965	10	0.02654	T	1	-4.8812	16.5103	0.84282	0.0:1.0:0.0:0.0	.	134;120	D3DWX8;P98173	.;FAM3A_HUMAN	T	120;120;120;127;82;127	ENSP00000352955:A120T;ENSP00000358657:A120T;ENSP00000416146:A120T;ENSP00000358655:A127T;ENSP00000377202:A82T;ENSP00000396845:A127T	ENSP00000352955:A120T	A	-	1	0	FAM3A	153389363	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	4.013000	0.57138	2.154000	0.67381	0.529000	0.55759	GCC	FAM3A	-	NULL	ENSG00000071889		0.657	FAM3A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3A	HGNC	protein_coding	OTTHUMT00000037362.2	64	0.00	0	C			153736169	153736169	-1	no_errors	ENST00000359889	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
FARP2	9855	genome.wustl.edu	37	2	242312535	242312535	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:242312535G>T	ENST00000264042.3	+	2	183	c.13G>T	c.(13-15)Gaa>Taa	p.E5*	FARP2_ENST00000373287.4_Nonsense_Mutation_p.E5*|FARP2_ENST00000545004.1_Nonsense_Mutation_p.E5*|FARP2_ENST00000479427.1_3'UTR	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	5					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GGGGGAGATAGAAGGAACATA	0.458																																						dbGAP											0													51.0	53.0	53.0					2																	242312535		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.13G>T	2.37:g.242312535G>T	ENSP00000264042:p.Glu5*		B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.E5*	ENST00000264042.3	37	c.13	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.057660	0.98632	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000418082;ENST00000445489	.	.	.	5.65	5.65	0.86999	.	0.124622	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	17.9066	0.88920	0.0:0.0:1.0:0.0	.	.	.	.	X	5	.	ENSP00000264042:E5X	E	+	1	0	FARP2	241961208	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	7.651000	0.83577	2.653000	0.90120	0.563000	0.77884	GAA	FARP2	-	NULL	ENSG00000006607		0.458	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	40	0.00	0	G			242312535	242312535	+1	no_errors	ENST00000264042	ensembl	human	known	69_37n	nonsense	25	16.67	5	SNP	1.000	T
FBXL20	84961	genome.wustl.edu	37	17	37457283	37457283	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:37457283C>A	ENST00000264658.6	-	4	465	c.205G>T	c.(205-207)Gac>Tac	p.D69Y	FBXL20_ENST00000583610.1_Missense_Mutation_p.D69Y|FBXL20_ENST00000577399.1_Missense_Mutation_p.D71Y|FBXL20_ENST00000394294.3_Missense_Mutation_p.D69Y	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	69					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			TCAAATAGGTCAATTCGCTGC	0.418																																						dbGAP											0													101.0	85.0	90.0					17																	37457283		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.205G>T	17.37:g.37457283C>A	ENSP00000264658:p.Asp69Tyr		A8K729|Q38J52	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.D69Y	ENST00000264658.6	37	c.205	CCDS32640.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820698	0.90873	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	T;T	0.38722	1.12;1.12	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.78033	-0.2362	10	0.87932	D	0	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	69;69	Q96IG2-2;Q96IG2	.;FXL20_HUMAN	Y	69	ENSP00000264658:D69Y;ENSP00000377832:D69Y	ENSP00000264658:D69Y	D	-	1	0	FBXL20	34710809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.805000	0.96524	0.655000	0.94253	GAC	FBXL20	-	NULL	ENSG00000108306		0.418	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL20	HGNC	protein_coding	OTTHUMT00000444315.2	46	0.00	0	C	NM_032875		37457283	37457283	-1	no_errors	ENST00000264658	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	1.000	A
FASN	2194	genome.wustl.edu	37	17	80037393	80037393	+	Missense_Mutation	SNP	C	C	T	rs557050126		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:80037393C>T	ENST00000306749.2	-	42	7456	c.7238G>A	c.(7237-7239)cGc>cAc	p.R2413H	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2413	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CAGCTCCTGGCGGTCCAGGCC	0.637																																					Colon(59;314 1043 11189 28578 32273)	dbGAP											0													69.0	60.0	63.0					17																	80037393		2203	4298	6501	-	-	-	SO:0001583	missense	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.7238G>A	17.37:g.80037393C>T	ENSP00000304592:p.Arg2413His		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.R2413H	ENST00000306749.2	37	c.7238	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086271	0.55861	.	.	ENSG00000169710	ENST00000306749	T	0.26810	1.71	4.16	2.06	0.26882	Fatty acid synthase, domain 2 (1);Thioesterase (1);	0.618907	0.15836	N	0.242275	T	0.33118	0.0852	M	0.70842	2.15	0.25154	N	0.990402	D	0.59357	0.985	P	0.52793	0.709	T	0.19976	-1.0289	10	0.56958	D	0.05	-12.1525	2.5584	0.04765	0.1579:0.5294:0.1531:0.1596	.	2413	P49327	FAS_HUMAN	H	2413	ENSP00000304592:R2413H	ENSP00000304592:R2413H	R	-	2	0	FASN	77630682	0.528000	0.26314	0.309000	0.25155	0.894000	0.52154	1.110000	0.31147	0.471000	0.27319	0.561000	0.74099	CGC	FASN	-	pfam_Thioesterase	ENSG00000169710		0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	82	0.00	0	C	NM_004104		80037393	80037393	-1	no_errors	ENST00000306749	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.086	T
FGFRL1	53834	genome.wustl.edu	37	4	1018703	1018703	+	Silent	SNP	G	G	A	rs537262686		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:1018703G>A	ENST00000398484.2	+	8	1663	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P	FGFRL1_ENST00000264748.6_Silent_p.P361P|FGFRL1_ENST00000504138.1_Silent_p.P361P|RP11-460I19.2_ENST00000503095.1_lincRNA|FGFRL1_ENST00000510644.1_Silent_p.P361P			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	361					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCCAAAACCGCCAGGGCCAC	0.662													g|||	1	0.000199681	0.0	0.0	5008	,	,		13661	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													26.0	31.0	29.0					4																	1018703		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0				CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.1083G>A	4.37:g.1018703G>A			B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P361	ENST00000398484.2	37	c.1083	CCDS3344.1	4																																																																																			FGFRL1	-	NULL	ENSG00000127418		0.662	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFRL1	HGNC	protein_coding	OTTHUMT00000239195.2	79	0.00	0	G	NM_021923		1018703	1018703	+1	no_errors	ENST00000264748	ensembl	human	known	69_37n	silent	37	11.90	5	SNP	0.068	A
FHOD3	80206	genome.wustl.edu	37	18	34359414	34359414	+	Missense_Mutation	SNP	G	G	A	rs201185019		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:34359414G>A	ENST00000359247.4	+	24	4190	c.4190G>A	c.(4189-4191)cGa>cAa	p.R1397Q	FHOD3_ENST00000591635.1_Missense_Mutation_p.R610Q|TPGS2_ENST00000590652.1_5'Flank|FHOD3_ENST00000445677.1_Missense_Mutation_p.R1376Q|FHOD3_ENST00000592128.1_Missense_Mutation_p.R393Q|FHOD3_ENST00000257209.4_Missense_Mutation_p.R1414Q|FHOD3_ENST00000590592.1_Missense_Mutation_p.R1597Q	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1397					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACTGCAGTGCGAAGAACCCTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18975	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	80.0	81.0					18																	34359414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.4190G>A	18.37:g.34359414G>A	ENSP00000352186:p.Arg1397Gln		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.R1414Q	ENST00000359247.4	37	c.4241		18	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.29	3.592390	0.66219	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.49720	0.79;0.77;0.78	5.15	5.15	0.70609	.	0.047846	0.85682	D	0.000000	T	0.72724	0.3496	M	0.88105	2.93	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.78314	0.986;0.968;0.991	T	0.78334	-0.2244	10	0.87932	D	0	.	14.4684	0.67499	0.0:0.0:1.0:0.0	.	1376;1397;1414	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	Q	1414;1397;1376	ENSP00000257209:R1414Q;ENSP00000352186:R1397Q;ENSP00000411430:R1376Q	ENSP00000257209:R1414Q	R	+	2	0	FHOD3	32613412	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	6.469000	0.73555	2.548000	0.85928	0.591000	0.81541	CGA	FHOD3	-	NULL	ENSG00000134775		0.577	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	41	0.00	0	G	XM_371114		34359414	34359414	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34359414	34359414	+	Missense_Mutation	SNP	G	G	A	rs201185019		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr18:34359414G>A	ENST00000359247.4	+	24	4190	c.4190G>A	c.(4189-4191)cGa>cAa	p.R1397Q	FHOD3_ENST00000591635.1_Missense_Mutation_p.R610Q|TPGS2_ENST00000590652.1_5'Flank|FHOD3_ENST00000445677.1_Missense_Mutation_p.R1376Q|FHOD3_ENST00000592128.1_Missense_Mutation_p.R393Q|FHOD3_ENST00000257209.4_Missense_Mutation_p.R1414Q|FHOD3_ENST00000590592.1_Missense_Mutation_p.R1597Q	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1397					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACTGCAGTGCGAAGAACCCTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18975	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	80.0	81.0					18																	34359414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.4190G>A	18.37:g.34359414G>A	ENSP00000352186:p.Arg1397Gln		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.R1414Q	ENST00000359247.4	37	c.4241		18	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.29	3.592390	0.66219	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.49720	0.79;0.77;0.78	5.15	5.15	0.70609	.	0.047846	0.85682	D	0.000000	T	0.72724	0.3496	M	0.88105	2.93	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.78314	0.986;0.968;0.991	T	0.78334	-0.2244	10	0.87932	D	0	.	14.4684	0.67499	0.0:0.0:1.0:0.0	.	1376;1397;1414	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	Q	1414;1397;1376	ENSP00000257209:R1414Q;ENSP00000352186:R1397Q;ENSP00000411430:R1376Q	ENSP00000257209:R1414Q	R	+	2	0	FHOD3	32613412	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	6.469000	0.73555	2.548000	0.85928	0.591000	0.81541	CGA	FHOD3	-	NULL	ENSG00000134775		0.577	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	37	0.00	0	G	XM_371114		34359414	34359414	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34359414	34359414	+	Missense_Mutation	SNP	G	G	A	rs201185019		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:34359414G>A	ENST00000359247.4	+	24	4190	c.4190G>A	c.(4189-4191)cGa>cAa	p.R1397Q	FHOD3_ENST00000591635.1_Missense_Mutation_p.R610Q|TPGS2_ENST00000590652.1_5'Flank|FHOD3_ENST00000445677.1_Missense_Mutation_p.R1376Q|FHOD3_ENST00000592128.1_Missense_Mutation_p.R393Q|FHOD3_ENST00000257209.4_Missense_Mutation_p.R1414Q|FHOD3_ENST00000590592.1_Missense_Mutation_p.R1597Q	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1397					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACTGCAGTGCGAAGAACCCTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18975	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	80.0	81.0					18																	34359414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.4190G>A	18.37:g.34359414G>A	ENSP00000352186:p.Arg1397Gln		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.R1414Q	ENST00000359247.4	37	c.4241		18	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.29	3.592390	0.66219	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.49720	0.79;0.77;0.78	5.15	5.15	0.70609	.	0.047846	0.85682	D	0.000000	T	0.72724	0.3496	M	0.88105	2.93	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.78314	0.986;0.968;0.991	T	0.78334	-0.2244	10	0.87932	D	0	.	14.4684	0.67499	0.0:0.0:1.0:0.0	.	1376;1397;1414	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	Q	1414;1397;1376	ENSP00000257209:R1414Q;ENSP00000352186:R1397Q;ENSP00000411430:R1376Q	ENSP00000257209:R1414Q	R	+	2	0	FHOD3	32613412	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	6.469000	0.73555	2.548000	0.85928	0.591000	0.81541	CGA	FHOD3	-	NULL	ENSG00000134775		0.577	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	41	0.00	0	G	XM_371114		34359414	34359414	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	A
FKBP8	23770	genome.wustl.edu	37	19	18644121	18644121	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:18644121G>T	ENST00000596558.2	-	7	1088	c.979C>A	c.(979-981)Ccc>Acc	p.P327T	AC005387.2_ENST00000596596.1_RNA|FKBP8_ENST00000597960.3_Missense_Mutation_p.P328T|AC005387.3_ENST00000597837.2_RNA|FKBP8_ENST00000222308.4_Missense_Mutation_p.P327T|FKBP8_ENST00000610101.1_Missense_Mutation_p.P168T|FKBP8_ENST00000608443.1_Missense_Mutation_p.P328T|FKBP8_ENST00000453489.2_Missense_Mutation_p.P356T			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	327					apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						CTCAGGATGGGGATGGCCTCA	0.622																																						dbGAP											0													67.0	47.0	54.0					19																	18644121		2203	4299	6502	-	-	-	SO:0001583	missense	0			L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.979C>A	19.37:g.18644121G>T	ENSP00000472302:p.Pro327Thr		C8C9T5|Q53GU3|Q7Z349|Q86YK6	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.P356T	ENST00000596558.2	37	c.1066		19	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606003	0.28623	.	.	ENSG00000105701	ENST00000222308;ENST00000544835;ENST00000453489	T;T;T	0.40756	1.02;1.02;1.02	4.86	4.86	0.63082	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.260506	0.39020	N	0.001482	T	0.20780	0.0500	N	0.05306	-0.075	0.34378	D	0.692767	B;B;B;B	0.29432	0.136;0.028;0.063;0.244	B;B;B;B	0.28465	0.07;0.09;0.018;0.041	T	0.28586	-1.0039	10	0.15066	T	0.55	-24.4699	11.9603	0.53005	0.0:0.0:0.7129:0.2871	.	356;271;327;328	B7Z6M0;B2R8G6;Q14318;Q14318-2	.;.;FKBP8_HUMAN;.	T	328;168;356	ENSP00000222308:P328T;ENSP00000441267:P168T;ENSP00000388891:P356T	ENSP00000222308:P328T	P	-	1	0	FKBP8	18505121	0.877000	0.30153	1.000000	0.80357	0.991000	0.79684	1.005000	0.29834	2.528000	0.85240	0.655000	0.94253	CCC	FKBP8	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000105701		0.622	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	FKBP8	HGNC	protein_coding	OTTHUMT00000466374.3	90	0.00	0	G	NM_012181		18644121	18644121	-1	no_errors	ENST00000453489	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.996	T
FLG	2312	genome.wustl.edu	37	1	152282658	152282658	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:152282658G>A	ENST00000368799.1	-	3	4739	c.4704C>T	c.(4702-4704)gcC>gcT	p.A1568A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1568	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGCTGCCGGCCCGAGTGG	0.587									Ichthyosis																													dbGAP											0													184.0	195.0	191.0					1																	152282658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4704C>T	1.37:g.152282658G>A			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.A1568	ENST00000368799.1	37	c.4704	CCDS30860.1	1																																																																																			FLG	-	pfam_Filaggrin	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	237	0.00	0	G	NM_002016		152282658	152282658	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	silent	120	46.93	107	SNP	0.000	A
FLG	2312	genome.wustl.edu	37	1	152282658	152282658	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr1:152282658G>A	ENST00000368799.1	-	3	4739	c.4704C>T	c.(4702-4704)gcC>gcT	p.A1568A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1568	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGCTGCCGGCCCGAGTGG	0.587									Ichthyosis																													dbGAP											0													184.0	195.0	191.0					1																	152282658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4704C>T	1.37:g.152282658G>A			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.A1568	ENST00000368799.1	37	c.4704	CCDS30860.1	1																																																																																			FLG	-	pfam_Filaggrin	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	199	0.00	0	G	NM_002016		152282658	152282658	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	silent	108	44.62	87	SNP	0.000	A
FLG	2312	genome.wustl.edu	37	1	152282658	152282658	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:152282658G>A	ENST00000368799.1	-	3	4739	c.4704C>T	c.(4702-4704)gcC>gcT	p.A1568A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1568	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGCTGCCGGCCCGAGTGG	0.587									Ichthyosis																													dbGAP											0													184.0	195.0	191.0					1																	152282658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4704C>T	1.37:g.152282658G>A			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.A1568	ENST00000368799.1	37	c.4704	CCDS30860.1	1																																																																																			FLG	-	pfam_Filaggrin	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	237	0.00	0	G	NM_002016		152282658	152282658	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	silent	150	52.23	164	SNP	0.000	A
FLNC	2318	genome.wustl.edu	37	7	128488729	128488729	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:128488729C>T	ENST00000325888.8	+	27	4956	c.4695C>T	c.(4693-4695)gaC>gaT	p.D1565D	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.D1565D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1565					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TCACCATCGACGCACGGGACG	0.662																																						dbGAP											0													105.0	116.0	112.0					7																	128488729		2086	4215	6301	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4695C>T	7.37:g.128488729C>T			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.D1565	ENST00000325888.8	37	c.4695	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.662	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	66	0.00	0	C			128488729	128488729	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	1.000	T
FPR1	2357	genome.wustl.edu	37	19	52249581	52249581	+	Missense_Mutation	SNP	G	G	T	rs542658365		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:52249581G>T	ENST00000595042.1	-	3	808	c.667C>A	c.(667-669)Ctt>Att	p.L223I	FPR1_ENST00000304748.4_Missense_Mutation_p.L223I	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	223					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	GTGGCAATAAGCCCATAACTG	0.527																																						dbGAP											0													122.0	110.0	114.0					19																	52249581		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.667C>A	19.37:g.52249581G>T	ENSP00000471493:p.Leu223Ile		Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Frt_met_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt	p.L223I	ENST00000595042.1	37	c.667	CCDS12839.1	19	.	.	.	.	.	.	.	.	.	.	.	10.47	1.359618	0.24598	.	.	ENSG00000171051	ENST00000304748	T	0.40476	1.03	3.65	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000035	T	0.48150	0.1484	L	0.58969	1.84	0.25266	N	0.98955	D	0.55800	0.973	P	0.59012	0.85	T	0.26326	-1.0106	10	0.33940	T	0.23	.	5.4881	0.16761	0.1194:0.2067:0.6739:0.0	.	223	P21462	FPR1_HUMAN	I	223	ENSP00000302707:L223I	ENSP00000302707:L223I	L	-	1	0	FPR1	56941393	0.000000	0.05858	0.438000	0.26821	0.075000	0.17131	0.448000	0.21726	0.804000	0.34136	0.650000	0.86243	CTT	FPR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt	ENSG00000171051		0.527	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR1	HGNC	protein_coding	OTTHUMT00000466905.1	39	0.00	0	G	NM_002029		52249581	52249581	-1	no_errors	ENST00000304748	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	0.721	T
FRMPD4	9758	genome.wustl.edu	37	X	12735733	12735733	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:12735733G>T	ENST00000380682.1	+	16	3294	c.2788G>T	c.(2788-2790)Gaa>Taa	p.E930*		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	930					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AAAACAGTCAGAAAACCTCTC	0.547																																						dbGAP											0													123.0	117.0	119.0					X																	12735733		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2788G>T	X.37:g.12735733G>T	ENSP00000370057:p.Glu930*		A8K0X9|O15032	Nonsense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.E930*	ENST00000380682.1	37	c.2788	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	G	44	11.051668	0.99508	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-26.5964	19.1909	0.93666	0.0:0.0:1.0:0.0	.	.	.	.	X	930;921;919	.	ENSP00000304583:E919X	E	+	1	0	FRMPD4	12645654	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.360000	0.97119	2.483000	0.83821	0.600000	0.82982	GAA	FRMPD4	-	NULL	ENSG00000169933		0.547	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	53	0.00	0	G	XM_045712		12735733	12735733	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	nonsense	30	11.76	4	SNP	1.000	T
FSD2	123722	genome.wustl.edu	37	15	83437774	83437774	+	Missense_Mutation	SNP	G	G	A	rs200109394		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:83437774G>A	ENST00000334574.8	-	9	1592	c.1411C>T	c.(1411-1413)Ccc>Tcc	p.P471S	FSD2_ENST00000541889.1_Missense_Mutation_p.P426S			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	471	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						ATAATGGGGGGAGAAGGTGCT	0.473																																						dbGAP											0													39.0	40.0	40.0					15																	83437774		1934	4138	6072	-	-	-	SO:0001583	missense	0			AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1411C>T	15.37:g.83437774G>A	ENSP00000335651:p.Pro471Ser		B3KVG1|B7ZM02	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.P471S	ENST00000334574.8	37	c.1411	CCDS45332.1	15	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	17.08	3.298721	0.60195	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.62498	0.57;0.02	5.46	4.55	0.56014	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.049383	0.85682	N	0.000000	T	0.76983	0.4064	M	0.72118	2.19	0.51233	D	0.999915	D;D	0.89917	0.993;1.0	D;D	0.97110	0.954;1.0	T	0.79235	-0.1887	10	0.66056	D	0.02	-19.2145	13.0852	0.59135	0.0772:0.0:0.9228:0.0	.	426;471	B7ZM02;A1L4K1	.;FSD2_HUMAN	S	471;426	ENSP00000335651:P471S;ENSP00000444078:P426S	ENSP00000335651:P471S	P	-	1	0	FSD2	81234828	1.000000	0.71417	0.807000	0.32361	0.453000	0.32348	7.198000	0.77823	1.314000	0.45095	0.561000	0.74099	CCC	FSD2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000186628		0.473	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD2	HGNC	protein_coding	OTTHUMT00000418385.1	87	0.00	0	G	NM_001007122		83437774	83437774	-1	no_errors	ENST00000334574	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	A
FSD2	123722	genome.wustl.edu	37	15	83437774	83437774	+	Missense_Mutation	SNP	G	G	A	rs200109394		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:83437774G>A	ENST00000334574.8	-	9	1592	c.1411C>T	c.(1411-1413)Ccc>Tcc	p.P471S	FSD2_ENST00000541889.1_Missense_Mutation_p.P426S			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	471	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						ATAATGGGGGGAGAAGGTGCT	0.473																																						dbGAP											0													39.0	40.0	40.0					15																	83437774		1934	4138	6072	-	-	-	SO:0001583	missense	0			AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1411C>T	15.37:g.83437774G>A	ENSP00000335651:p.Pro471Ser		B3KVG1|B7ZM02	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.P471S	ENST00000334574.8	37	c.1411	CCDS45332.1	15	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	17.08	3.298721	0.60195	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.62498	0.57;0.02	5.46	4.55	0.56014	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.049383	0.85682	N	0.000000	T	0.76983	0.4064	M	0.72118	2.19	0.51233	D	0.999915	D;D	0.89917	0.993;1.0	D;D	0.97110	0.954;1.0	T	0.79235	-0.1887	10	0.66056	D	0.02	-19.2145	13.0852	0.59135	0.0772:0.0:0.9228:0.0	.	426;471	B7ZM02;A1L4K1	.;FSD2_HUMAN	S	471;426	ENSP00000335651:P471S;ENSP00000444078:P426S	ENSP00000335651:P471S	P	-	1	0	FSD2	81234828	1.000000	0.71417	0.807000	0.32361	0.453000	0.32348	7.198000	0.77823	1.314000	0.45095	0.561000	0.74099	CCC	FSD2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000186628		0.473	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD2	HGNC	protein_coding	OTTHUMT00000418385.1	87	0.00	0	G	NM_001007122		83437774	83437774	-1	no_errors	ENST00000334574	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186657778	186657778	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:186657778C>A	ENST00000424728.1	+	16	5915	c.5915C>A	c.(5914-5916)tCt>tAt	p.S1972Y	FSIP2_ENST00000343098.5_Missense_Mutation_p.S2061Y|AC008174.3_ENST00000429929.1_RNA|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1972										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GATTCATATTCTGATGAGCAA	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.5915C>A	2.37:g.186657778C>A	ENSP00000401306:p.Ser1972Tyr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.S2061Y	ENST00000424728.1	37	c.6182		2	.	.	.	.	.	.	.	.	.	.	C	2.979	-0.210724	0.06140	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.57595	0.39;0.4	5.2	3.37	0.38596	.	.	.	.	.	T	0.39911	0.1096	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.29305	-1.0016	7	0.48119	T	0.1	.	6.3995	0.21630	0.1796:0.7291:0.0:0.0913	.	.	.	.	Y	2061;1972;1972	ENSP00000344403:S2061Y;ENSP00000401306:S1972Y	ENSP00000321903:S1972Y	S	+	2	0	FSIP2	186366023	0.404000	0.25328	0.004000	0.12327	0.017000	0.09413	1.455000	0.35190	0.753000	0.32945	-0.157000	0.13467	TCT	FSIP2	-	NULL	ENSG00000188738		0.368	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	28	0.00	0	C	NM_173651		186657778	186657778	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.013	A
FSIP2	401024	genome.wustl.edu	37	2	186657778	186657778	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:186657778C>A	ENST00000424728.1	+	16	5915	c.5915C>A	c.(5914-5916)tCt>tAt	p.S1972Y	FSIP2_ENST00000343098.5_Missense_Mutation_p.S2061Y|AC008174.3_ENST00000429929.1_RNA|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1972										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GATTCATATTCTGATGAGCAA	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.5915C>A	2.37:g.186657778C>A	ENSP00000401306:p.Ser1972Tyr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.S2061Y	ENST00000424728.1	37	c.6182		2	.	.	.	.	.	.	.	.	.	.	C	2.979	-0.210724	0.06140	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.57595	0.39;0.4	5.2	3.37	0.38596	.	.	.	.	.	T	0.39911	0.1096	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.29305	-1.0016	7	0.48119	T	0.1	.	6.3995	0.21630	0.1796:0.7291:0.0:0.0913	.	.	.	.	Y	2061;1972;1972	ENSP00000344403:S2061Y;ENSP00000401306:S1972Y	ENSP00000321903:S1972Y	S	+	2	0	FSIP2	186366023	0.404000	0.25328	0.004000	0.12327	0.017000	0.09413	1.455000	0.35190	0.753000	0.32945	-0.157000	0.13467	TCT	FSIP2	-	NULL	ENSG00000188738		0.368	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	28	0.00	0	C	NM_173651		186657778	186657778	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.013	A
FUBP1	8880	genome.wustl.edu	37	1	78413028	78413028	+	IGR	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:78413028G>T	ENST00000370768.2	-	0	2378				FUBP1_ENST00000489495.1_5'UTR	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1						positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CAAGATATCAGCACTGTATTC	0.299			"""F, N"""		oligodendroglioma																																	dbGAP		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0																																										-	-	-	SO:0001628	intergenic_variant	0			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799		1.37:g.78413028G>T			Q12828	RNA	SNP	-	NULL	ENST00000370768.2	37	NULL	CCDS683.1	1																																																																																			FUBP1	-	-	ENSG00000162613		0.299	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP1	HGNC	protein_coding	OTTHUMT00000098030.3	35	0.00	0	G	NM_003902		78413028	78413028	-1	no_errors	ENST00000489495	ensembl	human	known	69_37n	rna	20	13.04	3	SNP	1.000	T
GAPDHS	26330	genome.wustl.edu	37	19	36034281	36034281	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:36034281G>T	ENST00000222286.4	+	8	897	c.781G>T	c.(781-783)Gac>Tac	p.D261Y	AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000444728.1_RNA|TMEM147_ENST00000222284.5_5'Flank|TMEM147_ENST00000392204.2_5'Flank|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000590125.1_RNA|TMEM147_ENST00000392205.1_5'Flank	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	261					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GAAGACAGTGGACGGGCCATC	0.582																																						dbGAP											0													91.0	90.0	91.0					19																	36034281		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.781G>T	19.37:g.36034281G>T	ENSP00000222286:p.Asp261Tyr		B2RC82|O60823|Q6JTT9|Q9HCU6	Missense_Mutation	SNP	pfam_GlycerAld_3-P_DH_cat,pfam_GlycerAld_3-P_DH_NAD(P)-bd,smart_GlycerAld_3-P_DH_NAD(P)-bd,pirsf_GlycerAld/Erythrose_P_DH,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	p.D261Y	ENST00000222286.4	37	c.781	CCDS12465.1	19	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819478	0.71028	.	.	ENSG00000105679	ENST00000222286	T	0.75938	-0.98	5.43	5.43	0.79202	Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92394	0.7586	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95246	0.8355	10	0.87932	D	0	-30.5301	17.0955	0.86634	0.0:0.0:1.0:0.0	.	261	O14556	G3PT_HUMAN	Y	261	ENSP00000222286:D261Y	ENSP00000222286:D261Y	D	+	1	0	GAPDHS	40726121	1.000000	0.71417	0.998000	0.56505	0.351000	0.29236	9.767000	0.98960	2.710000	0.92621	0.561000	0.74099	GAC	GAPDHS	-	pfam_GlycerAld_3-P_DH_cat,pirsf_GlycerAld/Erythrose_P_DH,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	ENSG00000105679		0.582	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAPDHS	HGNC	protein_coding	OTTHUMT00000460423.1	59	0.00	0	G	NM_014364		36034281	36034281	+1	no_errors	ENST00000222286	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
GBP5	115362	genome.wustl.edu	37	1	89732029	89732029	+	Splice_Site	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:89732029G>A	ENST00000370459.3	-	6	995	c.868C>T	c.(868-870)Cgt>Tgt	p.R290C	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Splice_Site_p.R290C			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	290	GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TAATACTCACGAGATCCATTG	0.358																																						dbGAP											0													72.0	71.0	71.0					1																	89732029		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.868+1C>T	1.37:g.89732029G>A			B2RCE1|Q86TM5	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.R290C	ENST00000370459.3	37	c.868	CCDS722.1	1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.481727	0.26598	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.02323	4.34;4.34;4.34	5.3	-2.97	0.05530	Guanylate-binding protein, C-terminal (3);	1.194660	0.05779	N	0.608297	T	0.01765	0.0056	M	0.70108	2.13	0.22034	N	0.999409	P	0.46512	0.879	B	0.44163	0.443	T	0.34576	-0.9823	9	.	.	.	2.3286	6.2009	0.20575	0.5222:0.1693:0.3085:0.0	.	290	Q96PP8	GBP5_HUMAN	C	290	ENSP00000340396:R290C;ENSP00000359488:R290C;ENSP00000403010:R290C	.	R	-	1	0	GBP5	89504617	0.000000	0.05858	0.145000	0.22337	0.004000	0.04260	-0.636000	0.05465	-0.644000	0.05465	-0.151000	0.13558	CGT	GBP5	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000154451		0.358	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	HGNC	protein_coding	OTTHUMT00000027700.1	32	0.00	0	G	NM_052942	Missense_Mutation	89732029	89732029	-1	no_errors	ENST00000343435	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.035	A
GDPD4	220032	genome.wustl.edu	37	11	76979997	76979997	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:76979997G>T	ENST00000376217.2	-	8	846	c.596C>A	c.(595-597)aCc>aAc	p.T199N	GDPD4_ENST00000315938.4_Missense_Mutation_p.T199N|GDPD4_ENST00000527489.1_5'Flank			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	199	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TCCAAAGATGGTTGGCTTGGG	0.448																																						dbGAP											0													161.0	158.0	159.0					11																	76979997		2200	4292	6492	-	-	-	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.596C>A	11.37:g.76979997G>T	ENSP00000365390:p.Thr199Asn		Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.T199N	ENST00000376217.2	37	c.596		11	.	.	.	.	.	.	.	.	.	.	G	1.629	-0.519465	0.04171	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.11604	2.76;2.76	5.07	-4.99	0.03010	.	1.395530	0.04219	N	0.333207	T	0.07098	0.0180	L	0.38175	1.15	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.35599	-0.9782	10	0.18276	T	0.48	7.8456	3.2807	0.06915	0.113:0.1951:0.4365:0.2554	.	199	Q6W3E5-2	.	N	199	ENSP00000365390:T199N;ENSP00000320815:T199N	ENSP00000320815:T199N	T	-	2	0	GDPD4	76657645	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.883000	0.04170	-1.288000	0.02378	-0.302000	0.09304	ACC	GDPD4	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000178795		0.448	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	54	0.00	0	G	NM_182833		76979997	76979997	-1	no_errors	ENST00000376217	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.000	T
GLE1	2733	genome.wustl.edu	37	9	131287531	131287531	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:131287531G>A	ENST00000309971.4	+	7	1064	c.958G>A	c.(958-960)Gac>Aac	p.D320N	GLE1_ENST00000539582.1_Missense_Mutation_p.D66N|GLE1_ENST00000494417.1_3'UTR|GLE1_ENST00000372770.4_Missense_Mutation_p.D320N	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	320					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						GGAAATGCGGGACCTCCTGAT	0.562																																						dbGAP											0													68.0	63.0	65.0					9																	131287531		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.958G>A	9.37:g.131287531G>A	ENSP00000308622:p.Asp320Asn		O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	pfam_GLE1	p.D320N	ENST00000309971.4	37	c.958	CCDS35154.1	9	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573170	0.45902	.	.	ENSG00000119392	ENST00000309971;ENST00000372770;ENST00000539582	T;T;T	0.76968	-0.06;0.35;-1.06	5.35	2.12	0.27331	.	0.475758	0.24318	N	0.039569	T	0.73125	0.3547	L	0.57536	1.79	0.24397	N	0.994722	P;P	0.47762	0.698;0.9	B;P	0.45138	0.115;0.471	T	0.63047	-0.6724	10	0.22109	T	0.4	-14.7898	10.9706	0.47436	0.0775:0.2607:0.6617:0.0	.	320;320	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	N	320;320;66	ENSP00000308622:D320N;ENSP00000361856:D320N;ENSP00000438670:D66N	ENSP00000308622:D320N	D	+	1	0	GLE1	130327352	0.998000	0.40836	0.980000	0.43619	0.924000	0.55760	1.035000	0.30216	0.579000	0.29504	0.462000	0.41574	GAC	GLE1	-	NULL	ENSG00000119392		0.562	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	HGNC	protein_coding	OTTHUMT00000054456.1	38	0.00	0	G	NM_001003722		131287531	131287531	+1	no_errors	ENST00000309971	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.997	A
GPR112	139378	genome.wustl.edu	37	X	135429953	135429953	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:135429953C>T	ENST00000394143.1	+	6	4379	c.4088C>T	c.(4087-4089)aCa>aTa	p.T1363I	GPR112_ENST00000287534.4_Missense_Mutation_p.T1300I|GPR112_ENST00000394141.1_Missense_Mutation_p.T1158I|GPR112_ENST00000370652.1_Missense_Mutation_p.T1363I|GPR112_ENST00000412101.1_Missense_Mutation_p.T1158I	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1363					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTTGGGAAAACAGCTCTCCCC	0.468																																						dbGAP											0													165.0	148.0	154.0					X																	135429953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4088C>T	X.37:g.135429953C>T	ENSP00000377699:p.Thr1363Ile		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T1363I	ENST00000394143.1	37	c.4088	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	c	6.929	0.541067	0.13250	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.39056	1.14;1.14;1.1;1.21;1.1	2.95	2.06	0.26882	.	.	.	.	.	T	0.48519	0.1504	L	0.34521	1.04	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.991;0.996;0.99	T	0.26677	-1.0096	9	0.87932	D	0	.	6.1906	0.20522	0.0:0.8368:0.0:0.1632	.	1300;1158;1363	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	I	1363;1363;1158;1300;1158	ENSP00000377699:T1363I;ENSP00000359686:T1363I;ENSP00000416526:T1158I;ENSP00000287534:T1300I;ENSP00000377697:T1158I	ENSP00000287534:T1300I	T	+	2	0	GPR112	135257619	0.974000	0.33945	0.016000	0.15963	0.014000	0.08584	1.160000	0.31761	0.408000	0.25621	-0.351000	0.07748	ACA	GPR112	-	NULL	ENSG00000156920		0.468	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	48	0.00	0	C			135429953	135429953	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.014	T
GTPBP4	23560	genome.wustl.edu	37	10	1034404	1034404	+	5'UTR	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:1034404G>A	ENST00000360803.4	+	0	67				GTPBP4_ENST00000538293.1_5'UTR|GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000545048.1_5'Flank|AL359878.1_ENST00000381466.1_5'Flank	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4						GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GTACCCGCGTGCATACGGCTG	0.627																																						dbGAP											0													30.0	31.0	30.0					10																	1034404		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.-16G>A	10.37:g.1034404G>A			B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	RNA	SNP	-	NULL	ENST00000360803.4	37	NULL	CCDS31132.1	10																																																																																			GTPBP4	-	-	ENSG00000107937		0.627	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP4	HGNC	protein_coding	OTTHUMT00000046412.1	119	0.00	0	G	NM_012341		1034404	1034404	+1	no_errors	ENST00000491635	ensembl	human	known	69_37n	rna	39	11.11	5	SNP	0.496	A
GTPBP4	23560	genome.wustl.edu	37	10	1034404	1034404	+	5'UTR	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:1034404G>A	ENST00000360803.4	+	0	67				GTPBP4_ENST00000538293.1_5'UTR|GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000545048.1_5'Flank|AL359878.1_ENST00000381466.1_5'Flank	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4						GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GTACCCGCGTGCATACGGCTG	0.627																																						dbGAP											0													30.0	31.0	30.0					10																	1034404		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.-16G>A	10.37:g.1034404G>A			B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	RNA	SNP	-	NULL	ENST00000360803.4	37	NULL	CCDS31132.1	10																																																																																			GTPBP4	-	-	ENSG00000107937		0.627	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP4	HGNC	protein_coding	OTTHUMT00000046412.1	119	0.00	0	G	NM_012341		1034404	1034404	+1	no_errors	ENST00000491635	ensembl	human	known	69_37n	rna	75	21.88	21	SNP	0.496	A
HECTD2	143279	genome.wustl.edu	37	10	93256090	93256090	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:93256090C>T	ENST00000298068.5	+	15	1735	c.1641C>T	c.(1639-1641)atC>atT	p.I547I	HECTD2_ENST00000446394.1_Silent_p.I551I|HECTD2_ENST00000536715.1_Silent_p.I136I|HECTD2_ENST00000371667.1_Silent_p.I197I	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	547	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CAGTAGGCATCTGCAATGTTA	0.373																																					NSCLC(12;376 469 1699 39910 41417)	dbGAP											0													156.0	133.0	141.0					10																	93256090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1641C>T	10.37:g.93256090C>T			Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Silent	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.I551	ENST00000298068.5	37	c.1653	CCDS7414.1	10																																																																																			HECTD2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000165338		0.373	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	176	0.00	0	C			93256090	93256090	+1	no_errors	ENST00000446394	ensembl	human	known	69_37n	silent	110	17.29	23	SNP	1.000	T
HECTD2	143279	genome.wustl.edu	37	10	93256090	93256090	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr10:93256090C>T	ENST00000298068.5	+	15	1735	c.1641C>T	c.(1639-1641)atC>atT	p.I547I	HECTD2_ENST00000446394.1_Silent_p.I551I|HECTD2_ENST00000536715.1_Silent_p.I136I|HECTD2_ENST00000371667.1_Silent_p.I197I	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	547	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CAGTAGGCATCTGCAATGTTA	0.373																																					NSCLC(12;376 469 1699 39910 41417)	dbGAP											0													156.0	133.0	141.0					10																	93256090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1641C>T	10.37:g.93256090C>T			Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Silent	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.I551	ENST00000298068.5	37	c.1653	CCDS7414.1	10																																																																																			HECTD2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000165338		0.373	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	78	0.00	0	C			93256090	93256090	+1	no_errors	ENST00000446394	ensembl	human	known	69_37n	silent	53	17.19	11	SNP	1.000	T
HECTD2	143279	genome.wustl.edu	37	10	93256090	93256090	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:93256090C>T	ENST00000298068.5	+	15	1735	c.1641C>T	c.(1639-1641)atC>atT	p.I547I	HECTD2_ENST00000446394.1_Silent_p.I551I|HECTD2_ENST00000536715.1_Silent_p.I136I|HECTD2_ENST00000371667.1_Silent_p.I197I	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	547	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CAGTAGGCATCTGCAATGTTA	0.373																																					NSCLC(12;376 469 1699 39910 41417)	dbGAP											0													156.0	133.0	141.0					10																	93256090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1641C>T	10.37:g.93256090C>T			Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Silent	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.I551	ENST00000298068.5	37	c.1653	CCDS7414.1	10																																																																																			HECTD2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000165338		0.373	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	176	0.00	0	C			93256090	93256090	+1	no_errors	ENST00000446394	ensembl	human	known	69_37n	silent	74	26.00	26	SNP	1.000	T
HIPK3	10114	genome.wustl.edu	37	11	33360340	33360340	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:33360340C>A	ENST00000303296.4	+	5	1684	c.1379C>A	c.(1378-1380)tCt>tAt	p.S460Y	HIPK3_ENST00000379016.3_Missense_Mutation_p.S460Y|HIPK3_ENST00000525975.1_Missense_Mutation_p.S460Y|HIPK3_ENST00000456517.1_Missense_Mutation_p.S460Y|HIPK3_ENST00000534262.1_3'UTR	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	460	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						GGAATGAAGTCTAAAGAAGCC	0.363																																						dbGAP											0													142.0	131.0	135.0					11																	33360340		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1379C>A	11.37:g.33360340C>A	ENSP00000304226:p.Ser460Tyr		O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S460Y	ENST00000303296.4	37	c.1379	CCDS7884.1	11	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983954	0.93044	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.58358	0.37;0.34;0.37;0.37	5.89	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	T	0.60573	0.2279	L	0.51914	1.62	0.80722	D	1	P;B	0.38020	0.615;0.277	P;B	0.48189	0.57;0.175	T	0.64411	-0.6414	10	0.87932	D	0	.	16.5175	0.84304	0.1318:0.8682:0.0:0.0	.	460;460	Q9H422-2;Q9H422	.;HIPK3_HUMAN	Y	460	ENSP00000431710:S460Y;ENSP00000304226:S460Y;ENSP00000368301:S460Y;ENSP00000398241:S460Y	ENSP00000304226:S460Y	S	+	2	0	HIPK3	33316916	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	1.473000	0.48159	0.555000	0.69702	TCT	HIPK3	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000110422		0.363	HIPK3-001	KNOWN	basic|CCDS	protein_coding	HIPK3	HGNC	protein_coding	OTTHUMT00000255358.1	36	0.00	0	C	NM_005734		33360340	33360340	+1	no_errors	ENST00000303296	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	1.000	A
HK2	3099	genome.wustl.edu	37	2	75117929	75117929	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:75117929C>T	ENST00000290573.2	+	18	3215	c.2615C>T	c.(2614-2616)gCc>gTc	p.A872V	HK2_ENST00000409174.1_Missense_Mutation_p.A844V	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	872	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TCCAGCTTTGCCAAAGTCATG	0.488																																						dbGAP											0													200.0	195.0	197.0					2																	75117929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2615C>T	2.37:g.75117929C>T	ENSP00000290573:p.Ala872Val		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.A872V	ENST00000290573.2	37	c.2615	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976882	0.92982	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96334	-3.98;-3.98	4.99	4.99	0.66335	Hexokinase, C-terminal (1);	0.242284	0.42420	D	0.000719	D	0.96605	0.8892	M	0.69185	2.1	0.50813	D	0.999899	P	0.45348	0.856	P	0.50860	0.652	D	0.96742	0.9547	10	0.59425	D	0.04	-18.4276	15.8192	0.78626	0.0:1.0:0.0:0.0	.	872	P52789	HXK2_HUMAN	V	872;872;844	ENSP00000290573:A872V;ENSP00000387140:A844V	ENSP00000290573:A872V	A	+	2	0	HK2	74971437	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.320000	0.79064	2.609000	0.88269	0.561000	0.74099	GCC	HK2	-	pfam_Hexokinase_C	ENSG00000159399		0.488	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	58	0.00	0	C	NM_000189		75117929	75117929	+1	no_errors	ENST00000290573	ensembl	human	known	69_37n	missense	31	30.43	14	SNP	1.000	T
HK2	3099	genome.wustl.edu	37	2	75117929	75117929	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:75117929C>T	ENST00000290573.2	+	18	3215	c.2615C>T	c.(2614-2616)gCc>gTc	p.A872V	HK2_ENST00000409174.1_Missense_Mutation_p.A844V	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	872	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TCCAGCTTTGCCAAAGTCATG	0.488																																						dbGAP											0													200.0	195.0	197.0					2																	75117929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2615C>T	2.37:g.75117929C>T	ENSP00000290573:p.Ala872Val		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.A872V	ENST00000290573.2	37	c.2615	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976882	0.92982	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96334	-3.98;-3.98	4.99	4.99	0.66335	Hexokinase, C-terminal (1);	0.242284	0.42420	D	0.000719	D	0.96605	0.8892	M	0.69185	2.1	0.50813	D	0.999899	P	0.45348	0.856	P	0.50860	0.652	D	0.96742	0.9547	10	0.59425	D	0.04	-18.4276	15.8192	0.78626	0.0:1.0:0.0:0.0	.	872	P52789	HXK2_HUMAN	V	872;872;844	ENSP00000290573:A872V;ENSP00000387140:A844V	ENSP00000290573:A872V	A	+	2	0	HK2	74971437	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.320000	0.79064	2.609000	0.88269	0.561000	0.74099	GCC	HK2	-	pfam_Hexokinase_C	ENSG00000159399		0.488	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	87	0.00	0	C	NM_000189		75117929	75117929	+1	no_errors	ENST00000290573	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	1.000	T
HK2	3099	genome.wustl.edu	37	2	75117929	75117929	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:75117929C>T	ENST00000290573.2	+	18	3215	c.2615C>T	c.(2614-2616)gCc>gTc	p.A872V	HK2_ENST00000409174.1_Missense_Mutation_p.A844V	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	872	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TCCAGCTTTGCCAAAGTCATG	0.488																																						dbGAP											0													200.0	195.0	197.0					2																	75117929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2615C>T	2.37:g.75117929C>T	ENSP00000290573:p.Ala872Val		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.A872V	ENST00000290573.2	37	c.2615	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976882	0.92982	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96334	-3.98;-3.98	4.99	4.99	0.66335	Hexokinase, C-terminal (1);	0.242284	0.42420	D	0.000719	D	0.96605	0.8892	M	0.69185	2.1	0.50813	D	0.999899	P	0.45348	0.856	P	0.50860	0.652	D	0.96742	0.9547	10	0.59425	D	0.04	-18.4276	15.8192	0.78626	0.0:1.0:0.0:0.0	.	872	P52789	HXK2_HUMAN	V	872;872;844	ENSP00000290573:A872V;ENSP00000387140:A844V	ENSP00000290573:A872V	A	+	2	0	HK2	74971437	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.320000	0.79064	2.609000	0.88269	0.561000	0.74099	GCC	HK2	-	pfam_Hexokinase_C	ENSG00000159399		0.488	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	58	0.00	0	C	NM_000189		75117929	75117929	+1	no_errors	ENST00000290573	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	1.000	T
HMGB3	3149	genome.wustl.edu	37	X	150155775	150155775	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:150155775G>T	ENST00000325307.7	+	4	561	c.465G>T	c.(463-465)aaG>aaT	p.K155N	HMGB3_ENST00000448905.2_Splice_Site_p.K155N	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	155					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					AGTATGAGAAGGTAAGGTGGG	0.493																																						dbGAP											0													50.0	46.0	47.0					X																	150155775		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.465+1G>T	X.37:g.150155775G>T			O95556|Q6NS40	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K155N	ENST00000325307.7	37	c.465	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	g	19.25	3.791321	0.70452	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	4.49	3.62	0.41486	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	M	0.88640	2.97	0.80722	D	1	B	0.33739	0.422	B	0.43274	0.414	D	0.97996	1.0357	10	0.87932	D	0	.	11.1371	0.48381	0.0934:0.0:0.9066:0.0	.	155	O15347	HMGB3_HUMAN	N	155	ENSP00000410354:K155N;ENSP00000359393:K155N;ENSP00000405601:K155N;ENSP00000442758:K155N	ENSP00000359393:K155N	K	+	3	2	HMGB3	149906433	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	7.338000	0.79269	0.808000	0.34231	0.529000	0.55759	AAG	HMGB3	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000029993		0.493	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	HGNC	protein_coding	OTTHUMT00000060867.1	28	0.00	0	G	NM_005342	Missense_Mutation	150155775	150155775	+1	no_errors	ENST00000325307	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
HMGB3	3149	genome.wustl.edu	37	X	150155775	150155775	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chrX:150155775G>T	ENST00000325307.7	+	4	561	c.465G>T	c.(463-465)aaG>aaT	p.K155N	HMGB3_ENST00000448905.2_Splice_Site_p.K155N	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	155					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					AGTATGAGAAGGTAAGGTGGG	0.493																																						dbGAP											0													50.0	46.0	47.0					X																	150155775		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.465+1G>T	X.37:g.150155775G>T			O95556|Q6NS40	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K155N	ENST00000325307.7	37	c.465	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	g	19.25	3.791321	0.70452	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	4.49	3.62	0.41486	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	M	0.88640	2.97	0.80722	D	1	B	0.33739	0.422	B	0.43274	0.414	D	0.97996	1.0357	10	0.87932	D	0	.	11.1371	0.48381	0.0934:0.0:0.9066:0.0	.	155	O15347	HMGB3_HUMAN	N	155	ENSP00000410354:K155N;ENSP00000359393:K155N;ENSP00000405601:K155N;ENSP00000442758:K155N	ENSP00000359393:K155N	K	+	3	2	HMGB3	149906433	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	7.338000	0.79269	0.808000	0.34231	0.529000	0.55759	AAG	HMGB3	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000029993		0.493	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	HGNC	protein_coding	OTTHUMT00000060867.1	57	0.00	0	G	NM_005342	Missense_Mutation	150155775	150155775	+1	no_errors	ENST00000325307	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	1.000	T
HMGB3	3149	genome.wustl.edu	37	X	150155775	150155775	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:150155775G>T	ENST00000325307.7	+	4	561	c.465G>T	c.(463-465)aaG>aaT	p.K155N	HMGB3_ENST00000448905.2_Splice_Site_p.K155N	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	155					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					AGTATGAGAAGGTAAGGTGGG	0.493																																						dbGAP											0													50.0	46.0	47.0					X																	150155775		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.465+1G>T	X.37:g.150155775G>T			O95556|Q6NS40	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K155N	ENST00000325307.7	37	c.465	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	g	19.25	3.791321	0.70452	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	4.49	3.62	0.41486	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	M	0.88640	2.97	0.80722	D	1	B	0.33739	0.422	B	0.43274	0.414	D	0.97996	1.0357	10	0.87932	D	0	.	11.1371	0.48381	0.0934:0.0:0.9066:0.0	.	155	O15347	HMGB3_HUMAN	N	155	ENSP00000410354:K155N;ENSP00000359393:K155N;ENSP00000405601:K155N;ENSP00000442758:K155N	ENSP00000359393:K155N	K	+	3	2	HMGB3	149906433	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	7.338000	0.79269	0.808000	0.34231	0.529000	0.55759	AAG	HMGB3	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000029993		0.493	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	HGNC	protein_coding	OTTHUMT00000060867.1	28	0.00	0	G	NM_005342	Missense_Mutation	150155775	150155775	+1	no_errors	ENST00000325307	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	T
HMGXB3	22993	genome.wustl.edu	37	5	149427198	149427198	+	Missense_Mutation	SNP	G	G	T	rs566396436		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:149427198G>T	ENST00000502717.1	+	17	3426	c.2962G>T	c.(2962-2964)Gcc>Tcc	p.A988S	HMGXB3_ENST00000503427.1_Missense_Mutation_p.A956S	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	1234					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						CAGTGGCAGTGCCTTGGTGAG	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18796	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													47.0	48.0	48.0					5																	149427198		692	1591	2283	-	-	-	SO:0001583	missense	0			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.2962G>T	5.37:g.149427198G>T	ENSP00000421917:p.Ala988Ser		G5E9Y4|Q86UG3|Q9UMF4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.A988S	ENST00000502717.1	37	c.2962	CCDS54935.1	5	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899494	0.33535	.	.	ENSG00000113716	ENST00000503427;ENST00000502717	.	.	.	5.97	5.03	0.67393	.	0.217561	0.47852	D	0.000217	T	0.45657	0.1353	N	0.19112	0.55	0.41520	D	0.988395	B	0.18863	0.031	B	0.20577	0.03	T	0.44907	-0.9297	9	0.87932	D	0	-11.9498	15.991	0.80206	0.0:0.0:0.7793:0.2207	.	1234	Q12766	HMGX3_HUMAN	S	956;988	.	ENSP00000421917:A988S	A	+	1	0	HMGXB3	149407391	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	4.237000	0.58681	2.837000	0.97791	0.655000	0.94253	GCC	HMGXB3	-	NULL	ENSG00000113716		0.587	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	75	0.00	0	G	XM_001717202		149427198	149427198	+1	no_errors	ENST00000502717	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	T
HMHA1	23526	genome.wustl.edu	37	19	1073174	1073174	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:1073174G>A	ENST00000313093.2	+	3	679	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	HMHA1_ENST00000592335.1_Silent_p.G30G|HMHA1_ENST00000590214.1_Missense_Mutation_p.A177T|HMHA1_ENST00000536472.1_5'UTR|HMHA1_ENST00000586866.1_Missense_Mutation_p.A154T|HMHA1_ENST00000543365.1_Missense_Mutation_p.A33T|HMHA1_ENST00000539243.2_Missense_Mutation_p.A166T	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	150					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCCCGCGGGCCCACGAGTG	0.657																																						dbGAP											0													44.0	50.0	48.0					19																	1073174		2202	4298	6500	-	-	-	SO:0001583	missense	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.448G>A	19.37:g.1073174G>A	ENSP00000316772:p.Ala150Thr		B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.A150T	ENST00000313093.2	37	c.448	CCDS32863.1	19	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040726	0.75732	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000412039;ENST00000543365	T;T;T	0.28666	1.7;1.71;1.6	4.16	4.16	0.48862	.	0.062767	0.64402	D	0.000007	T	0.53190	0.1781	M	0.76328	2.33	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.995	P;D;P	0.69479	0.866;0.964;0.797	T	0.55289	-0.8164	10	0.38643	T	0.18	-24.0175	15.0034	0.71492	0.0:0.0:1.0:0.0	.	166;33;150	F6QP70;F5H1R4;Q92619	.;.;HMHA1_HUMAN	T	166;150;150;144;33	ENSP00000439601:A166T;ENSP00000316772:A150T;ENSP00000438979:A33T	ENSP00000316772:A150T	A	+	1	0	HMHA1	1024174	1.000000	0.71417	0.986000	0.45419	0.239000	0.25481	7.335000	0.79234	1.855000	0.53841	0.491000	0.48974	GCC	HMHA1	-	NULL	ENSG00000180448		0.657	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	83	0.00	0	G			1073174	1073174	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	missense	27	12.50	4	SNP	1.000	A
IBTK	25998	genome.wustl.edu	37	6	82891744	82891744	+	Splice_Site	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:82891744C>T	ENST00000306270.7	-	26	4126	c.3577G>A	c.(3577-3579)Gca>Aca	p.A1193T	IBTK_ENST00000503631.1_Splice_Site_p.A992T|IBTK_ENST00000510291.1_Splice_Site_p.A1178T	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1193					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AGAGAAGATGCCCTGCAAAAG	0.348																																						dbGAP											0													58.0	62.0	61.0					6																	82891744		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3576-1G>A	6.37:g.82891744C>T			Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.A1193T	ENST00000306270.7	37	c.3577	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053707	0.55218	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.33654	1.73;1.4;1.74	5.26	-5.06	0.02946	.	0.781753	0.11766	N	0.531633	T	0.10252	0.0251	L	0.42245	1.32	0.80722	D	1	B;B;B;B	0.22683	0.073;0.002;0.011;0.002	B;B;B;B	0.19946	0.027;0.002;0.009;0.004	T	0.29212	-1.0019	10	0.33141	T	0.24	0.0045	5.8348	0.18601	0.2034:0.3182:0.0:0.4784	.	992;1178;144;1193	E9PDR5;E7EPI0;B3KX60;Q9P2D0	.;.;.;IBTK_HUMAN	T	1193;992;1178	ENSP00000305721:A1193T;ENSP00000422762:A992T;ENSP00000426405:A1178T	ENSP00000305721:A1193T	A	-	1	0	IBTK	82948463	0.663000	0.27448	0.033000	0.17914	0.775000	0.43874	-0.395000	0.07287	-0.677000	0.05231	0.543000	0.68304	GCA	IBTK	-	NULL	ENSG00000005700		0.348	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2	40	0.00	0	C	NM_015525	Missense_Mutation	82891744	82891744	-1	no_errors	ENST00000306270	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.081	T
IL17C	27189	genome.wustl.edu	37	16	88706309	88706309	+	Silent	SNP	C	C	A	rs201451262		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:88706309C>A	ENST00000244241.4	+	3	472	c.423C>A	c.(421-423)cgC>cgA	p.R141R		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	141					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		GGACGGGCCGCGAGACAGCTG	0.706																																						dbGAP											0													23.0	29.0	27.0					16																	88706309		2084	4195	6279	-	-	-	SO:0001819	synonymous_variant	0			AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.423C>A	16.37:g.88706309C>A			Q3MIG8|Q9HC75	Silent	SNP	pfam_Interleukin-17,prints_Interleukin-17_chordata	p.R141	ENST00000244241.4	37	c.423	CCDS42217.1	16																																																																																			IL17C	-	pfam_Interleukin-17	ENSG00000124391		0.706	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17C	HGNC	protein_coding	OTTHUMT00000422575.1	64	0.00	0	C	NM_013278		88706309	88706309	+1	no_errors	ENST00000244241	ensembl	human	known	69_37n	silent	12	20.00	3	SNP	0.199	A
ILDR1	286676	genome.wustl.edu	37	3	121713130	121713130	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:121713130G>T	ENST00000344209.5	-	6	803	c.677C>A	c.(676-678)gCc>gAc	p.A226D	ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000462014.1_Intron|ILDR1_ENST00000393631.1_Missense_Mutation_p.A137D|ILDR1_ENST00000273691.3_Intron	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	226					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		TAGGGCCTGGGCCTGCTTCAT	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.677C>A	3.37:g.121713130G>T	ENSP00000345667:p.Ala226Asp		Q6ZP61|Q7Z578	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.A226D	ENST00000344209.5	37	c.677	CCDS56271.1	3	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420600	0.42918	.	.	ENSG00000145103	ENST00000344209;ENST00000383663;ENST00000393631	T;D	0.82526	-0.95;-1.62	5.28	4.39	0.52855	.	0.140531	0.46758	U	0.000264	D	0.85915	0.5808	M	0.72894	2.215	0.80722	D	1	B;D	0.61080	0.001;0.989	B;P	0.55871	0.003;0.786	D	0.86039	0.1518	10	0.66056	D	0.02	-3.8399	7.2573	0.26183	0.1954:0.0:0.8046:0.0	.	137;226	Q86SU0-5;Q86SU0	.;ILDR1_HUMAN	D	226;109;137	ENSP00000345667:A226D;ENSP00000377251:A137D	ENSP00000345667:A226D	A	-	2	0	ILDR1	123195820	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	2.218000	0.42889	1.438000	0.47492	0.655000	0.94253	GCC	ILDR1	-	NULL	ENSG00000145103		0.607	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ILDR1	HGNC	protein_coding	OTTHUMT00000355666.1	74	0.00	0	G	NM_175924		121713130	121713130	-1	no_errors	ENST00000344209	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.977	T
INF2	64423	genome.wustl.edu	37	14	105179546	105179546	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:105179546G>T	ENST00000392634.4	+	19	2890	c.2778G>T	c.(2776-2778)gaG>gaT	p.E926D	INF2_ENST00000330634.7_Missense_Mutation_p.E926D	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	926	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CAGTGCAGGAGAACAAGGACC	0.716																																						dbGAP											0													26.0	38.0	34.0					14																	105179546		2116	4203	6319	-	-	-	SO:0001583	missense	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.2778G>T	14.37:g.105179546G>T	ENSP00000376410:p.Glu926Asp		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_WH2_dom,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg,pfscan_WH2_dom	p.E926D	ENST00000392634.4	37	c.2778	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595642	0.46318	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.53640	0.61;0.61	4.6	3.69	0.42338	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.176186	0.48767	D	0.000180	T	0.27134	0.0665	L	0.28014	0.82	0.80722	D	1	P;B	0.35507	0.506;0.372	B;B	0.31495	0.131;0.062	T	0.07597	-1.0764	10	0.35671	T	0.21	.	4.365	0.11220	0.1772:0.2085:0.6143:0.0	.	926;926	Q27J81-2;Q27J81	.;INF2_HUMAN	D	926	ENSP00000376406:E926D;ENSP00000376410:E926D	ENSP00000252527:E394D	E	+	3	2	INF2	104250591	0.997000	0.39634	1.000000	0.80357	0.928000	0.56348	0.303000	0.19210	2.082000	0.62665	0.462000	0.41574	GAG	INF2	-	superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000203485		0.716	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4	68	0.00	0	G	NM_022489		105179546	105179546	+1	no_errors	ENST00000392634	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	1.000	T
INPP5K	51763	genome.wustl.edu	37	17	1413094	1413094	+	Splice_Site	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:1413094C>A	ENST00000421807.2	-	4	650		c.e4-1		INPP5K_ENST00000397335.3_Splice_Site|INPP5K_ENST00000406424.4_Splice_Site|INPP5K_ENST00000542125.1_Splice_Site|INPP5K_ENST00000320345.6_Splice_Site	NM_016532.3	NP_057616.2	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K						actin cytoskeleton organization (GO:0030036)|cellular response to cAMP (GO:0071320)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hormone stimulus (GO:0032870)|cellular response to insulin stimulus (GO:0032869)|cellular response to tumor necrosis factor (GO:0071356)|dephosphorylation (GO:0016311)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inositol phosphate dephosphorylation (GO:0046855)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of dephosphorylation (GO:0035305)|negative regulation of glucose transport (GO:0010829)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of renal water transport (GO:2001153)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|protein targeting to plasma membrane (GO:0072661)|regulation of glycogen biosynthetic process (GO:0005979)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	inositol bisphosphate phosphatase activity (GO:0016312)|inositol trisphosphate phosphatase activity (GO:0046030)|inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|lipid phosphatase activity (GO:0042577)|phosphatidylinositol phosphate 5-phosphatase activity (GO:0034595)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)|vasopressin receptor activity (GO:0005000)			endometrium(1)|large_intestine(7)|lung(3)|skin(1)	12						CATGGGAGACCTGCAGGAGAG	0.522																																						dbGAP											0													79.0	71.0	74.0					17																	1413094		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS11004.1, CCDS11005.1	17p13.3	2008-09-09			ENSG00000132376	ENSG00000132376			33882	protein-coding gene	gene with protein product	"""skeletal muscle and kidney enriched inositol phosphatase"""	607875				10753883, 12536145	Standard	NM_016532		Approved	SKIP	uc002fsr.3	Q9BT40	OTTHUMG00000150648	ENST00000421807.2:c.262-1G>T	17.37:g.1413094C>A			B2R6I2|B2R750|D3DTH8|Q15733|Q9NPJ5|Q9P2R5	Splice_Site	SNP	-	e4-1	ENST00000421807.2	37	c.262-1	CCDS11004.1	17	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150351	0.78001	.	.	ENSG00000132376	ENST00000421807;ENST00000406424;ENST00000350761;ENST00000320345;ENST00000542125;ENST00000445774	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2597	0.90031	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	INPP5K	1359844	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.606000	0.67641	2.620000	0.88729	0.462000	0.41574	.	INPP5K	-	-	ENSG00000132376		0.522	INPP5K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5K	HGNC	protein_coding	OTTHUMT00000319381.4	66	0.00	0	C		Intron	1413094	1413094	-1	no_errors	ENST00000421807	ensembl	human	known	69_37n	splice_site	18	18.18	4	SNP	1.000	A
INTS4L2	644619	genome.wustl.edu	37	7	65150713	65150714	+	RNA	INS	-	-	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr7:65150713_65150714insA	ENST00000430126.2	+	0	694_695							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		CATACCATGAGAAAATCTCTAA	0.436																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65150717_65150717dupA				RNA	INS	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.436	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	37	0.00	0	-	NR_027392		65150713	65150714	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	39	15.22	7	INS	1.000:0.995	A
JAK3	3718	genome.wustl.edu	37	19	17943400	17943400	+	Missense_Mutation	SNP	G	G	A	rs200198236		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:17943400G>A	ENST00000527670.1	-	18	2637	c.2608C>T	c.(2608-2610)Cgg>Tgg	p.R870W	JAK3_ENST00000534444.1_Missense_Mutation_p.R870W|JAK3_ENST00000458235.1_Missense_Mutation_p.R870W			P52333	JAK3_HUMAN	Janus kinase 3	870	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TGAATCTCCCGCTGAAAGTCC	0.582		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																	dbGAP		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													102.0	87.0	92.0					19																	17943400		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2608C>T	19.37:g.17943400G>A	ENSP00000432511:p.Arg870Trp		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom	p.R870W	ENST00000527670.1	37	c.2608	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780028	0.70222	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.83591	-1.74;-1.74;-1.74	4.52	2.32	0.28847	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.124032	0.51477	D	0.000094	D	0.90229	0.6945	M	0.83483	2.645	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90267	0.4305	10	0.87932	D	0	-36.2842	11.5254	0.50576	0.0:0.0:0.676:0.324	.	870;870	P52333-2;P52333	.;JAK3_HUMAN	W	870	ENSP00000391676:R870W;ENSP00000432511:R870W;ENSP00000436421:R870W	ENSP00000391676:R870W	R	-	1	2	JAK3	17804400	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.113000	0.31184	0.618000	0.30179	0.549000	0.68633	CGG	JAK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000105639		0.582	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	59	0.00	0	G	NM_000215		17943400	17943400	-1	no_errors	ENST00000458235	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	A
IRGC	56269	genome.wustl.edu	37	19	44223465	44223465	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:44223465C>A	ENST00000244314.5	+	2	954	c.755C>A	c.(754-756)tCg>tAg	p.S252*		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	252						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				CCCGACATCTCGCTGGAGGCC	0.672																																					Colon(189;350 2037 11447 13433 38914)	dbGAP											0													29.0	26.0	27.0					19																	44223465		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.755C>A	19.37:g.44223465C>A	ENSP00000244314:p.Ser252*		Q05BR8	Nonsense_Mutation	SNP	pfam_Interferon-induced_GTPase	p.S252*	ENST00000244314.5	37	c.755	CCDS12629.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.568194	0.97671	.	.	ENSG00000124449	ENST00000244314	.	.	.	5.35	5.35	0.76521	.	0.174843	0.36932	N	0.002330	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5523	0.84475	0.0:1.0:0.0:0.0	.	.	.	.	X	252	.	ENSP00000244314:S252X	S	+	2	0	IRGC	48915305	0.177000	0.23109	0.974000	0.42286	0.938000	0.57974	2.006000	0.40874	2.500000	0.84329	0.655000	0.94253	TCG	IRGC	-	pfam_Interferon-induced_GTPase	ENSG00000124449		0.672	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	HGNC	protein_coding	OTTHUMT00000336191.1	58	0.00	0	C	NM_019612		44223465	44223465	+1	no_errors	ENST00000244314	ensembl	human	known	69_37n	nonsense	29	12.12	4	SNP	0.997	A
KBTBD6	89890	genome.wustl.edu	37	13	41706178	41706178	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr13:41706178C>T	ENST00000379485.1	-	1	704	c.470G>A	c.(469-471)cGg>cAg	p.R157Q	KBTBD6_ENST00000499385.2_Missense_Mutation_p.R91Q	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	157										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		ACAGGCTTCCCGCACATATTC	0.587																																						dbGAP											0													91.0	83.0	86.0					13																	41706178		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.470G>A	13.37:g.41706178C>T	ENSP00000368799:p.Arg157Gln		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.R157Q	ENST00000379485.1	37	c.470	CCDS9376.1	13	.	.	.	.	.	.	.	.	.	.	c	13.59	2.283690	0.40394	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.70749	-0.51;-0.51	3.56	3.56	0.40772	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.73830	0.3637	L	0.33245	0.995	0.38730	D	0.95364	D;D	0.89917	1.0;0.98	D;P	0.87578	0.998;0.752	T	0.71836	-0.4472	10	0.23891	T	0.37	.	13.002	0.58681	0.0:1.0:0.0:0.0	.	91;157	F5GZN7;Q86V97	.;KBTB6_HUMAN	Q	157;91	ENSP00000368799:R157Q;ENSP00000444326:R91Q	ENSP00000368799:R157Q	R	-	2	0	KBTBD6	40604178	1.000000	0.71417	0.998000	0.56505	0.533000	0.34776	2.824000	0.48088	1.999000	0.58509	0.313000	0.20887	CGG	KBTBD6	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000165572		0.587	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD6	HGNC	protein_coding	OTTHUMT00000044657.1	64	0.00	0	C	NM_152903		41706178	41706178	-1	no_errors	ENST00000379485	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
KCNA7	3743	genome.wustl.edu	37	19	49573727	49573727	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:49573727C>A	ENST00000221444.1	-	2	1319	c.964G>T	c.(964-966)Ggt>Tgt	p.G322C		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	322					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	AGGACCACACCGATGAAGAGG	0.577																																					Colon(74;686 1235 3793 23366 48562)	dbGAP											0													52.0	53.0	53.0					19																	49573727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.964G>T	19.37:g.49573727C>A	ENSP00000221444:p.Gly322Cys		A1KYX7|Q9BYS4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.G322C	ENST00000221444.1	37	c.964	CCDS12755.1	19	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118878	0.77323	.	.	ENSG00000104848	ENST00000221444	D	0.98455	-4.94	4.65	4.65	0.58169	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98068	0.9363	M	0.63208	1.945	0.80722	D	1	D	0.57899	0.981	P	0.54460	0.753	D	0.98576	1.0648	10	0.56958	D	0.05	.	16.6617	0.85242	0.0:1.0:0.0:0.0	.	322	Q96RP8	KCNA7_HUMAN	C	322	ENSP00000221444:G322C	ENSP00000221444:G322C	G	-	1	0	KCNA7	54265539	1.000000	0.71417	0.917000	0.36280	0.934000	0.57294	7.811000	0.86092	2.321000	0.78463	0.491000	0.48974	GGT	KCNA7	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl,prints_K_chnl_volt-dep_Kv	ENSG00000104848		0.577	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	HGNC	protein_coding	OTTHUMT00000466263.1	39	0.00	0	C	NM_031886		49573727	49573727	-1	no_errors	ENST00000221444	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	A
KCNC1	3746	genome.wustl.edu	37	11	17757887	17757887	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:17757887G>T	ENST00000379472.3	+	1	368	c.338G>T	c.(337-339)cGc>cTc	p.R113L	KCNC1_ENST00000265969.6_Missense_Mutation_p.R113L	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	113					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CGCCAGCACCGCGACGCCGAG	0.721																																						dbGAP											0													25.0	28.0	27.0					11																	17757887		2198	4292	6490	-	-	-	SO:0001583	missense	0			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.338G>T	11.37:g.17757887G>T	ENSP00000368785:p.Arg113Leu		K4DI87	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.R113L	ENST00000379472.3	37	c.338	CCDS7827.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269865	0.80469	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.97620	-4.46;-4.44	5.09	5.09	0.68999	BTB/POZ fold (1);	0.381500	0.17772	U	0.162532	D	0.96602	0.8891	M	0.87456	2.885	0.80722	D	1	P;P	0.43352	0.804;0.615	B;B	0.33339	0.162;0.076	D	0.97892	1.0298	10	0.87932	D	0	.	18.4739	0.90785	0.0:0.0:1.0:0.0	.	113;113	Q3KNS8;P48547	.;KCNC1_HUMAN	L	113	ENSP00000265969:R113L;ENSP00000368785:R113L	ENSP00000265969:R113L	R	+	2	0	KCNC1	17714463	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.808000	0.99193	2.368000	0.80403	0.491000	0.48974	CGC	KCNC1	-	NULL	ENSG00000129159		0.721	KCNC1-001	KNOWN	basic|CCDS	protein_coding	KCNC1	HGNC	protein_coding	OTTHUMT00000389389.1	109	0.00	0	G	NM_004976		17757887	17757887	+1	no_errors	ENST00000265969	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
KCNIP2	30819	genome.wustl.edu	37	10	103586813	103586813	+	3'UTR	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:103586813G>T	ENST00000356640.2	-	0	1385				KCNIP2_ENST00000358038.3_3'UTR|KCNIP2_ENST00000348850.5_3'UTR|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000355657.2_5'UTR	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2						clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		TAGAGTAGGGGTAGGAGGTGG	0.557																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.*297C>A	10.37:g.103586813G>T			A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	RNA	SNP	-	NULL	ENST00000356640.2	37	NULL	CCDS7522.1	10																																																																																			KCNIP2	-	-	ENSG00000120049		0.557	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	KCNIP2	HGNC	protein_coding	OTTHUMT00000049973.1	42	0.00	0	G			103586813	103586813	-1	no_errors	ENST00000355657	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	0.000	T
KCNJ16	3773	genome.wustl.edu	37	17	68128822	68128822	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:68128822C>A	ENST00000589377.1	+	2	757	c.594C>A	c.(592-594)tgC>tgA	p.C198*	KCNJ16_ENST00000392671.1_Nonsense_Mutation_p.C198*|KCNJ16_ENST00000585558.1_Nonsense_Mutation_p.C233*|KCNJ16_ENST00000392670.1_Nonsense_Mutation_p.C198*|KCNJ16_ENST00000586462.1_Nonsense_Mutation_p.C237*|KCNJ16_ENST00000283936.1_Nonsense_Mutation_p.C198*	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	198					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					GGAAGCTTTGCCTCATGTGGC	0.488																																						dbGAP											0													79.0	70.0	73.0					17																	68128822		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.594C>A	17.37:g.68128822C>A	ENSP00000465967:p.Cys198*			Nonsense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir_Cr2	p.C198*	ENST00000589377.1	37	c.594	CCDS11687.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.779719	0.96929	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	.	.	.	5.84	2.79	0.32731	.	0.042962	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1204	0.42616	0.0:0.7268:0.0:0.2732	.	.	.	.	X	198	.	.	C	+	3	2	KCNJ16	65640417	0.772000	0.28567	1.000000	0.80357	0.276000	0.26787	-0.039000	0.12124	0.823000	0.34589	-0.143000	0.13931	TGC	KCNJ16	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000153822		0.488	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	HGNC	protein_coding	OTTHUMT00000450880.1	18	0.00	0	C	NM_018658		68128822	68128822	+1	no_errors	ENST00000283936	ensembl	human	known	69_37n	nonsense	9	25.00	3	SNP	0.965	A
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																						dbGAP											0													6.0	4.0	5.0					1																	154842243		1926	3811	5737	-	-	-	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C			B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66	ENST00000271915.4	37	c.198	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	18	0.00	0	A	NM_002249		154842243	154842243	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent	24	36.84	14	SNP	0.000	C
KCP	375616	genome.wustl.edu	37	7	128524838	128524838	+	RNA	SNP	G	G	A	rs570615867		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:128524838G>A	ENST00000476647.2	-	0	3162							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CACCTACCTCGCAGATGCACA	0.647																																						dbGAP											0													53.0	53.0	53.0					7																	128524838		692	1591	2283	-	-	-			0			AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128524838G>A			Q8NBE0	RNA	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			KCP	-	-	ENSG00000135253		0.647	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	31	0.00	0	G	NM_199349		128524838	128524838	-1	no_errors	ENST00000297801	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.974	A
KCTD19	146212	genome.wustl.edu	37	16	67333403	67333403	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:67333403C>A	ENST00000304372.5	-	6	904	c.849G>T	c.(847-849)gtG>gtT	p.V283V	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	283					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		AGAGCGGTTTCACGGACTCCA	0.642																																						dbGAP											0													87.0	97.0	94.0					16																	67333403		1982	4155	6137	-	-	-	SO:0001819	synonymous_variant	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.849G>T	16.37:g.67333403C>A			B4DZ49|Q8N804	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.V283	ENST00000304372.5	37	c.849	CCDS42179.1	16																																																																																			KCTD19	-	NULL	ENSG00000168676		0.642	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	84	0.00	0	C	XM_085367		67333403	67333403	-1	no_errors	ENST00000304372	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	0.961	A
KDM2B	84678	genome.wustl.edu	37	12	121878877	121878877	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:121878877C>A	ENST00000377071.4	-	20	3516	c.3444G>T	c.(3442-3444)ctG>ctT	p.L1148L	KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Silent_p.L516L|KDM2B_ENST00000377069.4_Silent_p.L1079L	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1148					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GCTCACCAGGCAGCCGGTTGA	0.627																																						dbGAP											0													30.0	36.0	34.0					12																	121878877		2048	4191	6239	-	-	-	SO:0001819	synonymous_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3444G>T	12.37:g.121878877C>A			A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.L1148	ENST00000377071.4	37	c.3444	CCDS41850.1	12																																																																																			KDM2B	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000089094		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	41	0.00	0	C	NM_032590		121878877	121878877	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	silent	9	43.75	7	SNP	0.991	A
KDM2B	84678	genome.wustl.edu	37	12	121878877	121878877	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr12:121878877C>A	ENST00000377071.4	-	20	3516	c.3444G>T	c.(3442-3444)ctG>ctT	p.L1148L	KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Silent_p.L516L|KDM2B_ENST00000377069.4_Silent_p.L1079L	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1148					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GCTCACCAGGCAGCCGGTTGA	0.627																																						dbGAP											0													30.0	36.0	34.0					12																	121878877		2048	4191	6239	-	-	-	SO:0001819	synonymous_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3444G>T	12.37:g.121878877C>A			A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.L1148	ENST00000377071.4	37	c.3444	CCDS41850.1	12																																																																																			KDM2B	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000089094		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	46	0.00	0	C	NM_032590		121878877	121878877	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	silent	14	51.72	15	SNP	0.991	A
KDM2B	84678	genome.wustl.edu	37	12	121878877	121878877	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:121878877C>A	ENST00000377071.4	-	20	3516	c.3444G>T	c.(3442-3444)ctG>ctT	p.L1148L	KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Silent_p.L516L|KDM2B_ENST00000377069.4_Silent_p.L1079L	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1148					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GCTCACCAGGCAGCCGGTTGA	0.627																																						dbGAP											0													30.0	36.0	34.0					12																	121878877		2048	4191	6239	-	-	-	SO:0001819	synonymous_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3444G>T	12.37:g.121878877C>A			A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.L1148	ENST00000377071.4	37	c.3444	CCDS41850.1	12																																																																																			KDM2B	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000089094		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	41	0.00	0	C	NM_032590		121878877	121878877	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	silent	28	36.36	16	SNP	0.991	A
KDM5C	8242	genome.wustl.edu	37	X	53224485	53224486	+	In_Frame_Ins	INS	-	-	GGT			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chrX:53224485_53224486insGGT	ENST00000375401.3	-	21	3759_3760	c.3227_3228insACC	c.(3226-3228)ctg>ctACCg	p.1076_1077insP	KDM5C_ENST00000404049.3_In_Frame_Ins_p.1075_1076insP|KDM5C_ENST00000452825.3_In_Frame_Ins_p.1009_1010insP|KDM5C_ENST00000375383.3_In_Frame_Ins_p.1035_1036insP|KDM5C_ENST00000375379.3_In_Frame_Ins_p.1076_1077insP	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1076					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AGTGCGCTGTCAGTACCTGTAG	0.594			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										-	-	-	SO:0001652	inframe_insertion	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3227_3228insACC	X.37:g.53224485_53224486insGGT	ENSP00000364550:p.Leu1076_Thr1077insPro		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	In_Frame_Ins	INS	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.1077in_frame_insP	ENST00000375401.3	37	c.3228_3227	CCDS14351.1	X																																																																																			KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.594	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	67	0.00	0	-	NM_004187		53224485	53224486	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	in_frame_ins	47	14.55	8	INS	1.000:1.000	GGT
KDM5C	8242	genome.wustl.edu	37	X	53224486	53224486	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:53224486A>G	ENST00000375401.3	-	21	3759	c.3227T>C	c.(3226-3228)cTg>cCg	p.L1076P	KDM5C_ENST00000404049.3_Missense_Mutation_p.L1075P|KDM5C_ENST00000452825.3_Missense_Mutation_p.L1009P|KDM5C_ENST00000375383.3_Missense_Mutation_p.L1035P|KDM5C_ENST00000375379.3_Missense_Mutation_p.L1076P	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1076					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GTGCGCTGTCAGTACCTGTAG	0.592			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													103.0	74.0	84.0					X																	53224486		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3227T>C	X.37:g.53224486A>G	ENSP00000364550:p.Leu1076Pro		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.L1076P	ENST00000375401.3	37	c.3227	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	a	15.84	2.952900	0.53293	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.88	3.71	0.42584	Lysine-specific demethylase-like domain (1);	0.138672	0.47455	D	0.000234	T	0.49338	0.1551	M	0.65975	2.015	0.46564	D	0.999105	P;P;P	0.47604	0.898;0.86;0.86	P;P;P	0.54026	0.622;0.74;0.74	T	0.41360	-0.9513	10	0.40728	T	0.16	-1.3206	5.9814	0.19409	0.7887:0.0:0.2113:0.0	.	1009;1075;1076	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	P	1009;1076;1075;1076;1035	ENSP00000445176:L1009P;ENSP00000364550:L1076P;ENSP00000385394:L1075P;ENSP00000364528:L1076P;ENSP00000364532:L1035P	ENSP00000364528:L1076P	L	-	2	0	KDM5C	53241211	0.775000	0.28604	0.904000	0.35570	0.989000	0.77384	1.634000	0.37123	0.559000	0.29153	0.427000	0.28365	CTG	KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.592	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	77	0.00	0	A	NM_004187		53224486	53224486	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	G
KDM5C	8242	genome.wustl.edu	37	X	53224486	53224486	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:53224486A>G	ENST00000375401.3	-	21	3759	c.3227T>C	c.(3226-3228)cTg>cCg	p.L1076P	KDM5C_ENST00000404049.3_Missense_Mutation_p.L1075P|KDM5C_ENST00000452825.3_Missense_Mutation_p.L1009P|KDM5C_ENST00000375383.3_Missense_Mutation_p.L1035P|KDM5C_ENST00000375379.3_Missense_Mutation_p.L1076P	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1076					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GTGCGCTGTCAGTACCTGTAG	0.592			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													103.0	74.0	84.0					X																	53224486		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3227T>C	X.37:g.53224486A>G	ENSP00000364550:p.Leu1076Pro		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.L1076P	ENST00000375401.3	37	c.3227	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	a	15.84	2.952900	0.53293	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.88	3.71	0.42584	Lysine-specific demethylase-like domain (1);	0.138672	0.47455	D	0.000234	T	0.49338	0.1551	M	0.65975	2.015	0.46564	D	0.999105	P;P;P	0.47604	0.898;0.86;0.86	P;P;P	0.54026	0.622;0.74;0.74	T	0.41360	-0.9513	10	0.40728	T	0.16	-1.3206	5.9814	0.19409	0.7887:0.0:0.2113:0.0	.	1009;1075;1076	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	P	1009;1076;1075;1076;1035	ENSP00000445176:L1009P;ENSP00000364550:L1076P;ENSP00000385394:L1075P;ENSP00000364528:L1076P;ENSP00000364532:L1035P	ENSP00000364528:L1076P	L	-	2	0	KDM5C	53241211	0.775000	0.28604	0.904000	0.35570	0.989000	0.77384	1.634000	0.37123	0.559000	0.29153	0.427000	0.28365	CTG	KDM5C	-	pfam_Lys_sp_deMease_like_dom	ENSG00000126012		0.592	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	77	0.00	0	A	NM_004187		53224486	53224486	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	G
PPP2R3C	55012	genome.wustl.edu	37	14	35591079	35591079	+	Intron	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:35591079C>A	ENST00000261475.5	-	1	412				KIAA0391_ENST00000603588.1_3'UTR|KIAA0391_ENST00000321130.10_5'Flank|KIAA0391_ENST00000604948.1_5'Flank|KIAA0391_ENST00000534898.4_5'Flank|KIAA0391_ENST00000250377.7_5'Flank|PPP2R3C_ENST00000555644.1_Intron|KIAA0391_ENST00000557565.1_5'Flank|KIAA0391_ENST00000605870.1_5'Flank|KIAA0391_ENST00000603544.1_5'Flank	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma						activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		GCCGGGCCATCCCAACGGGCT	0.622																																						dbGAP											0													44.0	45.0	44.0					14																	35591079		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.58+28G>T	14.37:g.35591079C>A			B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	RNA	SNP	-	NULL	ENST00000261475.5	37	NULL	CCDS9654.1	14																																																																																			RP11-173D9.3	-	-	ENSG00000100890		0.622	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0391	Clone_based_vega_gene	protein_coding	OTTHUMT00000276687.1	61	0.00	0	C	NM_017917		35591079	35591079	+1	no_errors	ENST00000556711	ensembl	human	putative	69_37n	rna	26	13.33	4	SNP	0.004	A
KIAA1683	80726	genome.wustl.edu	37	19	18368439	18368439	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:18368439G>T	ENST00000600328.3	-	4	3287	c.3094C>A	c.(3094-3096)Cgc>Agc	p.R1032S	KIAA1683_ENST00000392413.4_Missense_Mutation_p.R1219S|KIAA1683_ENST00000600359.3_Missense_Mutation_p.R986S|PDE4C_ENST00000596647.1_5'Flank|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1032						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TGGAAGCAGCGATGGTCAGAT	0.662																																						dbGAP											0													28.0	30.0	29.0					19																	18368439		2192	4284	6476	-	-	-	SO:0001583	missense	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3094C>A	19.37:g.18368439G>T	ENSP00000470780:p.Arg1032Ser		B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R1219S	ENST00000600328.3	37	c.3655	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450017	0.26074	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.03951	3.8;3.94;3.75	4.26	3.22	0.36961	.	0.000000	0.33005	N	0.005389	T	0.06962	0.0177	L	0.34521	1.04	0.19300	N	0.999972	P;D	0.63880	0.91;0.993	B;P	0.57548	0.415;0.823	T	0.31833	-0.9929	10	0.13853	T	0.58	-25.3622	7.0663	0.25154	0.124:0.0:0.876:0.0	.	1219;1032	E9PDE0;Q9H0B3	.;K1683_HUMAN	S	1219;1032;986;296;646	ENSP00000376213:R1219S;ENSP00000352774:R1032S;ENSP00000404501:R986S	ENSP00000352774:R1032S	R	-	1	0	KIAA1683	18229439	1.000000	0.71417	0.999000	0.59377	0.070000	0.16714	1.601000	0.36773	1.935000	0.56089	0.313000	0.20887	CGC	KIAA1683	-	NULL	ENSG00000130518		0.662	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3	71	0.00	0	G			18368439	18368439	-1	no_errors	ENST00000392413	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
KIF1C	10749	genome.wustl.edu	37	17	4926940	4926940	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:4926940delC	ENST00000320785.5	+	23	3163	c.2806delC	c.(2806-2808)cgtfs	p.R936fs		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	936					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						TGCCTTCCGTCGTGGTCGTCT	0.721																																					Melanoma(96;1023 1447 10250 19259 33730)	dbGAP											0													30.0	28.0	28.0					17																	4926940		2203	4297	6500	-	-	-	SO:0001589	frameshift_variant	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2806delC	17.37:g.4926940delC	ENSP00000320821:p.Arg936fs		D3DTL6|O75186|Q5U618	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R936fs	ENST00000320785.5	37	c.2806	CCDS11065.1	17																																																																																			KIF1C	-	NULL	ENSG00000129250		0.721	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	50	0.00	0	C			4926940	4926940	+1	no_errors	ENST00000320785	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.999	-
KLHL36	79786	genome.wustl.edu	37	16	84695218	84695218	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:84695218G>T	ENST00000564996.1	+	5	1471	c.1330G>T	c.(1330-1332)Gac>Tac	p.D444Y	KLHL36_ENST00000258157.5_Missense_Mutation_p.D381Y	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	444					protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CATCTACAAAGACTTCGTGTA	0.632																																						dbGAP											0													85.0	79.0	81.0					16																	84695218		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.1330G>T	16.37:g.84695218G>T	ENSP00000456743:p.Asp444Tyr		Q8N5G6|Q9H9U6	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D444Y	ENST00000564996.1	37	c.1330	CCDS10948.1	16	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397887	0.83120	.	.	ENSG00000135686	ENST00000325279;ENST00000258157	T	0.69435	-0.4	5.66	4.71	0.59529	Kelch-type beta propeller (1);	0.238411	0.43579	D	0.000543	T	0.77246	0.4102	M	0.71581	2.175	0.46203	D	0.998929	D;P	0.58620	0.983;0.823	P;B	0.58331	0.837;0.423	T	0.80360	-0.1415	10	0.87932	D	0	.	13.616	0.62108	0.074:0.0:0.926:0.0	.	381;444	Q8N4N3-2;Q8N4N3	.;KLH36_HUMAN	Y	444;381	ENSP00000258157:D381Y	ENSP00000258157:D381Y	D	+	1	0	KLHL36	83252719	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	6.647000	0.74354	1.398000	0.46701	0.655000	0.94253	GAC	KLHL36	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000135686		0.632	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL36	HGNC	protein_coding	OTTHUMT00000269084.2	83	0.00	0	G			84695218	84695218	+1	no_errors	ENST00000564996	ensembl	human	known	69_37n	missense	34	10.26	4	SNP	0.994	T
KRT82	3888	genome.wustl.edu	37	12	52790696	52790696	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:52790696G>T	ENST00000257974.2	-	6	1116	c.1039C>A	c.(1039-1041)Cag>Aag	p.Q347K	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	347	Coil 2.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		GTTTCTTGCTGCAGCCGCTGG	0.562																																						dbGAP											0													126.0	113.0	117.0					12																	52790696		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.1039C>A	12.37:g.52790696G>T	ENSP00000257974:p.Gln347Lys			Missense_Mutation	SNP	pfam_F,prints_Keratin_II,prints_Keratin_I	p.Q347K	ENST00000257974.2	37	c.1039	CCDS8826.1	12	.	.	.	.	.	.	.	.	.	.	G	3.762	-0.049370	0.07407	.	.	ENSG00000161850	ENST00000257974	D	0.88431	-2.38	4.82	4.82	0.62117	Filament (1);	0.000000	0.46145	D	0.000311	D	0.83510	0.5270	L	0.41079	1.255	0.32677	N	0.515963	B	0.11235	0.004	B	0.10450	0.005	T	0.82418	-0.0467	10	0.34782	T	0.22	.	12.0375	0.53433	0.0:0.0:0.8274:0.1726	.	347	Q9NSB4	KRT82_HUMAN	K	347	ENSP00000257974:Q347K	ENSP00000257974:Q347K	Q	-	1	0	KRT82	51076963	0.895000	0.30542	1.000000	0.80357	0.739000	0.42172	1.333000	0.33816	2.410000	0.81850	0.561000	0.74099	CAG	KRT82	-	pfam_F	ENSG00000161850		0.562	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT82	HGNC	protein_coding	OTTHUMT00000405189.1	79	0.00	0	G	NM_033033		52790696	52790696	-1	no_errors	ENST00000257974	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	T
RP4-529N6.1	0	genome.wustl.edu	37	6	4611304	4611304	+	lincRNA	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:4611304C>A	ENST00000380106.2	+	0	250																											GCCTCGGGGTCCCTGTCTCTA	0.562																																						dbGAP											0																																										-	-	-			0																															6.37:g.4611304C>A				RNA	SNP	-	NULL	ENST00000380106.2	37	NULL		6																																																																																			RP4-529N6.1	-	-	ENSG00000205444		0.562	RP4-529N6.1-001	KNOWN	basic	lincRNA	KU-MEL-3	Clone_based_vega_gene	lincRNA	OTTHUMT00000039731.1	63	0.00	0	C			4611304	4611304	+1	no_errors	ENST00000380106	ensembl	human	known	69_37n	rna	23	39.47	15	SNP	0.000	A
RP4-529N6.1	0	genome.wustl.edu	37	6	4611304	4611304	+	lincRNA	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:4611304C>A	ENST00000380106.2	+	0	250																											GCCTCGGGGTCCCTGTCTCTA	0.562																																						dbGAP											0																																										-	-	-			0																															6.37:g.4611304C>A				RNA	SNP	-	NULL	ENST00000380106.2	37	NULL		6																																																																																			RP4-529N6.1	-	-	ENSG00000205444		0.562	RP4-529N6.1-001	KNOWN	basic	lincRNA	KU-MEL-3	Clone_based_vega_gene	lincRNA	OTTHUMT00000039731.1	63	0.00	0	C			4611304	4611304	+1	no_errors	ENST00000380106	ensembl	human	known	69_37n	rna	28	34.88	15	SNP	0.000	A
LARP1	23367	genome.wustl.edu	37	5	154182890	154182890	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:154182890G>A	ENST00000336314.4	+	12	1943	c.1919G>A	c.(1918-1920)cGg>cAg	p.R640Q		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	717					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATGATCAGCCGGGAGCAGTTT	0.532																																						dbGAP											0													72.0	73.0	72.0					5																	154182890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1919G>A	5.37:g.154182890G>A	ENSP00000336721:p.Arg640Gln		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.R640Q	ENST00000336314.4	37	c.1919	CCDS4328.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.72|13.72	2.320521|2.320521	0.41096|0.41096	.|.	.|.	ENSG00000155506|ENSG00000155506	ENST00000518677|ENST00000336314;ENST00000518297;ENST00000524248	.|T;T;T	.|0.25749	.|2.11;1.78;1.79	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.097576	.|0.64402	.|D	.|0.000003	T|T	0.14700|0.14700	0.0355|0.0355	N|N	0.12611|0.12611	0.24|0.24	0.51767|0.51767	D|D	0.999934|0.999934	.|B;B	.|0.33044	.|0.19;0.395	.|B;B	.|0.21360	.|0.015;0.034	T|T	0.12293|0.12293	-1.0553|-1.0553	5|10	.|0.12430	.|T	.|0.62	-16.0687|-16.0687	20.3594|20.3594	0.98849|0.98849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|717;640	.|Q6PKG0;Q6PKG0-3	.|LARP1_HUMAN;.	R|Q	31|640;717;512	.|ENSP00000336721:R640Q;ENSP00000428589:R717Q;ENSP00000429904:R512Q	.|ENSP00000336721:R640Q	G|R	+|+	1|2	0|0	LARP1|LARP1	154163083|154163083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.126000|4.126000	0.57937|0.57937	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	GGG|CGG	LARP1	-	NULL	ENSG00000155506		0.532	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	53	0.00	0	G	NM_033551		154182890	154182890	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	A
LDB3	11155	genome.wustl.edu	37	10	88447007	88447007	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:88447007G>T	ENST00000372066.3	+	5	605	c.526G>T	c.(526-528)Gcc>Tcc	p.A176S	LDB3_ENST00000352360.5_Intron|LDB3_ENST00000542786.1_3'UTR|LDB3_ENST00000361373.4_Intron|LDB3_ENST00000429277.2_Missense_Mutation_p.A291S|LDB3_ENST00000458213.2_Missense_Mutation_p.A176S|LDB3_ENST00000263066.6_Missense_Mutation_p.A176S|LDB3_ENST00000310944.6_Intron|LDB3_ENST00000372056.4_Missense_Mutation_p.A291S	NM_001080116.1	NP_001073585.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						GCAGGCCCAAGCCCAAGGCAG	0.632																																						dbGAP											0													87.0	101.0	96.0					10																	88447007		2167	4252	6419	-	-	-	SO:0001583	missense	0			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000372066.3:c.526G>T	10.37:g.88447007G>T	ENSP00000361136:p.Ala176Ser			Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.A291S	ENST00000372066.3	37	c.871	CCDS41545.1	10	.	.	.	.	.	.	.	.	.	.	G	25.4	4.639371	0.87760	.	.	ENSG00000122367	ENST00000429277;ENST00000458213;ENST00000372066;ENST00000263066;ENST00000372056	D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12	5.14	5.14	0.70334	.	.	.	.	.	D	0.92163	0.7515	L	0.34521	1.04	0.80722	D	1	D;D;P;P	0.59767	0.976;0.986;0.952;0.58	P;P;P;P	0.58520	0.696;0.84;0.652;0.476	D	0.89897	0.4041	9	0.19590	T	0.45	.	18.6007	0.91247	0.0:0.0:1.0:0.0	.	291;291;176;176	B4E3K3;O75112-4;O75112-2;O75112-6	.;.;.;.	S	291;176;176;176;291	ENSP00000401437:A291S;ENSP00000409148:A176S;ENSP00000361136:A176S;ENSP00000263066:A176S;ENSP00000361126:A291S	ENSP00000263066:A176S	A	+	1	0	LDB3	88436987	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.665000	0.74442	2.407000	0.81776	0.462000	0.41574	GCC	LDB3	-	NULL	ENSG00000122367		0.632	LDB3-002	KNOWN	basic|CCDS	protein_coding	LDB3	HGNC	protein_coding	OTTHUMT00000049161.1	82	0.00	0	G			88447007	88447007	+1	no_errors	ENST00000429277	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
LDLRAD2	401944	genome.wustl.edu	37	1	22138947	22138947	+	Start_Codon_SNP	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:22138947G>T	ENST00000344642.2	+	1	190	c.3G>T	c.(1-3)atG>atT	p.M1I	LDLRAD2_ENST00000543870.1_Start_Codon_SNP_p.M1I	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2	1						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		GAGCCTGGATGGAGGCTTGTT	0.597																																						dbGAP											0													44.0	43.0	43.0					1																	22138947		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	ENST00000344642.2:c.3G>T	1.37:g.22138947G>T	ENSP00000340988:p.Met1Ile		B9EJB3|Q6ZSN5	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,superfamily_CUB,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.M1I	ENST00000344642.2	37	c.3	CCDS30624.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012043	0.75046	.	.	ENSG00000187942	ENST00000344642;ENST00000543870	T;T	0.41758	0.99;0.99	3.9	3.9	0.45041	.	.	.	.	.	T	0.60287	0.2257	.	.	.	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.64980	-0.6279	8	0.87932	D	0	-4.5916	11.5947	0.50966	0.0:0.0:1.0:0.0	.	1	Q5SZI1	LRAD2_HUMAN	I	1	ENSP00000340988:M1I;ENSP00000444097:M1I	ENSP00000340988:M1I	M	+	3	0	LDLRAD2	22011534	0.996000	0.38824	0.805000	0.32314	0.921000	0.55340	4.113000	0.57851	2.170000	0.68504	0.551000	0.68910	ATG	LDLRAD2	-	NULL	ENSG00000187942		0.597	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD2	HGNC	protein_coding	OTTHUMT00000007601.1	40	0.00	0	G	NM_001013693	Missense_Mutation	22138947	22138947	+1	no_errors	ENST00000344642	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.971	T
LEKR1	389170	genome.wustl.edu	37	3	156710875	156710875	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:156710875G>T	ENST00000470811.1	+	10	1341	c.6G>T	c.(4-6)ctG>ctT	p.L2L	LEKR1_ENST00000356539.4_Silent_p.L306L			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	2										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATACTATGCTGCTTAAGGAAA	0.313																																						dbGAP											0													48.0	50.0	49.0					3																	156710875		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.6G>T	3.37:g.156710875G>T				Silent	SNP	superfamily_Ribosomal_L29	p.L306	ENST00000470811.1	37	c.918		3																																																																																			LEKR1	-	NULL	ENSG00000178110		0.313	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	27	0.00	0	G	NM_001004316		156710875	156710875	+1	no_errors	ENST00000356539	ensembl	human	known	69_37n	silent	23	11.54	3	SNP	0.988	T
MBOAT4	619373	genome.wustl.edu	37	8	29994831	29994831	+	Intron	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:29994831C>A	ENST00000320542.3	-	2	429				LEPROTL1_ENST00000523116.1_Missense_Mutation_p.S108Y|LEPROTL1_ENST00000442880.2_3'UTR	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4						cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						ACAGCTGAGTCTGAAGGAAGA	0.498																																						dbGAP											0													52.0	47.0	48.0					8																	29994831		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.344+1216G>T	8.37:g.29994831C>A			B1Q003	Missense_Mutation	SNP	pfam_VPS55	p.S108Y	ENST00000320542.3	37	c.323	CCDS47835.1	8	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129225	0.56721	.	.	ENSG00000104660	ENST00000523116	.	.	.	3.93	2.09	0.27110	.	.	.	.	.	T	0.18002	0.0432	N	0.08118	0	0.09310	N	0.999997	P	0.50943	0.94	P	0.48030	0.564	T	0.07233	-1.0783	7	.	.	.	.	5.9053	0.18998	0.0:0.7005:0.1931:0.1064	.	108	E9PHP8	.	Y	108	.	.	S	+	2	0	LEPROTL1	30114373	0.000000	0.05858	0.004000	0.12327	0.571000	0.35966	-0.268000	0.08607	0.592000	0.29728	0.655000	0.94253	TCT	LEPROTL1	-	NULL	ENSG00000104660		0.498	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPROTL1	HGNC	protein_coding	OTTHUMT00000375795.1	52	0.00	0	C			29994831	29994831	+1	no_errors	ENST00000523116	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.005	A
LGR4	55366	genome.wustl.edu	37	11	27390168	27390168	+	Missense_Mutation	SNP	G	G	T	rs369897268		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:27390168G>T	ENST00000379214.4	-	18	2545	c.2102C>A	c.(2101-2103)aCg>aAg	p.T701K	LGR4_ENST00000389858.4_Missense_Mutation_p.T677K	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	701					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						TAATGATGGCGTTTCACCTGT	0.403																																						dbGAP											0													96.0	89.0	91.0					11																	27390168		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2102C>A	11.37:g.27390168G>T	ENSP00000368516:p.Thr701Lys		A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.T701K	ENST00000379214.4	37	c.2102	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	G	10.53	1.374783	0.24857	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	T;T	0.38887	1.11;1.19	5.43	5.43	0.79202	GPCR, rhodopsin-like superfamily (1);	0.199771	0.52532	D	0.000068	T	0.41026	0.1141	L	0.43923	1.385	0.80722	D	1	B;P	0.37781	0.267;0.608	B;B	0.36666	0.165;0.23	T	0.41538	-0.9503	10	0.72032	D	0.01	.	19.2348	0.93855	0.0:0.0:1.0:0.0	.	677;701	G5E9B3;Q9BXB1	.;LGR4_HUMAN	K	701;677	ENSP00000368516:T701K;ENSP00000374508:T677K	ENSP00000368516:T701K	T	-	2	0	LGR4	27346744	0.968000	0.33430	0.171000	0.22900	0.208000	0.24298	5.955000	0.70306	2.548000	0.85928	0.555000	0.69702	ACG	LGR4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205213		0.403	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	HGNC	protein_coding	OTTHUMT00000257467.1	31	0.00	0	G	NM_018490		27390168	27390168	-1	no_errors	ENST00000379214	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	0.918	T
LINC00265	349114	genome.wustl.edu	37	7	39833586	39833586	+	lincRNA	SNP	G	G	A	rs556695286		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:39833586G>A	ENST00000340510.4	+	0	6098					NR_026999.1				long intergenic non-protein coding RNA 265																		GGCCCAAATCGTCCTGAAGTC	0.687																																						dbGAP											0																																										-	-	-			0					7p14.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000188185	ENSG00000188185		"""Long non-coding RNAs"""	28019	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 265-1"""		"""non-protein coding RNA 265"""	NCRNA00265		12477932	Standard	NR_026999		Approved	NCRNA00265-1	uc003thf.3		OTTHUMG00000155273		7.37:g.39833586G>A				RNA	SNP	-	NULL	ENST00000340510.4	37	NULL		7																																																																																			LINC00265	-	-	ENSG00000188185		0.687	LINC00265-001	KNOWN	basic	lincRNA	LINC00265	HGNC	lincRNA	OTTHUMT00000339278.1	160	0.00	0	G	NR_026999		39833586	39833586	+1	no_errors	ENST00000512765	ensembl	human	known	69_37n	rna	71	34.26	37	SNP	0.072	A
LINC00265	349114	genome.wustl.edu	37	7	39833586	39833586	+	lincRNA	SNP	G	G	A	rs556695286		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:39833586G>A	ENST00000340510.4	+	0	6098					NR_026999.1				long intergenic non-protein coding RNA 265																		GGCCCAAATCGTCCTGAAGTC	0.687																																						dbGAP											0																																										-	-	-			0					7p14.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000188185	ENSG00000188185		"""Long non-coding RNAs"""	28019	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 265-1"""		"""non-protein coding RNA 265"""	NCRNA00265		12477932	Standard	NR_026999		Approved	NCRNA00265-1	uc003thf.3		OTTHUMG00000155273		7.37:g.39833586G>A				RNA	SNP	-	NULL	ENST00000340510.4	37	NULL		7																																																																																			LINC00265	-	-	ENSG00000188185		0.687	LINC00265-001	KNOWN	basic	lincRNA	LINC00265	HGNC	lincRNA	OTTHUMT00000339278.1	160	0.00	0	G	NR_026999		39833586	39833586	+1	no_errors	ENST00000512765	ensembl	human	known	69_37n	rna	106	34.16	55	SNP	0.072	A
LINC00313	114038	genome.wustl.edu	37	21	44891426	44891426	+	lincRNA	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:44891426C>A	ENST00000427188.1	-	0	46							P59037	CU084_HUMAN	long intergenic non-protein coding RNA 313																		GGAAGAGATGCAGGCCCATCG	0.577																																						dbGAP											0																																										-	-	-			0			AF426261		21q22.3	2013-05-31	2011-08-10	2011-08-10	ENSG00000185186	ENSG00000185186		"""Long non-coding RNAs"""	16416	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 84"", ""non-protein coding RNA 313"""	C21orf84, NCRNA00313		12036297	Standard	NR_026863		Approved		uc002zdh.1	P59037	OTTHUMG00000086867		21.37:g.44891426C>A			Q3KNU0	RNA	SNP	-	NULL	ENST00000427188.1	37	NULL		21																																																																																			LINC00313	-	-	ENSG00000185186		0.577	LINC00313-006	KNOWN	basic	lincRNA	LINC00313	HGNC	lincRNA	OTTHUMT00000195631.1	68	0.00	0	C			44891426	44891426	-1	no_errors	ENST00000332440	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.001	A
LINC00667	339290	genome.wustl.edu	37	18	5233049	5233049	+	lincRNA	SNP	C	C	A	rs572918088		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:5233049C>A	ENST00000579933.1	-	0	802																											GCCTCTGGCACTTCATGTTTC	0.522																																						dbGAP											0																																										-	-	-			0																															18.37:g.5233049C>A				RNA	SNP	-	NULL	ENST00000579933.1	37	NULL		18	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.336971	0.01287	.	.	ENSG00000228344	ENST00000458396	.	.	.	2.36	-3.88	0.04205	.	.	.	.	.	T	0.33556	0.0867	.	.	.	.	.	.	.	.	.	.	.	.	T	0.43475	-0.9389	4	0.54805	T	0.06	.	4.1064	0.10038	0.0:0.4406:0.216:0.3434	.	.	.	.	I	59	.	ENSP00000394681:L59I	L	+	1	0	AP001496.1	5223049	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.323000	0.07997	-0.872000	0.04037	-0.339000	0.08088	CTT	LINC00667	-	-	ENSG00000263753		0.522	RP11-835E18.5-001	KNOWN	basic	lincRNA	LINC00667	HGNC	lincRNA	OTTHUMT00000444199.1	50	0.00	0	C			5233049	5233049	+1	no_errors	ENST00000458396	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.001	A
LRP1B	53353	genome.wustl.edu	37	2	141283540	141283540	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:141283540G>A	ENST00000389484.3	-	49	8870	c.7899C>T	c.(7897-7899)ttC>ttT	p.F2633F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2633	LDL-receptor class A 14. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGCTTATAGAAATGTGTGC	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													98.0	92.0	94.0					2																	141283540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7899C>T	2.37:g.141283540G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.F2633	ENST00000389484.3	37	c.7899	CCDS2182.1	2																																																																																			LRP1B	-	superfamily_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	75	0.00	0	G	NM_018557		141283540	141283540	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	silent	57	28.75	23	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141283540	141283540	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:141283540G>A	ENST00000389484.3	-	49	8870	c.7899C>T	c.(7897-7899)ttC>ttT	p.F2633F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2633	LDL-receptor class A 14. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGCTTATAGAAATGTGTGC	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													98.0	92.0	94.0					2																	141283540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7899C>T	2.37:g.141283540G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.F2633	ENST00000389484.3	37	c.7899	CCDS2182.1	2																																																																																			LRP1B	-	superfamily_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	77	0.00	0	G	NM_018557		141283540	141283540	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	silent	38	36.67	22	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141283540	141283540	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:141283540G>A	ENST00000389484.3	-	49	8870	c.7899C>T	c.(7897-7899)ttC>ttT	p.F2633F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2633	LDL-receptor class A 14. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGCTTATAGAAATGTGTGC	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													98.0	92.0	94.0					2																	141283540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7899C>T	2.37:g.141283540G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.F2633	ENST00000389484.3	37	c.7899	CCDS2182.1	2																																																																																			LRP1B	-	superfamily_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	75	0.00	0	G	NM_018557		141283540	141283540	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	silent	56	30.00	24	SNP	1.000	A
LRRC37A2	474170	genome.wustl.edu	37	17	44625866	44625866	+	Missense_Mutation	SNP	A	A	C	rs199913382	byFrequency	TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:44625866A>C	ENST00000576629.1	+	10	3856	c.3361A>C	c.(3361-3363)Agt>Cgt	p.S1121R	ARL17A_ENST00000337845.7_Intron|ARL17A_ENST00000573185.1_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.S1121R|ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000329240.4_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1121						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		CAGTACACTAAGTTACATCTT	0.458													a|||	447	0.0892572	0.0204	0.1614	5008	,	,		26285	0.001		0.2445	False		,,,				2504	0.0624					dbGAP											0													2.0	3.0	3.0					17																	44625866		758	2100	2858	-	-	-	SO:0001583	missense	0			AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.3361A>C	17.37:g.44625866A>C	ENSP00000459551:p.Ser1121Arg		B7ZMC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S1121R	ENST00000576629.1	37	c.3361	CCDS42353.1	17	.	.	.	.	.	.	.	.	.	.	a	12.35	1.911480	0.33721	.	.	ENSG00000238083	ENST00000333412	T	0.43688	0.94	3.36	3.36	0.38483	.	.	.	.	.	T	0.36303	0.0962	L	0.47716	1.5	0.80722	D	1	B;P;B	0.47253	0.053;0.892;0.06	B;P;B	0.45037	0.019;0.467;0.018	T	0.06770	-1.0808	9	0.25751	T	0.34	.	8.3817	0.32474	1.0:0.0:0.0:0.0	.	1121;82;1121	C9JSP5;B3KRJ4;A6NM11	.;.;L37A2_HUMAN	R	1121	ENSP00000333071:S1121R	ENSP00000333071:S1121R	S	+	1	0	LRRC37A2	41981182	0.039000	0.19947	0.918000	0.36340	0.109000	0.19521	3.772000	0.55325	1.550000	0.49438	0.147000	0.16070	AGT	LRRC37A2	-	NULL	ENSG00000238083		0.458	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A2	HGNC	protein_coding	OTTHUMT00000440299.2	14	0.00	0	A	NM_001006607		44625866	44625866	+1	no_errors	ENST00000333412	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	0.911	C
LRRFIP2	9209	genome.wustl.edu	37	3	37169138	37169138	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:37169138G>T	ENST00000336686.4	-	4	291	c.211C>A	c.(211-213)Cag>Aag	p.Q71K	LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.Q71K|LRRFIP2_ENST00000440230.1_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	71	DVL3-binding.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TTCTGAATCTGTCCCCACTTC	0.353																																						dbGAP											1	Whole gene deletion(1)	ovary(1)											52.0	49.0	50.0					3																	37169138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.211C>A	3.37:g.37169138G>T	ENSP00000338727:p.Gln71Lys		A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd,superfamily_Prefoldin	p.Q71K	ENST00000336686.4	37	c.211	CCDS2664.1	3	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875100	0.51695	.	.	ENSG00000093167	ENST00000421307;ENST00000336686	T;T	0.42900	0.96;0.96	5.55	4.66	0.58398	.	0.140081	0.48767	D	0.000168	T	0.28566	0.0707	L	0.27053	0.805	0.40580	D	0.981387	B	0.28128	0.201	B	0.28385	0.089	T	0.06215	-1.0839	10	0.08179	T	0.78	-27.3595	14.0612	0.64802	0.0:0.1567:0.8433:0.0	.	71	Q9Y608	LRRF2_HUMAN	K	71	ENSP00000392217:Q71K;ENSP00000338727:Q71K	ENSP00000338727:Q71K	Q	-	1	0	LRRFIP2	37144142	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.396000	0.73234	1.290000	0.44636	0.557000	0.71058	CAG	LRRFIP2	-	pfam_Leu-rich_rep_flightless-int_pr	ENSG00000093167		0.353	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	44	0.00	0	G	NM_006309		37169138	37169138	-1	no_errors	ENST00000336686	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	1.000	T
LSG1	55341	genome.wustl.edu	37	3	194379815	194379815	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:194379815C>A	ENST00000265245.5	-	7	944	c.630G>T	c.(628-630)ctG>ctT	p.L210L		NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	210	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CCTTGTTGATCAGAATGACGT	0.418																																						dbGAP											0													155.0	162.0	160.0					3																	194379815		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.630G>T	3.37:g.194379815C>A			A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Silent	SNP	pfam_GTP_binding_domain,prints_GTP_binding_domain	p.L210	ENST00000265245.5	37	c.630	CCDS33922.1	3																																																																																			LSG1	-	NULL	ENSG00000041802		0.418	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSG1	HGNC	protein_coding	OTTHUMT00000342740.1	59	0.00	0	C	NM_018385		194379815	194379815	-1	no_errors	ENST00000265245	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	1.000	A
MADD	8567	genome.wustl.edu	37	11	47314093	47314093	+	Splice_Site	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:47314093G>A	ENST00000311027.5	+	21	3526		c.e21-1		MADD_ENST00000395336.3_Splice_Site|MADD_ENST00000342922.4_Intron|MADD_ENST00000402192.2_Intron|MADD_ENST00000395344.3_Intron|MADD_ENST00000349238.3_Intron|MADD_ENST00000407859.3_Intron|MADD_ENST00000405573.2_5'UTR|MADD_ENST00000406482.1_Intron|MADD_ENST00000402799.1_Intron	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		ATCTGGGGTAGAATTGTGGAA	0.473																																						dbGAP											0													93.0	87.0	89.0					11																	47314093		2201	4298	6499	-	-	-	SO:0001630	splice_region_variant	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3362-1G>A	11.37:g.47314093G>A				Splice_Site	SNP	-	e20-1	ENST00000311027.5	37	c.3362-1	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013126	0.75161	.	.	ENSG00000110514	ENST00000311027;ENST00000395336	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0442	0.97604	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MADD	47270669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.355000	0.97087	2.814000	0.96858	0.655000	0.94253	.	MADD	-	-	ENSG00000110514		0.473	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	27	0.00	0	G		Intron	47314093	47314093	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	splice_site	13	18.75	3	SNP	1.000	A
MAK16	84549	genome.wustl.edu	37	8	33346271	33346271	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:33346271G>T	ENST00000360128.6	+	4	652	c.195G>T	c.(193-195)atG>atT	p.M65I	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	65						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						ACTTGTATATGAAGGTTATAG	0.418																																						dbGAP											0													89.0	88.0	88.0					8																	33346271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.195G>T	8.37:g.33346271G>T	ENSP00000353246:p.Met65Ile		B2RB44|Q5U5T1|Q86UC4|Q96SY6	Nonsense_Mutation	SNP	NULL	p.E68*	ENST00000360128.6	37	c.202	CCDS6089.1	8	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926513	0.73327	.	.	ENSG00000198042	ENST00000360128	T	0.39997	1.05	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.41373	0.1156	L	0.33485	1.01	0.80722	D	1	B	0.29508	0.246	B	0.37091	0.241	T	0.13255	-1.0516	10	0.30854	T	0.27	-15.2946	19.6488	0.95793	0.0:0.0:1.0:0.0	.	65	Q9BXY0	MAK16_HUMAN	I	65	ENSP00000353246:M65I	ENSP00000353246:M65I	M	+	3	0	MAK16	33465813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.025000	0.93694	2.758000	0.94735	0.561000	0.74099	ATG	MAK16	-	NULL	ENSG00000198042		0.418	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK16	HGNC	protein_coding	OTTHUMT00000376559.3	50	0.00	0	G	NM_032509		33346271	33346271	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518389	ensembl	human	known	69_37n	nonsense	35	14.63	6	SNP	1.000	T
MAPKBP1	23005	genome.wustl.edu	37	15	42114192	42114192	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:42114192G>T	ENST00000456763.2	+	26	3129	c.2933G>T	c.(2932-2934)gGa>gTa	p.G978V	MAPKBP1_ENST00000260357.7_Missense_Mutation_p.G811V|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.G855V|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.G972V|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.G972V	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	978										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CCAGCCCGGGGAACTCTGGGA	0.607																																						dbGAP											0													21.0	20.0	21.0					15																	42114192		2202	4298	6500	-	-	-	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2933G>T	15.37:g.42114192G>T	ENSP00000393099:p.Gly978Val		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G978V	ENST00000456763.2	37	c.2933	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	g	20.4	3.986490	0.74589	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.50001	1.0;1.09;0.76;1.05;1.17	5.69	5.69	0.88448	.	0.290587	0.37669	N	0.001995	T	0.58509	0.2127	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.955;0.967;0.968;1.0;1.0;1.0	T	0.60586	-0.7234	10	0.62326	D	0.03	-8.4926	18.0034	0.89203	0.0:0.0:1.0:0.0	.	811;855;811;972;978;972	F8WC21;O60336-3;B4DYK7;O60336-2;O60336;O60336-6	.;.;.;.;MABP1_HUMAN;.	V	972;855;811;978;972	ENSP00000397570:G972V;ENSP00000221214:G855V;ENSP00000260357:G811V;ENSP00000393099:G978V;ENSP00000426154:G972V	ENSP00000221214:G855V	G	+	2	0	MAPKBP1	39901484	1.000000	0.71417	0.994000	0.49952	0.888000	0.51559	6.391000	0.73208	2.707000	0.92482	0.556000	0.70494	GGA	MAPKBP1	-	NULL	ENSG00000137802		0.607	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	55	0.00	0	G	NM_014994		42114192	42114192	+1	no_errors	ENST00000456763	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.978	T
MEFV	4210	genome.wustl.edu	37	16	3297243	3297243	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:3297243G>A	ENST00000219596.1	-	5	1399	c.1360C>T	c.(1360-1362)Caa>Taa	p.Q454*	MEFV_ENST00000536379.1_Nonsense_Mutation_p.Q243*|MEFV_ENST00000339854.4_Nonsense_Mutation_p.Q274*|MEFV_ENST00000541159.1_Nonsense_Mutation_p.Q243*	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	454	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GCTTCAGTTTGTTTCTGGGGA	0.582																																						dbGAP											0													57.0	60.0	59.0					16																	3297243		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1360C>T	16.37:g.3297243G>A	ENSP00000219596:p.Gln454*		D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Nonsense_Mutation	SNP	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_DEATH-like,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.Q454*	ENST00000219596.1	37	c.1360	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476846	0.63849	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	.	.	.	5.29	2.04	0.26737	.	0.270288	0.26601	N	0.023465	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-5.1999	7.4716	0.27353	0.0846:0.0:0.6089:0.3064	.	.	.	.	X	454;454;274;243;243;243	.	ENSP00000219596:Q454X	Q	-	1	0	MEFV	3237244	0.019000	0.18553	0.547000	0.28179	0.368000	0.29767	0.230000	0.17852	0.804000	0.34136	0.655000	0.94253	CAA	MEFV	-	NULL	ENSG00000103313		0.582	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	HGNC	protein_coding	OTTHUMT00000251464.1	56	0.00	0	G	NM_000243		3297243	3297243	-1	no_errors	ENST00000219596	ensembl	human	known	69_37n	nonsense	25	13.79	4	SNP	0.329	A
MEN1	4221	genome.wustl.edu	37	11	64575422	64575422	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:64575422G>T	ENST00000337652.1	-	3	1113	c.610C>A	c.(610-612)Cac>Aac	p.H204N	MEN1_ENST00000315422.4_Missense_Mutation_p.H199N|MEN1_ENST00000377321.1_Intron|MEN1_ENST00000394374.2_Missense_Mutation_p.H204N|MEN1_ENST00000377316.2_Missense_Mutation_p.H199N|MEN1_ENST00000312049.6_Missense_Mutation_p.H199N|MEN1_ENST00000443283.1_Missense_Mutation_p.H204N|MEN1_ENST00000377313.1_Missense_Mutation_p.H204N|MEN1_ENST00000377326.3_Missense_Mutation_p.H199N|MEN1_ENST00000394376.1_Missense_Mutation_p.H204N|MEN1_ENST00000478548.1_5'Flank	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	204					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						CCCTTGCCGTGCCAGGTGACC	0.632			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)	dbGAP	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	0													85.0	66.0	72.0					11																	64575422		2201	4297	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.610C>A	11.37:g.64575422G>T	ENSP00000337088:p.His204Asn		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	pfam_Menin	p.H204N	ENST00000337652.1	37	c.610	CCDS8083.1	11	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684338	0.88639	.	.	ENSG00000133895	ENST00000377316;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626	D;D;D;D;D;D;D;D;D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28	4.76	4.76	0.60689	.	0.114155	0.64402	D	0.000018	D	0.99459	0.9808	M	0.67397	2.05	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71870	0.958;0.975	D	0.98342	1.0539	10	0.87932	D	0	-7.1759	15.7236	0.77736	0.0:0.0:1.0:0.0	.	199;204	O00255-2;O00255	.;MEN1_HUMAN	N	199;199;199;199;204;204;204;204;204;199;199;199	ENSP00000366533:H199N;ENSP00000366543:H199N;ENSP00000308975:H199N;ENSP00000323747:H199N;ENSP00000337088:H204N;ENSP00000377901:H204N;ENSP00000377899:H204N;ENSP00000396940:H204N;ENSP00000366530:H204N;ENSP00000413944:H199N;ENSP00000394933:H199N;ENSP00000411218:H199N	ENSP00000308975:H199N	H	-	1	0	MEN1	64331998	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.690000	0.91272	2.382000	0.81193	0.456000	0.33151	CAC	MEN1	-	pfam_Menin	ENSG00000133895		0.632	MEN1-201	KNOWN	basic|CCDS	protein_coding	MEN1	HGNC	protein_coding	OTTHUMT00000143881.1	87	0.00	0	G			64575422	64575422	-1	no_errors	ENST00000337652	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
TLCD2	727910	genome.wustl.edu	37	17	1615490	1615490	+	5'Flank	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:1615490C>A	ENST00000330676.6	-	0	0				MIR22HG_ENST00000362190.1_lincRNA	NM_001164407.1	NP_001157879.1	A6NGC4	TLCD2_HUMAN	TLC domain containing 2							integral component of membrane (GO:0016021)				prostate(1)	1						atttgcctttctttaattact	0.343																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0				CCDS45567.1	17p13.3	2010-10-18			ENSG00000185561	ENSG00000185561			33522	protein-coding gene	gene with protein product						16793762	Standard	NM_001164407		Approved		uc021tnh.1	A6NGC4	OTTHUMG00000132477		17.37:g.1615490C>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000330676.6	37	NULL	CCDS45567.1	17																																																																																			MIR22HG	-	-	ENSG00000186594		0.343	TLCD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIR22HG	HGNC	protein_coding	OTTHUMT00000255644.4	29	0.00	0	C	NM_001164407		1615490	1615490	-1	no_errors	ENST00000334146	ensembl	human	known	69_37n	rna	18	14.29	3	SNP	0.281	A
KMT2A	4297	genome.wustl.edu	37	11	118354912	118354912	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:118354912G>A	ENST00000389506.5	+	9	4101	c.4101G>A	c.(4099-4101)ccG>ccA	p.P1367P	KMT2A_ENST00000420751.2_3'UTR|KMT2A_ENST00000534358.1_Silent_p.P1367P|KMT2A_ENST00000354520.4_Silent_p.P1367P			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1367					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AACCACCTCCGGTCAATAAGC	0.398																																						dbGAP											0													101.0	95.0	97.0					11																	118354912		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4101G>A	11.37:g.118354912G>A			E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.P1367	ENST00000389506.5	37	c.4101	CCDS31686.1	11																																																																																			MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.398	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	39	0.00	0	G	NM_005933		118354912	118354912	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.002	A
KMT2D	8085	genome.wustl.edu	37	12	49438733	49438733	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:49438733C>A	ENST00000301067.7	-	19	4756	c.4757G>T	c.(4756-4758)cGc>cTc	p.R1586L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1586					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ACCTTCGAAGCGAAAGTACTG	0.552																																						dbGAP											0													96.0	95.0	95.0					12																	49438733		2052	4200	6252	-	-	-	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4757G>T	12.37:g.49438733C>A	ENSP00000301067:p.Arg1586Leu		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R1586L	ENST00000301067.7	37	c.4757	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	17.16	3.317753	0.60524	.	.	ENSG00000167548	ENST00000301067	T	0.79247	-1.25	5.81	5.81	0.92471	.	0.000000	0.36703	N	0.002453	D	0.84674	0.5524	L	0.39633	1.23	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85509	0.1196	10	0.87932	D	0	.	18.854	0.92244	0.0:1.0:0.0:0.0	.	1586	O14686	MLL2_HUMAN	L	1586	ENSP00000301067:R1586L	ENSP00000301067:R1586L	R	-	2	0	MLL2	47725000	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.739000	0.68622	2.746000	0.94184	0.655000	0.94253	CGC	MLL2	-	NULL	ENSG00000167548		0.552	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	61	0.00	0	C			49438733	49438733	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	1.000	A
MMP3	4314	genome.wustl.edu	37	11	102709951	102709951	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:102709951C>A	ENST00000299855.5	-	7	1215	c.959G>T	c.(958-960)aGg>aTg	p.R320M	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	320					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	TTCAAGCTTCCTGAGGGATTT	0.393																																						dbGAP											0													87.0	95.0	92.0					11																	102709951		2203	4299	6502	-	-	-	SO:0001583	missense	0			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.959G>T	11.37:g.102709951C>A	ENSP00000299855:p.Arg320Met		B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.R320M	ENST00000299855.5	37	c.959	CCDS8323.1	11	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720535	0.30503	.	.	ENSG00000149968	ENST00000299855	T	0.02682	4.2	5.65	3.61	0.41365	Hemopexin/matrixin (2);	0.363325	0.20087	N	0.099526	T	0.10165	0.0249	M	0.78456	2.415	0.22017	N	0.99941	B	0.31241	0.315	P	0.47891	0.56	T	0.03706	-1.1011	10	0.35671	T	0.21	.	10.8875	0.46976	0.0:0.7861:0.0:0.2139	.	320	P08254	MMP3_HUMAN	M	320	ENSP00000299855:R320M	ENSP00000299855:R320M	R	-	2	0	MMP3	102215161	0.075000	0.21258	0.150000	0.22450	0.212000	0.24457	1.671000	0.37513	1.561000	0.49584	0.655000	0.94253	AGG	MMP3	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000149968		0.393	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	HGNC	protein_coding	OTTHUMT00000109758.2	47	0.00	0	C	NM_002422		102709951	102709951	-1	no_errors	ENST00000299855	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.431	A
MPRIP	23164	genome.wustl.edu	37	17	17075095	17075095	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:17075095C>A	ENST00000341712.4	+	16	2227	c.2227C>A	c.(2227-2229)Cag>Aag	p.Q743K	MPRIP_ENST00000395811.5_Missense_Mutation_p.Q743K|MPRIP_ENST00000395804.3_Missense_Mutation_p.Q743K|RP11-45M22.3_ENST00000584203.1_RNA|RNU6-767P_ENST00000384132.1_RNA|MPRIP_ENST00000444976.1_Missense_Mutation_p.Q705K			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	743	Interaction with RHOA.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TGAAGATCTCCAGAGGCAGCA	0.547																																						dbGAP											0													82.0	99.0	93.0					17																	17075095		2203	4297	6500	-	-	-	SO:0001583	missense	0			BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2227C>A	17.37:g.17075095C>A	ENSP00000342379:p.Gln743Lys		Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_Ferritin/RR-like,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q743K	ENST00000341712.4	37	c.2227	CCDS32578.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.181667|5.181667	0.94885|0.94885	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000313485|ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	.|T;T;T;T	.|0.26957	.|1.7;2.0;2.02;2.02	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.063724	.|0.64402	.|D	.|0.000005	T|T	0.49047|0.49047	0.1534|0.1534	L|L	0.49126|0.49126	1.545|1.545	0.58432|0.58432	D|D	0.999995|0.999995	.|D;P;D	.|0.89917	.|1.0;0.528;0.993	.|D;P;D	.|0.87578	.|0.998;0.574;0.952	T|T	0.39121|0.39121	-0.9629|-0.9629	5|10	.|0.66056	.|D	.|0.02	-7.4915|-7.4915	20.032|20.032	0.97543|0.97543	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1107;743;743	.|Q9Y6X7;Q6WCQ1-2;Q6WCQ1	.|.;.;MPRIP_HUMAN	Q|K	1107|705;743;743;743	.|ENSP00000400189:Q705K;ENSP00000379156:Q743K;ENSP00000379149:Q743K;ENSP00000342379:Q743K	.|ENSP00000342379:Q743K	P|Q	+|+	2|1	0|0	MPRIP|MPRIP	17015820|17015820	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.881000|0.881000	0.50899|0.50899	7.419000|7.419000	0.80179|0.80179	2.743000|2.743000	0.94032|0.94032	0.655000|0.655000	0.94253|0.94253	CCA|CAG	MPRIP	-	superfamily_Ferritin/RR-like	ENSG00000133030		0.547	MPRIP-002	KNOWN	basic|CCDS	protein_coding	MPRIP	HGNC	protein_coding	OTTHUMT00000131587.1	64	0.00	0	C	NM_015134		17075095	17075095	+1	no_errors	ENST00000395811	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	A
MTOR	2475	genome.wustl.edu	37	1	11294317	11294317	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:11294317C>A	ENST00000361445.4	-	14	2290	c.2214G>T	c.(2212-2214)ttG>ttT	p.L738F		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	738					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCAACTCTGTCAAAATCTGTA	0.517																																						dbGAP											0													130.0	139.0	136.0					1																	11294317		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2214G>T	1.37:g.11294317C>A	ENSP00000354558:p.Leu738Phe		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L738F	ENST00000361445.4	37	c.2214	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520650	0.64747	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.75050	-0.9	5.7	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	D	0.87935	0.6303	H	0.94658	3.565	0.80722	D	1	D	0.69078	0.997	D	0.64237	0.923	D	0.89949	0.4078	10	0.87932	D	0	.	10.5439	0.45050	0.0:0.7874:0.1357:0.0769	.	738	P42345	MTOR_HUMAN	F	738	ENSP00000354558:L738F	ENSP00000354558:L738F	L	-	3	2	MTOR	11216904	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	2.394000	0.44450	1.402000	0.46780	0.561000	0.74099	TTG	MTOR	-	superfamily_ARM-type_fold	ENSG00000198793		0.517	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	53	0.00	0	C	NM_004958		11294317	11294317	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	A
MTUS1	57509	genome.wustl.edu	37	8	17541837	17541837	+	Splice_Site	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:17541837C>T	ENST00000262102.6	-	7	3062	c.2838G>A	c.(2836-2838)gaG>gaA	p.E946E	MTUS1_ENST00000518713.1_5'UTR|MTUS1_ENST00000519263.1_Splice_Site_p.E892E|MIR548V_ENST00000584165.1_RNA|MTUS1_ENST00000381861.3_Splice_Site_p.E193E|MTUS1_ENST00000544260.1_Splice_Site_p.E91E|MTUS1_ENST00000297488.6_Splice_Site_p.E112E|MTUS1_ENST00000381869.3_Splice_Site_p.E892E	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	946					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		ACCTCCTTACCTCAGACAGCA	0.493																																						dbGAP											0													103.0	100.0	101.0					8																	17541837		2005	4169	6174	-	-	-	SO:0001630	splice_region_variant	0			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2838+1G>A	8.37:g.17541837C>T			A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	superfamily_Ferritin/RR-like	p.E946	ENST00000262102.6	37	c.2838	CCDS43717.1	8																																																																																			MTUS1	-	NULL	ENSG00000129422		0.493	MTUS1-001	KNOWN	basic|CCDS	protein_coding	MTUS1	HGNC	protein_coding	OTTHUMT00000375247.1	66	0.00	0	C	XM_372031	Silent	17541837	17541837	-1	no_errors	ENST00000262102	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	1.000	T
MX1	4599	genome.wustl.edu	37	21	42812847	42812847	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:42812847C>T	ENST00000398600.2	+	11	1650	c.625C>T	c.(625-627)Cag>Tag	p.Q209*	AP001610.5_ENST00000411427.1_RNA|MX1_ENST00000288383.6_Nonsense_Mutation_p.Q186*|MX1_ENST00000455164.2_Nonsense_Mutation_p.Q209*|MX1_ENST00000398598.3_Nonsense_Mutation_p.Q209*	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	209	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CATCCAGAGGCAGGAGACAAT	0.547																																						dbGAP											0													167.0	154.0	158.0					21																	42812847		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.625C>T	21.37:g.42812847C>T	ENSP00000381601:p.Gln209*		B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Nonsense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.Q209*	ENST00000398600.2	37	c.625	CCDS13673.1	21	.	.	.	.	.	.	.	.	.	.	C	33	5.240175	0.95240	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	.	.	.	4.65	3.74	0.42951	.	0.106440	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-52.8597	10.0102	0.41981	0.1545:0.6957:0.1498:0.0	.	.	.	.	X	209;209;209;186	.	ENSP00000288383:Q186X	Q	+	1	0	MX1	41734717	1.000000	0.71417	0.643000	0.29450	0.146000	0.21551	2.567000	0.45956	1.241000	0.43820	0.650000	0.86243	CAG	MX1	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase	ENSG00000157601		0.547	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2	78	0.00	0	C			42812847	42812847	+1	no_errors	ENST00000398598	ensembl	human	known	69_37n	nonsense	34	10.26	4	SNP	0.993	T
MXRA5	25878	genome.wustl.edu	37	X	3229372	3229372	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:3229372G>A	ENST00000217939.6	-	7	7026	c.6872C>T	c.(6871-6873)tCg>tTg	p.S2291L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2291	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)		p.S2291L(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCTGTCATCCGACTGCATGAA	0.577																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											109.0	86.0	94.0					X																	3229372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6872C>T	X.37:g.3229372G>A	ENSP00000217939:p.Ser2291Leu		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S2291L	ENST00000217939.6	37	c.6872	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589036	0.28357	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.27557	1.66	4.28	3.37	0.38596	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.511109	0.14573	U	0.311316	T	0.37265	0.0997	L	0.39147	1.195	0.09310	N	0.999999	D	0.60160	0.987	P	0.52823	0.71	T	0.16424	-1.0403	10	0.51188	T	0.08	.	13.2913	0.60272	0.0:0.1564:0.8436:0.0	.	2291	Q9NR99	MXRA5_HUMAN	L	2291	ENSP00000217939:S2291L	ENSP00000217939:S2291L	S	-	2	0	MXRA5	3239372	1.000000	0.71417	0.004000	0.12327	0.022000	0.10575	4.728000	0.62000	0.605000	0.29947	0.509000	0.49947	TCG	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101825		0.577	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	76	0.00	0	G	NM_015419		3229372	3229372	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.223	A
MYL9	10398	genome.wustl.edu	37	20	35177504	35177504	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:35177504G>A	ENST00000279022.2	+	4	475	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	MYL9_ENST00000346786.2_Missense_Mutation_p.R70Q|RP5-977B1.7_ENST00000425233.1_RNA|RP5-977B1.11_ENST00000561134.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA	NM_006097.4	NP_006088.2	P24844	MYL9_HUMAN	myosin, light chain 9, regulatory	124	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|platelet aggregation (GO:0070527)|regulation of muscle contraction (GO:0006937)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)	8	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GACCACCTCCGGGAGCTGCTC	0.592																																						dbGAP											0													81.0	72.0	75.0					20																	35177504		2203	4300	6503	-	-	-	SO:0001583	missense	0			J02854	CCDS13276.1, CCDS13277.1	20q11.23	2013-01-10	2006-09-29		ENSG00000101335	ENSG00000101335		"""Myosins / Light chain"", ""EF-hand domain containing"""	15754	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2, smooth muscle isoform"", ""myosin regulatory light chain 1"""	609905	"""myosin, light polypeptide 9, regulatory"""			2526655	Standard	NM_006097		Approved	MYRL2, MLC2, LC20, MRLC1	uc002xfl.2	P24844	OTTHUMG00000032387	ENST00000279022.2:c.371G>A	20.37:g.35177504G>A	ENSP00000279022:p.Arg124Gln		E1P5T6|Q9BQL9|Q9BUF9|Q9H136	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.R124Q	ENST00000279022.2	37	c.371	CCDS13276.1	20	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080314	0.76528	.	.	ENSG00000101335	ENST00000279022;ENST00000346786	T;T	0.80123	-1.34;-1.27	4.7	4.7	0.59300	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88451	0.6440	M	0.74546	2.27	0.32786	N	0.501789	D;D	0.71674	0.998;0.996	D;P	0.66602	0.945;0.7	D	0.91226	0.5010	10	0.52906	T	0.07	.	16.5838	0.84722	0.0:0.0:1.0:0.0	.	70;124	Q9BUF9;P24844	.;MYL9_HUMAN	Q	124;70	ENSP00000279022:R124Q;ENSP00000217313:R70Q	ENSP00000279022:R124Q	R	+	2	0	MYL9	34610918	1.000000	0.71417	0.988000	0.46212	0.962000	0.63368	9.759000	0.98931	2.317000	0.78254	0.655000	0.94253	CGG	MYL9	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000101335		0.592	MYL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL9	HGNC	protein_coding	OTTHUMT00000079015.2	66	0.00	0	G	NM_006097		35177504	35177504	+1	no_errors	ENST00000279022	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	A
MYO15A	51168	genome.wustl.edu	37	17	18058670	18058670	+	Missense_Mutation	SNP	G	G	A	rs144830391	byFrequency	TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:18058670G>A	ENST00000205890.5	+	47	8721	c.8383G>A	c.(8383-8385)Gtg>Atg	p.V2795M	MYO15A_ENST00000418233.3_Missense_Mutation_p.V59M|MYO15A_ENST00000585180.1_Missense_Mutation_p.R57H	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2795	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TGTGTCCCACGTGGGCATCAA	0.637													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18968	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													48.0	56.0	54.0					17																	18058670		2087	4224	6311	-	-	-	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8383G>A	17.37:g.18058670G>A	ENSP00000205890:p.Val2795Met		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.V2795M	ENST00000205890.5	37	c.8383	CCDS42271.1	17	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.97	1.501618	0.26949	.	.	ENSG00000091536	ENST00000205890	D	0.87571	-2.27	5.58	-1.75	0.08031	.	.	.	.	.	T	0.69415	0.3108	N	0.08118	0	0.29440	N	0.859217	B;B	0.11235	0.004;0.004	B;B	0.12156	0.007;0.001	T	0.57883	-0.7734	9	0.34782	T	0.22	.	4.9446	0.13984	0.4636:0.0:0.3208:0.2156	.	59;2795	B4DFC7;Q9UKN7	.;MYO15_HUMAN	M	2795	ENSP00000205890:V2795M	ENSP00000205890:V2795M	V	+	1	0	MYO15A	17999395	0.001000	0.12720	0.209000	0.23619	0.755000	0.42902	0.339000	0.19875	0.034000	0.15491	-0.459000	0.05422	GTG	MYO15A	-	NULL	ENSG00000091536		0.637	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	49	0.00	0	G	NM_016239		18058670	18058670	+1	no_errors	ENST00000205890	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.082	A
MYO15A	51168	genome.wustl.edu	37	17	18058670	18058670	+	Missense_Mutation	SNP	G	G	A	rs144830391	byFrequency	TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr17:18058670G>A	ENST00000205890.5	+	47	8721	c.8383G>A	c.(8383-8385)Gtg>Atg	p.V2795M	MYO15A_ENST00000418233.3_Missense_Mutation_p.V59M|MYO15A_ENST00000585180.1_Missense_Mutation_p.R57H	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2795	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TGTGTCCCACGTGGGCATCAA	0.637													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18968	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													48.0	56.0	54.0					17																	18058670		2087	4224	6311	-	-	-	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8383G>A	17.37:g.18058670G>A	ENSP00000205890:p.Val2795Met		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.V2795M	ENST00000205890.5	37	c.8383	CCDS42271.1	17	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.97	1.501618	0.26949	.	.	ENSG00000091536	ENST00000205890	D	0.87571	-2.27	5.58	-1.75	0.08031	.	.	.	.	.	T	0.69415	0.3108	N	0.08118	0	0.29440	N	0.859217	B;B	0.11235	0.004;0.004	B;B	0.12156	0.007;0.001	T	0.57883	-0.7734	9	0.34782	T	0.22	.	4.9446	0.13984	0.4636:0.0:0.3208:0.2156	.	59;2795	B4DFC7;Q9UKN7	.;MYO15_HUMAN	M	2795	ENSP00000205890:V2795M	ENSP00000205890:V2795M	V	+	1	0	MYO15A	17999395	0.001000	0.12720	0.209000	0.23619	0.755000	0.42902	0.339000	0.19875	0.034000	0.15491	-0.459000	0.05422	GTG	MYO15A	-	NULL	ENSG00000091536		0.637	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	19	0.00	0	G	NM_016239		18058670	18058670	+1	no_errors	ENST00000205890	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.082	A
MYO15A	51168	genome.wustl.edu	37	17	18058670	18058670	+	Missense_Mutation	SNP	G	G	A	rs144830391	byFrequency	TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:18058670G>A	ENST00000205890.5	+	47	8721	c.8383G>A	c.(8383-8385)Gtg>Atg	p.V2795M	MYO15A_ENST00000418233.3_Missense_Mutation_p.V59M|MYO15A_ENST00000585180.1_Missense_Mutation_p.R57H	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2795	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TGTGTCCCACGTGGGCATCAA	0.637													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18968	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													48.0	56.0	54.0					17																	18058670		2087	4224	6311	-	-	-	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8383G>A	17.37:g.18058670G>A	ENSP00000205890:p.Val2795Met		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.V2795M	ENST00000205890.5	37	c.8383	CCDS42271.1	17	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.97	1.501618	0.26949	.	.	ENSG00000091536	ENST00000205890	D	0.87571	-2.27	5.58	-1.75	0.08031	.	.	.	.	.	T	0.69415	0.3108	N	0.08118	0	0.29440	N	0.859217	B;B	0.11235	0.004;0.004	B;B	0.12156	0.007;0.001	T	0.57883	-0.7734	9	0.34782	T	0.22	.	4.9446	0.13984	0.4636:0.0:0.3208:0.2156	.	59;2795	B4DFC7;Q9UKN7	.;MYO15_HUMAN	M	2795	ENSP00000205890:V2795M	ENSP00000205890:V2795M	V	+	1	0	MYO15A	17999395	0.001000	0.12720	0.209000	0.23619	0.755000	0.42902	0.339000	0.19875	0.034000	0.15491	-0.459000	0.05422	GTG	MYO15A	-	NULL	ENSG00000091536		0.637	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	49	0.00	0	G	NM_016239		18058670	18058670	+1	no_errors	ENST00000205890	ensembl	human	known	69_37n	missense	69	24.18	22	SNP	0.082	A
MYO9A	4649	genome.wustl.edu	37	15	72120232	72120232	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:72120232C>A	ENST00000356056.5	-	41	7648	c.7176G>T	c.(7174-7176)gaG>gaT	p.E2392D	MYO9A_ENST00000424560.1_Missense_Mutation_p.E2463D|MYO9A_ENST00000444904.1_Missense_Mutation_p.E2373D|MYO9A_ENST00000564571.1_Missense_Mutation_p.E2392D	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2392	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TACCTGATTTCTCAGAGATAG	0.403																																						dbGAP											0													99.0	101.0	100.0					15																	72120232		2199	4297	6496	-	-	-	SO:0001583	missense	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7176G>T	15.37:g.72120232C>A	ENSP00000348349:p.Glu2392Asp		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.E2463D	ENST00000356056.5	37	c.7389	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	C	3.428	-0.116638	0.06838	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.82526	-1.62;-1.6;-1.62	5.84	1.55	0.23275	.	.	.	.	.	T	0.52289	0.1725	N	0.02011	-0.69	0.19300	N	0.999978	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.41805	-0.9488	9	0.13470	T	0.59	.	0.4847	0.00554	0.204:0.3359:0.2102:0.2499	.	2392;2156	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	D	2392;2463;2373	ENSP00000348349:E2392D;ENSP00000399162:E2463D;ENSP00000398250:E2373D	ENSP00000348349:E2392D	E	-	3	2	MYO9A	69907286	1.000000	0.71417	0.974000	0.42286	0.918000	0.54935	1.205000	0.32308	0.406000	0.25560	0.655000	0.94253	GAG	MYO9A	-	NULL	ENSG00000066933		0.403	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	48	0.00	0	C	NM_006901		72120232	72120232	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.643	A
NACAD	23148	genome.wustl.edu	37	7	45125692	45125692	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:45125692G>A	ENST00000490531.2	-	2	106	c.87C>T	c.(85-87)gcC>gcT	p.A29A		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	29					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TGGTGGCAGCGGCCGCATCGC	0.672																																						dbGAP											0													2.0	4.0	4.0					7																	45125692		568	1402	1970	-	-	-	SO:0001819	synonymous_variant	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.87C>T	7.37:g.45125692G>A				Silent	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.A29	ENST00000490531.2	37	c.87	CCDS47582.1	7																																																																																			NACAD	-	NULL	ENSG00000136274		0.672	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	20	0.00	0	G	NM_001146334		45125692	45125692	-1	no_errors	ENST00000490531	ensembl	human	known	69_37n	silent	4	50.00	4	SNP	0.025	A
NDUFV1	4723	genome.wustl.edu	37	11	67376142	67376142	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:67376142G>T	ENST00000322776.6	+	3	428	c.275G>T	c.(274-276)gGc>gTc	p.G92V	NDUFV1_ENST00000532303.1_5'UTR|C11orf72_ENST00000446232.1_5'Flank|C11orf72_ENST00000333139.3_5'Flank|NDUFV1_ENST00000526169.1_3'UTR|NDUFV1_ENST00000415352.2_Missense_Mutation_p.G85V|NDUFV1_ENST00000529927.1_Missense_Mutation_p.G83V|RP11-655M14.12_ENST00000533876.1_RNA	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	92					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						GGAGGCGCTGGCTTCCCCACT	0.612																																						dbGAP											0													95.0	103.0	100.0					11																	67376142		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.275G>T	11.37:g.67376142G>T	ENSP00000322450:p.Gly92Val		O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_51kDa_su,pfam_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,pfam_Soluble_ligand-bd,smart_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,tigrfam_NADH-UbQ_OxRdtase_suF	p.G92V	ENST00000322776.6	37	c.275	CCDS8173.1	11	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720920	0.89205	.	.	ENSG00000167792	ENST00000322776;ENST00000528328;ENST00000529927;ENST00000415352;ENST00000533075;ENST00000529867;ENST00000453836;ENST00000530638	D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	4.61	4.61	0.57282	NADH:ubiquinone oxidoreductase, 51kDa subunit (1);	0.000000	0.85682	D	0.000000	D	0.97714	0.9250	H	0.99830	4.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;0.994;1.0	D	0.98888	1.0772	10	0.87932	D	0	-18.2012	14.9788	0.71296	0.0:0.0:1.0:0.0	.	85;83;92	G3V0I5;P49821-2;P49821	.;.;NDUV1_HUMAN	V	92;75;83;85;85;80;92;53	ENSP00000322450:G92V;ENSP00000436906:G75V;ENSP00000436766:G83V;ENSP00000395368:G85V;ENSP00000437267:G85V;ENSP00000434438:G80V;ENSP00000436936:G53V	ENSP00000322450:G92V	G	+	2	0	NDUFV1	67132718	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.407000	0.97325	2.393000	0.81446	0.643000	0.83706	GGC	NDUFV1	-	pfam_NADH_UbQ_OxRdtase_51kDa_su,tigrfam_NADH-UbQ_OxRdtase_suF	ENSG00000167792		0.612	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	NDUFV1	HGNC	protein_coding	OTTHUMT00000388406.1	73	0.00	0	G	NM_007103		67376142	67376142	+1	no_errors	ENST00000322776	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152474877	152474877	+	Missense_Mutation	SNP	C	C	T	rs550715282		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:152474877C>T	ENST00000172853.10	-	70	10406	c.10259G>A	c.(10258-10260)cGt>cAt	p.R3420H	NEB_ENST00000409198.1_Missense_Mutation_p.R3420H|NEB_ENST00000604864.1_Missense_Mutation_p.R3663H|NEB_ENST00000427231.2_Missense_Mutation_p.R3663H|NEB_ENST00000603639.1_Missense_Mutation_p.R3663H|NEB_ENST00000397345.3_Missense_Mutation_p.R3663H			P20929	NEBU_HUMAN	nebulin	3420					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGACGCTGACGGTAGATAGT	0.443																																						dbGAP											0													171.0	166.0	167.0					2																	152474877		1945	4141	6086	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10259G>A	2.37:g.152474877C>T	ENSP00000172853:p.Arg3420His		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.R3663H	ENST00000172853.10	37	c.10988		2	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656838	0.67586	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.10763	2.88;2.91;2.84;2.88	5.68	5.68	0.88126	.	0.211738	0.40554	N	0.001066	T	0.35711	0.0941	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.09862	-1.0655	10	0.87932	D	0	.	13.3796	0.60761	0.0:0.9281:0.0:0.0719	.	3420	P20929	NEBU_HUMAN	H	3420;3663;3663;3420	ENSP00000386259:R3420H;ENSP00000380505:R3663H;ENSP00000416578:R3663H;ENSP00000172853:R3420H	ENSP00000172853:R3420H	R	-	2	0	NEB	152183123	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	5.961000	0.70356	2.835000	0.97688	0.650000	0.86243	CGT	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.443	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		37	0.00	0	C	NM_004543		152474877	152474877	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
NECAB3	63941	genome.wustl.edu	37	20	32257196	32257196	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:32257196C>A	ENST00000246190.6	-	5	427	c.372G>T	c.(370-372)atG>atT	p.M124I	NECAB3_ENST00000375238.4_Missense_Mutation_p.M124I	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	124					protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						TGGTGGCATCCATGGCAGCGA	0.597																																						dbGAP											0													53.0	62.0	59.0					20																	32257196		2159	4262	6421	-	-	-	SO:0001583	missense	0			AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.372G>T	20.37:g.32257196C>A	ENSP00000246190:p.Met124Ile		A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Missense_Mutation	SNP	pfam_Antibiotic_mOase,pfam_EF-hand,superfamily_Dimeric_a/b-barrel,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.M124I	ENST00000246190.6	37	c.372	CCDS42866.1	20	.	.	.	.	.	.	.	.	.	.	C	17.42	3.386284	0.61956	.	.	ENSG00000125967	ENST00000375238;ENST00000246190;ENST00000439478	T;T;T	0.29655	1.94;2.19;1.56	5.16	5.16	0.70880	.	0.050203	0.85682	D	0.000000	T	0.57021	0.2025	M	0.79805	2.47	0.80722	D	1	P;D;D;D	0.69078	0.685;0.997;0.97;0.97	B;D;P;P	0.81914	0.384;0.995;0.77;0.837	T	0.60974	-0.7156	10	0.72032	D	0.01	-10.729	14.0142	0.64515	0.0:1.0:0.0:0.0	.	124;1;124;124	Q96P71-3;E1P5N3;Q96P71;Q96P71-2	.;.;NECA3_HUMAN;.	I	124	ENSP00000364386:M124I;ENSP00000246190:M124I;ENSP00000392064:M124I	ENSP00000246190:M124I	M	-	3	0	NECAB3	31720857	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	5.505000	0.66981	2.687000	0.91594	0.462000	0.41574	ATG	NECAB3	-	NULL	ENSG00000125967		0.597	NECAB3-010	KNOWN	basic|CCDS	protein_coding	NECAB3	HGNC	protein_coding	OTTHUMT00000078724.2	53	0.00	0	C			32257196	32257196	-1	no_errors	ENST00000246190	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	A
NEU1	4758	genome.wustl.edu	37	6	31830428	31830428	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:31830428G>T	ENST00000375631.4	-	1	255	c.126C>A	c.(124-126)gcC>gcA	p.A42A		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	42					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	TGGACCAGGAGGCTGCCAGAG	0.642																																						dbGAP											0													91.0	62.0	72.0					6																	31830428		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.126C>A	6.37:g.31830428G>T				Silent	SNP	superfamily_Neuraminidase	p.A42	ENST00000375631.4	37	c.126	CCDS4723.1	6																																																																																			NEU1	-	NULL	ENSG00000204386		0.642	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEU1	HGNC	protein_coding	OTTHUMT00000076616.2	84	0.00	0	G			31830428	31830428	-1	no_errors	ENST00000375631	ensembl	human	known	69_37n	silent	43	10.42	5	SNP	0.000	T
NF1	4763	genome.wustl.edu	37	17	29653066	29653066	+	Silent	SNP	G	G	A	rs587781693		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:29653066G>A	ENST00000358273.4	+	37	5447	c.5064G>A	c.(5062-5064)gaG>gaA	p.E1688E	NF1_ENST00000356175.3_Silent_p.E1667E|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1688	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGGTCAGGGAGTACACCAAGT	0.463			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											97.0	91.0	93.0					17																	29653066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5064G>A	17.37:g.29653066G>A			O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E1688	ENST00000358273.4	37	c.5064	CCDS42292.1	17																																																																																			NF1	-	superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000196712		0.463	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	60	0.00	0	G	NM_000267		29653066	29653066	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	silent	45	10.00	5	SNP	0.999	A
NFE2L2	4780	genome.wustl.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:178098803C>T	ENST00000397062.3	-	2	796	c.242G>A	c.(241-243)gGt>gAt	p.G81D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												dbGAP		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)											143.0	142.0	142.0					2																	178098803		1901	4105	6006	-	-	-	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>A	2.37:g.178098803C>T	ENSP00000380252:p.Gly81Asp		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Splice_Site	SNP	-	e1+1	ENST00000397062.3	37	c.193+1	CCDS42782.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.944073|4.944073	0.92593|0.92593	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.51817	.|1.19;1.19;1.19;0.69;0.69;1.19	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75110	.|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	.|T	.|0.78563	.|-0.2156	.|10	.|0.87932	.|D	.|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|D	-1|65;81;65;65;65;65	.|ENSP00000380253:G65D;ENSP00000380252:G81D;ENSP00000411575:G65D;ENSP00000400073:G65D;ENSP00000412191:G65D;ENSP00000410015:G65D	.|ENSP00000380252:G81D	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	NFE2L2	-	-	ENSG00000116044		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	202	0.00	0	C	NM_006164		178098803	178098803	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000449627	ensembl	human	novel	69_37n	splice_site	168	29.29	70	SNP	1.000	T
NFE2L2	4780	genome.wustl.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:178098803C>T	ENST00000397062.3	-	2	796	c.242G>A	c.(241-243)gGt>gAt	p.G81D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												dbGAP		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)											143.0	142.0	142.0					2																	178098803		1901	4105	6006	-	-	-	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>A	2.37:g.178098803C>T	ENSP00000380252:p.Gly81Asp		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Splice_Site	SNP	-	e1+1	ENST00000397062.3	37	c.193+1	CCDS42782.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.944073|4.944073	0.92593|0.92593	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.51817	.|1.19;1.19;1.19;0.69;0.69;1.19	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75110	.|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	.|T	.|0.78563	.|-0.2156	.|10	.|0.87932	.|D	.|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|D	-1|65;81;65;65;65;65	.|ENSP00000380253:G65D;ENSP00000380252:G81D;ENSP00000411575:G65D;ENSP00000400073:G65D;ENSP00000412191:G65D;ENSP00000410015:G65D	.|ENSP00000380252:G81D	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	NFE2L2	-	-	ENSG00000116044		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	154	0.00	0	C	NM_006164		178098803	178098803	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000449627	ensembl	human	novel	69_37n	splice_site	91	31.06	41	SNP	1.000	T
NFE2L2	4780	genome.wustl.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:178098803C>T	ENST00000397062.3	-	2	796	c.242G>A	c.(241-243)gGt>gAt	p.G81D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												dbGAP		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)											143.0	142.0	142.0					2																	178098803		1901	4105	6006	-	-	-	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>A	2.37:g.178098803C>T	ENSP00000380252:p.Gly81Asp		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Splice_Site	SNP	-	e1+1	ENST00000397062.3	37	c.193+1	CCDS42782.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.944073|4.944073	0.92593|0.92593	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.51817	.|1.19;1.19;1.19;0.69;0.69;1.19	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75110	.|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	.|T	.|0.78563	.|-0.2156	.|10	.|0.87932	.|D	.|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|D	-1|65;81;65;65;65;65	.|ENSP00000380253:G65D;ENSP00000380252:G81D;ENSP00000411575:G65D;ENSP00000400073:G65D;ENSP00000412191:G65D;ENSP00000410015:G65D	.|ENSP00000380252:G81D	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	NFE2L2	-	-	ENSG00000116044		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	202	0.00	0	C	NM_006164		178098803	178098803	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000449627	ensembl	human	novel	69_37n	splice_site	90	39.33	59	SNP	1.000	T
NLGN1	22871	genome.wustl.edu	37	3	173998682	173998682	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:173998682G>T	ENST00000457714.1	+	7	2490	c.2061G>T	c.(2059-2061)ctG>ctT	p.L687L	NLGN1_ENST00000545397.1_Silent_p.L687L|NLGN1_ENST00000401917.3_Silent_p.L727L|NLGN1_ENST00000361589.4_Silent_p.L687L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	704					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CATCACTGCTGTTTCTGAACA	0.468																																						dbGAP											0													95.0	95.0	95.0					3																	173998682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.2061G>T	3.37:g.173998682G>T			Q9UPT2	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L727	ENST00000457714.1	37	c.2181	CCDS3222.1	3																																																																																			NLGN1	-	prints_Neuroligin	ENSG00000169760		0.468	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	57	0.00	0	G	NM_014932		173998682	173998682	+1	no_errors	ENST00000401917	ensembl	human	known	69_37n	silent	23	11.54	3	SNP	0.720	T
NRCAM	4897	genome.wustl.edu	37	7	107788595	107788595	+	3'UTR	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:107788595C>T	ENST00000379028.3	-	0	6145				NRCAM_ENST00000413765.2_3'UTR|NRCAM_ENST00000522550.2_5'UTR|NRCAM_ENST00000379024.4_3'UTR|NRCAM_ENST00000351718.4_3'UTR			Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						AAGATTTCATCGAAAAATCTG	0.398																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000379028.3:c.*1760G>A	7.37:g.107788595C>T			A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	RNA	SNP	-	NULL	ENST00000379028.3	37	NULL	CCDS47686.1	7																																																																																			NRCAM	-	-	ENSG00000091129		0.398	NRCAM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding		56	0.00	0	C	NM_001037132		107788595	107788595	-1	no_errors	ENST00000522550	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.881	T
NTNG2	84628	genome.wustl.edu	37	9	135116406	135116406	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:135116406G>A	ENST00000393229.3	+	7	2108	c.1332G>A	c.(1330-1332)acG>acA	p.T444T	NTNG2_ENST00000393228.4_Silent_p.T436T|NTNG2_ENST00000490694.1_3'UTR|NTNG2_ENST00000360670.3_Silent_p.T450T	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	444	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GCCTCCCCACGCACTACTGGC	0.741																																						dbGAP											0													18.0	18.0	18.0					9																	135116406		2195	4295	6490	-	-	-	SO:0001819	synonymous_variant	0			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.1332G>A	9.37:g.135116406G>A			Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.T450	ENST00000393229.3	37	c.1350	CCDS6946.1	9																																																																																			NTNG2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196358		0.741	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	19	0.00	0	G	NM_032536		135116406	135116406	+1	no_errors	ENST00000360670	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.998	A
NTNG2	84628	genome.wustl.edu	37	9	135116406	135116406	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:135116406G>A	ENST00000393229.3	+	7	2108	c.1332G>A	c.(1330-1332)acG>acA	p.T444T	NTNG2_ENST00000393228.4_Silent_p.T436T|NTNG2_ENST00000490694.1_3'UTR|NTNG2_ENST00000360670.3_Silent_p.T450T	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	444	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GCCTCCCCACGCACTACTGGC	0.741																																						dbGAP											0													18.0	18.0	18.0					9																	135116406		2195	4295	6490	-	-	-	SO:0001819	synonymous_variant	0			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.1332G>A	9.37:g.135116406G>A			Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.T450	ENST00000393229.3	37	c.1350	CCDS6946.1	9																																																																																			NTNG2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196358		0.741	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	19	0.00	0	G	NM_032536		135116406	135116406	+1	no_errors	ENST00000360670	ensembl	human	known	69_37n	silent	13	38.10	8	SNP	0.998	A
OOEP	441161	genome.wustl.edu	37	6	74078938	74078938	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:74078938G>T	ENST00000370359.5	-	2	360	c.361C>A	c.(361-363)Cgt>Agt	p.R121S	OOEP-AS1_ENST00000445350.2_RNA|OOEP_ENST00000370363.1_Missense_Mutation_p.R66S	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	121					cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						CCTCGGGCACGATGTTCTCGG	0.562																																						dbGAP											0													55.0	56.0	56.0					6																	74078938		2013	4178	6191	-	-	-	SO:0001583	missense	0			BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.361C>A	6.37:g.74078938G>T	ENSP00000359384:p.Arg121Ser		A6NIN5|A9UIB7	Missense_Mutation	SNP	NULL	p.R121S	ENST00000370359.5	37	c.361	CCDS47451.1	6	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926245	0.52759	.	.	ENSG00000203907	ENST00000370363;ENST00000370359;ENST00000441145	T;T;T	0.12147	2.71;2.71;2.71	3.69	1.83	0.25207	.	0.682875	0.12975	N	0.423772	T	0.13756	0.0333	M	0.66939	2.045	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.65233	0.933;0.933	T	0.06881	-1.0802	10	0.41790	T	0.15	-9.9933	4.9157	0.13844	0.1199:0.2192:0.6608:0.0	.	66;121	F2Z364;A6NGQ2	.;OOEP_HUMAN	S	66;121;66	ENSP00000359388:R66S;ENSP00000359384:R121S;ENSP00000397430:R66S	ENSP00000359384:R121S	R	-	1	0	OOEP	74135659	0.005000	0.15991	0.001000	0.08648	0.183000	0.23260	0.633000	0.24598	0.514000	0.28300	0.655000	0.94253	CGT	OOEP	-	NULL	ENSG00000203907		0.562	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OOEP	HGNC	protein_coding	OTTHUMT00000108414.2	49	0.00	0	G	NM_001080507		74078938	74078938	-1	no_errors	ENST00000370359	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.001	T
OPRK1	4986	genome.wustl.edu	37	8	54142078	54142078	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:54142078C>A	ENST00000265572.3	-	4	1219	c.922G>T	c.(922-924)Gct>Tct	p.A308S	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Missense_Mutation_p.A308S|OPRK1_ENST00000524278.1_Missense_Mutation_p.A219S	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	308					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CTGGAGAGAGCAGCTGTGCTG	0.522																																						dbGAP											0													75.0	68.0	70.0					8																	54142078		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.922G>T	8.37:g.54142078C>A	ENSP00000265572:p.Ala308Ser		E5RHC9|Q499G4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Kappa_opi_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,prints_P2_purnocptor	p.A308S	ENST00000265572.3	37	c.922	CCDS6152.1	8	.	.	.	.	.	.	.	.	.	.	C	5.290	0.238917	0.10023	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.35789	1.29;1.29;1.29	5.8	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.164825	0.56097	D	0.000036	T	0.18718	0.0449	N	0.05592	-0.015	0.30789	N	0.741089	B	0.24186	0.099	B	0.22152	0.038	T	0.10359	-1.0633	10	0.07990	T	0.79	.	14.7315	0.69386	0.0:0.9308:0.0:0.0692	.	308	P41145	OPRK_HUMAN	S	308;219;308;294	ENSP00000265572:A308S;ENSP00000430923:A219S;ENSP00000429706:A308S	ENSP00000265572:A308S	A	-	1	0	OPRK1	54304631	0.964000	0.33143	0.094000	0.20943	0.954000	0.61252	2.544000	0.45761	1.454000	0.47793	0.650000	0.86243	GCT	OPRK1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Kappa_opi_rcpt	ENSG00000082556		0.522	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	HGNC	protein_coding	OTTHUMT00000378048.1	33	0.00	0	C			54142078	54142078	-1	no_errors	ENST00000265572	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	0.657	A
OR10A3	26496	genome.wustl.edu	37	11	7961001	7961001	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:7961001G>T	ENST00000360759.3	-	1	140	c.67C>A	c.(67-69)Ctc>Atc	p.L23I		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	23					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGCACCTGGAGCTCAGGAAAG	0.408																																						dbGAP											0													72.0	74.0	73.0					11																	7961001		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.67C>A	11.37:g.7961001G>T	ENSP00000353988:p.Leu23Ile		B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L23I	ENST00000360759.3	37	c.67	CCDS31421.1	11	.	.	.	.	.	.	.	.	.	.	G	7.976	0.750138	0.15778	.	.	ENSG00000170683	ENST00000360759	T	0.05081	3.5	4.95	3.0	0.34707	.	0.000000	0.35936	U	0.002886	T	0.05914	0.0154	L	0.43923	1.385	0.23174	N	0.998172	P	0.38300	0.626	B	0.36186	0.219	T	0.30119	-0.9989	10	0.40728	T	0.16	.	8.2968	0.31990	0.2111:0.0:0.7889:0.0	.	23	P58181	O10A3_HUMAN	I	23	ENSP00000353988:L23I	ENSP00000353988:L23I	L	-	1	0	OR10A3	7917577	0.000000	0.05858	1.000000	0.80357	0.257000	0.26127	-0.076000	0.11412	1.373000	0.46208	0.650000	0.86243	CTC	OR10A3	-	NULL	ENSG00000170683		0.408	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A3	HGNC	protein_coding	OTTHUMT00000385704.1	36	0.00	0	G	NM_001003745		7961001	7961001	-1	no_errors	ENST00000360759	ensembl	human	known	69_37n	missense	26	10.34	3	SNP	0.974	T
OR11H1	81061	genome.wustl.edu	37	22	16449539	16449539	+	Missense_Mutation	SNP	A	A	G	rs199856986	byFrequency	TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr22:16449539A>G	ENST00000252835.4	-	1	266	c.266T>C	c.(265-267)gTc>gCc	p.V89A		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TGTAGAAGAGACATACCATAT	0.418																																						dbGAP											0													1.0	1.0	1.0					22																	16449539		71	200	271	-	-	-	SO:0001583	missense	0			AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.266T>C	22.37:g.16449539A>G	ENSP00000252835:p.Val89Ala		Q6IEX0|Q96R32	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V89A	ENST00000252835.4	37	c.266	CCDS33594.1	22	.	.	.	.	.	.	.	.	.	.	a	9.377	1.072113	0.20147	.	.	ENSG00000130538	ENST00000252835	T	0.00418	7.49	2.19	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37715	N	0.001976	T	0.00328	0.0010	L	0.47078	1.49	0.09310	N	1	P	0.42409	0.779	B	0.40636	0.335	T	0.53158	-0.8478	10	0.37606	T	0.19	.	8.3461	0.32275	1.0:0.0:0.0:0.0	.	89	Q8NG94	O11H1_HUMAN	A	89	ENSP00000252835:V89A	ENSP00000252835:V89A	V	-	2	0	OR11H1	14829539	0.000000	0.05858	0.990000	0.47175	0.581000	0.36288	0.456000	0.21859	0.966000	0.38159	0.302000	0.19851	GTC	OR11H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000130538		0.418	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H1	HGNC	protein_coding	OTTHUMT00000074923.2	48	0.00	0	A	NM_001005239		16449539	16449539	-1	no_errors	ENST00000252835	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.234	G
OR6J1	79549	genome.wustl.edu	37	14	23103063	23103063	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr14:23103063C>T	ENST00000540461.1	-	1	653	c.654G>A	c.(652-654)acG>acA	p.T218T				Q8NGC5	OR6J1_HUMAN	olfactory receptor, family 6, subfamily J, member 1 (gene/pseudogene)	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AGATGATGTACGTATAGGAAT	0.493																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AC023226		14q11.2	2012-08-09	2012-04-20	2004-03-10	ENSG00000255804	ENSG00000255804		"""GPCR / Class A : Olfactory receptors"""	14707	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily J, member 1"""	OR6J2, OR6J1P			Standard	NG_002274		Approved			Q8NGC5	OTTHUMG00000168897	ENST00000540461.1:c.654G>A	14.37:g.23103063C>T				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T218	ENST00000540461.1	37	c.654		14																																																																																			OR6J1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255804		0.493	OR6J1-001	KNOWN	basic|appris_principal	protein_coding	OR6J1	HGNC	protein_coding	OTTHUMT00000401548.1	53	0.00	0	C			23103063	23103063	-1	no_errors	ENST00000540461	ensembl	human	known	69_37n	silent	26	10.34	3	SNP	0.000	T
OR8J1	219477	genome.wustl.edu	37	11	56128623	56128623	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:56128623G>T	ENST00000303039.3	+	1	933	c.901G>T	c.(901-903)Gct>Tct	p.A301S		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					TGTGAAGACTGCTCTACAGAG	0.368																																						dbGAP											0													77.0	70.0	73.0					11																	56128623		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.901G>T	11.37:g.56128623G>T	ENSP00000304060:p.Ala301Ser		B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A301S	ENST00000303039.3	37	c.901	CCDS31529.1	11	.	.	.	.	.	.	.	.	.	.	G	5.952	0.359601	0.11239	.	.	ENSG00000172487	ENST00000303039	T	0.44482	0.92	4.02	4.02	0.46733	.	0.000000	0.64402	D	0.000007	T	0.34948	0.0915	L	0.48362	1.52	0.09310	N	1	B	0.31859	0.343	B	0.36504	0.226	T	0.32877	-0.9890	10	0.62326	D	0.03	.	5.1923	0.15216	0.1062:0.0:0.6884:0.2054	.	301	Q8NGP2	OR8J1_HUMAN	S	301	ENSP00000304060:A301S	ENSP00000304060:A301S	A	+	1	0	OR8J1	55885199	0.008000	0.16893	0.986000	0.45419	0.015000	0.08874	0.265000	0.18515	2.243000	0.73865	0.549000	0.68633	GCT	OR8J1	-	NULL	ENSG00000172487		0.368	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8J1	HGNC	protein_coding	OTTHUMT00000391606.2	34	0.00	0	G	NM_001005205		56128623	56128623	+1	no_errors	ENST00000303039	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	0.236	T
OVGP1	5016	genome.wustl.edu	37	1	111962288	111962288	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:111962288C>T	ENST00000369732.3	-	9	1019	c.964G>A	c.(964-966)Gcc>Acc	p.A322T	OVGP1_ENST00000481495.1_5'UTR|OVGP1_ENST00000540696.1_Missense_Mutation_p.M163I	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	322					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CCCTTGTTGGCATACGGGACA	0.502																																						dbGAP											0													222.0	194.0	203.0					1																	111962288		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.964G>A	1.37:g.111962288C>T	ENSP00000358747:p.Ala322Thr		A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.A322T	ENST00000369732.3	37	c.964	CCDS834.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.215641|5.215641	0.95104|0.95104	.|.	.|.	ENSG00000085465|ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331|ENST00000540696	T|T	0.49139|0.21191	0.79|2.02	5.12|5.12	5.12|5.12	0.69794|0.69794	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, superfamily (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.21186|0.21186	0.0510|0.0510	M|M	0.65498|0.65498	2.005|2.005	0.30127|0.30127	N|N	0.805206|0.805206	D;D|.	0.89917|.	0.966;1.0|.	D;D|.	0.91635|.	0.911;0.999|.	T|T	0.09684|0.09684	-1.0663|-1.0663	10|7	0.72032|0.21540	D|T	0.01|0.41	-23.2611|-23.2611	16.0739|16.0739	0.80955|0.80955	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	322;386|.	Q12889;Q59HH5|.	OVGP1_HUMAN;.|.	T|I	322;386;130|163	ENSP00000358747:A322T|ENSP00000438449:M163I	ENSP00000358743:A386T|ENSP00000438449:M163I	A|M	-|-	1|3	0|0	OVGP1|OVGP1	111763811|111763811	1.000000|1.000000	0.71417|0.71417	0.885000|0.885000	0.34714|0.34714	0.978000|0.978000	0.69477|0.69477	6.775000|6.775000	0.75018|0.75018	2.657000|2.657000	0.90304|0.90304	0.591000|0.591000	0.81541|0.81541	GCC|ATG	OVGP1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000085465		0.502	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	HGNC	protein_coding	OTTHUMT00000032461.1	80	0.00	0	C	NM_002557		111962288	111962288	-1	no_errors	ENST00000369732	ensembl	human	known	69_37n	missense	30	11.43	4	SNP	1.000	T
OXT	5020	genome.wustl.edu	37	20	3052805	3052805	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:3052805G>A	ENST00000217386.2	+	2	239	c.203G>A	c.(202-204)gGc>gAc	p.G68D		NM_000915.2	NP_000906.1	P01178	NEU1_HUMAN	oxytocin/neurophysin I prepropeptide	68					drinking behavior (GO:0042756)|eating behavior (GO:0042755)|female pregnancy (GO:0007565)|grooming behavior (GO:0007625)|heart development (GO:0007507)|hyperosmotic salinity response (GO:0042538)|male mating behavior (GO:0060179)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|memory (GO:0007613)|negative regulation of blood pressure (GO:0045776)|negative regulation of gastric acid secretion (GO:0060455)|negative regulation of urine volume (GO:0035811)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of female receptivity (GO:0045925)|positive regulation of hindgut contraction (GO:0060450)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of ossification (GO:0045778)|positive regulation of penile erection (GO:0060406)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of heart rate (GO:0002027)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ether (GO:0045472)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|response to prostaglandin E (GO:0034695)|response to retinoic acid (GO:0032526)|response to sucrose (GO:0009744)|signal transduction (GO:0007165)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)				lung(2)	2					Oxytocin(DB00107)	TGCTTCGTGGGCACCGCCGAA	0.741																																						dbGAP											0													7.0	9.0	8.0					20																	3052805		2145	4206	6351	-	-	-	SO:0001583	missense	0				CCDS13044.1	20p13	2013-02-28	2012-10-23		ENSG00000101405	ENSG00000101405		"""Endogenous ligands"""	8528	protein-coding gene	gene with protein product	"""oxytocin"", ""neurophysin I"""	167050	"""oxytocin, prepro- (neurophysin I)"", ""oxytocin, prepropeptide"""	OT			Standard	NM_000915		Approved	OXT-NPI, OT-NPI	uc002wht.1	P01178	OTTHUMG00000031724	ENST00000217386.2:c.203G>A	20.37:g.3052805G>A	ENSP00000217386:p.Gly68Asp		Q3MIG0	Missense_Mutation	SNP	pfam_Neurhyp_horm,superfamily_Neurhyp_horm,smart_Neurhyp_horm,pirsf_Neurhyp_horm,prints_Neurhyp_horm	p.G68D	ENST00000217386.2	37	c.203	CCDS13044.1	20	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755747	0.89843	.	.	ENSG00000101405	ENST00000217386	D	0.98280	-4.84	4.49	3.51	0.40186	.	0.050849	0.85682	D	0.000000	D	0.99083	0.9685	M	0.92317	3.295	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.99482	1.0948	10	0.87932	D	0	-35.1023	14.2614	0.66088	0.0:0.1502:0.8498:0.0	.	68	P01178	NEU1_HUMAN	D	68	ENSP00000217386:G68D	ENSP00000217386:G68D	G	+	2	0	OXT	3000805	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	7.371000	0.79600	0.835000	0.34877	0.491000	0.48974	GGC	OXT	-	pfam_Neurhyp_horm,superfamily_Neurhyp_horm,smart_Neurhyp_horm,pirsf_Neurhyp_horm,prints_Neurhyp_horm	ENSG00000101405		0.741	OXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXT	HGNC	protein_coding	OTTHUMT00000077698.2	12	0.00	0	G	NM_000915		3052805	3052805	+1	no_errors	ENST00000217386	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	1.000	A
PARM1	25849	genome.wustl.edu	37	4	75937958	75937958	+	Nonsense_Mutation	SNP	G	G	T	rs11552358		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:75937958G>T	ENST00000307428.7	+	2	579	c.367G>T	c.(367-369)Gag>Tag	p.E123*	PARM1_ENST00000513238.1_Intron|RP11-44F21.2_ENST00000513770.1_RNA	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	123				E -> K (in Ref. 4; AAH13294). {ECO:0000305}.	positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						AACCACGTTGGAGGAACACAG	0.587																																						dbGAP											0													142.0	147.0	145.0					4																	75937958		2123	4230	6353	-	-	-	SO:0001587	stop_gained	0			AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.367G>T	4.37:g.75937958G>T	ENSP00000370224:p.Glu123*		B3KMQ9|Q96DV8|Q9Y4S1	Nonsense_Mutation	SNP	NULL	p.E123*	ENST00000307428.7	37	c.367	CCDS47077.1	4	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669960	0.88348	.	.	ENSG00000169116	ENST00000307428	.	.	.	5.34	1.87	0.25490	.	1.333470	0.04772	N	0.428231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	0.3619	8.0104	0.30351	0.1848:0.0:0.8152:0.0	.	.	.	.	X	123	.	ENSP00000370224:E123X	E	+	1	0	PARM1	76156982	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.277000	0.08502	-0.011000	0.14247	0.563000	0.77884	GAG	PARM1	-	NULL	ENSG00000169116		0.587	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARM1	HGNC	protein_coding	OTTHUMT00000362494.1	49	0.00	0	G	NM_015393		75937958	75937958	+1	no_errors	ENST00000307428	ensembl	human	known	69_37n	nonsense	26	10.34	3	SNP	0.000	T
PCGF1	84759	genome.wustl.edu	37	2	74734188	74734188	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:74734188G>A	ENST00000233630.6	-	2	1091	c.180C>T	c.(178-180)atC>atT	p.I60I	PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000548978.2_RNA|LBX2-AS1_ENST00000603175.1_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	60					histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						GACACTCTGTGATGGTGGTGG	0.522																																						dbGAP											0													161.0	147.0	151.0					2																	74734188		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.180C>T	2.37:g.74734188G>A			Q7Z506	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I60	ENST00000233630.6	37	c.180	CCDS1946.2	2																																																																																			PCGF1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000115289		0.522	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF1	HGNC	protein_coding	OTTHUMT00000252216.1	93	0.00	0	G	NM_032673		74734188	74734188	-1	no_errors	ENST00000233630	ensembl	human	known	69_37n	silent	41	25.45	14	SNP	0.996	A
PCGF1	84759	genome.wustl.edu	37	2	74734188	74734188	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:74734188G>A	ENST00000233630.6	-	2	1091	c.180C>T	c.(178-180)atC>atT	p.I60I	PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000548978.2_RNA|LBX2-AS1_ENST00000603175.1_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	60					histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						GACACTCTGTGATGGTGGTGG	0.522																																						dbGAP											0													161.0	147.0	151.0					2																	74734188		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.180C>T	2.37:g.74734188G>A			Q7Z506	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I60	ENST00000233630.6	37	c.180	CCDS1946.2	2																																																																																			PCGF1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000115289		0.522	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF1	HGNC	protein_coding	OTTHUMT00000252216.1	63	0.00	0	G	NM_032673		74734188	74734188	-1	no_errors	ENST00000233630	ensembl	human	known	69_37n	silent	41	37.88	25	SNP	0.996	A
PCGF1	84759	genome.wustl.edu	37	2	74734188	74734188	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:74734188G>A	ENST00000233630.6	-	2	1091	c.180C>T	c.(178-180)atC>atT	p.I60I	PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000548978.2_RNA|LBX2-AS1_ENST00000603175.1_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	60					histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						GACACTCTGTGATGGTGGTGG	0.522																																						dbGAP											0													161.0	147.0	151.0					2																	74734188		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.180C>T	2.37:g.74734188G>A			Q7Z506	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I60	ENST00000233630.6	37	c.180	CCDS1946.2	2																																																																																			PCGF1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000115289		0.522	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF1	HGNC	protein_coding	OTTHUMT00000252216.1	93	0.00	0	G	NM_032673		74734188	74734188	-1	no_errors	ENST00000233630	ensembl	human	known	69_37n	silent	59	27.16	22	SNP	0.996	A
PCNXL2	80003	genome.wustl.edu	37	1	233394705	233394705	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:233394705G>T	ENST00000258229.9	-	5	1137	c.903C>A	c.(901-903)agC>agA	p.S301R	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	301						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GAGGTGACTTGCTTTGTACCC	0.552																																						dbGAP											0													72.0	74.0	73.0					1																	233394705		2041	4191	6232	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.903C>A	1.37:g.233394705G>T	ENSP00000258229:p.Ser301Arg		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.S301R	ENST00000258229.9	37	c.903	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348262	0.24426	.	.	ENSG00000135749	ENST00000258229	T	0.63255	-0.03	4.23	1.2	0.21068	.	.	.	.	.	T	0.40094	0.1103	N	0.24115	0.695	0.09310	N	0.999999	B	0.28713	0.22	B	0.23275	0.045	T	0.26849	-1.0091	9	0.48119	T	0.1	.	2.0845	0.03642	0.1883:0.1553:0.4969:0.1595	.	301	A6NKB5	PCX2_HUMAN	R	301	ENSP00000258229:S301R	ENSP00000258229:S301R	S	-	3	2	PCNXL2	231461328	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.300000	0.19156	0.139000	0.18822	0.555000	0.69702	AGC	PCNXL2	-	NULL	ENSG00000135749		0.552	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	57	0.00	0	G	NM_014801		233394705	233394705	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.000	T
PCYT2	5833	genome.wustl.edu	37	17	79865456	79865456	+	Missense_Mutation	SNP	G	G	A	rs544541474		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:79865456G>A	ENST00000538936.2	-	6	619	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W	PCYT2_ENST00000538721.2_Missense_Mutation_p.R171W|PCYT2_ENST00000331285.3_Missense_Mutation_p.R93W|PCYT2_ENST00000570388.1_Missense_Mutation_p.R93W|PCYT2_ENST00000570391.1_Missense_Mutation_p.R139W|PCYT2_ENST00000571105.1_Missense_Mutation_p.R171W	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	171					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	GCATACTCCCGGTACTCAGAG	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		19725	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													53.0	39.0	43.0					17																	79865456		2203	4296	6499	-	-	-	SO:0001583	missense	0			D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.511C>T	17.37:g.79865456G>A	ENSP00000439245:p.Arg171Trp		B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	p.R171W	ENST00000538936.2	37	c.511	CCDS11791.1	17	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277054	0.59758	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	.	.	.	4.34	3.33	0.38152	.	0.265315	0.38492	N	0.001672	T	0.51058	0.1652	N	0.22421	0.69	0.45837	D	0.998705	D;D;D;D;D	0.76494	0.994;0.995;0.999;0.997;0.994	P;P;P;P;P	0.57776	0.696;0.586;0.827;0.586;0.613	T	0.54105	-0.8343	9	0.72032	D	0.01	-33.3297	10.5268	0.44954	0.0:0.0:0.8056:0.1944	.	139;139;171;93;171	B7Z4W6;B7ZAS0;F5H8B1;B7Z7A5;Q99447	.;.;.;.;PCY2_HUMAN	W	171;171;93	.	ENSP00000331719:R93W	R	-	1	2	PCYT2	77458748	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	3.404000	0.52623	0.974000	0.38366	0.561000	0.74099	CGG	PCYT2	-	NULL	ENSG00000185813		0.667	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT2	HGNC	protein_coding	OTTHUMT00000439939.1	77	0.00	0	G	NM_002861		79865456	79865456	-1	no_errors	ENST00000538721	ensembl	human	known	69_37n	missense	17	14.29	3	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	32090982	32090982	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:32090982C>T	ENST00000438447.1	+	20	7816	c.7428C>T	c.(7426-7428)ccC>ccT	p.P2476P	PDZD2_ENST00000282493.3_Silent_p.P2476P			O15018	PDZD2_HUMAN	PDZ domain containing 2	2476					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGCCCTCGCCCGTGTCCCGCT	0.592																																						dbGAP											0													61.0	60.0	60.0					5																	32090982		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7428C>T	5.37:g.32090982C>T			Q9BXD4	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P2476	ENST00000438447.1	37	c.7428	CCDS34137.1	5																																																																																			PDZD2	-	NULL	ENSG00000133401		0.592	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	31	0.00	0	C			32090982	32090982	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	silent	15	16.67	3	SNP	0.000	T
PHC2	1912	genome.wustl.edu	37	1	33799862	33799862	+	Silent	SNP	G	G	A	rs370099521		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:33799862G>A	ENST00000257118.5	-	9	1640	c.1587C>T	c.(1585-1587)acC>acT	p.T529T	PHC2_ENST00000431992.1_Silent_p.T500T|PHC2_ENST00000485928.1_5'UTR|MIR3605_ENST00000583214.1_RNA|PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000373422.3_Silent_p.T135T|RN7SKP16_ENST00000410180.1_RNA|PHC2_ENST00000373418.3_5'UTR|PHC2_ENST00000419414.2_Silent_p.T530T	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	529					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCTGAGGTCGGTCAGTGCAT	0.592																																						dbGAP											0													107.0	103.0	105.0					1																	33799862		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1587C>T	1.37:g.33799862G>A			A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.T530	ENST00000257118.5	37	c.1590	CCDS378.1	1																																																																																			PHC2	-	NULL	ENSG00000134686		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	41	0.00	0	G	NM_198040		33799862	33799862	-1	no_errors	ENST00000419414	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	1.000	A
PHKA2	5256	genome.wustl.edu	37	X	18912444	18912444	+	Missense_Mutation	SNP	G	G	T	rs371835709		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:18912444G>T	ENST00000379942.4	-	32	4080	c.3415C>A	c.(3415-3417)Ctg>Atg	p.L1139M	PHKA2-AS1_ENST00000452900.1_RNA|PHKA2_ENST00000481718.1_5'UTR|PHKA2-AS1_ENST00000439295.1_RNA	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1139					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TCCACCAGCAGCTGCCGGTAC	0.607																																						dbGAP											0													81.0	63.0	69.0					X																	18912444		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3415C>A	X.37:g.18912444G>T	ENSP00000369274:p.Leu1139Met		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.L1139M	ENST00000379942.4	37	c.3415	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601120	0.87055	.	.	ENSG00000044446	ENST00000379942	D	0.95412	-3.7	5.37	4.51	0.55191	.	0.000000	0.85682	D	0.000000	D	0.97219	0.9091	M	0.76938	2.355	0.80722	D	1	D	0.69078	0.997	D	0.68192	0.956	D	0.97079	0.9783	10	0.59425	D	0.04	-11.4766	13.6948	0.62572	0.077:0.0:0.923:0.0	.	1139	P46019	KPB2_HUMAN	M	1139	ENSP00000369274:L1139M	ENSP00000369274:L1139M	L	-	1	2	PHKA2	18822365	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.067000	0.57527	1.018000	0.39521	0.529000	0.55759	CTG	PHKA2	-	NULL	ENSG00000044446		0.607	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	76	0.00	0	G	NM_000292		18912444	18912444	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	75	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	95	23.81	30	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	89	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	54	34.15	28	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	75	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	48	32.39	23	SNP	1.000	A
PITPNB	23760	genome.wustl.edu	37	22	28292596	28292596	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:28292596C>A	ENST00000335272.5	-	6	392	c.316G>T	c.(316-318)Gat>Tat	p.D106Y	PITPNB_ENST00000455418.3_Missense_Mutation_p.D108Y|PITPNB_ENST00000320996.10_Missense_Mutation_p.D106Y	NM_012399.3	NP_036531.1	P48739	PIPNB_HUMAN	phosphatidylinositol transfer protein, beta	106					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|lipid metabolic process (GO:0006629)|phospholipid metabolic process (GO:0006644)|phospholipid transport (GO:0015914)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	lipid binding (GO:0008289)			large_intestine(4)|lung(3)|skin(1)	8						ATGAAGAAATCATCTTTCATA	0.388																																						dbGAP											0													86.0	80.0	82.0					22																	28292596		2203	4297	6500	-	-	-	SO:0001583	missense	0			D30037	CCDS13842.1, CCDS63433.1	22q12.1	2006-12-15			ENSG00000180957	ENSG00000180957			9002	protein-coding gene	gene with protein product		606876				10591208	Standard	NM_012399		Approved	VIB1B	uc003adk.3	P48739	OTTHUMG00000150976	ENST00000335272.5:c.316G>T	22.37:g.28292596C>A	ENSP00000334738:p.Asp106Tyr		B3KYB8|B7Z7Q0|Q8N5W1	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.D108Y	ENST00000335272.5	37	c.322	CCDS13842.1	22	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175045	0.78564	.	.	ENSG00000180957	ENST00000335272;ENST00000320996;ENST00000455418;ENST00000415296;ENST00000436663	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.86;0.86	5.95	5.95	0.96441	START-like domain (1);	0.041576	0.85682	D	0.000000	T	0.67785	0.2930	M	0.83692	2.655	0.80722	D	1	P;P;P	0.49447	0.912;0.893;0.924	P;P;P	0.54346	0.749;0.633;0.749	T	0.70761	-0.4784	10	0.66056	D	0.02	-27.334	18.957	0.92662	0.0:1.0:0.0:0.0	.	108;106;106	B7Z7Q0;P48739-2;P48739	.;.;PIPNB_HUMAN	Y	106;106;108;33;108	ENSP00000334738:D106Y;ENSP00000321266:D106Y;ENSP00000405179:D108Y;ENSP00000406542:D33Y;ENSP00000403675:D108Y	ENSP00000321266:D106Y	D	-	1	0	PITPNB	26622596	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.570000	0.60872	2.824000	0.97209	0.655000	0.94253	GAT	PITPNB	-	pfam_PI_transfer	ENSG00000180957		0.388	PITPNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITPNB	HGNC	protein_coding	OTTHUMT00000320740.1	38	0.00	0	C			28292596	28292596	-1	no_errors	ENST00000455418	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	A
PLAC8	51316	genome.wustl.edu	37	4	84026073	84026073	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:84026073G>T	ENST00000509973.1	-	2	171	c.48C>A	c.(46-48)ctC>ctA	p.L16L	PLAC8_ENST00000426923.2_Silent_p.L73L|PLAC8_ENST00000505406.1_Silent_p.L73L|PLAC8_ENST00000411416.2_Silent_p.L73L|PLAC8_ENST00000311507.4_Silent_p.L73L|PLAC8_ENST00000515389.1_Intron			Q9UHV8	PP13_HUMAN	placenta-specific 8	0	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)			large_intestine(2)|lung(3)|ovary(1)	6		Hepatocellular(203;0.114)				GGGTCCTGTAGAGAGTCCTCA	0.438																																						dbGAP											0													124.0	116.0	119.0					4																	84026073		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF208846	CCDS3601.1	4q21.22	2006-05-20			ENSG00000145287	ENSG00000145287			19254	protein-coding gene	gene with protein product		607515				12758124, 12384430	Standard	NM_016619		Approved	onzin, C15	uc003hoe.3	Q9NZF1	OTTHUMG00000130294	ENST00000509973.1:c.48C>A	4.37:g.84026073G>T			C5HZ15	Silent	SNP	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	p.L73	ENST00000509973.1	37	c.219		4																																																																																			PLAC8	-	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	ENSG00000145287		0.438	PLAC8-003	PUTATIVE	basic|exp_conf	protein_coding	PLAC8	HGNC	protein_coding	OTTHUMT00000363078.1	51	0.00	0	G	NM_016619		84026073	84026073	-1	no_errors	ENST00000311507	ensembl	human	known	69_37n	silent	35	10.26	4	SNP	1.000	T
PLVAP	83483	genome.wustl.edu	37	19	17476399	17476399	+	Missense_Mutation	SNP	G	G	T	rs374123136		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:17476399G>T	ENST00000252590.4	-	3	936	c.875C>A	c.(874-876)gCg>gAg	p.A292E	CTD-2278I10.1_ENST00000597592.1_RNA	NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	292					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCGATATCCGCCCGGAGGCT	0.662																																						dbGAP											0													30.0	31.0	31.0					19																	17476399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.875C>A	19.37:g.17476399G>T	ENSP00000252590:p.Ala292Glu		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.A292E	ENST00000252590.4	37	c.875	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	G	0.193	-1.051214	0.01981	.	.	ENSG00000130300	ENST00000252590	.	.	.	5.41	-1.89	0.07689	.	1.163780	0.06098	N	0.664820	T	0.28167	0.0695	L	0.29908	0.895	0.09310	N	1	B	0.29612	0.251	B	0.32342	0.144	T	0.23655	-1.0182	9	0.07325	T	0.83	-3.8446	9.8994	0.41338	0.3976:0.0:0.6024:0.0	.	292	Q9BX97	PLVAP_HUMAN	E	292	.	ENSP00000252590:A292E	A	-	2	0	PLVAP	17337399	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.503000	0.06383	0.011000	0.14865	-1.901000	0.00528	GCG	PLVAP	-	pfam_PV-1	ENSG00000130300		0.662	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	72	0.00	0	G	NM_031310		17476399	17476399	-1	no_errors	ENST00000252590	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	0.000	T
PLVAP	83483	genome.wustl.edu	37	19	17476399	17476399	+	Missense_Mutation	SNP	G	G	T	rs374123136		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr19:17476399G>T	ENST00000252590.4	-	3	936	c.875C>A	c.(874-876)gCg>gAg	p.A292E	CTD-2278I10.1_ENST00000597592.1_RNA	NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	292					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCGATATCCGCCCGGAGGCT	0.662																																						dbGAP											0													30.0	31.0	31.0					19																	17476399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.875C>A	19.37:g.17476399G>T	ENSP00000252590:p.Ala292Glu		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.A292E	ENST00000252590.4	37	c.875	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	G	0.193	-1.051214	0.01981	.	.	ENSG00000130300	ENST00000252590	.	.	.	5.41	-1.89	0.07689	.	1.163780	0.06098	N	0.664820	T	0.28167	0.0695	L	0.29908	0.895	0.09310	N	1	B	0.29612	0.251	B	0.32342	0.144	T	0.23655	-1.0182	9	0.07325	T	0.83	-3.8446	9.8994	0.41338	0.3976:0.0:0.6024:0.0	.	292	Q9BX97	PLVAP_HUMAN	E	292	.	ENSP00000252590:A292E	A	-	2	0	PLVAP	17337399	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.503000	0.06383	0.011000	0.14865	-1.901000	0.00528	GCG	PLVAP	-	pfam_PV-1	ENSG00000130300		0.662	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	23	0.00	0	G	NM_031310		17476399	17476399	-1	no_errors	ENST00000252590	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.000	T
PLVAP	83483	genome.wustl.edu	37	19	17476399	17476399	+	Missense_Mutation	SNP	G	G	T	rs374123136		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:17476399G>T	ENST00000252590.4	-	3	936	c.875C>A	c.(874-876)gCg>gAg	p.A292E	CTD-2278I10.1_ENST00000597592.1_RNA	NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	292					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCGATATCCGCCCGGAGGCT	0.662																																						dbGAP											0													30.0	31.0	31.0					19																	17476399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.875C>A	19.37:g.17476399G>T	ENSP00000252590:p.Ala292Glu		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.A292E	ENST00000252590.4	37	c.875	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	G	0.193	-1.051214	0.01981	.	.	ENSG00000130300	ENST00000252590	.	.	.	5.41	-1.89	0.07689	.	1.163780	0.06098	N	0.664820	T	0.28167	0.0695	L	0.29908	0.895	0.09310	N	1	B	0.29612	0.251	B	0.32342	0.144	T	0.23655	-1.0182	9	0.07325	T	0.83	-3.8446	9.8994	0.41338	0.3976:0.0:0.6024:0.0	.	292	Q9BX97	PLVAP_HUMAN	E	292	.	ENSP00000252590:A292E	A	-	2	0	PLVAP	17337399	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.503000	0.06383	0.011000	0.14865	-1.901000	0.00528	GCG	PLVAP	-	pfam_PV-1	ENSG00000130300		0.662	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	72	0.00	0	G	NM_031310		17476399	17476399	-1	no_errors	ENST00000252590	ensembl	human	known	69_37n	missense	52	33.33	26	SNP	0.000	T
POLDIP2	26073	genome.wustl.edu	37	17	26677486	26677486	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:26677486C>T	ENST00000540200.1	-	10	886	c.887G>A	c.(886-888)cGa>cAa	p.R296Q	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	297	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CCCTCGGCCTCGCACTGTCTC	0.567																																						dbGAP											0													59.0	62.0	61.0					17																	26677486		2032	4183	6215	-	-	-	SO:0001583	missense	0			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.887G>A	17.37:g.26677486C>T	ENSP00000475924:p.Arg296Gln		B2R846|Q96JE4	RNA	SNP	-	NULL	ENST00000540200.1	37	NULL		17																																																																																			POLDIP2	-	-	ENSG00000004142		0.567	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	POLDIP2	HGNC	protein_coding		46	0.00	0	C	NM_015584		26677486	26677486	-1	no_errors	ENST00000003607	ensembl	human	known	69_37n	rna	23	11.11	3	SNP	1.000	T
POLQ	10721	genome.wustl.edu	37	3	121206758	121206758	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:121206758C>A	ENST00000264233.5	-	16	5148	c.5020G>T	c.(5020-5022)Gag>Tag	p.E1674*		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1674					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCATTTAACTCTGTATTTTTT	0.294								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	dbGAP											0													52.0	57.0	55.0					3																	121206758		2195	4294	6489	-	-	-	SO:0001587	stop_gained	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.5020G>T	3.37:g.121206758C>A	ENSP00000264233:p.Glu1674*		O95160|Q6VMB5	Nonsense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.E1674*	ENST00000264233.5	37	c.5020	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	C	41	8.824104	0.98968	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	.	.	.	6.06	3.32	0.38043	.	0.694197	0.14769	N	0.299517	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	9.6921	0.40134	0.0:0.7559:0.1173:0.1269	.	.	.	.	X	1297;1674;1810	.	ENSP00000264233:E1674X	E	-	1	0	POLQ	122689448	0.000000	0.05858	0.027000	0.17364	0.200000	0.23975	0.422000	0.21296	0.449000	0.26747	0.655000	0.94253	GAG	POLQ	-	NULL	ENSG00000051341		0.294	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	33	0.00	0	C	NM_199420		121206758	121206758	-1	no_errors	ENST00000264233	ensembl	human	known	69_37n	nonsense	27	12.50	4	SNP	0.005	A
PPP1R12C	54776	genome.wustl.edu	37	19	55614936	55614936	+	Splice_Site	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:55614936C>A	ENST00000263433.3	-	4	587	c.572G>T	c.(571-573)gGt>gTt	p.G191V	PPP1R12C_ENST00000376393.2_Splice_Site_p.G191V|PPP1R12C_ENST00000435544.2_Splice_Site_p.G117V	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CACATCCACACCTAGGAGGAT	0.607																																						dbGAP											0													43.0	35.0	38.0					19																	55614936		2202	4294	6496	-	-	-	SO:0001630	splice_region_variant	0			AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.572-1G>T	19.37:g.55614936C>A				Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G191V	ENST00000263433.3	37	c.572	CCDS12916.1	19	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727890	0.48833	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.60171	0.21;0.21;0.21	5.25	5.25	0.73442	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.84183	0.5416	H	0.96861	3.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.984;0.991	D	0.89384	0.3684	10	0.87932	D	0	.	16.7181	0.85402	0.0:1.0:0.0:0.0	.	117;191;191	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	V	191;191;117	ENSP00000263433:G191V;ENSP00000365573:G191V;ENSP00000387833:G117V	ENSP00000263433:G191V	G	-	2	0	PPP1R12C	60306748	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	5.568000	0.67385	2.619000	0.88677	0.650000	0.86243	GGT	PPP1R12C	-	pirsf_Pase-1_reg_su_12A/B/C_euk,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000125503		0.607	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12C	HGNC	protein_coding	OTTHUMT00000451814.2	50	0.00	0	C	NM_017607	Missense_Mutation	55614936	55614936	-1	no_errors	ENST00000263433	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	1.000	A
PPP1R1A	5502	genome.wustl.edu	37	12	54975905	54975905	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:54975905C>A	ENST00000257905.8	-	5	428	c.258G>T	c.(256-258)atG>atT	p.M86I	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	86					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						GTTCAACCATCATCTGGAGCT	0.602																																						dbGAP											0													33.0	36.0	35.0					12																	54975905		1928	4137	6065	-	-	-	SO:0001583	missense	0			U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.258G>T	12.37:g.54975905C>A	ENSP00000257905:p.Met86Ile		Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	pfam_PPI_1DARPP-32	p.M86I	ENST00000257905.8	37	c.258	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172943	0.38413	.	.	ENSG00000135447	ENST00000257905	T	0.29142	1.58	5.54	3.7	0.42460	.	0.574204	0.17876	N	0.159013	T	0.25344	0.0616	L	0.46157	1.445	0.24121	N	0.995808	B	0.24317	0.101	B	0.25614	0.062	T	0.18650	-1.0330	10	0.22706	T	0.39	.	9.0383	0.36302	0.0:0.8298:0.0:0.1702	.	86	Q13522	PPR1A_HUMAN	I	86	ENSP00000257905:M86I	ENSP00000257905:M86I	M	-	3	0	PPP1R1A	53262172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.588000	0.23924	0.806000	0.34183	0.655000	0.94253	ATG	PPP1R1A	-	pfam_PPI_1DARPP-32	ENSG00000135447		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406604.1	53	0.00	0	C	NM_006741		54975905	54975905	-1	no_errors	ENST00000257905	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
PPP1R9A	55607	genome.wustl.edu	37	7	94898540	94898540	+	Intron	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:94898540C>T	ENST00000433881.1	+	12	3289				PPP1R9A_ENST00000340694.4_Intron|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.H927Y|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.H949Y|PPP1R9A_ENST00000289495.5_Intron|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.H927Y			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TTTCTATAACCACATGCATAT	0.403										HNSCC(28;0.073)																												dbGAP											0													70.0	64.0	66.0					7																	94898540		1568	3581	5149	-	-	-	SO:0001627	intron_variant	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2757+521C>T	7.37:g.94898540C>T			A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_Smac_DIABLO-like,smart_PDZ,pfscan_PDZ	p.H927Y	ENST00000433881.1	37	c.2779	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541064	0.45280	.	.	ENSG00000158528	ENST00000433360;ENST00000424654;ENST00000456331	T;T;T	0.14144	2.53;2.53;2.53	4.43	4.43	0.53597	.	.	.	.	.	T	0.11665	0.0284	N	0.14661	0.345	0.21064	N	0.999797	P;P	0.40476	0.718;0.596	B;B	0.41036	0.346;0.188	T	0.21861	-1.0233	9	0.45353	T	0.12	.	16.5031	0.84262	0.0:1.0:0.0:0.0	.	949;927	E9PDX1;E9PCK6	.;.	Y	949;927;927	ENSP00000405514:H949Y;ENSP00000411342:H927Y;ENSP00000402893:H927Y	ENSP00000411342:H927Y	H	+	1	0	PPP1R9A	94736476	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.384000	0.52478	2.746000	0.94184	0.591000	0.81541	CAC	PPP1R9A	-	NULL	ENSG00000158528		0.403	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	36	0.00	0	C	NM_001166160		94898540	94898540	+1	no_errors	ENST00000456331	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	1.000	T
PRDM15	63977	genome.wustl.edu	37	21	43248563	43248563	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:43248563C>T	ENST00000269844.3	-	19	2701	c.2591G>A	c.(2590-2592)cGc>cAc	p.R864H	PRDM15_ENST00000538201.1_Missense_Mutation_p.R518H|PRDM15_ENST00000447207.2_Missense_Mutation_p.R498H|PRDM15_ENST00000422911.1_Missense_Mutation_p.R555H|PRDM15_ENST00000398548.1_Missense_Mutation_p.R535H	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	864					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R864L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GACGTCCTTGCGGTAGAACAT	0.612																																						dbGAP											1	Substitution - Missense(1)	lung(1)											294.0	248.0	264.0					21																	43248563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2591G>A	21.37:g.43248563C>T	ENSP00000269844:p.Arg864His		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.R864H	ENST00000269844.3	37	c.2591	CCDS13676.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	32|32	5.140128|5.140128	0.94560|0.94560	.|.	.|.	ENSG00000141956|ENSG00000141956	ENST00000380489|ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	.|T;T;T;T;T	.|0.29397	.|1.57;1.57;1.57;1.57;1.57	4.46|4.46	4.46|4.46	0.54185|0.54185	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.45155|0.45155	0.1328|0.1328	L|L	0.35414|0.35414	1.06|1.06	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.998;0.999	T|T	0.41662|0.41662	-0.9496|-0.9496	6|9	0.12766|0.49607	T|T	0.61|0.09	-10.3847|-10.3847	16.4845|16.4845	0.84181|0.84181	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|864;555;535	.|P57071;E9PDJ6;E9PF37	.|PRD15_HUMAN;.;.	T|H	501|555;535;518;498;864	.|ENSP00000408592:R555H;ENSP00000381556:R535H;ENSP00000444044:R518H;ENSP00000390245:R498H;ENSP00000269844:R864H	ENSP00000369856:A501T|ENSP00000269844:R864H	A|R	-|-	1|2	0|0	PRDM15|PRDM15	42121632|42121632	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.251000|7.251000	0.78297|0.78297	2.186000|2.186000	0.69663|0.69663	0.556000|0.556000	0.70494|0.70494	GCA|CGC	PRDM15	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000141956		0.612	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		90	0.00	0	C	NM_022115		43248563	43248563	-1	no_errors	ENST00000269844	ensembl	human	known	69_37n	missense	34	10.26	4	SNP	1.000	T
PRKAG3	53632	genome.wustl.edu	37	2	219692583	219692583	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:219692583C>T	ENST00000529249.1	-	7	1108	c.793G>A	c.(793-795)Gaa>Aaa	p.E265K	PRKAG3_ENST00000545803.1_Missense_Mutation_p.E81K|PRKAG3_ENST00000392098.3_Intron|PRKAG3_ENST00000439262.2_Missense_Mutation_p.E240K			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	265					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	TTATGTTGTTCAATCTCATAG	0.572																																						dbGAP											0													99.0	105.0	103.0					2																	219692583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.793G>A	2.37:g.219692583C>T	ENSP00000436068:p.Glu265Lys		Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.E265K	ENST00000529249.1	37	c.793	CCDS2424.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.110589	0.94292	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249	D;D;D	0.91945	-2.94;-2.94;-2.94	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98137	1.0434	10	0.66056	D	0.02	-8.9353	16.1833	0.81925	0.0:1.0:0.0:0.0	.	265	Q9UGI9	AAKG3_HUMAN	K	240;81;265	ENSP00000397133:E240K;ENSP00000444536:E81K;ENSP00000436068:E265K	ENSP00000233944:E265K	E	-	1	0	PRKAG3	219400827	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.627000	0.67784	2.283000	0.76528	0.655000	0.94253	GAA	PRKAG3	-	NULL	ENSG00000115592		0.572	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRKAG3	HGNC	protein_coding	OTTHUMT00000385992.1	82	0.00	0	C			219692583	219692583	-1	no_errors	ENST00000233944	ensembl	human	known	69_37n	missense	27	41.30	19	SNP	1.000	T
PRKAG3	53632	genome.wustl.edu	37	2	219692583	219692583	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr2:219692583C>T	ENST00000529249.1	-	7	1108	c.793G>A	c.(793-795)Gaa>Aaa	p.E265K	PRKAG3_ENST00000545803.1_Missense_Mutation_p.E81K|PRKAG3_ENST00000392098.3_Intron|PRKAG3_ENST00000439262.2_Missense_Mutation_p.E240K			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	265					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	TTATGTTGTTCAATCTCATAG	0.572																																						dbGAP											0													99.0	105.0	103.0					2																	219692583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.793G>A	2.37:g.219692583C>T	ENSP00000436068:p.Glu265Lys		Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.E265K	ENST00000529249.1	37	c.793	CCDS2424.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.110589	0.94292	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249	D;D;D	0.91945	-2.94;-2.94;-2.94	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98137	1.0434	10	0.66056	D	0.02	-8.9353	16.1833	0.81925	0.0:1.0:0.0:0.0	.	265	Q9UGI9	AAKG3_HUMAN	K	240;81;265	ENSP00000397133:E240K;ENSP00000444536:E81K;ENSP00000436068:E265K	ENSP00000233944:E265K	E	-	1	0	PRKAG3	219400827	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.627000	0.67784	2.283000	0.76528	0.655000	0.94253	GAA	PRKAG3	-	NULL	ENSG00000115592		0.572	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRKAG3	HGNC	protein_coding	OTTHUMT00000385992.1	102	0.00	0	C			219692583	219692583	-1	no_errors	ENST00000233944	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	1.000	T
PRKAG3	53632	genome.wustl.edu	37	2	219692583	219692583	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:219692583C>T	ENST00000529249.1	-	7	1108	c.793G>A	c.(793-795)Gaa>Aaa	p.E265K	PRKAG3_ENST00000545803.1_Missense_Mutation_p.E81K|PRKAG3_ENST00000392098.3_Intron|PRKAG3_ENST00000439262.2_Missense_Mutation_p.E240K			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	265					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	TTATGTTGTTCAATCTCATAG	0.572																																						dbGAP											0													99.0	105.0	103.0					2																	219692583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.793G>A	2.37:g.219692583C>T	ENSP00000436068:p.Glu265Lys		Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.E265K	ENST00000529249.1	37	c.793	CCDS2424.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.110589	0.94292	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249	D;D;D	0.91945	-2.94;-2.94;-2.94	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.97102	0.9053	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98137	1.0434	10	0.66056	D	0.02	-8.9353	16.1833	0.81925	0.0:1.0:0.0:0.0	.	265	Q9UGI9	AAKG3_HUMAN	K	240;81;265	ENSP00000397133:E240K;ENSP00000444536:E81K;ENSP00000436068:E265K	ENSP00000233944:E265K	E	-	1	0	PRKAG3	219400827	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.627000	0.67784	2.283000	0.76528	0.655000	0.94253	GAA	PRKAG3	-	NULL	ENSG00000115592		0.572	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRKAG3	HGNC	protein_coding	OTTHUMT00000385992.1	82	0.00	0	C			219692583	219692583	-1	no_errors	ENST00000233944	ensembl	human	known	69_37n	missense	50	29.58	21	SNP	1.000	T
PRUNE	58497	genome.wustl.edu	37	1	151006580	151006580	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:151006580C>A	ENST00000271620.3	+	8	1388	c.1232C>A	c.(1231-1233)cCc>cAc	p.P411H	BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368937.1_Missense_Mutation_p.P176H|BNIPL_ENST00000295294.7_5'Flank|PRUNE_ENST00000368934.1_Missense_Mutation_p.P176H|PRUNE_ENST00000271619.8_Missense_Mutation_p.P199H|PRUNE_ENST00000368936.1_Missense_Mutation_p.P229H|PRUNE_ENST00000368935.1_Missense_Mutation_p.P126H	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	411	Essential for homodimerization.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCCCCGACGCCCATGAACAGC	0.567																																						dbGAP											0													116.0	106.0	109.0					1																	151006580		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1232C>A	1.37:g.151006580C>A	ENSP00000271620:p.Pro411His		B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	pfam_DHHA2,pfam_Pesterase_RecJ	p.P411H	ENST00000271620.3	37	c.1232	CCDS977.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769248	0.90020	.	.	ENSG00000143363	ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000431193;ENST00000368936;ENST00000368935;ENST00000368934	T;T;T;T;T;T;T	0.74737	-0.11;-0.8;-0.87;-0.27;-0.72;-0.39;-0.87	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.74741	0.3756	L	0.29908	0.895	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71603	-0.4543	9	.	.	.	.	17.2626	0.87075	0.0:1.0:0.0:0.0	.	199;411	E9PCU1;Q86TP1	.;PRUNE_HUMAN	H	411;344;199;176;176;229;126;176	ENSP00000271620:P411H;ENSP00000271619:P199H;ENSP00000357933:P176H;ENSP00000392632:P176H;ENSP00000357932:P229H;ENSP00000357931:P126H;ENSP00000357930:P176H	.	P	+	2	0	PRUNE	149273204	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.527000	0.73803	2.941000	0.99782	0.655000	0.94253	CCC	PRUNE	-	NULL	ENSG00000143363		0.567	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRUNE	HGNC	protein_coding	OTTHUMT00000084885.1	49	0.00	0	C	NM_021222		151006580	151006580	+1	no_errors	ENST00000271620	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	A
PRRC2C	23215	genome.wustl.edu	37	1	171501813	171501813	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:171501813G>A	ENST00000338920.4	+	12	1817	c.1580G>A	c.(1579-1581)cGa>cAa	p.R527Q	PRRC2C_ENST00000392078.3_Missense_Mutation_p.R529Q|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R527Q|PRRC2C_ENST00000367742.3_Missense_Mutation_p.R529Q	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	527	Glu-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GAACAGGAGCGAgagaaggag	0.438																																						dbGAP											0													22.0	21.0	21.0					1																	171501813		2054	3935	5989	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1580G>A	1.37:g.171501813G>A	ENSP00000343629:p.Arg527Gln		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.R529Q	ENST00000338920.4	37	c.1586	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916239	0.33815	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	5.63	3.77	0.43336	.	1.125280	0.07049	N	0.831604	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B;B	0.23735	0.09;0.004	B;B	0.18263	0.021;0.003	T	0.38001	-0.9681	10	0.10902	T	0.67	.	12.4556	0.55702	0.1361:0.0:0.8639:0.0	.	527;529	Q9Y520-4;E7EPN9	.;.	Q	529;527;527;529;527;283;285	ENSP00000375928:R529Q;ENSP00000410219:R527Q;ENSP00000356716:R529Q;ENSP00000343629:R527Q	ENSP00000343629:R527Q	R	+	2	0	PRRC2C	169768437	0.005000	0.15991	0.628000	0.29241	0.667000	0.39255	0.084000	0.14891	0.751000	0.32900	-0.149000	0.13747	CGA	PRRC2C	-	NULL	ENSG00000117523		0.438	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	29	0.00	0	G	NM_015172		171501813	171501813	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.343	A
PTPN5	84867	genome.wustl.edu	37	11	18762218	18762218	+	Missense_Mutation	SNP	G	G	T	rs200242288		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:18762218G>T	ENST00000358540.2	-	8	1277	c.847C>A	c.(847-849)Cgt>Agt	p.R283S	PTPN5_ENST00000396170.1_Missense_Mutation_p.R251S|PTPN5_ENST00000477854.1_Missense_Mutation_p.R87S|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396171.4_Missense_Mutation_p.R283S|PTPN5_ENST00000396167.2_Missense_Mutation_p.R251S|PTPN5_ENST00000396168.1_Missense_Mutation_p.R259S|PTPN5_ENST00000496201.2_5'Flank	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	283					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						TGGAGGACACGGGAGGCGCTG	0.612																																						dbGAP											0													66.0	66.0	66.0					11																	18762218		2199	4293	6492	-	-	-	SO:0001583	missense	0			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.847C>A	11.37:g.18762218G>T	ENSP00000351342:p.Arg283Ser		B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R283S	ENST00000358540.2	37	c.847	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867034	0.51588	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73	5.14	4.16	0.48862	.	0.233756	0.36703	N	0.002450	T	0.23133	0.0559	L	0.45352	1.415	0.27764	N	0.943727	D;P	0.53151	0.958;0.915	B;B	0.41646	0.362;0.186	T	0.18335	-1.0340	10	0.66056	D	0.02	.	12.9835	0.58577	0.0:0.0:0.7557:0.2443	.	283;251	P54829;B3KXG7	PTN5_HUMAN;.	S	87;283;251;283;251;259	ENSP00000435056:R87S;ENSP00000351342:R283S;ENSP00000379473:R251S;ENSP00000379474:R283S;ENSP00000379470:R251S;ENSP00000379471:R259S	ENSP00000351342:R283S	R	-	1	0	PTPN5	18718794	0.993000	0.37304	0.997000	0.53966	0.985000	0.73830	2.080000	0.41586	2.398000	0.81561	0.655000	0.94253	CGT	PTPN5	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,prints_Tyr_Pase_KIM-con	ENSG00000110786		0.612	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	HGNC	protein_coding	OTTHUMT00000259196.2	90	0.00	0	G	NM_001039970		18762218	18762218	-1	no_errors	ENST00000358540	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.880	T
QSOX2	169714	genome.wustl.edu	37	9	139101011	139101011	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:139101011C>T	ENST00000358701.5	-	12	1697	c.1660G>A	c.(1660-1662)Gtg>Atg	p.V554M		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	554					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		AATGTGAGCACGTGGCCTTCA	0.592																																						dbGAP											0													96.0	102.0	100.0					9																	139101011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1660G>A	9.37:g.139101011C>T	ENSP00000351536:p.Val554Met		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.V554M	ENST00000358701.5	37	c.1660	CCDS35178.1	9	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871093	0.72065	.	.	ENSG00000165661	ENST00000358701	T	0.20332	2.08	4.91	4.91	0.64330	.	0.138983	0.46442	D	0.000291	T	0.48370	0.1496	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52808	-0.8526	10	0.72032	D	0.01	-33.4181	17.1404	0.86752	0.0:1.0:0.0:0.0	.	554	Q6ZRP7	QSOX2_HUMAN	M	554	ENSP00000351536:V554M	ENSP00000351536:V554M	V	-	1	0	QSOX2	138240832	0.999000	0.42202	0.986000	0.45419	0.372000	0.29890	4.307000	0.59123	2.258000	0.74832	0.558000	0.71614	GTG	QSOX2	-	NULL	ENSG00000165661		0.592	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	111	0.00	0	C	NM_181701		139101011	139101011	-1	no_errors	ENST00000358701	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	T
QSOX2	169714	genome.wustl.edu	37	9	139101011	139101011	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr9:139101011C>T	ENST00000358701.5	-	12	1697	c.1660G>A	c.(1660-1662)Gtg>Atg	p.V554M		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	554					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		AATGTGAGCACGTGGCCTTCA	0.592																																						dbGAP											0													96.0	102.0	100.0					9																	139101011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1660G>A	9.37:g.139101011C>T	ENSP00000351536:p.Val554Met		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.V554M	ENST00000358701.5	37	c.1660	CCDS35178.1	9	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871093	0.72065	.	.	ENSG00000165661	ENST00000358701	T	0.20332	2.08	4.91	4.91	0.64330	.	0.138983	0.46442	D	0.000291	T	0.48370	0.1496	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52808	-0.8526	10	0.72032	D	0.01	-33.4181	17.1404	0.86752	0.0:1.0:0.0:0.0	.	554	Q6ZRP7	QSOX2_HUMAN	M	554	ENSP00000351536:V554M	ENSP00000351536:V554M	V	-	1	0	QSOX2	138240832	0.999000	0.42202	0.986000	0.45419	0.372000	0.29890	4.307000	0.59123	2.258000	0.74832	0.558000	0.71614	GTG	QSOX2	-	NULL	ENSG00000165661		0.592	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	30	0.00	0	C	NM_181701		139101011	139101011	-1	no_errors	ENST00000358701	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	1.000	T
QSOX2	169714	genome.wustl.edu	37	9	139101011	139101011	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr9:139101011C>T	ENST00000358701.5	-	12	1697	c.1660G>A	c.(1660-1662)Gtg>Atg	p.V554M		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	554					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		AATGTGAGCACGTGGCCTTCA	0.592																																						dbGAP											0													96.0	102.0	100.0					9																	139101011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1660G>A	9.37:g.139101011C>T	ENSP00000351536:p.Val554Met		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.V554M	ENST00000358701.5	37	c.1660	CCDS35178.1	9	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871093	0.72065	.	.	ENSG00000165661	ENST00000358701	T	0.20332	2.08	4.91	4.91	0.64330	.	0.138983	0.46442	D	0.000291	T	0.48370	0.1496	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52808	-0.8526	10	0.72032	D	0.01	-33.4181	17.1404	0.86752	0.0:1.0:0.0:0.0	.	554	Q6ZRP7	QSOX2_HUMAN	M	554	ENSP00000351536:V554M	ENSP00000351536:V554M	V	-	1	0	QSOX2	138240832	0.999000	0.42202	0.986000	0.45419	0.372000	0.29890	4.307000	0.59123	2.258000	0.74832	0.558000	0.71614	GTG	QSOX2	-	NULL	ENSG00000165661		0.592	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	111	0.00	0	C	NM_181701		139101011	139101011	-1	no_errors	ENST00000358701	ensembl	human	known	69_37n	missense	71	23.66	22	SNP	1.000	T
RAB39B	116442	genome.wustl.edu	37	X	154490240	154490240	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:154490240A>C	ENST00000369454.3	-	2	790	c.490T>G	c.(490-492)Ttc>Gtc	p.F164V		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	164					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGGTCTGTGAAGGCTTTCTCC	0.502																																						dbGAP											0													105.0	85.0	92.0					X																	154490240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.490T>G	X.37:g.154490240A>C	ENSP00000358466:p.Phe164Val		Q5JT79|Q8NEX3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F164V	ENST00000369454.3	37	c.490	CCDS14766.1	X	.	.	.	.	.	.	.	.	.	.	A	20.5	3.997538	0.74818	.	.	ENSG00000155961	ENST00000369454	D	0.83419	-1.72	5.17	5.17	0.71159	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91466	0.7306	M	0.89214	3.015	0.58432	D	0.999999	D	0.69078	0.997	D	0.70016	0.967	D	0.92746	0.6212	10	0.87932	D	0	.	12.0756	0.53641	1.0:0.0:0.0:0.0	.	164	Q96DA2	RB39B_HUMAN	V	164	ENSP00000358466:F164V	ENSP00000358466:F164V	F	-	1	0	RAB39B	154143434	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.878000	0.92393	1.824000	0.53156	0.417000	0.27973	TTC	RAB39B	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.502	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	126	0.00	0	A	NM_171998		154490240	154490240	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	C
RAB39B	116442	genome.wustl.edu	37	X	154490240	154490240	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:154490240A>C	ENST00000369454.3	-	2	790	c.490T>G	c.(490-492)Ttc>Gtc	p.F164V		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	164					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGGTCTGTGAAGGCTTTCTCC	0.502																																						dbGAP											0													105.0	85.0	92.0					X																	154490240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.490T>G	X.37:g.154490240A>C	ENSP00000358466:p.Phe164Val		Q5JT79|Q8NEX3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F164V	ENST00000369454.3	37	c.490	CCDS14766.1	X	.	.	.	.	.	.	.	.	.	.	A	20.5	3.997538	0.74818	.	.	ENSG00000155961	ENST00000369454	D	0.83419	-1.72	5.17	5.17	0.71159	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91466	0.7306	M	0.89214	3.015	0.58432	D	0.999999	D	0.69078	0.997	D	0.70016	0.967	D	0.92746	0.6212	10	0.87932	D	0	.	12.0756	0.53641	1.0:0.0:0.0:0.0	.	164	Q96DA2	RB39B_HUMAN	V	164	ENSP00000358466:F164V	ENSP00000358466:F164V	F	-	1	0	RAB39B	154143434	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.878000	0.92393	1.824000	0.53156	0.417000	0.27973	TTC	RAB39B	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.502	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	126	0.00	0	A	NM_171998		154490240	154490240	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	missense	66	40.54	45	SNP	1.000	C
RAB39B	116442	genome.wustl.edu	37	X	154490246	154490246	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:154490246T>C	ENST00000369454.3	-	2	784	c.484A>G	c.(484-486)Aaa>Gaa	p.K162E		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	162					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GTGAAGGCTTTCTCCACATTA	0.507																																						dbGAP											0													105.0	85.0	92.0					X																	154490246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.484A>G	X.37:g.154490246T>C	ENSP00000358466:p.Lys162Glu		Q5JT79|Q8NEX3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K162E	ENST00000369454.3	37	c.484	CCDS14766.1	X	.	.	.	.	.	.	.	.	.	.	T	2.413	-0.334967	0.05278	.	.	ENSG00000155961	ENST00000369454	T	0.76060	-0.99	5.17	5.17	0.71159	Small GTP-binding protein domain (1);	0.139598	0.49916	D	0.000122	T	0.41305	0.1153	N	0.00972	-1.085	0.42993	D	0.994498	B	0.06786	0.001	B	0.13407	0.009	T	0.50180	-0.8858	10	0.02654	T	1	.	12.0756	0.53641	0.0:0.0:0.0:1.0	.	162	Q96DA2	RB39B_HUMAN	E	162	ENSP00000358466:K162E	ENSP00000358466:K162E	K	-	1	0	RAB39B	154143440	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.824000	0.62701	1.824000	0.53156	0.417000	0.27973	AAA	RAB39B	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.507	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	122	0.00	0	T	NM_171998		154490246	154490246	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	missense	45	24.59	15	SNP	1.000	C
RAB39B	116442	genome.wustl.edu	37	X	154490246	154490246	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:154490246T>C	ENST00000369454.3	-	2	784	c.484A>G	c.(484-486)Aaa>Gaa	p.K162E		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	162					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GTGAAGGCTTTCTCCACATTA	0.507																																						dbGAP											0													105.0	85.0	92.0					X																	154490246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.484A>G	X.37:g.154490246T>C	ENSP00000358466:p.Lys162Glu		Q5JT79|Q8NEX3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K162E	ENST00000369454.3	37	c.484	CCDS14766.1	X	.	.	.	.	.	.	.	.	.	.	T	2.413	-0.334967	0.05278	.	.	ENSG00000155961	ENST00000369454	T	0.76060	-0.99	5.17	5.17	0.71159	Small GTP-binding protein domain (1);	0.139598	0.49916	D	0.000122	T	0.41305	0.1153	N	0.00972	-1.085	0.42993	D	0.994498	B	0.06786	0.001	B	0.13407	0.009	T	0.50180	-0.8858	10	0.02654	T	1	.	12.0756	0.53641	0.0:0.0:0.0:1.0	.	162	Q96DA2	RB39B_HUMAN	E	162	ENSP00000358466:K162E	ENSP00000358466:K162E	K	-	1	0	RAB39B	154143440	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.824000	0.62701	1.824000	0.53156	0.417000	0.27973	AAA	RAB39B	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.507	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	122	0.00	0	T	NM_171998		154490246	154490246	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	missense	64	42.34	47	SNP	1.000	C
RAI1	10743	genome.wustl.edu	37	17	17700557	17700557	+	Missense_Mutation	SNP	C	C	A	rs201405375	byFrequency	TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:17700557C>A	ENST00000353383.1	+	3	4764	c.4295C>A	c.(4294-4296)cCg>cAg	p.P1432Q	RAI1_ENST00000261641.6_Missense_Mutation_p.P1432Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1432					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		TTCACATCCCCGGAGGCCCTG	0.557																																						dbGAP											0													41.0	45.0	44.0					17																	17700557		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.4295C>A	17.37:g.17700557C>A	ENSP00000323074:p.Pro1432Gln		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	smart_Znf_PHD	p.P1432Q	ENST00000353383.1	37	c.4295	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309311	0.23821	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000261641	T;T	0.65364	-0.15;0.45	5.22	4.25	0.50352	.	0.431628	0.21650	N	0.071197	T	0.47432	0.1445	N	0.24115	0.695	0.31844	N	0.623175	B	0.24675	0.109	B	0.21917	0.037	T	0.54997	-0.8209	10	0.49607	T	0.09	.	11.5242	0.50569	0.0:0.9155:0.0:0.0845	.	1432	Q7Z5J4	RAI1_HUMAN	Q	1432	ENSP00000323074:P1432Q;ENSP00000261641:P1432Q	ENSP00000261641:P1432Q	P	+	2	0	RAI1	17641282	0.005000	0.15991	0.246000	0.24233	0.200000	0.23975	1.976000	0.40579	1.201000	0.43203	0.561000	0.74099	CCG	RAI1	-	NULL	ENSG00000108557		0.557	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	38	0.00	0	C	NM_030665		17700557	17700557	+1	no_errors	ENST00000353383	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.954	A
RBM39	9584	genome.wustl.edu	37	20	34293206	34293206	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:34293206C>A	ENST00000253363.6	-	15	1377	c.1354G>T	c.(1354-1356)Gaa>Taa	p.E452*	RBM39_ENST00000528062.3_Nonsense_Mutation_p.E430*|RBM39_ENST00000407261.4_Nonsense_Mutation_p.E295*|RBM39_ENST00000361162.6_Nonsense_Mutation_p.E446*			Q14498	RBM39_HUMAN	RNA binding motif protein 39	452	Interaction with NCOA6. {ECO:0000250}.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TTACATTCTTCAATCACATCA	0.294																																						dbGAP											0													110.0	105.0	107.0					20																	34293206		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1354G>T	20.37:g.34293206C>A	ENSP00000253363:p.Glu452*		A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_CC1_SF	p.E452*	ENST00000253363.6	37	c.1354	CCDS13266.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.901583|6.901583	0.97920|0.97920	.|.	.|.	ENSG00000131051|ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261|ENST00000448303	.|.	.|.	.|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.56958|.	D|.	0.05|.	.|.	19.7075|19.7075	0.96079|0.96079	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	452;446;430;295|302	.|.	ENSP00000253363:E452X|.	E|X	-|-	1|2	0|2	RBM39|RBM39	33756620|33756620	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.805000|7.805000	0.86005|0.86005	2.643000|2.643000	0.89663|0.89663	0.655000|0.655000	0.94253|0.94253	GAA|TGA	RBM39	-	smart_RRM_dom_euk,smart_RRM_dom,tigrfam_CC1_SF	ENSG00000131051		0.294	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	50	0.00	0	C	NM_184237		34293206	34293206	-1	no_errors	ENST00000253363	ensembl	human	known	69_37n	nonsense	32	10.81	4	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114424597	114424597	+	Missense_Mutation	SNP	G	G	T	rs12009026		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:114424597G>T	ENST00000424776.3	+	1	635	c.593G>T	c.(592-594)cGc>cTc	p.R198L	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	198							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CAGCCACGGCGCTGGGCCGGC	0.697																																						dbGAP											0													6.0	11.0	9.0					X																	114424597		649	1530	2179	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.593G>T	X.37:g.114424597G>T	ENSP00000417451:p.Arg198Leu		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R198L	ENST00000424776.3	37	c.593	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	g	9.242	1.038542	0.19669	.	.	ENSG00000175718	ENST00000424776	T	0.04156	3.69	0.776	-0.407	0.12385	.	.	.	.	.	T	0.04318	0.0119	L	0.43923	1.385	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.41928	-0.9481	9	0.87932	D	0	.	2.47	0.04562	0.269:0.315:0.416:0.0	.	198	Q8N7X1	RMXL3_HUMAN	L	198	ENSP00000417451:R198L	ENSP00000417451:R198L	R	+	2	0	RBMXL3	114330853	0.118000	0.22208	0.000000	0.03702	0.006000	0.05464	0.046000	0.14035	-0.246000	0.09611	0.183000	0.17082	CGC	RBMXL3	-	NULL	ENSG00000175718		0.697	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	17	0.00	0	G	NM_001145346		114424597	114424597	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	0.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114424746	114424746	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chrX:114424746G>A	ENST00000424776.3	+	1	784	c.742G>A	c.(742-744)Gac>Aac	p.D248N	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	248							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCCGTGCCGCGACCCTGGGGA	0.672																																						dbGAP											0													10.0	9.0	9.0					X																	114424746		687	1585	2272	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.742G>A	X.37:g.114424746G>A	ENSP00000417451:p.Asp248Asn		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D248N	ENST00000424776.3	37	c.742	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055283	0.36277	.	.	ENSG00000175718	ENST00000424776	T	0.05139	3.49	0.803	0.803	0.18691	.	.	.	.	.	T	0.13457	0.0326	L	0.52905	1.665	0.09310	N	1	D	0.67145	0.996	P	0.57468	0.821	T	0.11916	-1.0568	8	0.87932	D	0	.	.	.	.	.	248	Q8N7X1	RMXL3_HUMAN	N	248	ENSP00000417451:D248N	ENSP00000417451:D248N	D	+	1	0	RBMXL3	114331002	0.996000	0.38824	0.001000	0.08648	0.001000	0.01503	2.337000	0.43947	0.662000	0.31006	0.384000	0.25694	GAC	RBMXL3	-	NULL	ENSG00000175718		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	8	0.00	0	G	NM_001145346		114424746	114424746	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.001	A
RBMXL3	139804	genome.wustl.edu	37	X	114424746	114424746	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:114424746G>A	ENST00000424776.3	+	1	784	c.742G>A	c.(742-744)Gac>Aac	p.D248N	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	248							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCCGTGCCGCGACCCTGGGGA	0.672																																						dbGAP											0													10.0	9.0	9.0					X																	114424746		687	1585	2272	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.742G>A	X.37:g.114424746G>A	ENSP00000417451:p.Asp248Asn		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D248N	ENST00000424776.3	37	c.742	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055283	0.36277	.	.	ENSG00000175718	ENST00000424776	T	0.05139	3.49	0.803	0.803	0.18691	.	.	.	.	.	T	0.13457	0.0326	L	0.52905	1.665	0.09310	N	1	D	0.67145	0.996	P	0.57468	0.821	T	0.11916	-1.0568	8	0.87932	D	0	.	.	.	.	.	248	Q8N7X1	RMXL3_HUMAN	N	248	ENSP00000417451:D248N	ENSP00000417451:D248N	D	+	1	0	RBMXL3	114331002	0.996000	0.38824	0.001000	0.08648	0.001000	0.01503	2.337000	0.43947	0.662000	0.31006	0.384000	0.25694	GAC	RBMXL3	-	NULL	ENSG00000175718		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	21	0.00	0	G	NM_001145346		114424746	114424746	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	0.001	A
RGR	5995	genome.wustl.edu	37	10	86004876	86004876	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:86004876C>A	ENST00000359452.4	+	1	68	c.30C>A	c.(28-30)ggC>ggA	p.G10G	RGR_ENST00000358110.5_Silent_p.G10G|RGR_ENST00000372092.3_Silent_p.G10G	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	10					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TGCCCACTGGCTTCGGGGAGC	0.647																																					NSCLC(15;204 545 5889 6385 32445)	dbGAP											0													106.0	93.0	98.0					10																	86004876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.30C>A	10.37:g.86004876C>A			A6NKK7|Q96FC5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_RPE_GPCR,prints_7TM_GPCR_Rhodpsn	p.G10	ENST00000359452.4	37	c.30	CCDS7374.1	10																																																																																			RGR	-	prints_RPE_GPCR	ENSG00000148604		0.647	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	HGNC	protein_coding	OTTHUMT00000049116.1	78	0.00	0	C	NM_002921		86004876	86004876	+1	no_errors	ENST00000359452	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.998	A
RNASEH2B	79621	genome.wustl.edu	37	13	51522140	51522140	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr13:51522140G>T	ENST00000336617.3	+	8	1033	c.634G>T	c.(634-636)Gcc>Tcc	p.A212S	RNASEH2B_ENST00000422660.1_Missense_Mutation_p.A212S|RNASEH2B_ENST00000495244.2_3'UTR	NM_024570.3	NP_078846.2	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B	212					in utero embryonic development (GO:0001701)|negative regulation of gene expression (GO:0010629)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of DNA damage checkpoint (GO:2000001)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|ribonucleotide metabolic process (GO:0009259)|RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(2)|liver(1)|lung(1)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)		TATTCGTTATGCCCATGGTCT	0.313																																						dbGAP											0													148.0	156.0	154.0					13																	51522140		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK021774	CCDS9425.1, CCDS45047.1	13q14.3	2014-09-17	2006-08-17	2006-08-17	ENSG00000136104	ENSG00000136104			25671	protein-coding gene	gene with protein product		610326	"""deleted in lymphocytic leukemia 8"", ""Aicardi-Goutieres syndrome 2"""	DLEU8, AGS2		16845400	Standard	NM_001142279		Approved	FLJ11712	uc001vfa.4	Q5TBB1	OTTHUMG00000016937	ENST00000336617.3:c.634G>T	13.37:g.51522140G>T	ENSP00000337623:p.Ala212Ser		G3XAJ1|Q05DR2|Q6PK48|Q9HAF7	Missense_Mutation	SNP	pfam_RNase_H2_suB	p.A212S	ENST00000336617.3	37	c.634	CCDS9425.1	13	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361111	0.61403	.	.	ENSG00000136104	ENST00000336617;ENST00000539292;ENST00000422660	D;D	0.97811	-4.55;-4.55	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	M	0.73598	2.24	0.80722	D	1	B;B	0.20988	0.05;0.025	B;B	0.32022	0.139;0.091	D	0.95217	0.8330	10	0.44086	T	0.13	-8.3874	16.7136	0.85392	0.0:0.0:1.0:0.0	.	212;212	G3XAJ1;Q5TBB1	.;RNH2B_HUMAN	S	212	ENSP00000337623:A212S;ENSP00000389877:A212S	ENSP00000337623:A212S	A	+	1	0	RNASEH2B	50420141	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.205000	0.77881	2.720000	0.93068	0.557000	0.71058	GCC	RNASEH2B	-	pfam_RNase_H2_suB	ENSG00000136104		0.313	RNASEH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH2B	HGNC	protein_coding	OTTHUMT00000045006.3	35	0.00	0	G	NM_024570		51522140	51522140	+1	no_errors	ENST00000336617	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	T
RNF207	388591	genome.wustl.edu	37	1	6272027	6272027	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:6272027C>T	ENST00000377939.4	+	13	1337	c.1210C>T	c.(1210-1212)Cgg>Tgg	p.R404W	RNF207_ENST00000377948.2_Missense_Mutation_p.P121L	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	404						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CACGCTGCACCGGTCCATCAG	0.682																																						dbGAP											0													12.0	13.0	13.0					1																	6272027		2189	4279	6468	-	-	-	SO:0001583	missense	0			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1210C>T	1.37:g.6272027C>T	ENSP00000367173:p.Arg404Trp		A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	NULL	p.P121L	ENST00000377939.4	37	c.362	CCDS59.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.23|16.23	3.064864|3.064864	0.55432|0.55432	.|.	.|.	ENSG00000158286|ENSG00000158286	ENST00000377948|ENST00000377939	.|T	.|0.64803	.|-0.12	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78033|0.78033	0.4220|0.4220	M|M	0.70275|0.70275	2.135|2.135	0.42205|0.42205	D|D	0.991787|0.991787	.|D	.|0.89917	.|1.0	.|D	.|0.79108	.|0.992	T|T	0.82354|0.82354	-0.0499|-0.0499	6|10	0.87932|0.87932	D|D	0|0	-19.3549|-19.3549	16.7895|16.7895	0.85584|0.85584	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|404	.|Q6ZRF8	.|RN207_HUMAN	L|W	121|404	.|ENSP00000367173:R404W	ENSP00000367183:P121L|ENSP00000367173:R404W	P|R	+|+	2|1	0|2	RNF207|RNF207	6194614|6194614	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.122000|0.122000	0.20287|0.20287	3.235000|3.235000	0.51328|0.51328	2.021000|2.021000	0.59480|0.59480	0.462000|0.462000	0.41574|0.41574	CCG|CGG	RNF207	-	NULL	ENSG00000158286		0.682	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF207	HGNC	protein_coding	OTTHUMT00000003669.2	24	0.00	0	C	NM_207396		6272027	6272027	+1	no_errors	ENST00000377948	ensembl	human	known	69_37n	missense	3	62.50	5	SNP	1.000	T
RNF207	388591	genome.wustl.edu	37	1	6272027	6272027	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:6272027C>T	ENST00000377939.4	+	13	1337	c.1210C>T	c.(1210-1212)Cgg>Tgg	p.R404W	RNF207_ENST00000377948.2_Missense_Mutation_p.P121L	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	404						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CACGCTGCACCGGTCCATCAG	0.682																																						dbGAP											0													12.0	13.0	13.0					1																	6272027		2189	4279	6468	-	-	-	SO:0001583	missense	0			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1210C>T	1.37:g.6272027C>T	ENSP00000367173:p.Arg404Trp		A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	NULL	p.P121L	ENST00000377939.4	37	c.362	CCDS59.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.23|16.23	3.064864|3.064864	0.55432|0.55432	.|.	.|.	ENSG00000158286|ENSG00000158286	ENST00000377948|ENST00000377939	.|T	.|0.64803	.|-0.12	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78033|0.78033	0.4220|0.4220	M|M	0.70275|0.70275	2.135|2.135	0.42205|0.42205	D|D	0.991787|0.991787	.|D	.|0.89917	.|1.0	.|D	.|0.79108	.|0.992	T|T	0.82354|0.82354	-0.0499|-0.0499	6|10	0.87932|0.87932	D|D	0|0	-19.3549|-19.3549	16.7895|16.7895	0.85584|0.85584	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|404	.|Q6ZRF8	.|RN207_HUMAN	L|W	121|404	.|ENSP00000367173:R404W	ENSP00000367183:P121L|ENSP00000367173:R404W	P|R	+|+	2|1	0|2	RNF207|RNF207	6194614|6194614	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.122000|0.122000	0.20287|0.20287	3.235000|3.235000	0.51328|0.51328	2.021000|2.021000	0.59480|0.59480	0.462000|0.462000	0.41574|0.41574	CCG|CGG	RNF207	-	NULL	ENSG00000158286		0.682	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF207	HGNC	protein_coding	OTTHUMT00000003669.2	24	0.00	0	C	NM_207396		6272027	6272027	+1	no_errors	ENST00000377948	ensembl	human	known	69_37n	missense	5	68.75	11	SNP	1.000	T
RNASEL	6041	genome.wustl.edu	37	1	182555755	182555755	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:182555755G>T	ENST00000367559.3	-	2	440	c.187C>A	c.(187-189)Ctg>Atg	p.L63M	RNASEL_ENST00000539397.1_Missense_Mutation_p.L63M|RNASEL_ENST00000444138.1_Missense_Mutation_p.L63M	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	63					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						GCGTTATGCAGAGGTGTCCAG	0.498																																						dbGAP											0													124.0	111.0	115.0					1																	182555755		2203	4300	6503	-	-	-	SO:0001583	missense	0			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.187C>A	1.37:g.182555755G>T	ENSP00000356530:p.Leu63Met		Q5W0L2|Q6AI46	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.L63M	ENST00000367559.3	37	c.187	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.105140	0.56291	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	D;D;D	0.81908	-1.55;-1.55;-1.55	4.71	-8.06	0.01102	Ankyrin repeat-containing domain (3);	0.000000	0.47093	D	0.000243	D	0.91264	0.7246	M	0.93062	3.375	0.20403	N	0.999902	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87610	0.2503	10	0.72032	D	0.01	-15.7302	19.2357	0.93858	0.2243:0.0:0.7757:0.0	.	63;63;63	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	M	63	ENSP00000356530:L63M;ENSP00000411147:L63M;ENSP00000440844:L63M	ENSP00000356530:L63M	L	-	1	2	RNASEL	180822378	0.010000	0.17322	0.000000	0.03702	0.043000	0.13939	-0.059000	0.11731	-1.597000	0.01609	-0.373000	0.07131	CTG	RNASEL	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000135828		0.498	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	HGNC	protein_coding	OTTHUMT00000085189.1	59	0.00	0	G	NM_021133		182555755	182555755	-1	no_errors	ENST00000367559	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.001	T
RNF213	57674	genome.wustl.edu	37	17	78341933	78341933	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:78341933C>A	ENST00000582970.1	+	44	12288	c.12145C>A	c.(12145-12147)Caa>Aaa	p.Q4049K	RNF213_ENST00000336301.6_Missense_Mutation_p.Q2122K|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.Q4098K|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4049					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGCTGTTTCCCAAGCGCACAG	0.453																																						dbGAP											0													147.0	142.0	143.0					17																	78341933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12145C>A	17.37:g.78341933C>A	ENSP00000464087:p.Gln4049Lys		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.Q4049K	ENST00000582970.1	37	c.12145	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	0.432	-0.902766	0.02453	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21191	2.02	4.67	1.41	0.22369	Zinc finger, RING/FYVE/PHD-type (1);	0.524707	0.20757	N	0.086244	T	0.13970	0.0338	L	0.35854	1.095	0.09310	N	0.999999	B;B	0.16603	0.018;0.0	B;B	0.14578	0.011;0.001	T	0.28427	-1.0044	10	0.21540	T	0.41	.	8.3477	0.32284	0.3463:0.2885:0.3651:0.0	.	4098;2122	C9JCP4;Q63HN8	.;RN213_HUMAN	K	4049;4098;2122	ENSP00000338218:Q2122K	ENSP00000338218:Q2122K	Q	+	1	0	RNF213	75956528	0.000000	0.05858	0.101000	0.21167	0.029000	0.11900	-0.202000	0.09451	0.158000	0.19367	0.655000	0.94253	CAA	RNF213	-	NULL	ENSG00000173821		0.453	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	79	0.00	0	C	NM_020914		78341933	78341933	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.287	A
ROBO4	54538	genome.wustl.edu	37	11	124763885	124763885	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:124763885C>A	ENST00000306534.3	-	9	1860	c.1375G>T	c.(1375-1377)Gag>Tag	p.E459*	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Nonsense_Mutation_p.E314*	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	459					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CTCAGCTGCTCCAGGGTCCAG	0.627																																						dbGAP											0													37.0	34.0	35.0					11																	124763885		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1375G>T	11.37:g.124763885C>A	ENSP00000304945:p.Glu459*		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E459*	ENST00000306534.3	37	c.1375	CCDS8455.1	11	.	.	.	.	.	.	.	.	.	.	C	43	9.933407	0.99299	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	.	.	.	4.9	3.95	0.45737	.	0.000000	0.37906	N	0.001895	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.3635	0.49657	0.0:0.8183:0.1817:0.0	.	.	.	.	X	459;349;314	.	ENSP00000304945:E459X	E	-	1	0	ROBO4	124269095	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	2.001000	0.40825	2.269000	0.75478	0.561000	0.74099	GAG	ROBO4	-	NULL	ENSG00000154133		0.627	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	81	0.00	0	C	NM_019055		124763885	124763885	-1	no_errors	ENST00000306534	ensembl	human	known	69_37n	nonsense	36	10.00	4	SNP	1.000	A
RPAP1	26015	genome.wustl.edu	37	15	41812534	41812534	+	Intron	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:41812534C>T	ENST00000304330.4	-	22	3912				RPAP1_ENST00000561603.1_Intron	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1							nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCAGGACTGCCCCCGAGGCC	0.567																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3795+54G>A	15.37:g.41812534C>T			Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.A1284T	ENST00000304330.4	37	c.3850	CCDS10079.1	15																																																																																			RPAP1	-	NULL	ENSG00000103932		0.567	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	50	0.00	0	C	NM_015540		41812534	41812534	-1	no_errors	ENST00000562303	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	0.000	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53734594	53734594	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:53734594C>T	ENST00000379925.3	-	2	92	c.42G>A	c.(40-42)gtG>gtA	p.V14V	RPGRIP1L_ENST00000262135.4_Silent_p.V14V|RPGRIP1L_ENST00000566096.1_Silent_p.V14V|RPGRIP1L_ENST00000568653.3_Silent_p.V14V|RPGRIP1L_ENST00000564374.1_Silent_p.V14V|RPGRIP1L_ENST00000563746.1_Silent_p.V14V	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	14					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTGTATCTTTCACAGGCAAGT	0.373																																						dbGAP											0													74.0	68.0	70.0					16																	53734594		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.42G>A	16.37:g.53734594C>T			A0PJ88|Q9Y2K8	Silent	SNP	pfam_DUF3250,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.V14	ENST00000379925.3	37	c.42	CCDS32447.1	16																																																																																			RPGRIP1L	-	NULL	ENSG00000103494		0.373	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1	26	0.00	0	C	NM_015272		53734594	53734594	-1	no_errors	ENST00000379925	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	T
RREB1	6239	genome.wustl.edu	37	6	7246803	7246803	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:7246803G>T	ENST00000349384.6	+	11	4269	c.3955G>T	c.(3955-3957)Gcc>Tcc	p.A1319S	RREB1_ENST00000379938.2_Missense_Mutation_p.A1374S|RREB1_ENST00000334984.6_Intron|RREB1_ENST00000379933.3_Missense_Mutation_p.A1319S	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1319					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GGCGGAAACGGCCTCGCCGGT	0.711																																						dbGAP											0													31.0	32.0	32.0					6																	7246803		2131	4199	6330	-	-	-	SO:0001583	missense	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.3955G>T	6.37:g.7246803G>T	ENSP00000305560:p.Ala1319Ser		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1374S	ENST00000349384.6	37	c.4120	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	G	4.783	0.145583	0.09134	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384	T;T;T	0.10382	2.88;2.95;2.88	4.81	0.754	0.18410	.	0.722507	0.11500	N	0.557802	T	0.02455	0.0075	L	0.46157	1.445	0.09310	N	0.999992	B;B	0.19200	0.0;0.034	B;B	0.21708	0.001;0.036	T	0.47873	-0.9083	10	0.15066	T	0.55	-1.1777	5.1548	0.15029	0.2531:0.0:0.6044:0.1426	.	1319;1374	Q92766;Q92766-2	RREB1_HUMAN;.	S	1319;1374;1319	ENSP00000369265:A1319S;ENSP00000369270:A1374S;ENSP00000305560:A1319S	ENSP00000305560:A1319S	A	+	1	0	RREB1	7191802	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.416000	0.07097	0.109000	0.17891	-0.258000	0.10820	GCC	RREB1	-	NULL	ENSG00000124782		0.711	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	58	0.00	0	G			7246803	7246803	+1	no_errors	ENST00000379938	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.000	T
RTKN	6242	genome.wustl.edu	37	2	74659707	74659707	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:74659707C>A	ENST00000233330.6	-	2	365	c.48G>T	c.(46-48)gaG>gaT	p.E16D	RTKN_ENST00000484453.1_5'UTR|RTKN_ENST00000272430.5_Missense_Mutation_p.E66D|RTKN_ENST00000305557.5_Missense_Mutation_p.E53D	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						CCAGAGCCTGCTCTCGCTGGG	0.637																																						dbGAP											0													61.0	59.0	59.0					2																	74659707		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.48G>T	2.37:g.74659707C>A	ENSP00000233330:p.Glu16Asp			Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E66D	ENST00000233330.6	37	c.198	CCDS42699.1	2	.	.	.	.	.	.	.	.	.	.	C	8.975	0.973955	0.18736	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	T;T;T	0.29655	1.58;1.58;1.56	4.87	0.791	0.18619	.	0.050449	0.85682	D	0.000000	T	0.10680	0.0261	N	0.03268	-0.37	0.35239	D	0.777658	B;B;B	0.22909	0.062;0.077;0.062	B;B;B	0.25291	0.035;0.059;0.035	T	0.23048	-1.0199	10	0.12766	T	0.61	.	6.5713	0.22541	0.0:0.486:0.0:0.514	.	70;66;53	Q9BST9-3;Q9BST9;Q9BST9-2	.;RTKN_HUMAN;.	D	53;66;16	ENSP00000305298:E53D;ENSP00000272430:E66D;ENSP00000233330:E16D	ENSP00000233330:E16D	E	-	3	2	RTKN	74513215	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	0.257000	0.18369	0.266000	0.21894	-0.258000	0.10820	GAG	RTKN	-	pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd	ENSG00000114993		0.637	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	RTKN	HGNC	protein_coding	OTTHUMT00000328236.3	67	0.00	0	C	NM_001015055		74659707	74659707	-1	no_errors	ENST00000272430	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.997	A
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	95	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	34	26.09	12	INS	0.999:1.000	C
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	72	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	32	23.81	10	INS	0.999:1.000	C
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	72	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	22	31.25	10	INS	0.999:1.000	C
SCNM1	79005	genome.wustl.edu	37	1	151139900	151139900	+	Intron	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:151139900G>A	ENST00000368905.4	+	5	509				LYSMD1_ENST00000440902.2_5'Flank|LYSMD1_ENST00000368908.5_5'Flank|SCNM1_ENST00000461862.1_3'UTR	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGTATGGGACGGGAAAGCCAG	0.498																																						dbGAP											0													92.0	95.0	94.0					1																	151139900		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.398+10G>A	1.37:g.151139900G>A			B4DWR1|Q5JR74	RNA	SNP	-	NULL	ENST00000368905.4	37	NULL	CCDS987.1	1																																																																																			SCNM1	-	-	ENSG00000163156		0.498	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	SCNM1	HGNC	protein_coding	OTTHUMT00000034064.2	37	0.00	0	G	NM_024041		151139900	151139900	+1	no_errors	ENST00000461862	ensembl	human	known	69_37n	rna	19	13.64	3	SNP	0.001	A
SDK2	54549	genome.wustl.edu	37	17	71375348	71375348	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:71375348C>A	ENST00000392650.3	-	36	4948	c.4948G>T	c.(4948-4950)Gac>Tac	p.D1650Y	SDK2_ENST00000388726.3_Missense_Mutation_p.D1631Y	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1650	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TTCTGGCTGTCCAGCGGAGGT	0.657																																						dbGAP											0													73.0	43.0	53.0					17																	71375348		2184	4256	6440	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4948G>T	17.37:g.71375348C>A	ENSP00000376421:p.Asp1650Tyr		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D1650Y	ENST00000392650.3	37	c.4948	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928531	0.73327	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.54279	0.58;0.58;0.58	4.44	4.44	0.53790	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.170706	0.51477	D	0.000095	T	0.59032	0.2164	M	0.68317	2.08	0.58432	D	0.999996	P;B;B	0.44690	0.841;0.277;0.204	P;B;P	0.45474	0.482;0.389;0.473	T	0.67440	-0.5670	10	0.72032	D	0.01	.	17.4221	0.87517	0.0:1.0:0.0:0.0	.	1650;1650;1631	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	Y	1274;1650;1631;807;1650	ENSP00000376421:D1650Y;ENSP00000373378:D1631Y;ENSP00000407098:D807Y	ENSP00000324967:D1650Y	D	-	1	0	SDK2	68886943	1.000000	0.71417	0.984000	0.44739	0.986000	0.74619	5.742000	0.68646	2.186000	0.69663	0.555000	0.69702	GAC	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	84	0.00	0	C	NM_019064		71375348	71375348	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	14	53.12	17	SNP	0.999	A
SDK2	54549	genome.wustl.edu	37	17	71375348	71375348	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr17:71375348C>A	ENST00000392650.3	-	36	4948	c.4948G>T	c.(4948-4950)Gac>Tac	p.D1650Y	SDK2_ENST00000388726.3_Missense_Mutation_p.D1631Y	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1650	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TTCTGGCTGTCCAGCGGAGGT	0.657																																						dbGAP											0													73.0	43.0	53.0					17																	71375348		2184	4256	6440	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4948G>T	17.37:g.71375348C>A	ENSP00000376421:p.Asp1650Tyr		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D1650Y	ENST00000392650.3	37	c.4948	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928531	0.73327	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.54279	0.58;0.58;0.58	4.44	4.44	0.53790	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.170706	0.51477	D	0.000095	T	0.59032	0.2164	M	0.68317	2.08	0.58432	D	0.999996	P;B;B	0.44690	0.841;0.277;0.204	P;B;P	0.45474	0.482;0.389;0.473	T	0.67440	-0.5670	10	0.72032	D	0.01	.	17.4221	0.87517	0.0:1.0:0.0:0.0	.	1650;1650;1631	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	Y	1274;1650;1631;807;1650	ENSP00000376421:D1650Y;ENSP00000373378:D1631Y;ENSP00000407098:D807Y	ENSP00000324967:D1650Y	D	-	1	0	SDK2	68886943	1.000000	0.71417	0.984000	0.44739	0.986000	0.74619	5.742000	0.68646	2.186000	0.69663	0.555000	0.69702	GAC	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	51	0.00	0	C	NM_019064		71375348	71375348	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	19	47.22	17	SNP	0.999	A
SDK2	54549	genome.wustl.edu	37	17	71375348	71375348	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:71375348C>A	ENST00000392650.3	-	36	4948	c.4948G>T	c.(4948-4950)Gac>Tac	p.D1650Y	SDK2_ENST00000388726.3_Missense_Mutation_p.D1631Y	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1650	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TTCTGGCTGTCCAGCGGAGGT	0.657																																						dbGAP											0													73.0	43.0	53.0					17																	71375348		2184	4256	6440	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4948G>T	17.37:g.71375348C>A	ENSP00000376421:p.Asp1650Tyr		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D1650Y	ENST00000392650.3	37	c.4948	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928531	0.73327	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.54279	0.58;0.58;0.58	4.44	4.44	0.53790	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.170706	0.51477	D	0.000095	T	0.59032	0.2164	M	0.68317	2.08	0.58432	D	0.999996	P;B;B	0.44690	0.841;0.277;0.204	P;B;P	0.45474	0.482;0.389;0.473	T	0.67440	-0.5670	10	0.72032	D	0.01	.	17.4221	0.87517	0.0:1.0:0.0:0.0	.	1650;1650;1631	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	Y	1274;1650;1631;807;1650	ENSP00000376421:D1650Y;ENSP00000373378:D1631Y;ENSP00000407098:D807Y	ENSP00000324967:D1650Y	D	-	1	0	SDK2	68886943	1.000000	0.71417	0.984000	0.44739	0.986000	0.74619	5.742000	0.68646	2.186000	0.69663	0.555000	0.69702	GAC	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	84	0.00	0	C	NM_019064		71375348	71375348	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	58	35.56	32	SNP	0.999	A
SETD1A	9739	genome.wustl.edu	37	16	30982699	30982699	+	Splice_Site	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr16:30982699G>T	ENST00000262519.8	+	13	3703	c.3017G>T	c.(3016-3018)gGc>gTc	p.G1006V		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1006	Glu-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GGATTTCCAGGCGAGGACGAG	0.577																																						dbGAP											0													139.0	137.0	138.0					16																	30982699		2197	4300	6497	-	-	-	SO:0001630	splice_region_variant	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3017-1G>T	16.37:g.30982699G>T			A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.G1006V	ENST00000262519.8	37	c.3017	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208696	0.58343	.	.	ENSG00000099381	ENST00000262519	T	0.56103	0.48	5.7	5.7	0.88788	.	0.327649	0.32401	N	0.006159	T	0.68540	0.3012	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66244	-0.5972	9	.	.	.	.	15.3212	0.74124	0.0:0.0:1.0:0.0	.	1006	O15047	SET1A_HUMAN	V	1006	ENSP00000262519:G1006V	.	G	+	2	0	SETD1A	30890200	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.018000	0.49625	2.693000	0.91896	0.467000	0.42956	GGC	SETD1A	-	NULL	ENSG00000099381		0.577	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	48	0.00	0	G	NM_014712	Missense_Mutation	30982699	30982699	+1	no_errors	ENST00000262519	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
SFI1	9814	genome.wustl.edu	37	22	32003986	32003986	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:32003986G>T	ENST00000400288.2	+	22	2326	c.2221G>T	c.(2221-2223)Gcc>Tcc	p.A741S	SFI1_ENST00000443011.1_Missense_Mutation_p.A588S|SFI1_ENST00000432498.1_Missense_Mutation_p.A710S|SFI1_ENST00000443326.1_Missense_Mutation_p.A659S|SFI1_ENST00000400289.1_Missense_Mutation_p.A659S|SFI1_ENST00000540643.1_Missense_Mutation_p.A686S|SFI1_ENST00000414585.1_Missense_Mutation_p.A588S	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	741					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGAGGACTGTGCCATCTGGGA	0.567																																						dbGAP											0													64.0	69.0	67.0					22																	32003986		2050	4208	6258	-	-	-	SO:0001583	missense	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2221G>T	22.37:g.32003986G>T	ENSP00000383145:p.Ala741Ser		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.A741S	ENST00000400288.2	37	c.2221	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354030	0.41700	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.17054	2.92;2.91;2.74;2.75;2.75;2.74;2.92;2.3	5.08	1.86	0.25419	.	0.351137	0.31760	N	0.007118	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.996;0.987;0.999;0.994	T	0.03413	-1.1039	10	0.62326	D	0.03	.	6.4702	0.22003	0.2989:0.0:0.7011:0.0	.	686;647;659;710;741	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	S	710;686;659;588;588;659;741;324	ENSP00000402679:A710S;ENSP00000443025:A686S;ENSP00000416469:A659S;ENSP00000397148:A588S;ENSP00000401199:A588S;ENSP00000383146:A659S;ENSP00000383145:A741S;ENSP00000398871:A324S	ENSP00000383145:A741S	A	+	1	0	SFI1	30333986	0.044000	0.20184	0.007000	0.13788	0.300000	0.27592	1.882000	0.39648	0.672000	0.31204	0.561000	0.74099	GCC	SFI1	-	superfamily_Cyclin-like	ENSG00000198089		0.567	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	89	0.00	0	G	NM_014775		32003986	32003986	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	missense	23	45.24	19	SNP	0.002	T
SFI1	9814	genome.wustl.edu	37	22	32003986	32003986	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr22:32003986G>T	ENST00000400288.2	+	22	2326	c.2221G>T	c.(2221-2223)Gcc>Tcc	p.A741S	SFI1_ENST00000443011.1_Missense_Mutation_p.A588S|SFI1_ENST00000432498.1_Missense_Mutation_p.A710S|SFI1_ENST00000443326.1_Missense_Mutation_p.A659S|SFI1_ENST00000400289.1_Missense_Mutation_p.A659S|SFI1_ENST00000540643.1_Missense_Mutation_p.A686S|SFI1_ENST00000414585.1_Missense_Mutation_p.A588S	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	741					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGAGGACTGTGCCATCTGGGA	0.567																																						dbGAP											0													64.0	69.0	67.0					22																	32003986		2050	4208	6258	-	-	-	SO:0001583	missense	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2221G>T	22.37:g.32003986G>T	ENSP00000383145:p.Ala741Ser		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.A741S	ENST00000400288.2	37	c.2221	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354030	0.41700	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.17054	2.92;2.91;2.74;2.75;2.75;2.74;2.92;2.3	5.08	1.86	0.25419	.	0.351137	0.31760	N	0.007118	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.996;0.987;0.999;0.994	T	0.03413	-1.1039	10	0.62326	D	0.03	.	6.4702	0.22003	0.2989:0.0:0.7011:0.0	.	686;647;659;710;741	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	S	710;686;659;588;588;659;741;324	ENSP00000402679:A710S;ENSP00000443025:A686S;ENSP00000416469:A659S;ENSP00000397148:A588S;ENSP00000401199:A588S;ENSP00000383146:A659S;ENSP00000383145:A741S;ENSP00000398871:A324S	ENSP00000383145:A741S	A	+	1	0	SFI1	30333986	0.044000	0.20184	0.007000	0.13788	0.300000	0.27592	1.882000	0.39648	0.672000	0.31204	0.561000	0.74099	GCC	SFI1	-	superfamily_Cyclin-like	ENSG00000198089		0.567	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	32	0.00	0	G	NM_014775		32003986	32003986	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	missense	7	65.00	13	SNP	0.002	T
SFI1	9814	genome.wustl.edu	37	22	32003986	32003986	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:32003986G>T	ENST00000400288.2	+	22	2326	c.2221G>T	c.(2221-2223)Gcc>Tcc	p.A741S	SFI1_ENST00000443011.1_Missense_Mutation_p.A588S|SFI1_ENST00000432498.1_Missense_Mutation_p.A710S|SFI1_ENST00000443326.1_Missense_Mutation_p.A659S|SFI1_ENST00000400289.1_Missense_Mutation_p.A659S|SFI1_ENST00000540643.1_Missense_Mutation_p.A686S|SFI1_ENST00000414585.1_Missense_Mutation_p.A588S	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	741					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGAGGACTGTGCCATCTGGGA	0.567																																						dbGAP											0													64.0	69.0	67.0					22																	32003986		2050	4208	6258	-	-	-	SO:0001583	missense	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2221G>T	22.37:g.32003986G>T	ENSP00000383145:p.Ala741Ser		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.A741S	ENST00000400288.2	37	c.2221	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354030	0.41700	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.17054	2.92;2.91;2.74;2.75;2.75;2.74;2.92;2.3	5.08	1.86	0.25419	.	0.351137	0.31760	N	0.007118	T	0.17408	0.0418	N	0.08118	0	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.996;0.987;0.999;0.994	T	0.03413	-1.1039	10	0.62326	D	0.03	.	6.4702	0.22003	0.2989:0.0:0.7011:0.0	.	686;647;659;710;741	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	S	710;686;659;588;588;659;741;324	ENSP00000402679:A710S;ENSP00000443025:A686S;ENSP00000416469:A659S;ENSP00000397148:A588S;ENSP00000401199:A588S;ENSP00000383146:A659S;ENSP00000383145:A741S;ENSP00000398871:A324S	ENSP00000383145:A741S	A	+	1	0	SFI1	30333986	0.044000	0.20184	0.007000	0.13788	0.300000	0.27592	1.882000	0.39648	0.672000	0.31204	0.561000	0.74099	GCC	SFI1	-	superfamily_Cyclin-like	ENSG00000198089		0.567	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	89	0.00	0	G	NM_014775		32003986	32003986	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	missense	31	59.74	46	SNP	0.002	T
SIX3	6496	genome.wustl.edu	37	2	45169961	45169961	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:45169961G>T	ENST00000260653.3	+	1	1060	c.718G>T	c.(718-720)Gcg>Tcg	p.A240S	SIX3-AS1_ENST00000419364.1_RNA|SIX3-AS1_ENST00000456467.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	240					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ACGCGAACTGGCGCAGGCCAC	0.642																																						dbGAP											0			GRCh37	CX086076	SIX3	X							27.0	30.0	29.0					2																	45169961		2091	4170	6261	-	-	-	SO:0001583	missense	0			AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.718G>T	2.37:g.45169961G>T	ENSP00000260653:p.Ala240Ser		D6W5A5|Q53T42	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A240S	ENST00000260653.3	37	c.718	CCDS1821.1	2	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324896	0.60634	.	.	ENSG00000138083	ENST00000260653	D	0.97888	-4.59	3.58	3.58	0.41010	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	U	0.000002	D	0.97870	0.9300	L	0.54908	1.71	0.80722	D	1	D	0.64830	0.994	D	0.67725	0.953	D	0.98027	1.0374	10	0.51188	T	0.08	.	14.9719	0.71241	0.0:0.0:1.0:0.0	.	240	O95343	SIX3_HUMAN	S	240	ENSP00000260653:A240S	ENSP00000260653:A240S	A	+	1	0	SIX3	45023465	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	9.274000	0.95731	1.842000	0.53543	0.484000	0.47621	GCG	SIX3	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000138083		0.642	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX3	HGNC	protein_coding	OTTHUMT00000326192.1	65	0.00	0	G	NM_005413		45169961	45169961	+1	no_errors	ENST00000260653	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
SKOR2	652991	genome.wustl.edu	37	18	44773244	44773244	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:44773244C>A	ENST00000425639.1	-	1	2310	c.2311G>T	c.(2311-2313)Gag>Tag	p.E771*	SKOR2_ENST00000400404.1_Intron	NM_001278063.1	NP_001264992.1	Q2VWA4	SKOR2_HUMAN	SKI family transcriptional corepressor 2	771	Glu-rich.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of cerebellar granule cell precursor proliferation (GO:0021936)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(1)	1						tccgtctcctcgtcctcttcc	0.701																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AY669508	CCDS62441.1, CCDS74222.1	18q21.1	2011-08-04			ENSG00000215474	ENSG00000215474		"""SKI transcriptional corepressors"""	32695	protein-coding gene	gene with protein product	"""functional smad suppressing element 18"""					16200078, 18522874	Standard	NM_001278063		Approved	CORL2, FUSSEL18, Fussel-18	uc031rif.1	Q2VWA4		ENST00000425639.1:c.2311G>T	18.37:g.44773244C>A	ENSP00000414750:p.Glu771*			Nonsense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like,superfamily_FH2_actin-bd	p.E771*	ENST00000425639.1	37	c.2311		18	.	.	.	.	.	.	.	.	.	.	C	38	7.272629	0.98179	.	.	ENSG00000215474	ENST00000425639	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.9134	0.63881	0.0:1.0:0.0:0.0	.	.	.	.	X	771	.	ENSP00000414750:E771X	E	-	1	0	SKOR2	43027242	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	4.820000	0.62671	2.272000	0.75746	0.462000	0.41574	GAG	SKOR2	-	NULL	ENSG00000215474		0.701	SKOR2-002	NOVEL	basic|appris_candidate_longest	protein_coding	SKOR2	HGNC	protein_coding	OTTHUMT00000450685.2	51	0.00	0	C	NM_001037802		44773244	44773244	-1	no_errors	ENST00000425639	ensembl	human	novel	69_37n	nonsense	20	12.50	3	SNP	1.000	A
SLC10A4	201780	genome.wustl.edu	37	4	48486056	48486056	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr4:48486056G>A	ENST00000273861.4	+	1	697	c.478G>A	c.(478-480)Gcc>Acc	p.A160T		NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GCTGGCCCTCGCCTTCAAGCT	0.692																																						dbGAP											0													15.0	16.0	15.0					4																	48486056		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.478G>A	4.37:g.48486056G>A	ENSP00000273861:p.Ala160Thr		Q8WUZ2	Missense_Mutation	SNP	pfam_BilAc/Na_symport	p.A160T	ENST00000273861.4	37	c.478	CCDS3482.1	4	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760009	0.49468	.	.	ENSG00000145248	ENST00000273861	T	0.12465	2.68	5.21	-3.33	0.04958	.	1.047610	0.07360	N	0.883968	T	0.13970	0.0338	L	0.48260	1.515	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.37478	-0.9704	10	0.54805	T	0.06	-34.7823	13.1073	0.59253	0.6804:0.0:0.3196:0.0	.	160	Q96EP9	NTCP4_HUMAN	T	160	ENSP00000273861:A160T	ENSP00000273861:A160T	A	+	1	0	SLC10A4	48180813	0.001000	0.12720	0.000000	0.03702	0.993000	0.82548	0.012000	0.13287	-0.739000	0.04809	0.491000	0.48974	GCC	SLC10A4	-	pfam_BilAc/Na_symport	ENSG00000145248		0.692	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	13	0.00	0	G	NM_152679		48486056	48486056	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.000	A
SLC10A4	201780	genome.wustl.edu	37	4	48486056	48486056	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:48486056G>A	ENST00000273861.4	+	1	697	c.478G>A	c.(478-480)Gcc>Acc	p.A160T		NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GCTGGCCCTCGCCTTCAAGCT	0.692																																						dbGAP											0													15.0	16.0	15.0					4																	48486056		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.478G>A	4.37:g.48486056G>A	ENSP00000273861:p.Ala160Thr		Q8WUZ2	Missense_Mutation	SNP	pfam_BilAc/Na_symport	p.A160T	ENST00000273861.4	37	c.478	CCDS3482.1	4	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760009	0.49468	.	.	ENSG00000145248	ENST00000273861	T	0.12465	2.68	5.21	-3.33	0.04958	.	1.047610	0.07360	N	0.883968	T	0.13970	0.0338	L	0.48260	1.515	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.37478	-0.9704	10	0.54805	T	0.06	-34.7823	13.1073	0.59253	0.6804:0.0:0.3196:0.0	.	160	Q96EP9	NTCP4_HUMAN	T	160	ENSP00000273861:A160T	ENSP00000273861:A160T	A	+	1	0	SLC10A4	48180813	0.001000	0.12720	0.000000	0.03702	0.993000	0.82548	0.012000	0.13287	-0.739000	0.04809	0.491000	0.48974	GCC	SLC10A4	-	pfam_BilAc/Na_symport	ENSG00000145248		0.692	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	30	0.00	0	G	NM_152679		48486056	48486056	+1	no_errors	ENST00000273861	ensembl	human	known	69_37n	missense	17	46.88	15	SNP	0.000	A
SLC15A1	6564	genome.wustl.edu	37	13	99360958	99360958	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr13:99360958G>A	ENST00000376503.5	-	15	1186	c.1131C>T	c.(1129-1131)atC>atT	p.I377I		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	377					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CCACCTGCACGATGGCAGCCA	0.512																																						dbGAP											0													103.0	79.0	87.0					13																	99360958		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1131C>T	13.37:g.99360958G>A			Q5VW82	Silent	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.I377	ENST00000376503.5	37	c.1131	CCDS9489.1	13																																																																																			SLC15A1	-	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	ENSG00000088386		0.512	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	HGNC	protein_coding	OTTHUMT00000045560.3	30	0.00	0	G	NM_005073		99360958	99360958	-1	no_errors	ENST00000376503	ensembl	human	known	69_37n	silent	17	14.29	3	SNP	0.946	A
SLC16A5	9121	genome.wustl.edu	37	17	73100138	73100138	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:73100138C>A	ENST00000450736.2	+	5	1642	c.1227C>A	c.(1225-1227)gcC>gcA	p.A409A	SLC16A5_ENST00000580123.1_Silent_p.A409A|SLC16A5_ENST00000538213.2_Silent_p.A449A|SLC16A5_ENST00000329783.4_Silent_p.A409A			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	409					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCTCAGCTGCCCTCTTCATGG	0.552																																						dbGAP											0													125.0	118.0	120.0					17																	73100138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1227C>A	17.37:g.73100138C>A			B4E288	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.A409	ENST00000450736.2	37	c.1227	CCDS11713.1	17																																																																																			SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000170190		0.552	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	59	0.00	0	C	NM_004695		73100138	73100138	+1	no_errors	ENST00000329783	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.841	A
SLC19A1	6573	genome.wustl.edu	37	21	46934897	46934897	+	3'UTR	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:46934897G>A	ENST00000311124.4	-	0	2603				SLC19A1_ENST00000468508.1_5'UTR|SLC19A1_ENST00000380010.4_Missense_Mutation_p.P488L|SLC19A1_ENST00000567670.1_Intron	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	AGGTCAGGATGGACACACTTC	0.647																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.*675C>T	21.37:g.46934897G>A			B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.P488L	ENST00000311124.4	37	c.1463	CCDS13725.1	21	.	.	.	.	.	.	.	.	.	.	G	3.876	-0.026952	0.07589	.	.	ENSG00000173638	ENST00000380010	D	0.86297	-2.1	2.06	-4.11	0.03928	.	.	.	.	.	T	0.68824	0.3043	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.06405	0.002	T	0.53940	-0.8367	9	0.87932	D	0	.	4.0778	0.09912	0.0:0.2926:0.3956:0.3118	.	488	E9PFY4	.	L	488	ENSP00000369347:P488L	ENSP00000369347:P488L	P	-	2	0	SLC19A1	45759325	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.623000	0.02040	-1.300000	0.02341	-0.410000	0.06199	CCA	SLC19A1	-	NULL	ENSG00000173638		0.647	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	56	0.00	0	G			46934897	46934897	-1	no_errors	ENST00000380010	ensembl	human	putative	69_37n	missense	29	12.12	4	SNP	0.000	A
SLC35C2	51006	genome.wustl.edu	37	20	44978848	44978849	+	3'UTR	INS	-	-	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:44978848_44978849insA	ENST00000372227.1	-	0	1822_1823				SLC35C2_ENST00000243896.2_3'UTR|SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000372230.5_3'UTR|SLC35C2_ENST00000543605.1_3'UTR|SLC35C2_ENST00000317734.8_3'UTR|SLC35C2_ENST00000372229.1_3'UTR	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2						negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				GCCTGGTGCTCGCCCCTTGTGT	0.649																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.*185->T	20.37:g.44978848_44978849insA			B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	RNA	INS	-	NULL	ENST00000372227.1	37	NULL	CCDS13396.1	20																																																																																			SLC35C2	-	-	ENSG00000080189		0.649	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	HGNC	protein_coding	OTTHUMT00000080363.1	27	0.00	0	-	NM_015945		44978848	44978849	-1	no_errors	ENST00000493599	ensembl	human	known	69_37n	rna	8	20.00	2	INS	0.001:0.000	A
SLC35F3	148641	genome.wustl.edu	37	1	234040838	234040838	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:234040838G>A	ENST00000366618.3	+	1	160	c.15G>A	c.(13-15)gaG>gaA	p.E5E		NM_173508.2	NP_775779.1	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	0					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GGATTCGAGAGTTTCCCAGCG	0.716																																						dbGAP											0													21.0	23.0	22.0					1																	234040838		2182	4256	6438	-	-	-	SO:0001819	synonymous_variant	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366618.3:c.15G>A	1.37:g.234040838G>A			Q5TDD6|Q8N9C9	Silent	SNP	pfam_DMT,pfam_DUF250,pfam_DUF914_euk	p.E5	ENST00000366618.3	37	c.15	CCDS1600.1	1																																																																																			SLC35F3	-	NULL	ENSG00000183780		0.716	SLC35F3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000092579.2	29	0.00	0	G	NM_173508		234040838	234040838	+1	no_errors	ENST00000366618	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	1.000	A
SLC37A2	219855	genome.wustl.edu	37	11	124951757	124951757	+	Silent	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:124951757C>T	ENST00000403796.2	+	9	1141	c.840C>T	c.(838-840)tgC>tgT	p.C280C	SLC37A2_ENST00000407458.1_Silent_p.C280C|SLC37A2_ENST00000298280.5_Silent_p.C280C|SLC37A2_ENST00000308074.4_Silent_p.C280C	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	280					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		AGGGGCCATGCGAAGAGCCTG	0.557																																					Melanoma(11;373 620 21213 26083 47768)	dbGAP											0													60.0	59.0	59.0					11																	124951757		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.840C>T	11.37:g.124951757C>T			A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.C280	ENST00000403796.2	37	c.840	CCDS44757.1	11																																																																																			SLC37A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000134955		0.557	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	51	0.00	0	C	XM_166184		124951757	124951757	+1	no_errors	ENST00000308074	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.000	T
SLC4A2	6522	genome.wustl.edu	37	7	150773425	150773425	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:150773425G>A	ENST00000485713.1	+	23	4737	c.3697G>A	c.(3697-3699)Gag>Aag	p.E1233K	FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Missense_Mutation_p.E1219K|SLC4A2_ENST00000392826.2_Missense_Mutation_p.E1224K|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E1151K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E1233K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1233	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGTGTGGACGAGTACAATGA	0.642																																						dbGAP											0													75.0	59.0	64.0					7																	150773425		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3697G>A	7.37:g.150773425G>A	ENSP00000419412:p.Glu1233Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E1233K	ENST00000485713.1	37	c.3697	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965727	0.92855	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.76968	-1.06;-1.06;-1.04;-1.05;-1.06	5.08	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.86851	0.6032	M	0.86178	2.8	0.58432	D	0.999998	D;D;D	0.76494	0.994;0.999;0.998	D;D;P	0.67725	0.922;0.953;0.899	D	0.85951	0.1464	10	0.31617	T	0.26	.	12.6983	0.57016	0.0:0.167:0.833:0.0	.	1224;1219;1233	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	1233;1233;1151;1224;1219	ENSP00000419412:E1233K;ENSP00000405600:E1233K;ENSP00000311402:E1151K;ENSP00000376571:E1224K;ENSP00000419164:E1219K	ENSP00000311402:E1151K	E	+	1	0	SLC4A2	150404358	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.943000	0.87716	2.361000	0.80049	0.655000	0.94253	GAG	SLC4A2	-	tigrfam_HCO3_transpt_euk	ENSG00000164889		0.642	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	101	0.00	0	G	NM_003040		150773425	150773425	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	49	28.99	20	SNP	0.999	A
SLC4A2	6522	genome.wustl.edu	37	7	150773425	150773425	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr7:150773425G>A	ENST00000485713.1	+	23	4737	c.3697G>A	c.(3697-3699)Gag>Aag	p.E1233K	FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Missense_Mutation_p.E1219K|SLC4A2_ENST00000392826.2_Missense_Mutation_p.E1224K|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E1151K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E1233K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1233	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGTGTGGACGAGTACAATGA	0.642																																						dbGAP											0													75.0	59.0	64.0					7																	150773425		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3697G>A	7.37:g.150773425G>A	ENSP00000419412:p.Glu1233Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E1233K	ENST00000485713.1	37	c.3697	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965727	0.92855	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.76968	-1.06;-1.06;-1.04;-1.05;-1.06	5.08	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.86851	0.6032	M	0.86178	2.8	0.58432	D	0.999998	D;D;D	0.76494	0.994;0.999;0.998	D;D;P	0.67725	0.922;0.953;0.899	D	0.85951	0.1464	10	0.31617	T	0.26	.	12.6983	0.57016	0.0:0.167:0.833:0.0	.	1224;1219;1233	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	1233;1233;1151;1224;1219	ENSP00000419412:E1233K;ENSP00000405600:E1233K;ENSP00000311402:E1151K;ENSP00000376571:E1224K;ENSP00000419164:E1219K	ENSP00000311402:E1151K	E	+	1	0	SLC4A2	150404358	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.943000	0.87716	2.361000	0.80049	0.655000	0.94253	GAG	SLC4A2	-	tigrfam_HCO3_transpt_euk	ENSG00000164889		0.642	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	36	0.00	0	G	NM_003040		150773425	150773425	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.999	A
SLC4A2	6522	genome.wustl.edu	37	7	150773425	150773425	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:150773425G>A	ENST00000485713.1	+	23	4737	c.3697G>A	c.(3697-3699)Gag>Aag	p.E1233K	FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000461735.1_Missense_Mutation_p.E1219K|SLC4A2_ENST00000392826.2_Missense_Mutation_p.E1224K|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E1151K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E1233K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1233	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGTGTGGACGAGTACAATGA	0.642																																						dbGAP											0													75.0	59.0	64.0					7																	150773425		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3697G>A	7.37:g.150773425G>A	ENSP00000419412:p.Glu1233Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E1233K	ENST00000485713.1	37	c.3697	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965727	0.92855	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.76968	-1.06;-1.06;-1.04;-1.05;-1.06	5.08	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.86851	0.6032	M	0.86178	2.8	0.58432	D	0.999998	D;D;D	0.76494	0.994;0.999;0.998	D;D;P	0.67725	0.922;0.953;0.899	D	0.85951	0.1464	10	0.31617	T	0.26	.	12.6983	0.57016	0.0:0.167:0.833:0.0	.	1224;1219;1233	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	1233;1233;1151;1224;1219	ENSP00000419412:E1233K;ENSP00000405600:E1233K;ENSP00000311402:E1151K;ENSP00000376571:E1224K;ENSP00000419164:E1219K	ENSP00000311402:E1151K	E	+	1	0	SLC4A2	150404358	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.943000	0.87716	2.361000	0.80049	0.655000	0.94253	GAG	SLC4A2	-	tigrfam_HCO3_transpt_euk	ENSG00000164889		0.642	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	101	0.00	0	G	NM_003040		150773425	150773425	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	57	40.00	38	SNP	0.999	A
MIEF1	54471	genome.wustl.edu	37	22	39909831	39909831	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:39909831G>T	ENST00000325301.2	+	6	1319	c.895G>T	c.(895-897)Gag>Tag	p.E299*	MIEF1_ENST00000404569.1_Nonsense_Mutation_p.E299*|MIEF1_ENST00000402881.1_Nonsense_Mutation_p.E299*	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	299					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										CCTCACACTGGAGGTGCAGTA	0.567											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													70.0	64.0	66.0					22																	39909831		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.895G>T	22.37:g.39909831G>T	ENSP00000327124:p.Glu299*	889	Q7L890|Q9BUI3	Nonsense_Mutation	SNP	NULL	p.E299*	ENST00000325301.2	37	c.895	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	G	38	7.273337	0.98179	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-19.4965	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	299	.	ENSP00000327124:E299X	E	+	1	0	SMCR7L	38239777	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	9.858000	0.99539	2.884000	0.98904	0.655000	0.94253	GAG	SMCR7L	-	NULL	ENSG00000100335		0.567	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR7L	HGNC	protein_coding	OTTHUMT00000321325.1	57	0.00	0	G	NM_019008		39909831	39909831	+1	no_errors	ENST00000325301	ensembl	human	known	69_37n	nonsense	23	14.81	4	SNP	1.000	T
SNX8	29886	genome.wustl.edu	37	7	2297110	2297110	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:2297110G>T	ENST00000222990.3	-	9	1066	c.1024C>A	c.(1024-1026)Cac>Aac	p.H342N		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	342					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GCCCGCTGGTGCTTGTGCAAC	0.687																																						dbGAP											0													41.0	38.0	39.0					7																	2297110		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.1024C>A	7.37:g.2297110G>T	ENSP00000222990:p.His342Asn		A4D207|Q96I67	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.H342N	ENST00000222990.3	37	c.1024	CCDS5331.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.119151	0.94385	.	.	ENSG00000106266	ENST00000222990	T	0.21191	2.02	5.26	5.26	0.73747	.	0.056386	0.64402	D	0.000001	T	0.28928	0.0718	M	0.71581	2.175	0.58432	D	0.999992	B	0.22851	0.076	B	0.25759	0.063	T	0.05920	-1.0856	10	0.27082	T	0.32	.	18.8488	0.92218	0.0:0.0:1.0:0.0	.	342	Q9Y5X2	SNX8_HUMAN	N	342	ENSP00000222990:H342N	ENSP00000222990:H342N	H	-	1	0	SNX8	2263636	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.272000	0.95707	2.459000	0.83118	0.561000	0.74099	CAC	SNX8	-	NULL	ENSG00000106266		0.687	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2	48	0.00	0	G			2297110	2297110	-1	no_errors	ENST00000222990	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	T
SNX8	29886	genome.wustl.edu	37	7	2309218	2309218	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:2309218G>A	ENST00000222990.3	-	5	639	c.597C>T	c.(595-597)aaC>aaT	p.N199N		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	199					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CCAGCTTACAGTTCAGGAATT	0.393																																						dbGAP											0													80.0	70.0	74.0					7																	2309218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.597C>T	7.37:g.2309218G>A			A4D207|Q96I67	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.N199	ENST00000222990.3	37	c.597	CCDS5331.1	7																																																																																			SNX8	-	NULL	ENSG00000106266		0.393	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2	36	0.00	0	G			2309218	2309218	-1	no_errors	ENST00000222990	ensembl	human	known	69_37n	silent	24	13.79	4	SNP	0.995	A
SPHK1	8877	genome.wustl.edu	37	17	74383309	74383309	+	Missense_Mutation	SNP	C	C	T	rs149492135		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr17:74383309C>T	ENST00000545180.1	+	8	1606	c.797C>T	c.(796-798)tCg>tTg	p.S266L	SPHK1_ENST00000323374.4_Missense_Mutation_p.S352L|SPHK1_ENST00000392496.3_Missense_Mutation_p.S266L|SPHK1_ENST00000590959.1_Missense_Mutation_p.S280L|SPHK1_ENST00000592299.1_Missense_Mutation_p.S266L			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	266					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CTGCTGCACTCGCACCTGGGC	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		20394	0.0		0.001	False		,,,				2504	0.0				GBM(90;966 1307 27369 33775 44498)	dbGAP											0													62.0	46.0	51.0					17																	74383309		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.797C>T	17.37:g.74383309C>T	ENSP00000440970:p.Ser266Leu		Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.S352L	ENST00000545180.1	37	c.1055	CCDS45785.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	26.1	4.705336	0.89018	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.17528	2.27;2.27;2.27	5.08	4.09	0.47781	.	0.121929	0.56097	D	0.000025	T	0.40498	0.1119	M	0.87456	2.885	0.48696	D	0.999699	D;D;D	0.62365	0.981;0.967;0.991	P;P;P	0.54544	0.755;0.573;0.716	T	0.53521	-0.8427	10	0.72032	D	0.01	-20.0264	15.354	0.74412	0.0:0.8597:0.1403:0.0	.	352;280;266	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	L	266;352;266;265	ENSP00000440970:S266L;ENSP00000313681:S352L;ENSP00000376285:S266L	ENSP00000313681:S352L	S	+	2	0	SPHK1	71894904	1.000000	0.71417	0.646000	0.29493	0.821000	0.46438	7.309000	0.78937	1.084000	0.41184	0.563000	0.77884	TCG	SPHK1	-	NULL	ENSG00000176170		0.622	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPHK1	HGNC	protein_coding	OTTHUMT00000450113.1	32	0.00	0	C	NM_182965, NM_021972		74383309	74383309	+1	no_errors	ENST00000323374	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.999	T
SPHK1	8877	genome.wustl.edu	37	17	74383309	74383309	+	Missense_Mutation	SNP	C	C	T	rs149492135		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:74383309C>T	ENST00000545180.1	+	8	1606	c.797C>T	c.(796-798)tCg>tTg	p.S266L	SPHK1_ENST00000323374.4_Missense_Mutation_p.S352L|SPHK1_ENST00000392496.3_Missense_Mutation_p.S266L|SPHK1_ENST00000590959.1_Missense_Mutation_p.S280L|SPHK1_ENST00000592299.1_Missense_Mutation_p.S266L			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	266					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CTGCTGCACTCGCACCTGGGC	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		20394	0.0		0.001	False		,,,				2504	0.0				GBM(90;966 1307 27369 33775 44498)	dbGAP											0													62.0	46.0	51.0					17																	74383309		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.797C>T	17.37:g.74383309C>T	ENSP00000440970:p.Ser266Leu		Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.S352L	ENST00000545180.1	37	c.1055	CCDS45785.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	26.1	4.705336	0.89018	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.17528	2.27;2.27;2.27	5.08	4.09	0.47781	.	0.121929	0.56097	D	0.000025	T	0.40498	0.1119	M	0.87456	2.885	0.48696	D	0.999699	D;D;D	0.62365	0.981;0.967;0.991	P;P;P	0.54544	0.755;0.573;0.716	T	0.53521	-0.8427	10	0.72032	D	0.01	-20.0264	15.354	0.74412	0.0:0.8597:0.1403:0.0	.	352;280;266	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	L	266;352;266;265	ENSP00000440970:S266L;ENSP00000313681:S352L;ENSP00000376285:S266L	ENSP00000313681:S352L	S	+	2	0	SPHK1	71894904	1.000000	0.71417	0.646000	0.29493	0.821000	0.46438	7.309000	0.78937	1.084000	0.41184	0.563000	0.77884	TCG	SPHK1	-	NULL	ENSG00000176170		0.622	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPHK1	HGNC	protein_coding	OTTHUMT00000450113.1	65	0.00	0	C	NM_182965, NM_021972		74383309	74383309	+1	no_errors	ENST00000323374	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.999	T
SSBP3	23648	genome.wustl.edu	37	1	54717521	54717521	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:54717521C>A	ENST00000371320.3	-	8	930	c.520G>T	c.(520-522)Gtt>Ttt	p.V174F	SSBP3_ENST00000371319.3_Missense_Mutation_p.V147F|SSBP3_ENST00000357475.4_Missense_Mutation_p.V154F|SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000417664.2_Missense_Mutation_p.V64F	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	174	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GTCCCAGGAACTCCTCCCGGA	0.617																																						dbGAP											0													48.0	42.0	44.0					1																	54717521		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.520G>T	1.37:g.54717521C>A	ENSP00000360371:p.Val174Phe		A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	pfam_SSDP_ss-bd,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.V174F	ENST00000371320.3	37	c.520	CCDS591.1	1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756295	0.69648	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475;ENST00000444533;ENST00000525990	.	.	.	4.51	4.51	0.55191	.	0.084341	0.47455	U	0.000224	T	0.58524	0.2128	L	0.47190	1.495	0.40191	D	0.977401	D;P;P	0.56035	0.974;0.845;0.872	P;P;P	0.51229	0.663;0.481;0.616	T	0.54221	-0.8326	9	0.10377	T	0.69	-1.0073	17.7791	0.88518	0.0:1.0:0.0:0.0	.	147;154;174	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	F	64;174;147;154;5;37	.	ENSP00000350067:V154F	V	-	1	0	SSBP3	54490109	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.284000	0.51708	2.499000	0.84300	0.655000	0.94253	GTT	SSBP3	-	pfam_SSDP_ss-bd	ENSG00000157216		0.617	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP3	HGNC	protein_coding	OTTHUMT00000022721.1	84	0.00	0	C	NM_018070		54717521	54717521	-1	no_errors	ENST00000371320	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
STAG3	10734	genome.wustl.edu	37	7	99795228	99795228	+	Intron	SNP	G	G	T	rs2405730		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:99795228G>T	ENST00000426455.1	+	11	1472				STAG3_ENST00000317296.5_Intron|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000394018.2_Intron	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGATCCTTTTGTTTTTTAAGT	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1066-173G>T	7.37:g.99795228G>T			A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	RNA	SNP	-	NULL	ENST00000426455.1	37	NULL	CCDS34703.1	7																																																																																			STAG3	-	-	ENSG00000066923		0.458	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	46	0.00	0	G	NM_012447		99795228	99795228	+1	no_errors	ENST00000440830	ensembl	human	known	69_37n	rna	38	15.56	7	SNP	0.000	T
STARD13	90627	genome.wustl.edu	37	13	33704162	33704162	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr13:33704162C>A	ENST00000336934.5	-	5	768	c.652G>T	c.(652-654)Gac>Tac	p.D218Y	STARD13_ENST00000399365.3_Missense_Mutation_p.D100Y|STARD13_ENST00000255486.4_Missense_Mutation_p.D210Y	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	218					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ACCGGGTTGTCTGTACAGCAC	0.627																																						dbGAP											0													41.0	45.0	43.0					13																	33704162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.652G>T	13.37:g.33704162C>A	ENSP00000338785:p.Asp218Tyr		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.D218Y	ENST00000336934.5	37	c.652	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953447	0.34471	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.06687	3.27;3.28;3.28	5.6	4.76	0.60689	.	0.292006	0.36854	N	0.002363	T	0.13157	0.0319	L	0.29908	0.895	0.80722	D	1	D;P;P;P	0.55385	0.971;0.855;0.485;0.855	P;P;B;P	0.56823	0.807;0.579;0.192;0.69	T	0.04825	-1.0924	10	0.40728	T	0.16	.	11.021	0.47718	0.0:0.7998:0.1304:0.0698	.	210;183;218;210	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	Y	100;210;218;210	ENSP00000382300:D100Y;ENSP00000255486:D210Y;ENSP00000338785:D218Y	ENSP00000255486:D210Y	D	-	1	0	STARD13	32602162	0.981000	0.34729	0.219000	0.23793	0.174000	0.22865	4.030000	0.57260	1.360000	0.45960	0.655000	0.94253	GAC	STARD13	-	NULL	ENSG00000133121		0.627	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	37	0.00	0	C	NM_001243466		33704162	33704162	-1	no_errors	ENST00000336934	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	0.945	A
STARD3	10948	genome.wustl.edu	37	17	37809761	37809761	+	5'UTR	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr17:37809761G>T	ENST00000336308.5	+	0	195				STARD3_ENST00000578232.1_Intron|STARD3_ENST00000544210.2_5'UTR|STARD3_ENST00000580611.1_5'UTR|STARD3_ENST00000394250.4_5'UTR	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3						cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CGCCCTCCCCGCCCTGAGGTG	0.701																																						dbGAP											0													17.0	18.0	18.0					17																	37809761		2198	4293	6491	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.-24G>T	17.37:g.37809761G>T			A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	RNA	SNP	-	NULL	ENST00000336308.5	37	NULL	CCDS11341.1	17																																																																																			STARD3	-	-	ENSG00000131748		0.701	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	45	0.00	0	G			37809761	37809761	+1	no_errors	ENST00000460894	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.000	T
STK10	6793	genome.wustl.edu	37	5	171482663	171482663	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr5:171482663C>T	ENST00000176763.5	-	16	2798	c.2455G>A	c.(2455-2457)Gcc>Acc	p.A819T		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	819	Gln-rich.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGTACATGGCCATGCGCGTC	0.632																																						dbGAP											0													49.0	40.0	43.0					5																	171482663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2455G>A	5.37:g.171482663C>T	ENSP00000176763:p.Ala819Thr		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Nonsense_Mutation	SNP	pfam_PKK	p.W91*	ENST00000176763.5	37	c.273	CCDS34290.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.87|17.87	3.494663|3.494663	0.64186|0.64186	.|.	.|.	ENSG00000072786|ENSG00000072786	ENST00000176763;ENST00000545839|ENST00000520476	T|.	0.30981|.	1.51|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.111526|.	0.64402|.	D|.	0.000009|.	T|.	0.61198|.	0.2328|.	L|L	0.53671|0.53671	1.685|1.685	0.42720|0.42720	D|D	0.99367|0.99367	P|.	0.46578|.	0.88|.	P|.	0.50934|.	0.654|.	T|.	0.59883|.	-0.7370|.	10|.	0.28530|.	T|.	0.3|.	.|.	10.2862|10.2862	0.43568|0.43568	0.0:0.9103:0.0:0.0897|0.0:0.9103:0.0:0.0897	.|.	819|.	O94804|.	STK10_HUMAN|.	T|X	819|91	ENSP00000176763:A819T|.	ENSP00000176763:A819T|.	A|W	-|-	1|3	0|0	STK10|STK10	171415268|171415268	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	2.081000|2.081000	0.41596|0.41596	2.571000|2.571000	0.86741|0.86741	0.561000|0.561000	0.74099|0.74099	GCC|TGG	STK10	-	pfam_PKK	ENSG00000072786		0.632	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	56	0.00	0	C	NM_005990		171482663	171482663	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000520476	ensembl	human	putative	69_37n	nonsense	18	14.29	3	SNP	1.000	T
SYNC	81493	genome.wustl.edu	37	1	33161497	33161497	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:33161497C>A	ENST00000409190.3	-	2	660	c.202G>T	c.(202-204)Gat>Tat	p.D68Y	SYNC_ENST00000373484.3_Missense_Mutation_p.D68Y	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	68	Head.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						AGTGTCTCATCAAGGTCACCT	0.517																																						dbGAP											0													131.0	107.0	114.0					1																	33161497		692	1591	2283	-	-	-	SO:0001583	missense	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.202G>T	1.37:g.33161497C>A	ENSP00000386439:p.Asp68Tyr		B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	pfam_F	p.D68Y	ENST00000409190.3	37	c.202	CCDS367.2	1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736462	0.89482	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	T;T	0.26067	1.76;1.76	4.85	4.85	0.62838	.	.	.	.	.	T	0.41305	0.1153	L	0.56769	1.78	0.09310	N	0.999995	D;D	0.61080	0.986;0.989	P;P	0.55667	0.748;0.781	T	0.24154	-1.0168	9	0.87932	D	0	-0.7104	13.8383	0.63424	0.0:1.0:0.0:0.0	.	68;68	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	Y	68	ENSP00000362583:D68Y;ENSP00000386439:D68Y	ENSP00000362583:D68Y	D	-	1	0	SYNC	32934084	0.967000	0.33354	0.443000	0.26883	0.702000	0.40608	2.953000	0.49105	2.426000	0.82243	0.561000	0.74099	GAT	SYNC	-	NULL	ENSG00000162520		0.517	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3	39	0.00	0	C	NM_030786		33161497	33161497	-1	no_errors	ENST00000409190	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.260	A
TBC1D17	79735	genome.wustl.edu	37	19	50385589	50385589	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:50385589G>T	ENST00000221543.5	+	7	1029	c.730G>T	c.(730-732)Gga>Tga	p.G244*	TBC1D17_ENST00000535102.2_Nonsense_Mutation_p.G211*	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	244	Required for interaction with OPTN.				autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		ACAGCCTGAGGGAGCCGCCTC	0.622																																						dbGAP											0													79.0	79.0	79.0					19																	50385589		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.730G>T	19.37:g.50385589G>T	ENSP00000221543:p.Gly244*		B4DT12|B9A6L8|F5H1W7	Nonsense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G244*	ENST00000221543.5	37	c.730	CCDS12785.1	19	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021306	0.93462	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	.	.	.	4.77	4.77	0.60923	.	0.686338	0.14602	N	0.309545	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-40.3028	15.3231	0.74139	0.0:0.0:1.0:0.0	.	.	.	.	X	244;211	.	ENSP00000221543:G244X	G	+	1	0	TBC1D17	55077401	1.000000	0.71417	0.994000	0.49952	0.038000	0.13279	4.172000	0.58243	2.499000	0.84300	0.467000	0.42956	GGA	TBC1D17	-	NULL	ENSG00000104946		0.622	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	75	0.00	0	G	NM_024682		50385589	50385589	+1	no_errors	ENST00000221543	ensembl	human	known	69_37n	nonsense	36	10.00	4	SNP	0.959	T
TBX19	9095	genome.wustl.edu	37	1	168283456	168283456	+	3'UTR	SNP	C	C	G			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:168283456C>G	ENST00000367821.3	+	0	2614				TBX19_ENST00000465440.1_3'UTR	NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					tctgatctatctctgctcgct	0.493																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.*1216C>G	1.37:g.168283456C>G			Q52M53	RNA	SNP	-	NULL	ENST00000367821.3	37	NULL	CCDS1272.1	1																																																																																			TBX19	-	-	ENSG00000143178		0.493	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX19	HGNC	protein_coding	OTTHUMT00000083825.1	74	0.00	0	C	NM_005149		168283456	168283456	+1	no_errors	ENST00000465440	ensembl	human	known	69_37n	rna	38	20.83	10	SNP	0.000	G
TBX19	9095	genome.wustl.edu	37	1	168283456	168283456	+	3'UTR	SNP	C	C	G			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:168283456C>G	ENST00000367821.3	+	0	2614				TBX19_ENST00000465440.1_3'UTR	NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					tctgatctatctctgctcgct	0.493																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.*1216C>G	1.37:g.168283456C>G			Q52M53	RNA	SNP	-	NULL	ENST00000367821.3	37	NULL	CCDS1272.1	1																																																																																			TBX19	-	-	ENSG00000143178		0.493	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX19	HGNC	protein_coding	OTTHUMT00000083825.1	74	0.00	0	C	NM_005149		168283456	168283456	+1	no_errors	ENST00000465440	ensembl	human	known	69_37n	rna	65	34.34	34	SNP	0.000	G
TCF12	6938	genome.wustl.edu	37	15	57213290	57213290	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr15:57213290delG	ENST00000267811.5	+	3	446	c.142delG	c.(142-144)ggafs	p.G48fs	ZNF280D_ENST00000559000.1_5'Flank|ZNF280D_ENST00000561122.1_5'Flank|TCF12_ENST00000557843.1_Frame_Shift_Del_p.G48fs|TCF12_ENST00000452095.2_Frame_Shift_Del_p.G48fs|TCF12_ENST00000438423.2_Frame_Shift_Del_p.G48fs|TCF12_ENST00000333725.5_Frame_Shift_Del_p.G48fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	48					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TCAATTCAGTGGATCAGGTAA	0.333			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													73.0	67.0	69.0					15																	57213290		2192	4292	6484	-	-	-	SO:0001589	frameshift_variant	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.142delG	15.37:g.57213290delG	ENSP00000267811:p.Gly48fs		Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G48fs	ENST00000267811.5	37	c.142	CCDS10159.1	15																																																																																			TCF12	-	NULL	ENSG00000140262		0.333	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	54	0.00	0	G	NM_003205		57213290	57213290	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	frame_shift_del	37	13.64	6	DEL	1.000	-
TCF12	6938	genome.wustl.edu	37	15	57213290	57213290	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:57213290delG	ENST00000267811.5	+	3	446	c.142delG	c.(142-144)ggafs	p.G48fs	ZNF280D_ENST00000559000.1_5'Flank|ZNF280D_ENST00000561122.1_5'Flank|TCF12_ENST00000557843.1_Frame_Shift_Del_p.G48fs|TCF12_ENST00000452095.2_Frame_Shift_Del_p.G48fs|TCF12_ENST00000438423.2_Frame_Shift_Del_p.G48fs|TCF12_ENST00000333725.5_Frame_Shift_Del_p.G48fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	48					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TCAATTCAGTGGATCAGGTAA	0.333			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													73.0	67.0	69.0					15																	57213290		2192	4292	6484	-	-	-	SO:0001589	frameshift_variant	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.142delG	15.37:g.57213290delG	ENSP00000267811:p.Gly48fs		Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G48fs	ENST00000267811.5	37	c.142	CCDS10159.1	15																																																																																			TCF12	-	NULL	ENSG00000140262		0.333	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	35	0.00	0	G	NM_003205		57213290	57213290	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	frame_shift_del	29	17.14	6	DEL	1.000	-
TCP11L2	255394	genome.wustl.edu	37	12	106712207	106712207	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:106712207G>T	ENST00000299045.3	+	4	553	c.379G>T	c.(379-381)Gaa>Taa	p.E127*	TCP11L2_ENST00000546625.1_Nonsense_Mutation_p.E127*|TCP11L2_ENST00000547153.1_Nonsense_Mutation_p.E127*	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	127										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						TCCTGAGTTTGAACATGCCAT	0.458																																						dbGAP											0													156.0	136.0	143.0					12																	106712207		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.379G>T	12.37:g.106712207G>T	ENSP00000299045:p.Glu127*		B2RA65|G3V1Y9	Nonsense_Mutation	SNP	pfam_Tcp11	p.E127*	ENST00000299045.3	37	c.379	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.542356	0.96474	.	.	ENSG00000166046	ENST00000547153;ENST00000299045;ENST00000546625;ENST00000553098;ENST00000551802	.	.	.	5.15	5.15	0.70609	.	0.359901	0.34245	N	0.004135	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-18.9265	18.9946	0.92807	0.0:0.0:1.0:0.0	.	.	.	.	X	127	.	ENSP00000299045:E127X	E	+	1	0	TCP11L2	105236337	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.662000	0.54510	2.562000	0.86427	0.655000	0.94253	GAA	TCP11L2	-	pfam_Tcp11	ENSG00000166046		0.458	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	41	0.00	0	G	NM_152772		106712207	106712207	+1	no_errors	ENST00000299045	ensembl	human	known	69_37n	nonsense	18	14.29	3	SNP	1.000	T
TEAD1	7003	genome.wustl.edu	37	11	12902571	12902571	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr11:12902571delA	ENST00000526600.1	+	2	420	c.197delA	c.(196-198)caafs	p.Q66fs	TEAD1_ENST00000361905.4_Frame_Shift_Del_p.Q147fs|TEAD1_ENST00000527575.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000527636.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000361985.2_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000334310.6_Frame_Shift_Del_p.Q151fs			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	162					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGAATGATTCAAACAGGGCAG	0.537																																						dbGAP											0													179.0	158.0	165.0					11																	12902571		2200	4294	6494	-	-	-	SO:0001589	frameshift_variant	0			X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.197delA	11.37:g.12902571delA	ENSP00000435393:p.Gln66fs		A4FUP2|E7EV65	Frame_Shift_Del	DEL	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.T148fs	ENST00000526600.1	37	c.440		11																																																																																			TEAD1	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000187079		0.537	TEAD1-007	PUTATIVE	basic	protein_coding	TEAD1	HGNC	protein_coding	OTTHUMT00000387220.1	80	0.00	0	A	NM_021961		12902571	12902571	+1	no_errors	ENST00000361905	ensembl	human	known	69_37n	frame_shift_del	21	52.27	23	DEL	1.000	-
TEAD1	7003	genome.wustl.edu	37	11	12902571	12902571	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:12902571delA	ENST00000526600.1	+	2	420	c.197delA	c.(196-198)caafs	p.Q66fs	TEAD1_ENST00000361905.4_Frame_Shift_Del_p.Q147fs|TEAD1_ENST00000527575.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000527636.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000361985.2_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000334310.6_Frame_Shift_Del_p.Q151fs			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	162					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGAATGATTCAAACAGGGCAG	0.537																																						dbGAP											0													179.0	158.0	165.0					11																	12902571		2200	4294	6494	-	-	-	SO:0001589	frameshift_variant	0			X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.197delA	11.37:g.12902571delA	ENSP00000435393:p.Gln66fs		A4FUP2|E7EV65	Frame_Shift_Del	DEL	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.T148fs	ENST00000526600.1	37	c.440		11																																																																																			TEAD1	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000187079		0.537	TEAD1-007	PUTATIVE	basic	protein_coding	TEAD1	HGNC	protein_coding	OTTHUMT00000387220.1	81	0.00	0	A	NM_021961		12902571	12902571	+1	no_errors	ENST00000361905	ensembl	human	known	69_37n	frame_shift_del	26	50.94	27	DEL	1.000	-
TEAD1	7003	genome.wustl.edu	37	11	12902571	12902571	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:12902571delA	ENST00000526600.1	+	2	420	c.197delA	c.(196-198)caafs	p.Q66fs	TEAD1_ENST00000361905.4_Frame_Shift_Del_p.Q147fs|TEAD1_ENST00000527575.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000527636.1_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000361985.2_Frame_Shift_Del_p.Q162fs|TEAD1_ENST00000334310.6_Frame_Shift_Del_p.Q151fs			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	162					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGAATGATTCAAACAGGGCAG	0.537																																						dbGAP											0													179.0	158.0	165.0					11																	12902571		2200	4294	6494	-	-	-	SO:0001589	frameshift_variant	0			X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.197delA	11.37:g.12902571delA	ENSP00000435393:p.Gln66fs		A4FUP2|E7EV65	Frame_Shift_Del	DEL	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.T148fs	ENST00000526600.1	37	c.440		11																																																																																			TEAD1	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000187079		0.537	TEAD1-007	PUTATIVE	basic	protein_coding	TEAD1	HGNC	protein_coding	OTTHUMT00000387220.1	81	0.00	0	A	NM_021961		12902571	12902571	+1	no_errors	ENST00000361905	ensembl	human	known	69_37n	frame_shift_del	22	37.14	13	DEL	1.000	-
TEC	7006	genome.wustl.edu	37	4	48147523	48147523	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:48147523C>A	ENST00000381501.3	-	13	1312	c.1155G>T	c.(1153-1155)agG>agT	p.R385S	TEC_ENST00000511471.2_5'UTR	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.R385S(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						ATTTGCCAAGCCTCACCACTC	0.458																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											156.0	136.0	143.0					4																	48147523		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1155G>T	4.37:g.48147523C>A	ENSP00000370912:p.Arg385Ser		B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom	p.R385S	ENST00000381501.3	37	c.1155	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331700	0.41297	.	.	ENSG00000135605	ENST00000381501	T	0.62105	0.05	5.62	3.65	0.41850	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	N	0.22421	0.69	0.44619	D	0.997598	D	0.56521	0.976	P	0.60286	0.872	T	0.54417	-0.8297	10	0.21540	T	0.41	.	1.2784	0.02035	0.2444:0.4213:0.1413:0.193	.	385	P42680	TEC_HUMAN	S	385	ENSP00000370912:R385S	ENSP00000370912:R385S	R	-	3	2	TEC	47842280	0.762000	0.28451	1.000000	0.80357	0.992000	0.81027	0.088000	0.14979	0.547000	0.28938	0.491000	0.48974	AGG	TEC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135605		0.458	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3	42	0.00	0	C			48147523	48147523	-1	no_errors	ENST00000381501	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
TET2	54790	genome.wustl.edu	37	4	106155230	106155230	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:106155230C>A	ENST00000540549.1	+	3	991	c.131C>A	c.(130-132)gCt>gAt	p.A44D	TET2_ENST00000394764.1_Missense_Mutation_p.A44D|TET2_ENST00000305737.2_Missense_Mutation_p.A44D|TET2_ENST00000545826.1_Missense_Mutation_p.A44D|TET2_ENST00000413648.2_Missense_Mutation_p.A44D|TET2_ENST00000380013.4_Missense_Mutation_p.A44D|TET2_ENST00000513237.1_Missense_Mutation_p.A65D			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	44					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CCTGAGAGAGCTCATCCAGAA	0.478			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													79.0	77.0	77.0					4																	106155230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.131C>A	4.37:g.106155230C>A	ENSP00000442788:p.Ala44Asp		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.A44D	ENST00000540549.1	37	c.131	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	3.373	-0.127919	0.06753	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110;ENST00000514870	T;T;T;T;T;T;T;T	0.31247	3.82;4.46;3.82;4.45;4.46;3.82;3.83;1.5	5.4	2.76	0.32466	.	0.643008	0.12841	U	0.434813	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.06405	0.0;0.0;0.002	T	0.18429	-1.0337	10	0.72032	D	0.01	.	3.6526	0.08209	0.1384:0.586:0.1335:0.1421	.	65;44;44	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	D	44;44;44;65;44;44;44;44;44	ENSP00000306705:A44D;ENSP00000442788:A44D;ENSP00000442867:A44D;ENSP00000425443:A65D;ENSP00000369351:A44D;ENSP00000378245:A44D;ENSP00000391448:A44D;ENSP00000426885:A44D	ENSP00000265149:A44D	A	+	2	0	TET2	106374679	0.001000	0.12720	0.323000	0.25347	0.052000	0.14988	0.846000	0.27682	0.670000	0.31165	-0.189000	0.12847	GCT	TET2	-	NULL	ENSG00000168769		0.478	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	35	0.00	0	C	NM_017628		106155230	106155230	+1	no_errors	ENST00000380013	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.001	A
TH	7054	genome.wustl.edu	37	11	2188135	2188135	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:2188135C>A	ENST00000381178.1	-	8	934	c.916G>T	c.(916-918)Gtc>Ttc	p.V306F	TH_ENST00000333684.5_Intron|TH_ENST00000381175.1_Missense_Mutation_p.V302F|TH_ENST00000352909.3_Missense_Mutation_p.V275F	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	306					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	AAGCGGGAGACGTCCTCCAGC	0.706																																						dbGAP											0													20.0	20.0	20.0					11																	2188135		2182	4284	6466	-	-	-	SO:0001583	missense	0			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.916G>T	11.37:g.2188135C>A	ENSP00000370571:p.Val306Phe		B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_Tyrosine_hydroxylase_CS,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Tyr_3_mOase	p.V306F	ENST00000381178.1	37	c.916	CCDS7731.1	11	.	.	.	.	.	.	.	.	.	.	C	19.38	3.816409	0.70912	.	.	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909	D;D;D	0.99722	-6.53;-6.53;-6.53	3.32	3.32	0.38043	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99789	0.9911	H	0.95950	3.745	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96739	0.9545	10	0.87932	D	0	-24.6502	14.1573	0.65426	0.0:1.0:0.0:0.0	.	279;275;306;302	B7ZL73;P07101-3;P07101;P07101-2	.;.;TY3H_HUMAN;.	F	306;302;275	ENSP00000370571:V306F;ENSP00000370567:V302F;ENSP00000325951:V275F	ENSP00000325951:V275F	V	-	1	0	TH	2144711	1.000000	0.71417	0.998000	0.56505	0.505000	0.33919	5.327000	0.65881	1.860000	0.53959	0.313000	0.20887	GTC	TH	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Tyr_3_mOase	ENSG00000180176		0.706	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TH	HGNC	protein_coding	OTTHUMT00000026597.1	49	0.00	0	C	NM_000360		2188135	2188135	-1	no_errors	ENST00000381178	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	A
THNSL1	79896	genome.wustl.edu	37	10	25313195	25313195	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:25313195G>A	ENST00000524413.1	+	3	1390	c.1043G>A	c.(1042-1044)gGa>gAa	p.G348E	THNSL1_ENST00000376356.4_Missense_Mutation_p.G348E			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	348						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GGACCAACAGGATCATTTAAA	0.413																																						dbGAP											0													87.0	80.0	82.0					10																	25313195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.1043G>A	10.37:g.25313195G>A	ENSP00000434887:p.Gly348Glu		B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	pfam_Shikimate_kinase,pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,prints_Shikimate_kinase,tigrfam_Thr_synthase	p.G348E	ENST00000524413.1	37	c.1043	CCDS7147.1	10	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354187	0.41700	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	D;D	0.98550	-4.99;-4.99	5.71	5.71	0.89125	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.123219	0.52532	D	0.000080	D	0.97511	0.9185	L	0.61218	1.895	0.42356	D	0.992395	P	0.39920	0.695	P	0.46026	0.501	D	0.96757	0.9558	10	0.31617	T	0.26	-31.2542	14.3211	0.66487	0.0:0.2645:0.7355:0.0	.	348	Q8IYQ7	THNS1_HUMAN	E	348	ENSP00000434887:G348E;ENSP00000365534:G348E	ENSP00000365534:G348E	G	+	2	0	THNSL1	25353201	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	5.384000	0.66225	2.700000	0.92200	0.650000	0.86243	GGA	THNSL1	-	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000185875		0.413	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	THNSL1	HGNC	protein_coding	OTTHUMT00000394913.1	55	0.00	0	G	NM_024838		25313195	25313195	+1	no_errors	ENST00000376356	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	A
THRB	7068	genome.wustl.edu	37	3	24231793	24231793	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:24231793G>T	ENST00000356447.4	-	4	339	c.55C>A	c.(55-57)Cac>Aac	p.H19N	THRB_ENST00000416420.1_Missense_Mutation_p.H19N|THRB_ENST00000396671.2_Missense_Mutation_p.H19N	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	19	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCTGGACAGTGCTTCGGTTTG	0.478																																					Melanoma(21;896 1043 15021 37958)	dbGAP											0													157.0	141.0	146.0					3																	24231793		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.55C>A	3.37:g.24231793G>T	ENSP00000348827:p.His19Asn		B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.H19N	ENST00000356447.4	37	c.55	CCDS2641.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.54|12.54	1.967426|1.967426	0.34754|0.34754	.|.	.|.	ENSG00000151090|ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000415021;ENST00000447875;ENST00000453729;ENST00000431815;ENST00000447414;ENST00000428492;ENST00000418247|ENST00000416811	D;D;D|.	0.93189|.	-3.18;-3.18;-3.18|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|.	.|.	.|.	.|.	T|T	0.39860|0.39860	0.1094|0.1094	N|N	0.19112|0.19112	0.55|0.55	0.24027|0.24027	N|N	0.996123|0.996123	B|.	0.16166|.	0.016|.	B|.	0.14023|.	0.01|.	T|T	0.42447|0.42447	-0.9451|-0.9451	9|6	0.40728|0.87932	T|D	0.16|0	.|.	15.0971|15.0971	0.72244|0.72244	0.0:0.0:0.8584:0.1416|0.0:0.0:0.8584:0.1416	.|.	19|.	P10828|.	THB_HUMAN|.	N|R	19|18	ENSP00000379904:H19N;ENSP00000348827:H19N;ENSP00000414444:H19N|.	ENSP00000348827:H19N|ENSP00000414401:S18R	H|S	-|-	1|3	0|2	THRB|THRB	24206797|24206797	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.986000|0.986000	0.74619|0.74619	4.076000|4.076000	0.57591|0.57591	2.805000|2.805000	0.96524|0.96524	0.655000|0.655000	0.94253|0.94253	CAC|AGC	THRB	-	NULL	ENSG00000151090		0.478	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3	42	0.00	0	G	NM_000461		24231793	24231793	-1	no_errors	ENST00000356447	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.974	T
TLN2	83660	genome.wustl.edu	37	15	63012031	63012031	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr15:63012031C>A	ENST00000561311.1	+	24	3173	c.2943C>A	c.(2941-2943)gaC>gaA	p.D981E	TLN2_ENST00000306829.6_Missense_Mutation_p.D981E			Q9Y4G6	TLN2_HUMAN	talin 2	981	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AAGCTGAAGACCTGAGTGCCC	0.572																																						dbGAP											0													81.0	61.0	68.0					15																	63012031		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2943C>A	15.37:g.63012031C>A	ENSP00000453508:p.Asp981Glu		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.D981E	ENST00000561311.1	37	c.2943	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101271	0.37048	.	.	ENSG00000171914	ENST00000306829	T	0.69806	-0.43	5.75	1.27	0.21489	.	0.084744	0.85682	D	0.000000	T	0.59851	0.2224	M	0.65498	2.005	0.43852	D	0.99644	B	0.02656	0.0	B	0.08055	0.003	T	0.55798	-0.8084	10	0.39692	T	0.17	-28.4587	9.4757	0.38869	0.0:0.6063:0.0:0.3937	.	981	Q9Y4G6	TLN2_HUMAN	E	981	ENSP00000303476:D981E	ENSP00000303476:D981E	D	+	3	2	TLN2	60799323	0.999000	0.42202	1.000000	0.80357	0.864000	0.49448	0.708000	0.25719	0.460000	0.27045	-0.142000	0.14014	GAC	TLN2	-	NULL	ENSG00000171914		0.572	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	66	0.00	0	C			63012031	63012031	+1	no_errors	ENST00000306829	ensembl	human	known	69_37n	missense	34	10.26	4	SNP	0.983	A
TM6SF2	53345	genome.wustl.edu	37	19	19378520	19378520	+	Silent	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:19378520C>A	ENST00000389363.4	-	8	786	c.714G>T	c.(712-714)gtG>gtT	p.V238V	AC138430.4_ENST00000586064.2_RNA|TM6SF2_ENST00000586107.1_5'Flank	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	238						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			AATCAAGCACCACCTGGAGCA	0.592																																						dbGAP											0													52.0	53.0	53.0					19																	19378520		1998	4172	6170	-	-	-	SO:0001819	synonymous_variant	0			AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.714G>T	19.37:g.19378520C>A			Q0IJ64	Silent	SNP	pfam_Transmembrane_6/97	p.V238	ENST00000389363.4	37	c.714	CCDS42528.1	19																																																																																			TM6SF2	-	pfam_Transmembrane_6/97	ENSG00000213996		0.592	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM6SF2	HGNC	protein_coding	OTTHUMT00000460122.2	21	0.00	0	C	NM_203510		19378520	19378520	-1	no_errors	ENST00000389363	ensembl	human	known	69_37n	silent	9	25.00	3	SNP	0.999	A
TMEM150A	129303	genome.wustl.edu	37	2	85827065	85827065	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:85827065G>T	ENST00000409668.1	-	5	812	c.345C>A	c.(343-345)ctC>ctA	p.L115L	TMEM150A_ENST00000334462.5_Silent_p.L115L|TMEM150A_ENST00000306353.3_Silent_p.L62L			Q86TG1	T150A_HUMAN	transmembrane protein 150A	115					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						AGCCTGTGATGAGTGCCGTGG	0.587																																						dbGAP											0													113.0	99.0	104.0					2																	85827065		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.345C>A	2.37:g.85827065G>T			A8K764|B7WPQ9|D6W5L2|Q8N2R6	Silent	SNP	pfam_Frag1/DRAM/Sfk1	p.L115	ENST00000409668.1	37	c.345	CCDS33233.1	2																																																																																			TMEM150A	-	pfam_Frag1/DRAM/Sfk1	ENSG00000168890		0.587	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM150A	HGNC	protein_coding	OTTHUMT00000329474.1	72	0.00	0	G	NM_153342		85827065	85827065	-1	no_errors	ENST00000334462	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	1.000	T
TMEM200C	645369	genome.wustl.edu	37	18	5890355	5890355	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:5890355C>T	ENST00000581347.2	-	3	2353	c.1708G>A	c.(1708-1710)Gcg>Acg	p.A570T	TMEM200C_ENST00000383490.2_Missense_Mutation_p.A570T|RP11-945C19.4_ENST00000577694.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	570						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CTCTGCTCCGCACCCAGAACG	0.647																																						dbGAP											0													27.0	29.0	29.0					18																	5890355		1856	4096	5952	-	-	-	SO:0001583	missense	0				CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1708G>A	18.37:g.5890355C>T	ENSP00000463375:p.Ala570Thr			Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.A570T	ENST00000581347.2	37	c.1708	CCDS45825.1	18	.	.	.	.	.	.	.	.	.	.	C	10.64	1.407276	0.25378	.	.	ENSG00000206432	ENST00000383490	.	.	.	3.76	-2.65	0.06095	.	.	.	.	.	T	0.13798	0.0334	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32798	-0.9893	8	0.10636	T	0.68	.	5.6669	0.17700	0.0:0.3184:0.3847:0.2969	.	570	A6NKL6	T200C_HUMAN	T	570	.	ENSP00000372982:A570T	A	-	1	0	TMEM200C	5880355	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.366000	0.20365	-0.623000	0.05618	-0.304000	0.09214	GCG	TMEM200C	-	NULL	ENSG00000206432		0.647	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200C	HGNC	protein_coding	OTTHUMT00000441917.4	73	0.00	0	C	NM_001080209		5890355	5890355	-1	no_errors	ENST00000383490	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.000	T
TNFRSF14	8764	genome.wustl.edu	37	1	2489170	2489170	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:2489170G>T	ENST00000355716.4	+	2	374	c.75G>T	c.(73-75)ctG>ctT	p.L25L	TNFRSF14_ENST00000409119.1_Silent_p.L25L|RP3-395M20.8_ENST00000416860.2_RNA|TNFRSF14_ENST00000442392.2_3'UTR|RP3-395M20.8_ENST00000452793.1_RNA	NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	25					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		CTTAGGTGCTGTATCTCACCT	0.642			"""Mis, N, F"""		follicular lymphoma																																	dbGAP		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	0													35.0	31.0	33.0					1																	2489170		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.75G>T	1.37:g.2489170G>T			B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_14,prints_Fas_rcpt,pfscan_TNFR/NGFR_Cys_rich_reg	p.L25	ENST00000355716.4	37	c.75	CCDS44046.1	1																																																																																			TNFRSF14	-	NULL	ENSG00000157873		0.642	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF14	HGNC	protein_coding	OTTHUMT00000002088.1	47	0.00	0	G			2489170	2489170	+1	no_errors	ENST00000355716	ensembl	human	known	69_37n	silent	18	14.29	3	SNP	0.003	T
TOM1	10043	genome.wustl.edu	37	22	35713945	35713945	+	Missense_Mutation	SNP	C	C	T	rs201539247		TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr22:35713945C>T	ENST00000449058.2	+	2	253	c.128C>T	c.(127-129)aCg>aTg	p.T43M	TOM1_ENST00000436462.2_Missense_Mutation_p.R22W|TOM1_ENST00000425375.1_Missense_Mutation_p.T43M|TOM1_ENST00000382034.5_5'UTR|TOM1_ENST00000447733.1_Missense_Mutation_p.T10M|TOM1_ENST00000411850.1_Missense_Mutation_p.T43M	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	43	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						ATCAACGAGACGGAGGAAGGG	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19534	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													95.0	95.0	95.0					22																	35713945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.128C>T	22.37:g.35713945C>T	ENSP00000394466:p.Thr43Met		B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.T43M	ENST00000449058.2	37	c.128	CCDS13913.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.4|29.4	5.001652|5.001652	0.93227|0.93227	.|.	.|.	ENSG00000100284|ENSG00000100284	ENST00000436462|ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000450839;ENST00000451197;ENST00000443206	T|T;T;T;T;T;T	0.26067|0.23950	1.76|1.88;1.88;1.88;1.88;1.88;1.88	5.36|5.36	5.36|5.36	0.76844|0.76844	.|VHS subgroup (1);ENTH/VHS (2);VHS (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57315|0.57315	0.2045|0.2045	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	D|D;D;D;D	0.61697|0.89917	0.99|1.0;1.0;1.0;1.0	P|D;D;D;D	0.47075|0.97110	0.536|0.985;0.995;1.0;0.994	T|T	0.63391|0.63391	-0.6648|-0.6648	9|10	0.87932|0.87932	D|D	0|0	-21.7116|-21.7116	19.079|19.079	0.93173|0.93173	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	22|43;43;43;43	E7EPD0|O60784-3;B4DKQ5;O60784-2;O60784	.|.;.;.;TOM1_HUMAN	W|M	22|10;43;43;43;43;43;43;10	ENSP00000402556:R22W|ENSP00000398876:T10M;ENSP00000393714:T43M;ENSP00000394466:T43M;ENSP00000413697:T43M;ENSP00000394924:T43M;ENSP00000389789:T10M	ENSP00000402556:R22W|ENSP00000338422:T43M	R|T	+|+	1|2	2|0	TOM1|TOM1	34043945|34043945	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.916000|0.916000	0.54674|0.54674	7.764000|7.764000	0.85297|0.85297	2.502000|2.502000	0.84385|0.84385	0.561000|0.561000	0.74099|0.74099	CGG|ACG	TOM1	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_VHS	ENSG00000100284		0.607	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1	32	0.00	0	C	NM_005488		35713945	35713945	+1	no_errors	ENST00000411850	ensembl	human	known	69_37n	missense	9	52.63	10	SNP	1.000	T
TOM1	10043	genome.wustl.edu	37	22	35713945	35713945	+	Missense_Mutation	SNP	C	C	T	rs201539247		TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:35713945C>T	ENST00000449058.2	+	2	253	c.128C>T	c.(127-129)aCg>aTg	p.T43M	TOM1_ENST00000436462.2_Missense_Mutation_p.R22W|TOM1_ENST00000425375.1_Missense_Mutation_p.T43M|TOM1_ENST00000382034.5_5'UTR|TOM1_ENST00000447733.1_Missense_Mutation_p.T10M|TOM1_ENST00000411850.1_Missense_Mutation_p.T43M	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	43	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						ATCAACGAGACGGAGGAAGGG	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19534	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													95.0	95.0	95.0					22																	35713945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.128C>T	22.37:g.35713945C>T	ENSP00000394466:p.Thr43Met		B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.T43M	ENST00000449058.2	37	c.128	CCDS13913.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.4|29.4	5.001652|5.001652	0.93227|0.93227	.|.	.|.	ENSG00000100284|ENSG00000100284	ENST00000436462|ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000450839;ENST00000451197;ENST00000443206	T|T;T;T;T;T;T	0.26067|0.23950	1.76|1.88;1.88;1.88;1.88;1.88;1.88	5.36|5.36	5.36|5.36	0.76844|0.76844	.|VHS subgroup (1);ENTH/VHS (2);VHS (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57315|0.57315	0.2045|0.2045	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	D|D;D;D;D	0.61697|0.89917	0.99|1.0;1.0;1.0;1.0	P|D;D;D;D	0.47075|0.97110	0.536|0.985;0.995;1.0;0.994	T|T	0.63391|0.63391	-0.6648|-0.6648	9|10	0.87932|0.87932	D|D	0|0	-21.7116|-21.7116	19.079|19.079	0.93173|0.93173	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	22|43;43;43;43	E7EPD0|O60784-3;B4DKQ5;O60784-2;O60784	.|.;.;.;TOM1_HUMAN	W|M	22|10;43;43;43;43;43;43;10	ENSP00000402556:R22W|ENSP00000398876:T10M;ENSP00000393714:T43M;ENSP00000394466:T43M;ENSP00000413697:T43M;ENSP00000394924:T43M;ENSP00000389789:T10M	ENSP00000402556:R22W|ENSP00000338422:T43M	R|T	+|+	1|2	2|0	TOM1|TOM1	34043945|34043945	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.916000|0.916000	0.54674|0.54674	7.764000|7.764000	0.85297|0.85297	2.502000|2.502000	0.84385|0.84385	0.561000|0.561000	0.74099|0.74099	CGG|ACG	TOM1	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_VHS	ENSG00000100284		0.607	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1	66	0.00	0	C	NM_005488		35713945	35713945	+1	no_errors	ENST00000411850	ensembl	human	known	69_37n	missense	9	65.38	17	SNP	1.000	T
TNRC6B	23112	genome.wustl.edu	37	22	40711407	40711407	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:40711407G>A	ENST00000454349.2	+	20	5010	c.4799G>A	c.(4798-4800)cGc>cAc	p.R1600H	TNRC6B_ENST00000301923.9_Missense_Mutation_p.R796H|TNRC6B_ENST00000402203.1_Missense_Mutation_p.R796H|TNRC6B_ENST00000335727.9_Missense_Mutation_p.R1490H	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1600	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CCGCTGCCCCGCCCACCTCCT	0.582																																						dbGAP											0													65.0	69.0	68.0					22																	40711407		2034	4168	6202	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4799G>A	22.37:g.40711407G>A	ENSP00000401946:p.Arg1600His		B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.R1600H	ENST00000454349.2	37	c.4799	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.820284|5.820284	0.96989|0.96989	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	.|T;T;T;T	.|0.47869	.|0.83;0.83;0.83;0.83	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72342|0.72342	0.3448|0.3448	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.87578	.|0.988;0.996;0.998;0.993	T|T	0.70565|0.70565	-0.4837|-0.4837	5|10	.|0.52906	.|T	.|0.07	-6.6963|-6.6963	20.8598|20.8598	0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1600;1490;1490;796	.|Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2	.|TNR6B_HUMAN;.;.;.	T|H	1286|796;796;1600;1490;1490	.|ENSP00000306759:R796H;ENSP00000384795:R796H;ENSP00000401946:R1600H;ENSP00000338371:R1490H	.|ENSP00000306759:R796H	A|R	+|+	1|2	0|0	TNRC6B|TNRC6B	39041353|39041353	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.705000|9.705000	0.98719|0.98719	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCC|CGC	TNRC6B	-	NULL	ENSG00000100354		0.582	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		50	0.00	0	G			40711407	40711407	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	1.000	A
CROT	54677	genome.wustl.edu	37	7	86974645	86974645	+	5'Flank	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr7:86974645C>A	ENST00000331536.3	+	0	0				CROT_ENST00000412227.2_5'Flank|CROT_ENST00000442291.1_5'Flank|TP53TG1_ENST00000359941.5_lincRNA|CROT_ENST00000419147.2_5'Flank	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase						carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	CGCGGCCTGCCCAGAGTGCCT	0.612																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653		7.37:g.86974645C>A	Exception_encountered		A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	RNA	SNP	-	NULL	ENST00000331536.3	37	NULL	CCDS5604.1	7																																																																																			TP53TG1	-	-	ENSG00000182165		0.612	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG1	HGNC	protein_coding	OTTHUMT00000253485.1	66	0.00	0	C	NM_021151		86974645	86974645	-1	no_errors	ENST00000359941	ensembl	human	known	69_37n	rna	44	10.20	5	SNP	0.000	A
TPH2	121278	genome.wustl.edu	37	12	72338138	72338138	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:72338138A>G	ENST00000333850.3	+	3	461	c.320A>G	c.(319-321)gAa>gGa	p.E107G	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	107	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TCTGAGGTTGAAATCTTTGTG	0.423																																						dbGAP											0													152.0	144.0	147.0					12																	72338138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.320A>G	12.37:g.72338138A>G	ENSP00000329093:p.Glu107Gly		A6NGA4|Q14CB0	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.E107G	ENST00000333850.3	37	c.320	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089576	0.76756	.	.	ENSG00000139287	ENST00000333850;ENST00000266669	D	0.99176	-5.52	5.53	5.53	0.82687	Amino acid-binding ACT (1);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	M	0.70842	2.15	0.80722	D	1	D	0.64830	0.994	D	0.68192	0.956	D	0.99811	1.1041	10	0.87932	D	0	-29.3427	15.9539	0.79865	1.0:0.0:0.0:0.0	.	107	Q8IWU9	TPH2_HUMAN	G	107	ENSP00000329093:E107G	ENSP00000266669:E107G	E	+	2	0	TPH2	70624405	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.910000	0.92685	2.240000	0.73641	0.528000	0.53228	GAA	TPH2	-	pfam_ACT_dom,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase	ENSG00000139287		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	51	0.00	0	A	NM_173353		72338138	72338138	+1	no_errors	ENST00000333850	ensembl	human	known	69_37n	missense	36	32.73	18	SNP	1.000	G
TPH2	121278	genome.wustl.edu	37	12	72338138	72338138	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr12:72338138A>G	ENST00000333850.3	+	3	461	c.320A>G	c.(319-321)gAa>gGa	p.E107G	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	107	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TCTGAGGTTGAAATCTTTGTG	0.423																																						dbGAP											0													152.0	144.0	147.0					12																	72338138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.320A>G	12.37:g.72338138A>G	ENSP00000329093:p.Glu107Gly		A6NGA4|Q14CB0	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.E107G	ENST00000333850.3	37	c.320	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089576	0.76756	.	.	ENSG00000139287	ENST00000333850;ENST00000266669	D	0.99176	-5.52	5.53	5.53	0.82687	Amino acid-binding ACT (1);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	M	0.70842	2.15	0.80722	D	1	D	0.64830	0.994	D	0.68192	0.956	D	0.99811	1.1041	10	0.87932	D	0	-29.3427	15.9539	0.79865	1.0:0.0:0.0:0.0	.	107	Q8IWU9	TPH2_HUMAN	G	107	ENSP00000329093:E107G	ENSP00000266669:E107G	E	+	2	0	TPH2	70624405	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.910000	0.92685	2.240000	0.73641	0.528000	0.53228	GAA	TPH2	-	pfam_ACT_dom,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase	ENSG00000139287		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	126	0.00	0	A	NM_173353		72338138	72338138	+1	no_errors	ENST00000333850	ensembl	human	known	69_37n	missense	59	37.50	36	SNP	1.000	G
TPH2	121278	genome.wustl.edu	37	12	72338138	72338138	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr12:72338138A>G	ENST00000333850.3	+	3	461	c.320A>G	c.(319-321)gAa>gGa	p.E107G	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	107	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TCTGAGGTTGAAATCTTTGTG	0.423																																						dbGAP											0													152.0	144.0	147.0					12																	72338138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.320A>G	12.37:g.72338138A>G	ENSP00000329093:p.Glu107Gly		A6NGA4|Q14CB0	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.E107G	ENST00000333850.3	37	c.320	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089576	0.76756	.	.	ENSG00000139287	ENST00000333850;ENST00000266669	D	0.99176	-5.52	5.53	5.53	0.82687	Amino acid-binding ACT (1);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	M	0.70842	2.15	0.80722	D	1	D	0.64830	0.994	D	0.68192	0.956	D	0.99811	1.1041	10	0.87932	D	0	-29.3427	15.9539	0.79865	1.0:0.0:0.0:0.0	.	107	Q8IWU9	TPH2_HUMAN	G	107	ENSP00000329093:E107G	ENSP00000266669:E107G	E	+	2	0	TPH2	70624405	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.910000	0.92685	2.240000	0.73641	0.528000	0.53228	GAA	TPH2	-	pfam_ACT_dom,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase	ENSG00000139287		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	51	0.00	0	A	NM_173353		72338138	72338138	+1	no_errors	ENST00000333850	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	G
TRAK1	22906	genome.wustl.edu	37	3	42244336	42244336	+	Intron	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:42244336C>A	ENST00000327628.5	+	13	2144				TRAK1_ENST00000449246.1_Missense_Mutation_p.H538Q|TRAK1_ENST00000341421.3_Intron|TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000396175.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						ACCTCTGTCACGCCTACTCCT	0.662																																					GBM(44;195 884 22595 31865 41850)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1744+92C>A	3.37:g.42244336C>A			E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.H538Q	ENST00000327628.5	37	c.1614	CCDS43072.1	3	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307679	0.23821	.	.	ENSG00000182606	ENST00000449246	T	0.08896	3.04	5.64	-0.0913	0.13661	.	.	.	.	.	T	0.04497	0.0123	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.46133	-0.9213	7	.	.	.	.	5.626	0.17482	0.0:0.4111:0.1397:0.4492	.	538	E9PDS2	.	Q	538	ENSP00000410717:H538Q	.	H	+	3	2	TRAK1	42219340	0.000000	0.05858	0.004000	0.12327	0.535000	0.34838	-0.498000	0.06420	0.036000	0.15547	0.650000	0.86243	CAC	TRAK1	-	NULL	ENSG00000182606		0.662	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	HGNC	protein_coding	OTTHUMT00000343413.1	29	0.00	0	C	NM_014965		42244336	42244336	+1	no_errors	ENST00000449246	ensembl	human	putative	69_37n	missense	11	20.00	3	SNP	0.001	A
TRIM28	10155	genome.wustl.edu	37	19	59058997	59058997	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:59058997G>T	ENST00000253024.5	+	5	1045	c.756G>T	c.(754-756)caG>caT	p.Q252H	TRIM28_ENST00000341753.6_Missense_Mutation_p.Q170H	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	252	Interaction with MAGEC2.|Leucine zipper alpha helical coiled-coil region.|RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		TGAGGAACCAGCGCAAGCTCC	0.562																																						dbGAP											0													77.0	65.0	69.0					19																	59058997		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.756G>T	19.37:g.59058997G>T	ENSP00000253024:p.Gln252His		O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q252H	ENST00000253024.5	37	c.756	CCDS12985.1	19	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050739	0.55218	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.56776	0.44;0.44	5.0	3.96	0.45880	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59945	0.2231	L	0.45137	1.4	0.37030	D	0.896651	D;D	0.64830	0.994;0.99	D;D	0.78314	0.991;0.979	T	0.64024	-0.6504	10	0.48119	T	0.1	-27.7861	7.3475	0.26672	0.2023:0.0:0.7977:0.0	.	170;252	Q13263-2;Q13263	.;TIF1B_HUMAN	H	252;170	ENSP00000253024:Q252H;ENSP00000342232:Q170H	ENSP00000253024:Q252H	Q	+	3	2	TRIM28	63750809	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.885000	0.28227	1.226000	0.43582	0.561000	0.74099	CAG	TRIM28	-	smart_Bbox_C	ENSG00000130726		0.562	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM28	HGNC	protein_coding	OTTHUMT00000467074.1	66	0.00	0	G	NM_005762		59058997	59058997	+1	no_errors	ENST00000253024	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
TRIM6	117854	genome.wustl.edu	37	11	5632160	5632160	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:5632160C>A	ENST00000278302.5	+	8	1195	c.1055C>A	c.(1054-1056)tCt>tAt	p.S352Y	HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000380097.3_Missense_Mutation_p.S380Y|TRIM6_ENST00000515022.1_Missense_Mutation_p.S177Y|TRIM6_ENST00000445329.1_Missense_Mutation_p.S177Y|TRIM6_ENST00000481603.1_3'UTR|TRIM6-TRIM34_ENST00000354852.5_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000506134.1_Missense_Mutation_p.S177Y|TRIM6_ENST00000507320.1_Missense_Mutation_p.S177Y|TRIM6_ENST00000380107.1_Missense_Mutation_p.S326Y	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	352	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CACTTCTCCTCTGGTAAGCAT	0.493																																						dbGAP											0													112.0	109.0	110.0					11																	5632160		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.1055C>A	11.37:g.5632160C>A	ENSP00000278302:p.Ser352Tyr		A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S380Y	ENST00000278302.5	37	c.1139	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331335	0.60853	.	.	ENSG00000121236	ENST00000278302;ENST00000507320;ENST00000380107;ENST00000380097;ENST00000445329;ENST00000396867;ENST00000515022;ENST00000506134	T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	4.2	3.29	0.37713	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.86276	0.5894	H	0.97491	4.015	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.997	D;P;D	0.81914	0.995;0.885;0.93	D	0.88885	0.3342	9	0.87932	D	0	.	10.3338	0.43837	0.0:0.9021:0.0:0.0979	.	326;380;352	E9PFM0;Q9C030-2;Q9C030	.;.;TRIM6_HUMAN	Y	352;177;326;380;177;259;177;177	ENSP00000278302:S352Y;ENSP00000427704:S177Y;ENSP00000369450:S326Y;ENSP00000369440:S380Y;ENSP00000399215:S177Y;ENSP00000421802:S177Y;ENSP00000421079:S177Y	ENSP00000278302:S352Y	S	+	2	0	TRIM6	5588736	0.091000	0.21658	0.990000	0.47175	0.732000	0.41865	2.189000	0.42621	1.371000	0.46172	0.467000	0.42956	TCT	TRIM6	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000121236		0.493	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6	HGNC	protein_coding	OTTHUMT00000143376.2	93	0.00	0	C	NM_001003818		5632160	5632160	+1	no_errors	ENST00000380097	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.999	A
TRIOBP	11078	genome.wustl.edu	37	22	38121968	38121971	+	Frame_Shift_Del	DEL	ATTC	ATTC	-			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	ATTC	ATTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr22:38121968_38121971delATTC	ENST00000406386.3	+	7	3660_3663	c.3405_3408delATTC	c.(3403-3408)ttattcfs	p.LF1135fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1135					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CTTCCCTCTTATTCCAGGACCTCC	0.647																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3405_3408delATTC	22.37:g.38121968_38121971delATTC	ENSP00000384312:p.Leu1135fs		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1135fs	ENST00000406386.3	37	c.3405_3408	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.647	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	53	0.00	0	ATTC			38121968	38121971	+1	no_errors	ENST00000406386	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.211:0.628:0.923:0.991	-
TRMT44	152992	genome.wustl.edu	37	4	8442601	8442601	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr4:8442601C>A	ENST00000389737.4	+	1	52	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	TRMT44_ENST00000513449.2_Intron|ACOX3_ENST00000413009.2_5'Flank|ACOX3_ENST00000356406.5_5'Flank	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	18					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GCTTCTCCCACAGGGCTTCTG	0.701																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.52C>A	4.37:g.8442601C>A	ENSP00000374387:p.Gln18Lys		Q8NA95	Missense_Mutation	SNP	pfam_tRNA_uracil_MeTrfase	p.Q18K	ENST00000389737.4	37	c.52	CCDS3402.2	4	.	.	.	.	.	.	.	.	.	.	C	3.540	-0.093982	0.07053	.	.	ENSG00000155275	ENST00000389737	T	0.16196	2.36	4.55	1.59	0.23543	.	1.071070	0.07248	N	0.865335	T	0.09468	0.0233	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.10132	-1.0643	8	0.02654	T	1	-4.0441	16.9518	0.86247	0.0:0.4563:0.5437:0.0	.	.	.	.	K	18	ENSP00000374387:Q18K	ENSP00000374387:Q18K	Q	+	1	0	METTL19	8493501	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.031000	0.12287	0.608000	0.30000	-0.165000	0.13383	CAG	TRMT44	-	NULL	ENSG00000155275		0.701	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRMT44	HGNC	protein_coding	OTTHUMT00000359197.2	23	0.00	0	C	NM_152544		8442601	8442601	+1	no_errors	ENST00000389737	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.000	A
TRPC6	7225	genome.wustl.edu	37	11	101344388	101344388	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr11:101344388C>T	ENST00000344327.3	-	7	2285	c.1861G>A	c.(1861-1863)Gga>Aga	p.G621R	TRPC6_ENST00000360497.4_Missense_Mutation_p.G566R|TRPC6_ENST00000532133.1_Missense_Mutation_p.G543R|TRPC6_ENST00000348423.4_Missense_Mutation_p.G505R	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	621					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGCAGAGGTCCAAAGCTTTCA	0.363																																					Colon(166;1315 1927 11094 12848 34731)	dbGAP											0													96.0	95.0	95.0					11																	101344388		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1861G>A	11.37:g.101344388C>T	ENSP00000340913:p.Gly621Arg		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.G621R	ENST00000344327.3	37	c.1861	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975961	0.92982	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.98150	-2.48;-4.75;-4.75;-4.75	5.91	5.91	0.95273	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99223	0.9730	H	0.95187	3.635	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98982	1.0805	10	0.87932	D	0	-9.3113	20.2985	0.98592	0.0:1.0:0.0:0.0	.	566;505;621	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	R	621;543;505;566	ENSP00000340913:G621R;ENSP00000435574:G543R;ENSP00000343672:G505R;ENSP00000353687:G566R	ENSP00000340913:G621R	G	-	1	0	TRPC6	100849598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.807000	0.86032	2.793000	0.96121	0.655000	0.94253	GGA	TRPC6	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,tigrfam_TRP_channel	ENSG00000137672		0.363	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	40	0.00	0	C	NM_004621		101344388	101344388	-1	no_errors	ENST00000344327	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179445303	179445303	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:179445303C>A	ENST00000591111.1	-	267	62104	c.61880G>T	c.(61879-61881)aGg>aTg	p.R20627M	TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R13395M|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R13203M|TTN_ENST00000359218.5_Missense_Mutation_p.R13328M|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R22268M|TTN_ENST00000342992.6_Missense_Mutation_p.R19700M			Q8WZ42	TITIN_HUMAN	titin	20627					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTGTCTTCCTTAAGTCCGC	0.388																																						dbGAP											0													69.0	60.0	63.0					2																	179445303		1847	4089	5936	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61880G>T	2.37:g.179445303C>A	ENSP00000465570:p.Arg20627Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R19700M	ENST00000591111.1	37	c.59099		2	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551128	0.45383	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63417	-0.04;0.23;0.21;0.2	5.34	5.34	0.76211	Immunoglobulin subtype (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.79598	0.4473	M	0.70275	2.135	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.81611	-0.0854	9	0.87932	D	0	.	19.0305	0.92955	0.0:1.0:0.0:0.0	.	13203;13328;13395;20627	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	19700;13203;13395;13328;13201	ENSP00000343764:R19700M;ENSP00000434586:R13203M;ENSP00000340554:R13395M;ENSP00000352154:R13328M	ENSP00000340554:R13395M	R	-	2	0	TTN	179153549	1.000000	0.71417	0.985000	0.45067	0.979000	0.70002	3.996000	0.57009	2.500000	0.84329	0.563000	0.77884	AGG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	42	0.00	0	C	NM_133378		179445303	179445303	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	A
UBE3D	90025	genome.wustl.edu	37	6	83732261	83732261	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:83732261C>T	ENST00000369747.3	-	7	879	c.757G>A	c.(757-759)Gtg>Atg	p.V253M		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	253	Interaction with UBE2C.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										TGGGCGATCACGCTCTGGACA	0.393																																						dbGAP											0													65.0	63.0	64.0					6																	83732261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.757G>A	6.37:g.83732261C>T	ENSP00000358762:p.Val253Met		B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	pfam_UBQ-conj_enz_E2-bd_prot	p.V253M	ENST00000369747.3	37	c.757	CCDS34491.1	6	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627868	0.46944	.	.	ENSG00000118420	ENST00000369747	T	0.32753	1.44	5.72	-0.875	0.10628	.	0.521314	0.21982	N	0.066297	T	0.26304	0.0642	M	0.63428	1.95	0.09310	N	0.999996	D;D	0.64830	0.991;0.994	P;P	0.58780	0.837;0.845	T	0.24368	-1.0162	10	0.51188	T	0.08	-15.6432	10.6681	0.45743	0.0:0.4412:0.0:0.5588	.	232;253	C9JRS1;Q7Z6J8	.;UB2CB_HUMAN	M	253	ENSP00000358762:V253M	ENSP00000358762:V253M	V	-	1	0	UBE2CBP	83788980	0.000000	0.05858	0.002000	0.10522	0.607000	0.37147	-0.986000	0.03747	-0.534000	0.06315	0.563000	0.77884	GTG	UBE3D	-	pfam_UBQ-conj_enz_E2-bd_prot	ENSG00000118420		0.393	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3D	HGNC	protein_coding	OTTHUMT00000041347.7	37	0.00	0	C	NM_198920		83732261	83732261	-1	no_errors	ENST00000369747	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	0.006	T
UCKL1	54963	genome.wustl.edu	37	20	62571731	62571731	+	Splice_Site	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:62571731C>A	ENST00000354216.6	-	13	1452	c.1410G>T	c.(1408-1410)ctG>ctT	p.L470L	UCKL1_ENST00000358711.3_3'UTR|UCKL1_ENST00000369892.3_Splice_Site_p.L470L|MIR1914_ENST00000607800.1_RNA|MIR647_ENST00000384823.1_RNA|UCKL1_ENST00000369908.5_Splice_Site_p.L455L	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	470					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GCTCACTCACCAGGAGCACGC	0.622																																						dbGAP											0													57.0	52.0	54.0					20																	62571731		2193	4299	6492	-	-	-	SO:0001630	splice_region_variant	0			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.1410+1G>T	20.37:g.62571731C>A			B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Silent	SNP	pfam_PRK/URK,pfam_CPT,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.L470	ENST00000354216.6	37	c.1410	CCDS13547.1	20																																																																																			UCKL1	-	NULL	ENSG00000198276		0.622	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	HGNC	protein_coding	OTTHUMT00000080236.1	37	0.00	0	C	NM_017859	Silent	62571731	62571731	-1	no_errors	ENST00000354216	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	1.000	A
UMODL1	89766	genome.wustl.edu	37	21	43496126	43496126	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:43496126C>T	ENST00000408910.2	+	2	89	c.89C>T	c.(88-90)tCc>tTc	p.S30F	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000400424.2_5'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.S30F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	30					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						AAAGGCCTCTCCCTGTTGGGC	0.587																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													127.0	137.0	134.0					21																	43496126		2042	4189	6231	-	-	-	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.89C>T	21.37:g.43496126C>T	ENSP00000386147:p.Ser30Phe		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S30F	ENST00000408910.2	37	c.89	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354661	0.61293	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	T;T	0.80566	-1.39;-1.37	4.44	4.44	0.53790	.	0.000000	0.45361	D	0.000372	D	0.82287	0.5004	N	0.19112	0.55	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.85161	0.0992	10	0.87932	D	0	-38.1855	14.8484	0.70277	0.0:1.0:0.0:0.0	.	30;30	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	30	ENSP00000386126:S30F;ENSP00000386147:S30F	ENSP00000386147:S30F	S	+	2	0	UMODL1	42369195	0.998000	0.40836	0.901000	0.35422	0.508000	0.34012	4.530000	0.60595	2.394000	0.81467	0.655000	0.94253	TCC	UMODL1	-	NULL	ENSG00000177398		0.587	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	75	0.00	0	C			43496126	43496126	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	0.999	T
UMODL1	89766	genome.wustl.edu	37	21	43496126	43496126	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr21:43496126C>T	ENST00000408910.2	+	2	89	c.89C>T	c.(88-90)tCc>tTc	p.S30F	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000400424.2_5'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.S30F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	30					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						AAAGGCCTCTCCCTGTTGGGC	0.587																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													127.0	137.0	134.0					21																	43496126		2042	4189	6231	-	-	-	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.89C>T	21.37:g.43496126C>T	ENSP00000386147:p.Ser30Phe		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S30F	ENST00000408910.2	37	c.89	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354661	0.61293	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	T;T	0.80566	-1.39;-1.37	4.44	4.44	0.53790	.	0.000000	0.45361	D	0.000372	D	0.82287	0.5004	N	0.19112	0.55	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.85161	0.0992	10	0.87932	D	0	-38.1855	14.8484	0.70277	0.0:1.0:0.0:0.0	.	30;30	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	30	ENSP00000386126:S30F;ENSP00000386147:S30F	ENSP00000386147:S30F	S	+	2	0	UMODL1	42369195	0.998000	0.40836	0.901000	0.35422	0.508000	0.34012	4.530000	0.60595	2.394000	0.81467	0.655000	0.94253	TCC	UMODL1	-	NULL	ENSG00000177398		0.587	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	24	0.00	0	C			43496126	43496126	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.999	T
UMODL1	89766	genome.wustl.edu	37	21	43496126	43496126	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr21:43496126C>T	ENST00000408910.2	+	2	89	c.89C>T	c.(88-90)tCc>tTc	p.S30F	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000400424.2_5'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.S30F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	30					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						AAAGGCCTCTCCCTGTTGGGC	0.587																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													127.0	137.0	134.0					21																	43496126		2042	4189	6231	-	-	-	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.89C>T	21.37:g.43496126C>T	ENSP00000386147:p.Ser30Phe		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S30F	ENST00000408910.2	37	c.89	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354661	0.61293	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	T;T	0.80566	-1.39;-1.37	4.44	4.44	0.53790	.	0.000000	0.45361	D	0.000372	D	0.82287	0.5004	N	0.19112	0.55	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.85161	0.0992	10	0.87932	D	0	-38.1855	14.8484	0.70277	0.0:1.0:0.0:0.0	.	30;30	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	30	ENSP00000386126:S30F;ENSP00000386147:S30F	ENSP00000386147:S30F	S	+	2	0	UMODL1	42369195	0.998000	0.40836	0.901000	0.35422	0.508000	0.34012	4.530000	0.60595	2.394000	0.81467	0.655000	0.94253	TCC	UMODL1	-	NULL	ENSG00000177398		0.587	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	75	0.00	0	C			43496126	43496126	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	44	39.73	29	SNP	0.999	T
UPK1A	11045	genome.wustl.edu	37	19	36159144	36159144	+	Intron	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:36159144G>T	ENST00000222275.2	+	2	84				UPK1A-AS1_ENST00000443196.1_RNA|UPK1A_ENST00000379013.2_Intron	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A						epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAAACTGGCAGCTGGGGCGTG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.85-212G>T	19.37:g.36159144G>T			Q3KNU5|Q3KNU6	RNA	SNP	-	NULL	ENST00000222275.2	37	NULL	CCDS12470.1	19																																																																																			UPK1A-AS1	-	-	ENSG00000226510		0.602	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1A-AS1	HGNC	protein_coding	OTTHUMT00000109486.3	28	0.00	0	G			36159144	36159144	-1	no_errors	ENST00000443196	ensembl	human	known	69_37n	rna	13	18.75	3	SNP	0.000	T
WAS	7454	genome.wustl.edu	37	X	48547384	48547384	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:48547384G>A	ENST00000376701.4	+	10	1342	c.1267G>A	c.(1267-1269)Ggg>Agg	p.G423R		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	423					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				GGTGCCTGCCGGGGGCCTGGC	0.687			"""Mis, N, F, S"""			lymphoma																																dbGAP		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													6.0	7.0	6.0					X																	48547384		2070	4016	6086	-	-	-	SO:0001583	missense	0			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1267G>A	X.37:g.48547384G>A	ENSP00000365891:p.Gly423Arg		Q9BU11|Q9UNJ9	Missense_Mutation	SNP	pfam_EVH1,pfam_PAK_box_Rho-bd,pfam_WH2_dom,superfamily_WASP_C,smart_EVH1,smart_PAK_box_Rho-bd,smart_WH2_dom,pfscan_PAK_box_Rho-bd,pfscan_EVH1,pfscan_WH2_dom	p.G423R	ENST00000376701.4	37	c.1267	CCDS14303.1	X	.	.	.	.	.	.	.	.	.	.	G	6.062	0.379842	0.11466	.	.	ENSG00000015285	ENST00000376701	D	0.99735	-6.58	4.5	4.5	0.54988	.	0.096264	0.38663	N	0.001612	D	0.97779	0.9271	N	0.08118	0	0.09310	N	0.999999	D	0.55385	0.971	P	0.45971	0.499	D	0.95079	0.8211	10	0.48119	T	0.1	-8.982	8.065	0.30654	0.116:0.0:0.884:0.0	.	423	P42768	WASP_HUMAN	R	423	ENSP00000365891:G423R	ENSP00000365891:G423R	G	+	1	0	WAS	48432328	0.000000	0.05858	0.022000	0.16811	0.168000	0.22595	0.603000	0.24149	1.978000	0.57642	0.464000	0.42555	GGG	WAS	-	NULL	ENSG00000015285		0.687	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WAS	HGNC	protein_coding	OTTHUMT00000083379.1	46	0.00	0	G	NM_000377		48547384	48547384	+1	no_errors	ENST00000376701	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.102	A
WDR35	57539	genome.wustl.edu	37	2	20137600	20137600	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr2:20137600C>A	ENST00000345530.3	-	20	2319	c.2204G>T	c.(2203-2205)gGc>gTc	p.G735V	WDR35_ENST00000281405.4_Missense_Mutation_p.G724V|WDR35_ENST00000416055.2_Missense_Mutation_p.G300V	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	735					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGTAGTTTGCCCAAGCGCTT	0.463																																						dbGAP											0													189.0	184.0	186.0					2																	20137600		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.2204G>T	2.37:g.20137600C>A	ENSP00000314444:p.Gly735Val		B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pirsf_WD_repeat_p35,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G735V	ENST00000345530.3	37	c.2204	CCDS33152.1	2	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900507	0.33535	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	T;T;T;D	0.85955	-0.07;-0.07;-0.63;-2.05	5.18	4.28	0.50868	.	0.170434	0.52532	D	0.000075	T	0.81192	0.4771	L	0.50333	1.59	0.80722	D	1	B;B;B;P	0.38565	0.248;0.377;0.138;0.637	B;B;B;B	0.36186	0.136;0.107;0.027;0.219	T	0.80324	-0.1430	10	0.40728	T	0.16	-7.1006	14.8739	0.70481	0.0:0.8555:0.1445:0.0	.	735;724;735;300	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	V	735;724;300;270	ENSP00000314444:G735V;ENSP00000281405:G724V;ENSP00000399159:G300V;ENSP00000404409:G270V	ENSP00000281405:G724V	G	-	2	0	WDR35	20001081	1.000000	0.71417	0.994000	0.49952	0.672000	0.39443	3.163000	0.50763	1.274000	0.44362	0.591000	0.81541	GGC	WDR35	-	pirsf_WD_repeat_p35	ENSG00000118965		0.463	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	HGNC	protein_coding	OTTHUMT00000207472.2	57	0.00	0	C	NM_020779		20137600	20137600	-1	no_errors	ENST00000345530	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	A
WDR6	11180	genome.wustl.edu	37	3	49052603	49052603	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr3:49052603G>T	ENST00000608424.1	+	6	3287	c.3248G>T	c.(3247-3249)aGc>aTc	p.S1083I	WDR6_ENST00000448293.1_Missense_Mutation_p.S1032I|WDR6_ENST00000395474.3_Missense_Mutation_p.S1113I|WDR6_ENST00000415265.2_Missense_Mutation_p.S531I|DALRD3_ENST00000496568.1_5'Flank			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	1083					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TTCATGAATAGCACTGTGTTC	0.572																																						dbGAP											0													134.0	88.0	104.0					3																	49052603		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.3248G>T	3.37:g.49052603G>T	ENSP00000477389:p.Ser1083Ile		B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1113I	ENST00000608424.1	37	c.3338		3	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602456	0.66445	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.61742	0.08;0.09	5.54	5.54	0.83059	.	0.170557	0.49916	D	0.000135	T	0.60753	0.2293	L	0.48642	1.525	0.34513	D	0.707272	D;P;P	0.57899	0.981;0.844;0.95	P;B;P	0.51385	0.668;0.294;0.512	T	0.70691	-0.4802	10	0.45353	T	0.12	-22.8113	14.4463	0.67352	0.0:0.2567:0.7433:0.0	.	531;1083;1032	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	I	1113;531;1032	ENSP00000378857:S1113I;ENSP00000413432:S1032I	ENSP00000378857:S1113I	S	+	2	0	WDR6	49027607	1.000000	0.71417	0.995000	0.50966	0.951000	0.60555	4.187000	0.58344	2.611000	0.88343	0.561000	0.74099	AGC	WDR6	-	NULL	ENSG00000178252		0.572	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	65	0.00	0	G			49052603	49052603	+1	no_errors	ENST00000395474	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.995	T
WFDC3	140686	genome.wustl.edu	37	20	44405748	44405748	+	Silent	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:44405748G>T	ENST00000243938.4	-	5	542	c.459C>A	c.(457-459)ggC>ggA	p.G153G	WFDC3_ENST00000372632.2_Intron|WFDC3_ENST00000372630.2_Intron|WFDC3_ENST00000481847.1_Intron|RNU6ATAC38P_ENST00000408119.1_RNA	NM_080614.1	NP_542181.1	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3	153	WAP 3. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(3)|prostate(1)	5		Myeloproliferative disorder(115;0.0122)				TGCGGCCACAGCCGGTGCTGC	0.557																																						dbGAP											0													63.0	53.0	57.0					20																	44405748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL050348	CCDS33478.1	20q13.12	2013-01-21			ENSG00000124116	ENSG00000124116		"""WAP four-disulfide core domain containing"""	15957	protein-coding gene	gene with protein product						12206714, 10680116	Standard	NM_080614		Approved	dJ447F3.3, WAP14	uc002xpf.1	Q8IUB2	OTTHUMG00000032614	ENST00000243938.4:c.459C>A	20.37:g.44405748G>T			A6PVF2|Q0P6A5|Q3T1C5|Q8TC52|Q9BQP3|Q9BQP4	Missense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,prints_4-disulphide_core	p.A147D	ENST00000243938.4	37	c.440	CCDS33478.1	20	.	.	.	.	.	.	.	.	.	.	G	9.284	1.048805	0.19827	.	.	ENSG00000124116	ENST00000337205	.	.	.	4.62	2.54	0.30619	.	.	.	.	.	T	0.55369	0.1916	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47824	-0.9087	4	.	.	.	-20.3373	7.3959	0.26936	0.0:0.1927:0.6238:0.1835	.	.	.	.	D	147	.	.	A	-	2	0	WFDC3	43839155	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	0.657000	0.24963	0.619000	0.30197	0.655000	0.94253	GCT	WFDC3	-	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core	ENSG00000124116		0.557	WFDC3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC3	HGNC	protein_coding	OTTHUMT00000316858.1	65	0.00	0	G			44405748	44405748	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000337205	ensembl	human	putative	69_37n	missense	26	16.13	5	SNP	1.000	T
WWC3	55841	genome.wustl.edu	37	X	10107538	10107538	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chrX:10107538G>T	ENST00000380861.4	+	22	3561	c.3170G>T	c.(3169-3171)cGt>cTt	p.R1057L	WWC3_ENST00000454666.1_Missense_Mutation_p.R1057L	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	1057					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TACCAGCTGCGTGGGCAGAGC	0.582																																						dbGAP											0													106.0	90.0	95.0					X																	10107538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.3170G>T	X.37:g.10107538G>T	ENSP00000370242:p.Arg1057Leu		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.R1057L	ENST00000380861.4	37	c.3170	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109903	0.56398	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.47869	0.83;0.83	4.64	2.86	0.33363	.	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	M	0.75777	2.31	0.53688	D	0.999972	D	0.89917	1.0	D	0.85130	0.997	T	0.62932	-0.6749	9	.	.	.	-9.1846	10.1499	0.42786	0.1685:0.0:0.8315:0.0	.	1057	Q9ULE0	WWC3_HUMAN	L	1057;1057;552	ENSP00000370242:R1057L;ENSP00000399584:R1057L	.	R	+	2	0	WWC3	10067538	1.000000	0.71417	0.469000	0.27204	0.224000	0.24922	9.077000	0.94016	0.503000	0.28060	0.600000	0.82982	CGT	WWC3	-	NULL	ENSG00000047644		0.582	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	108	0.00	0	G	NM_015691		10107538	10107538	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.994	T
XPO7	23039	genome.wustl.edu	37	8	21842314	21842314	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr8:21842314G>A	ENST00000252512.9	+	12	1535	c.1435G>A	c.(1435-1437)Gcc>Acc	p.A479T	XPO7_ENST00000434536.1_Missense_Mutation_p.A488T|XPO7_ENST00000433566.4_Missense_Mutation_p.A480T	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	479					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		GCTACAGAGCGCCAGCGCAAG	0.567																																						dbGAP											0													78.0	82.0	81.0					8																	21842314		2159	4258	6417	-	-	-	SO:0001583	missense	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1435G>A	8.37:g.21842314G>A	ENSP00000252512:p.Ala479Thr		O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.A488T	ENST00000252512.9	37	c.1462	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	G	13.95	2.389244	0.42410	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.67865	-0.29;-0.29;-0.29	5.53	5.53	0.82687	Armadillo-type fold (1);	0.219732	0.47455	D	0.000240	T	0.58323	0.2114	L	0.35854	1.095	0.35840	D	0.82597	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.58317	-0.7657	10	0.17369	T	0.5	-1.8255	19.1176	0.93348	0.0:0.0:1.0:0.0	.	480;488;479	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	T	488;479;480	ENSP00000404853:A488T;ENSP00000252512:A479T;ENSP00000410249:A480T	ENSP00000252512:A479T	A	+	1	0	XPO7	21898260	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	5.248000	0.65421	2.617000	0.88574	0.585000	0.79938	GCC	XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.567	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	66	0.00	0	G	NM_015024		21842314	21842314	+1	no_errors	ENST00000434536	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
ZNF343	79175	genome.wustl.edu	37	20	2464568	2464568	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr20:2464568G>T	ENST00000278772.4	-	6	1526	c.1039C>A	c.(1039-1041)Cac>Aac	p.H347N	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						TCCTCTGAGTGAGTCCACTGA	0.498																																						dbGAP											0													101.0	79.0	87.0					20																	2464568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.1039C>A	20.37:g.2464568G>T	ENSP00000278772:p.His347Asn		Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H347N	ENST00000278772.4	37	c.1039	CCDS13028.1	20	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706522	0.68615	.	.	ENSG00000088876	ENST00000278772	T	0.67345	-0.26	2.91	1.94	0.25998	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81108	0.4754	M	0.90198	3.095	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.80627	-0.1298	9	0.87932	D	0	.	7.8124	0.29239	0.1336:0.0:0.8664:0.0	.	347	Q6P1L6	ZN343_HUMAN	N	347	ENSP00000278772:H347N	ENSP00000278772:H347N	H	-	1	0	ZNF343	2412568	1.000000	0.71417	0.001000	0.08648	0.154000	0.21943	6.708000	0.74660	0.571000	0.29365	0.591000	0.81541	CAC	ZNF343	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000088876		0.498	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF343	HGNC	protein_coding	OTTHUMT00000077617.1	67	0.00	0	G	NM_024325		2464568	2464568	-1	no_errors	ENST00000278772	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	0.977	T
ZNF451	26036	genome.wustl.edu	37	6	57012855	57012855	+	Nonsense_Mutation	SNP	G	G	T	rs371313272		TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr6:57012855G>T	ENST00000370706.4	+	10	2216	c.1972G>T	c.(1972-1974)Gag>Tag	p.E658*	RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Nonsense_Mutation_p.E658*|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|ZNF451_ENST00000357489.3_Nonsense_Mutation_p.E658*|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	658					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTGCCAAGATGAGCATGACAA	0.398																																						dbGAP											0													81.0	83.0	82.0					6																	57012855		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1972G>T	6.37:g.57012855G>T	ENSP00000359740:p.Glu658*		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E658*	ENST00000370706.4	37	c.1972	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.880333	0.97904	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	.	.	.	5.13	4.2	0.49525	.	0.264995	0.36893	N	0.002351	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-19.9791	7.8142	0.29249	0.0973:0.3402:0.5625:0.0	.	.	.	.	X	658	.	ENSP00000350083:E658X	E	+	1	0	ZNF451	57120814	1.000000	0.71417	0.994000	0.49952	0.981000	0.71138	3.498000	0.53302	2.541000	0.85698	0.557000	0.71058	GAG	ZNF451	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000112200		0.398	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	40	0.00	0	G	NM_015555		57012855	57012855	+1	no_errors	ENST00000370706	ensembl	human	known	69_37n	nonsense	34	10.53	4	SNP	1.000	T
ZNF473	25888	genome.wustl.edu	37	19	50550060	50550060	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr19:50550060G>T	ENST00000595661.1	+	6	2855	c.2360G>T	c.(2359-2361)aGa>aTa	p.R787I	CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000445728.3_Missense_Mutation_p.R775I|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000391821.2_Missense_Mutation_p.R787I|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.R787I			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	787					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		AAGCCCTACAGATGTGGTGAA	0.498											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													87.0	79.0	81.0					19																	50550060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2360G>T	19.37:g.50550060G>T	ENSP00000472808:p.Arg787Ile	970	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R787I	ENST00000595661.1	37	c.2360	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	G	1.368	-0.586752	0.03827	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.14893	2.47;2.47;2.47	3.95	-0.441	0.12257	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.989880	0.02812	N	0.124456	T	0.15825	0.0381	L	0.42487	1.325	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28839	-1.0031	10	0.48119	T	0.1	1.3341	4.9958	0.14237	0.0:0.4276:0.1903:0.3821	.	787	Q8WTR7	ZN473_HUMAN	I	787;787;775	ENSP00000270617:R787I;ENSP00000375697:R787I;ENSP00000388961:R775I	ENSP00000270617:R787I	R	+	2	0	ZNF473	55241872	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-3.518000	0.00444	-0.164000	0.10927	-0.265000	0.10407	AGA	ZNF473	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000142528		0.498	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	HGNC	protein_coding	OTTHUMT00000464833.1	31	0.00	0	G	XM_046390		50550060	50550060	+1	no_errors	ENST00000270617	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.000	T
ZSCAN30	100101467	genome.wustl.edu	37	18	32844303	32844303	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr18:32844303G>T	ENST00000420878.3	-	3	469	c.14C>A	c.(13-15)gCc>gAc	p.A5D	ZSCAN30_ENST00000592278.1_Missense_Mutation_p.A5D|ZSCAN30_ENST00000589178.1_Missense_Mutation_p.A5D|ZSCAN30_ENST00000383091.2_Missense_Mutation_p.A5D|ZSCAN30_ENST00000333206.5_Missense_Mutation_p.A5D|ZSCAN30_ENST00000601405.1_Missense_Mutation_p.A5D|ZNF397_ENST00000589420.1_Intron	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	5					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(3)|urinary_tract(1)	9						CAAGACTGTGGCCTCTCCTGA	0.493																																						dbGAP											0													38.0	36.0	36.0					18																	32844303		1556	3559	5115	-	-	-	SO:0001583	missense	0			AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.14C>A	18.37:g.32844303G>T	ENSP00000392371:p.Ala5Asp		B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A5D	ENST00000420878.3	37	c.14	CCDS42427.1	18	.	.	.	.	.	.	.	.	.	.	G	9.434	1.086341	0.20390	.	.	ENSG00000186814	ENST00000420878;ENST00000333206;ENST00000383091	T;T;T	0.08984	3.03;3.03;4.08	4.4	1.61	0.23674	.	.	.	.	.	T	0.06781	0.0173	L	0.38531	1.155	0.09310	N	1	P;B	0.40476	0.718;0.281	B;B	0.36885	0.235;0.055	T	0.29579	-1.0007	9	0.66056	D	0.02	.	6.6376	0.22891	0.3059:0.0:0.6941:0.0	.	5;5	C9JCM2;Q86W11	.;ZSC30_HUMAN	D	5	ENSP00000392371:A5D;ENSP00000329738:A5D;ENSP00000372569:A5D	ENSP00000329738:A5D	A	-	2	0	ZSCAN30	31098301	0.001000	0.12720	0.000000	0.03702	0.710000	0.40934	0.912000	0.28597	0.224000	0.20940	0.650000	0.86243	GCC	ZSCAN30	-	NULL	ENSG00000186814		0.493	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZSCAN30	HGNC	protein_coding	OTTHUMT00000442510.1	36	0.00	0	G	NM_001112734		32844303	32844303	-1	no_errors	ENST00000333206	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.000	T
ZWINT	11130	genome.wustl.edu	37	10	58119522	58119522	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr10:58119522C>A	ENST00000373944.3	-	4	387	c.349G>T	c.(349-351)Gcc>Tcc	p.A117S	ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000318387.2_5'Flank|ZWINT_ENST00000361148.6_Missense_Mutation_p.A117S|ZWINT_ENST00000395405.1_Missense_Mutation_p.A117S			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	117	Interaction with NDC80 and ZW10.				establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						TGAGTCAGGGCCTTGGTGAGG	0.552																																						dbGAP											0													117.0	110.0	112.0					10																	58119522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.349G>T	10.37:g.58119522C>A	ENSP00000363055:p.Ala117Ser		A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	NULL	p.A117S	ENST00000373944.3	37	c.349	CCDS7249.1	10	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738288	0.30774	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000361148	T;T;T	0.54675	0.56;0.56;0.56	4.7	1.69	0.24217	.	0.507607	0.16872	N	0.196097	T	0.43809	0.1264	L	0.56769	1.78	0.09310	N	1	P;P	0.44816	0.844;0.844	B;B	0.41764	0.366;0.366	T	0.35126	-0.9801	10	0.48119	T	0.1	-30.6598	3.359	0.07179	0.1769:0.5568:0.1712:0.0951	.	117;117	A6NNV6;O95229	.;ZWINT_HUMAN	S	117	ENSP00000363055:A117S;ENSP00000378801:A117S;ENSP00000354921:A117S	ENSP00000354921:A117S	A	-	1	0	ZWINT	57789528	0.000000	0.05858	0.002000	0.10522	0.023000	0.10783	0.000000	0.12993	0.266000	0.21894	0.650000	0.86243	GCC	ZWINT	-	NULL	ENSG00000122952		0.552	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZWINT	HGNC	protein_coding	OTTHUMT00000048132.1	76	0.00	0	C			58119522	58119522	-1	no_errors	ENST00000373944	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.005	A
ZYG11A	440590	genome.wustl.edu	37	1	53326444	53326444	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01B-06D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e7d12cf9-bc24-4566-a54d-3a0bf7ae3bd0	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:53326444G>A	ENST00000371528.1	+	4	1198	c.1050G>A	c.(1048-1050)ctG>ctA	p.L350L	ZYG11A_ENST00000371532.1_Silent_p.L8L	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	350										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						CAGAAGCACTGAGCCGATACA	0.413																																						dbGAP											0													126.0	108.0	113.0					1																	53326444		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.1050G>A	1.37:g.53326444G>A			A6NCK5	Silent	SNP	superfamily_ARM-type_fold	p.L350	ENST00000371528.1	37	c.1050	CCDS44148.1	1																																																																																			ZYG11A	-	NULL	ENSG00000203995		0.413	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	81	0.00	0	G	NM_001004339		53326444	53326444	+1	no_errors	ENST00000371528	ensembl	human	known	69_37n	silent	43	29.51	18	SNP	1.000	A
ZYG11A	440590	genome.wustl.edu	37	1	53326444	53326444	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A167-09	TCGA-A7-A26E-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	73651880-cfbd-4f8d-8031-a14b3ac65454	a411cfe0-378e-4919-94e6-4c3beb8f61ca	g.chr1:53326444G>A	ENST00000371528.1	+	4	1198	c.1050G>A	c.(1048-1050)ctG>ctA	p.L350L	ZYG11A_ENST00000371532.1_Silent_p.L8L	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	350										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						CAGAAGCACTGAGCCGATACA	0.413																																						dbGAP											0													126.0	108.0	113.0					1																	53326444		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.1050G>A	1.37:g.53326444G>A			A6NCK5	Silent	SNP	superfamily_ARM-type_fold	p.L350	ENST00000371528.1	37	c.1050	CCDS44148.1	1																																																																																			ZYG11A	-	NULL	ENSG00000203995		0.413	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	77	0.00	0	G	NM_001004339		53326444	53326444	+1	no_errors	ENST00000371528	ensembl	human	known	69_37n	silent	33	26.67	12	SNP	1.000	A
ZYG11A	440590	genome.wustl.edu	37	1	53326444	53326444	+	Silent	SNP	G	G	A			TCGA-A7-A26E-01A-11D-A272-09	TCGA-A7-A26E-10A-01D-A272-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a2bbb02b-3046-4633-9b5c-6ff4222a10d8	d2ed0f51-2c5c-44b5-97a2-b3e83b1467ed	g.chr1:53326444G>A	ENST00000371528.1	+	4	1198	c.1050G>A	c.(1048-1050)ctG>ctA	p.L350L	ZYG11A_ENST00000371532.1_Silent_p.L8L	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	350										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						CAGAAGCACTGAGCCGATACA	0.413																																						dbGAP											0													126.0	108.0	113.0					1																	53326444		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.1050G>A	1.37:g.53326444G>A			A6NCK5	Silent	SNP	superfamily_ARM-type_fold	p.L350	ENST00000371528.1	37	c.1050	CCDS44148.1	1																																																																																			ZYG11A	-	NULL	ENSG00000203995		0.413	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	81	0.00	0	G	NM_001004339		53326444	53326444	+1	no_errors	ENST00000371528	ensembl	human	known	69_37n	silent	37	11.90	5	SNP	1.000	A
